MOTIFSIM - MOTIF SIMilarity Detection Tool

Version 2.1

INPUT

Input Parameters
Number of files: 5
Number of top significant motifs: 10
Number of best matches: 10
Similarity cutoff >= 0.75
Matching motif database: UniProbe Mus Musculus
Phylogenetic tree: Yes
Combined similar motifs: Yes
Output file type: All
Output file format: All

Input files and motif counts
File name Count of motifs Dataset number
MEME-ChIP_DM05.txt 4 1
MEME_DM05.txt 46 2
PScanChIP_DM05.txt 16 3
RSAT_peak-motifs_DM05.txt 17 4
W-ChIPMotifs_DM05.txt 11 5

RESULTS

Top 10 Significant Motifs - Global Matching (Highest to Lowest)

Dataset #: 5 Motif ID: 84 Motif name: TFW3

Original motif     Consensus sequence: GCACTG Reverse complement motif     Consensus sequence: CAGTGC

Best Matches for Top Significant Motif ID 84 (Highest to Lowest)

Dataset #: 4
Motif ID: 67
Motif name: TgTGgTGTCACAGTGCTCC
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 4
Number of overlap: 6
Similarity score: 0

Alignment:
GGAGCACTGTGACACCACA
----------GCACTG---

Original motif     Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif     Consensus sequence: GGAGCACTGTGACACCACA


Dataset #: 4
Motif ID: 72
Motif name: CACTGTGrYrtCACAGTGswsCAcT
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 14
Number of overlap: 6
Similarity score: 0.000794289

Alignment:
CACTGTGRTRTCACAGTGSWSCACT
------CAGTGC-------------

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG


Dataset #: 4
Motif ID: 73
Motif name: TGGAGCACTGTGACAcCACAGTGg
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 5
Number of overlap: 6
Similarity score: 0.00482436

Alignment:
CCACTGTGVTGTCACAGTGCTCCA
--------------CAGTGC----

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA


Dataset #: 4
Motif ID: 76
Motif name: CAcCACAGTGGAGCAct
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 7
Number of overlap: 6
Similarity score: 0.0201914

Alignment:
CAHCACAGTGGAGCACT
------CAGTGC-----

Original motif     Consensus sequence: CAHCACAGTGGAGCACT Reverse complement motif     Consensus sequence: AGTGCTCCACTGTGDTG


Dataset #: 4
Motif ID: 70
Motif name: CagTGCTCCACTGTGgT
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 8
Number of overlap: 6
Similarity score: 0.0205497

Alignment:
ABCACAGTGGAGCACTG
----CAGTGC-------

Original motif     Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif     Consensus sequence: ABCACAGTGGAGCACTG


Dataset #: 4
Motif ID: 77
Motif name: AgTGCTCCACTGTGgTGTCACAgT
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 13
Number of overlap: 6
Similarity score: 0.0290883

Alignment:
ACTGTGACACCACAGTGGAGCACT
------------CAGTGC------

Original motif     Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif     Consensus sequence: ACTGTGACACCACAGTGGAGCACT


Dataset #: 3
Motif ID: 57
Motif name: REST
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 15
Number of overlap: 6
Similarity score: 0.039883

Alignment:
TTCAGCACCATGGACAGCKCC
-CAGTGC--------------

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 3
Motif ID: 65
Motif name: Tcfcp2l1
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 8
Number of overlap: 6
Similarity score: 0.0447224

Alignment:
CCAGYYHVADCCRG
-------CAGTGC-

Original motif     Consensus sequence: CCAGYYHVADCCRG Reverse complement motif     Consensus sequence: CKGGDTBDMMCTGG


Dataset #: 2
Motif ID: 9
Motif name: Motif 9
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 9
Number of overlap: 6
Similarity score: 0.0459818

Alignment:
GAKAGKTGGCTCWG
GCACTG--------

Original motif     Consensus sequence: CWGAGCCAYCTYTC Reverse complement motif     Consensus sequence: GAKAGKTGGCTCWG


Dataset #: 4
Motif ID: 75
Motif name: wwCCAmAGTCmt
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 6
Number of overlap: 6
Similarity score: 0.0587933

Alignment:
VDGACTRTGGDD
-----GCACTG-

Original motif     Consensus sequence: DDCCAMAGTCHB Reverse complement motif     Consensus sequence: VDGACTRTGGDD


Dataset #: 5 Motif ID: 85 Motif name: TFW1

Original motif     Consensus sequence: TTGCGCAA Reverse complement motif     Consensus sequence: TTGCGCAA

Best Matches for Top Significant Motif ID 85 (Highest to Lowest)

Dataset #: 2
Motif ID: 25
Motif name: Motif 25
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 8
Similarity score: 0.0195312

Alignment:
TTYGGAAAGCAG
----TTGCGCAA

Original motif     Consensus sequence: CTGCTTTCCMAA Reverse complement motif     Consensus sequence: TTYGGAAAGCAG


Dataset #: 3
Motif ID: 52
Motif name: NR2F1
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 1
Number of overlap: 8
Similarity score: 0.0276442

Alignment:
AKGYYCAAAGRTCA
TTGCGCAA------

Original motif     Consensus sequence: TGAMCTTTGMMCYT Reverse complement motif     Consensus sequence: AKGYYCAAAGRTCA


Dataset #: 3
Motif ID: 64
Motif name: PPARGRXRA
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 7
Number of overlap: 8
Similarity score: 0.0277567

Alignment:
BTRGGDCARAGGKCA
------TTGCGCAA-

Original motif     Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif     Consensus sequence: TGRCCTKTGHCCKAB


Dataset #: 2
Motif ID: 32
Motif name: Motif 32
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 2
Number of overlap: 8
Similarity score: 0.0328125

Alignment:
TTTACTAAAT
-TTGCGCAA-

Original motif     Consensus sequence: ATTTAGTAAA Reverse complement motif     Consensus sequence: TTTACTAAAT


Dataset #: 4
Motif ID: 76
Motif name: CAcCACAGTGGAGCAct
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 8
Similarity score: 0.0336914

Alignment:
CAHCACAGTGGAGCACT
-TTGCGCAA--------

Original motif     Consensus sequence: CAHCACAGTGGAGCACT Reverse complement motif     Consensus sequence: AGTGCTCCACTGTGDTG


Dataset #: 4
Motif ID: 73
Motif name: TGGAGCACTGTGACAcCACAGTGg
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 17
Number of overlap: 8
Similarity score: 0.0338471

Alignment:
TGGAGCACTGTGACAVCACAGTGG
TTGCGCAA----------------

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA


Dataset #: 4
Motif ID: 77
Motif name: AgTGCTCCACTGTGgTGTCACAgT
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 2
Number of overlap: 8
Similarity score: 0.034375

Alignment:
AGTGCTCCACTGTGGTGTCACAGT
---------------TTGCGCAA-

Original motif     Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif     Consensus sequence: ACTGTGACACCACAGTGGAGCACT


Dataset #: 4
Motif ID: 70
Motif name: CagTGCTCCACTGTGgT
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 3
Number of overlap: 8
Similarity score: 0.0354167

Alignment:
CAGTGCTCCACTGTGBT
-------TTGCGCAA--

Original motif     Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif     Consensus sequence: ABCACAGTGGAGCACTG


Dataset #: 4
Motif ID: 72
Motif name: CACTGTGrYrtCACAGTGswsCAcT
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 3
Number of overlap: 8
Similarity score: 0.0407242

Alignment:
CACTGTGRTRTCACAGTGSWSCACT
---------------TTGCGCAA--

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG


Dataset #: 2
Motif ID: 20
Motif name: Motif 20
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 3
Number of overlap: 8
Similarity score: 0.0421875

Alignment:
TWTTGACAYAGA
--TTGCGCAA--

Original motif     Consensus sequence: TCTKTGTCAAWA Reverse complement motif     Consensus sequence: TWTTGACAYAGA


Dataset #: 3 Motif ID: 55 Motif name: ZEB1

Original motif     Consensus sequence: CACCTD Reverse complement motif     Consensus sequence: HAGGTG

Best Matches for Top Significant Motif ID 55 (Highest to Lowest)

Dataset #: 1
Motif ID: 1
Motif name: Motif 1
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 6
Number of overlap: 6
Similarity score: 0

Alignment:
YGCCACCTDSTGGY
---CACCTD-----

Original motif     Consensus sequence: YGCCACCTDSTGGY Reverse complement motif     Consensus sequence: KCCASDAGGTGGCK


Dataset #: 2
Motif ID: 9
Motif name: Motif 9
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 3
Number of overlap: 6
Similarity score: 0.00902841

Alignment:
CWGAGCCAYCTYTC
------CACCTD--

Original motif     Consensus sequence: CWGAGCCAYCTYTC Reverse complement motif     Consensus sequence: GAKAGKTGGCTCWG


Dataset #: 2
Motif ID: 50
Motif name: Motif 50
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 8
Number of overlap: 6
Similarity score: 0.0285279

Alignment:
TATKCTAAACCTAT
-CACCTD-------

Original motif     Consensus sequence: ATAGGTTTAGYATA Reverse complement motif     Consensus sequence: TATKCTAAACCTAT


Dataset #: 2
Motif ID: 24
Motif name: Motif 24
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 4
Number of overlap: 6
Similarity score: 0.0346255

Alignment:
TTCCAGGAGGA
---HAGGTG--

Original motif     Consensus sequence: TCCTCCTGGAA Reverse complement motif     Consensus sequence: TTCCAGGAGGA


Dataset #: 2
Motif ID: 16
Motif name: Motif 16
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 5
Number of overlap: 6
Similarity score: 0.0376742

Alignment:
ACAACACATTT
----CACCTD-

Original motif     Consensus sequence: ACAACACATTT Reverse complement motif     Consensus sequence: AAATGTGTTGT


Dataset #: 2
Motif ID: 38
Motif name: Motif 38
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 2
Number of overlap: 6
Similarity score: 0.0397068

Alignment:
AAAGATGA
-HAGGTG-

Original motif     Consensus sequence: AAAGATGA Reverse complement motif     Consensus sequence: TCATCTTT


Dataset #: 2
Motif ID: 26
Motif name: Motif 26
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 6
Number of overlap: 6
Similarity score: 0.0397068

Alignment:
TTTATGGTGAGCAT
-----HAGGTG---

Original motif     Consensus sequence: TTTATGGTGAGCAT Reverse complement motif     Consensus sequence: ATGCTCACCATAAA


Dataset #: 2
Motif ID: 21
Motif name: Motif 21
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 6
Number of overlap: 6
Similarity score: 0.0458043

Alignment:
CTTCTGACCTC
-----CACCTD

Original motif     Consensus sequence: CTTCTGACCTC Reverse complement motif     Consensus sequence: GAGGTCAGAAG


Dataset #: 5
Motif ID: 92
Motif name: TFM11
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 7
Number of overlap: 6
Similarity score: 0.0461561

Alignment:
CAMACACACACAYDCACACA
--------CACCTD------

Original motif     Consensus sequence: CAMACACACACAYDCACACA Reverse complement motif     Consensus sequence: TGTGTGDKTGTGTGTGTRTG


Dataset #: 5
Motif ID: 89
Motif name: TFM1
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 7
Number of overlap: 6
Similarity score: 0.0467843

Alignment:
CACACACACACWCACACA
------CACCTD------

Original motif     Consensus sequence: CACACACACACWCACACA Reverse complement motif     Consensus sequence: TGTGTGWGTGTGTGTGTG


Dataset #: 2 Motif ID: 7 Motif name: Motif 7

Original motif     Consensus sequence: HCAGRRVACASAG Reverse complement motif     Consensus sequence: CTSTGTBKMCTGH

Best Matches for Top Significant Motif ID 7 (Highest to Lowest)

Dataset #: 5
Motif ID: 93
Motif name: TFM12
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 7
Number of overlap: 13
Similarity score: 0.00926418

Alignment:
RAGKGMAGVRRGSRCASAGV
------HCAGRRVACASAG-

Original motif     Consensus sequence: RAGKGMAGVRRGSRCASAGV Reverse complement motif     Consensus sequence: VCTSTGKSCMKBCTRCYCTK


Dataset #: 3
Motif ID: 53
Motif name: ESR1
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 4
Number of overlap: 13
Similarity score: 0.0328703

Alignment:
VDBHMAGGTCACCCTGACCY
---HCAGRRVACASAG----

Original motif     Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif     Consensus sequence: MGGTCAGGGTGACCTRDBHV


Dataset #: 4
Motif ID: 72
Motif name: CACTGTGrYrtCACAGTGswsCAcT
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 3
Number of overlap: 13
Similarity score: 0.0400966

Alignment:
AGTGSWSCACTGTGAMAMCACAGTG
----------HCAGRRVACASAG--

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG


Dataset #: 5
Motif ID: 90
Motif name: TFM2
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 3
Number of overlap: 13
Similarity score: 0.0435274

Alignment:
GCAGAKGSAGGABDGHDG
--HCAGRRVACASAG---

Original motif     Consensus sequence: CHHCHBTCCTSCYTCTGC Reverse complement motif     Consensus sequence: GCAGAKGSAGGABDGHDG


Dataset #: 3
Motif ID: 66
Motif name: CTCF
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 7
Number of overlap: 13
Similarity score: 0.0448341

Alignment:
YDRCCASYAGRKGGCRSYV
------HCAGRRVACASAG

Original motif     Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif     Consensus sequence: BMSMGCCYMCTKSTGGMHM


Dataset #: 4
Motif ID: 73
Motif name: TGGAGCACTGTGACAcCACAGTGg
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 4
Number of overlap: 13
Similarity score: 0.045698

Alignment:
CCACTGTGVTGTCACAGTGCTCCA
---CTSTGTBKMCTGH--------

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA


Dataset #: 3
Motif ID: 64
Motif name: PPARGRXRA
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 13
Similarity score: 0.0457253

Alignment:
BTRGGDCARAGGKCA
HCAGRRVACASAG--

Original motif     Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif     Consensus sequence: TGRCCTKTGHCCKAB


Dataset #: 3
Motif ID: 65
Motif name: Tcfcp2l1
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 2
Number of overlap: 13
Similarity score: 0.0477557

Alignment:
CKGGDTBDMMCTGG
CTSTGTBKMCTGH-

Original motif     Consensus sequence: CCAGYYHVADCCRG Reverse complement motif     Consensus sequence: CKGGDTBDMMCTGG


Dataset #: 5
Motif ID: 94
Motif name: TFM13
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 4
Number of overlap: 13
Similarity score: 0.0478998

Alignment:
WHAATTAAARAARAAAAAAA
----HCAGRRVACASAG---

Original motif     Consensus sequence: TTTTTTTKTTKTTTAATTHW Reverse complement motif     Consensus sequence: WHAATTAAARAARAAAAAAA


Dataset #: 5
Motif ID: 88
Motif name: TFF11
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 13
Similarity score: 0.048132

Alignment:
HVCDBBDBCAGCAG
-HCAGRRVACASAG

Original motif     Consensus sequence: CTGCTGBDBBDGBD Reverse complement motif     Consensus sequence: HVCDBBDBCAGCAG


Dataset #: 1 Motif ID: 2 Motif name: Motif 2

Original motif     Consensus sequence: GCARRGGSAGS Reverse complement motif     Consensus sequence: SCTSCCKMTGC

Best Matches for Top Significant Motif ID 2 (Highest to Lowest)

Dataset #: 2
Motif ID: 5
Motif name: Motif 5
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 11
Similarity score: 0

Alignment:
CYTSCCTCTGC
SCTSCCKMTGC

Original motif     Consensus sequence: CYTSCCTCTGC Reverse complement motif     Consensus sequence: GCAGAGGSAKG


Dataset #: 5
Motif ID: 90
Motif name: TFM2
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 1
Number of overlap: 11
Similarity score: 0.000952693

Alignment:
GCAGAKGSAGGABDGHDG
GCARRGGSAGS-------

Original motif     Consensus sequence: CHHCHBTCCTSCYTCTGC Reverse complement motif     Consensus sequence: GCAGAKGSAGGABDGHDG


Dataset #: 3
Motif ID: 66
Motif name: CTCF
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 3
Number of overlap: 11
Similarity score: 0.033658

Alignment:
YDRCCASYAGRKGGCRSYV
------GCARRGGSAGS--

Original motif     Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif     Consensus sequence: BMSMGCCYMCTKSTGGMHM


Dataset #: 5
Motif ID: 88
Motif name: TFF11
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 3
Number of overlap: 11
Similarity score: 0.0410341

Alignment:
CTGCTGBDBBDGBD
--SCTSCCKMTGC-

Original motif     Consensus sequence: CTGCTGBDBBDGBD Reverse complement motif     Consensus sequence: HVCDBBDBCAGCAG


Dataset #: 5
Motif ID: 93
Motif name: TFM12
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 6
Number of overlap: 11
Similarity score: 0.0422459

Alignment:
RAGKGMAGVRRGSRCASAGV
----GCARRGGSAGS-----

Original motif     Consensus sequence: RAGKGMAGVRRGSRCASAGV Reverse complement motif     Consensus sequence: VCTSTGKSCMKBCTRCYCTK


Dataset #: 3
Motif ID: 65
Motif name: Tcfcp2l1
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 11
Similarity score: 0.0533531

Alignment:
CCAGYYHVADCCRG
SCTSCCKMTGC---

Original motif     Consensus sequence: CCAGYYHVADCCRG Reverse complement motif     Consensus sequence: CKGGDTBDMMCTGG


Dataset #: 3
Motif ID: 57
Motif name: REST
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 4
Number of overlap: 11
Similarity score: 0.0578944

Alignment:
GGYGCTGTCCATGGTGCTGAA
---SCTSCCKMTGC-------

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 3
Motif ID: 53
Motif name: ESR1
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 3
Number of overlap: 11
Similarity score: 0.0620615

Alignment:
VDBHMAGGTCACCCTGACCY
--GCARRGGSAGS-------

Original motif     Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif     Consensus sequence: MGGTCAGGGTGACCTRDBHV


Dataset #: 2
Motif ID: 7
Motif name: Motif 7
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 11
Similarity score: 0.0627554

Alignment:
HCAGRRVACASAG
GCARRGGSAGS--

Original motif     Consensus sequence: HCAGRRVACASAG Reverse complement motif     Consensus sequence: CTSTGTBKMCTGH


Dataset #: 3
Motif ID: 59
Motif name: ESR2
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 5
Number of overlap: 11
Similarity score: 0.0646979

Alignment:
VHRGGTCABDBTGMCCTB
---SCTSCCKMTGC----

Original motif     Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif     Consensus sequence: BAGGYCABHBTGACCKHV


Dataset #: 5 Motif ID: 87 Motif name: TFF1

Original motif     Consensus sequence: AGGACAAAGAVV Reverse complement motif     Consensus sequence: VVTCTTTGTCCT

Best Matches for Top Significant Motif ID 87 (Highest to Lowest)

Dataset #: 3
Motif ID: 51
Motif name: HNF4A
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 12
Similarity score: 0.0111472

Alignment:
TGMYCTTTGBCCK
-VVTCTTTGTCCT

Original motif     Consensus sequence: RGGBCAAAGKYCA Reverse complement motif     Consensus sequence: TGMYCTTTGBCCK


Dataset #: 3
Motif ID: 64
Motif name: PPARGRXRA
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 3
Number of overlap: 12
Similarity score: 0.0210867

Alignment:
BTRGGDCARAGGKCA
--AGGACAAAGAVV-

Original motif     Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif     Consensus sequence: TGRCCTKTGHCCKAB


Dataset #: 3
Motif ID: 59
Motif name: ESR2
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 5
Number of overlap: 12
Similarity score: 0.0351633

Alignment:
BAGGYCABHBTGACCKHV
----VVTCTTTGTCCT--

Original motif     Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif     Consensus sequence: BAGGYCABHBTGACCKHV


Dataset #: 3
Motif ID: 53
Motif name: ESR1
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 9
Number of overlap: 12
Similarity score: 0.039773

Alignment:
VDBHMAGGTCACCCTGACCY
VVTCTTTGTCCT--------

Original motif     Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif     Consensus sequence: MGGTCAGGGTGACCTRDBHV


Dataset #: 3
Motif ID: 52
Motif name: NR2F1
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 2
Number of overlap: 12
Similarity score: 0.0472374

Alignment:
AKGYYCAAAGRTCA
-AGGACAAAGAVV-

Original motif     Consensus sequence: TGAMCTTTGMMCYT Reverse complement motif     Consensus sequence: AKGYYCAAAGRTCA


Dataset #: 3
Motif ID: 60
Motif name: NR1H2RXRA
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 3
Number of overlap: 12
Similarity score: 0.0472884

Alignment:
GTTGACCTTTGACCTTT
---VVTCTTTGTCCT--

Original motif     Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif     Consensus sequence: GTTGACCTTTGACCTTT


Dataset #: 4
Motif ID: 72
Motif name: CACTGTGrYrtCACAGTGswsCAcT
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 7
Number of overlap: 12
Similarity score: 0.0530556

Alignment:
CACTGTGRTRTCACAGTGSWSCACT
-------AGGACAAAGAVV------

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG


Dataset #: 4
Motif ID: 73
Motif name: TGGAGCACTGTGACAcCACAGTGg
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 13
Number of overlap: 12
Similarity score: 0.0539204

Alignment:
TGGAGCACTGTGACAVCACAGTGG
------------AGGACAAAGAVV

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA


Dataset #: 3
Motif ID: 57
Motif name: REST
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 7
Number of overlap: 12
Similarity score: 0.0558379

Alignment:
TTCAGCACCATGGACAGCKCC
---AGGACAAAGAVV------

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 4
Motif ID: 77
Motif name: AgTGCTCCACTGTGgTGTCACAgT
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 7
Number of overlap: 12
Similarity score: 0.0609269

Alignment:
AGTGCTCCACTGTGGTGTCACAGT
------VVTCTTTGTCCT------

Original motif     Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif     Consensus sequence: ACTGTGACACCACAGTGGAGCACT


Dataset #: 2 Motif ID: 41 Motif name: Motif 41

Original motif     Consensus sequence: ACTTTGG Reverse complement motif     Consensus sequence: CCAAAGT

Best Matches for Top Significant Motif ID 41 (Highest to Lowest)

Dataset #: 4
Motif ID: 69
Motif name: atactttggc
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 7
Similarity score: 0

Alignment:
GCCAAAGTAT
-CCAAAGT--

Original motif     Consensus sequence: ATACTTTGGC Reverse complement motif     Consensus sequence: GCCAAAGTAT


Dataset #: 4
Motif ID: 75
Motif name: wwCCAmAGTCmt
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 4
Number of overlap: 7
Similarity score: 0.0275974

Alignment:
DDCCAMAGTCHB
--CCAAAGT---

Original motif     Consensus sequence: DDCCAMAGTCHB Reverse complement motif     Consensus sequence: VDGACTRTGGDD


Dataset #: 4
Motif ID: 77
Motif name: AgTGCTCCACTGTGgTGTCACAgT
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 10
Number of overlap: 7
Similarity score: 0.056841

Alignment:
ACTGTGACACCACAGTGGAGCACT
---------CCAAAGT--------

Original motif     Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif     Consensus sequence: ACTGTGACACCACAGTGGAGCACT


Dataset #: 4
Motif ID: 71
Motif name: AmTGTGACACCACAGT
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 1
Number of overlap: 7
Similarity score: 0.0597098

Alignment:
ACTGTGGTGTCACART
ACTTTGG---------

Original motif     Consensus sequence: AMTGTGACACCACAGT Reverse complement motif     Consensus sequence: ACTGTGGTGTCACART


Dataset #: 4
Motif ID: 76
Motif name: CAcCACAGTGGAGCAct
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 3
Number of overlap: 7
Similarity score: 0.061942

Alignment:
AGTGCTCCACTGTGDTG
--------ACTTTGG--

Original motif     Consensus sequence: CAHCACAGTGGAGCACT Reverse complement motif     Consensus sequence: AGTGCTCCACTGTGDTG


Dataset #: 4
Motif ID: 70
Motif name: CagTGCTCCACTGTGgT
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 7
Similarity score: 0.0625

Alignment:
ABCACAGTGGAGCACTG
-CCAAAGT---------

Original motif     Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif     Consensus sequence: ABCACAGTGGAGCACTG


Dataset #: 3
Motif ID: 52
Motif name: NR2F1
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 4
Number of overlap: 7
Similarity score: 0.0686813

Alignment:
TGAMCTTTGMMCYT
---ACTTTGG----

Original motif     Consensus sequence: TGAMCTTTGMMCYT Reverse complement motif     Consensus sequence: AKGYYCAAAGRTCA


Dataset #: 4
Motif ID: 72
Motif name: CACTGTGrYrtCACAGTGswsCAcT
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 7
Similarity score: 0.0714286

Alignment:
CACTGTGRTRTCACAGTGSWSCACT
-ACTTTGG-----------------

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG


Dataset #: 4
Motif ID: 73
Motif name: TGGAGCACTGTGACAcCACAGTGg
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 3
Number of overlap: 7
Similarity score: 0.0714286

Alignment:
TGGAGCACTGTGACAVCACAGTGG
---------------CCAAAGT--

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA


Dataset #: 3
Motif ID: 60
Motif name: NR1H2RXRA
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 6
Number of overlap: 7
Similarity score: 0.0728571

Alignment:
GTTGACCTTTGACCTTT
-----ACTTTGG-----

Original motif     Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif     Consensus sequence: GTTGACCTTTGACCTTT


Dataset #: 1 Motif ID: 4 Motif name: Motif 4

Original motif     Consensus sequence: GGAAM Reverse complement motif     Consensus sequence: YTTCC

Best Matches for Top Significant Motif ID 4 (Highest to Lowest)

Dataset #: 2
Motif ID: 25
Motif name: Motif 25
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 5
Number of overlap: 5
Similarity score: 0.01875

Alignment:
CTGCTTTCCMAA
----YTTCC---

Original motif     Consensus sequence: CTGCTTTCCMAA Reverse complement motif     Consensus sequence: TTYGGAAAGCAG


Dataset #: 2
Motif ID: 45
Motif name: Motif 45
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 5
Number of overlap: 5
Similarity score: 0.01875

Alignment:
TGGAGGAAA
----GGAAM

Original motif     Consensus sequence: TGGAGGAAA Reverse complement motif     Consensus sequence: TTTCCTCCA


Dataset #: 2
Motif ID: 47
Motif name: Motif 47
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 5
Number of overlap: 5
Similarity score: 0.04375

Alignment:
TGCCTTTCYTT
----YTTCC--

Original motif     Consensus sequence: AAKGAAAGGCA Reverse complement motif     Consensus sequence: TGCCTTTCYTT


Dataset #: 2
Motif ID: 48
Motif name: Motif 48
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 3
Number of overlap: 5
Similarity score: 0.05625

Alignment:
TTCTTYCATT
--YTTCC---

Original motif     Consensus sequence: AATGKAAGAA Reverse complement motif     Consensus sequence: TTCTTYCATT


Dataset #: 2
Motif ID: 32
Motif name: Motif 32
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 1
Number of overlap: 5
Similarity score: 0.06875

Alignment:
TTTACTAAAT
YTTCC-----

Original motif     Consensus sequence: ATTTAGTAAA Reverse complement motif     Consensus sequence: TTTACTAAAT


Dataset #: 2
Motif ID: 12
Motif name: Motif 12
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 7
Number of overlap: 5
Similarity score: 0.06875

Alignment:
TGAAAATSCTT
GGAAM------

Original motif     Consensus sequence: TGAAAATSCTT Reverse complement motif     Consensus sequence: AAGSATTTTCA


Dataset #: 2
Motif ID: 13
Motif name: Motif 13
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 8
Number of overlap: 5
Similarity score: 0.06875

Alignment:
TGAAAATATGTT
GGAAM-------

Original motif     Consensus sequence: AACATATTTTCA Reverse complement motif     Consensus sequence: TGAAAATATGTT


Dataset #: 2
Motif ID: 23
Motif name: Motif 23
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 5
Similarity score: 0.06875

Alignment:
CTTTCTCT
-YTTCC--

Original motif     Consensus sequence: AGAGAAAG Reverse complement motif     Consensus sequence: CTTTCTCT


Dataset #: 3
Motif ID: 57
Motif name: REST
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 12
Number of overlap: 5
Similarity score: 0.0747947

Alignment:
GGYGCTGTCCATGGTGCTGAA
-----YTTCC-----------

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 2
Motif ID: 27
Motif name: Motif 27
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 6
Number of overlap: 5
Similarity score: 0.075

Alignment:
ATGTWTTCATTMAT
----YTTCC-----

Original motif     Consensus sequence: ATGTWTTCATTMAT Reverse complement motif     Consensus sequence: ATYAATGAAWACAT


Dataset #: 3 Motif ID: 61 Motif name: NR4A2

Original motif     Consensus sequence: AAGGTCAC Reverse complement motif     Consensus sequence: GTGACCTT

Best Matches for Top Significant Motif ID 61 (Highest to Lowest)

Dataset #: 2
Motif ID: 21
Motif name: Motif 21
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 8
Similarity score: 0.0393171

Alignment:
CTTCTGACCTC
GTGACCTT---

Original motif     Consensus sequence: CTTCTGACCTC Reverse complement motif     Consensus sequence: GAGGTCAGAAG


Dataset #: 2
Motif ID: 19
Motif name: Motif 19
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 8
Similarity score: 0.040519

Alignment:
AAAGRTMAAACTA
-AAGGTCAC----

Original motif     Consensus sequence: AAAGRTMAAACTA Reverse complement motif     Consensus sequence: TAGTTTYAKCTTT


Dataset #: 2
Motif ID: 28
Motif name: Motif 28
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 4
Number of overlap: 8
Similarity score: 0.0539119

Alignment:
TTWATGWCTTT
---GTGACCTT

Original motif     Consensus sequence: AAAGWCATWAA Reverse complement motif     Consensus sequence: TTWATGWCTTT


Dataset #: 4
Motif ID: 72
Motif name: CACTGTGrYrtCACAGTGswsCAcT
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 7
Number of overlap: 8
Similarity score: 0.0557243

Alignment:
CACTGTGRTRTCACAGTGSWSCACT
------AAGGTCAC-----------

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG


Dataset #: 2
Motif ID: 39
Motif name: Motif 39
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 8
Similarity score: 0.0566591

Alignment:
AGATGYTCTTG
-GTGACCTT--

Original motif     Consensus sequence: AGATGYTCTTG Reverse complement motif     Consensus sequence: CAAGAKCATCT


Dataset #: 5
Motif ID: 93
Motif name: TFM12
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 10
Number of overlap: 8
Similarity score: 0.0584971

Alignment:
RAGKGMAGVRRGSRCASAGV
---------AAGGTCAC---

Original motif     Consensus sequence: RAGKGMAGVRRGSRCASAGV Reverse complement motif     Consensus sequence: VCTSTGKSCMKBCTRCYCTK


Dataset #: 4
Motif ID: 73
Motif name: TGGAGCACTGTGACAcCACAGTGg
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 8
Number of overlap: 8
Similarity score: 0.060729

Alignment:
CCACTGTGVTGTCACAGTGCTCCA
-------AAGGTCAC---------

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA


Dataset #: 4
Motif ID: 71
Motif name: AmTGTGACACCACAGT
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 4
Number of overlap: 8
Similarity score: 0.0645146

Alignment:
ACTGTGGTGTCACART
-----AAGGTCAC---

Original motif     Consensus sequence: AMTGTGACACCACAGT Reverse complement motif     Consensus sequence: ACTGTGGTGTCACART


Dataset #: 2
Motif ID: 26
Motif name: Motif 26
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 7
Number of overlap: 8
Similarity score: 0.0664462

Alignment:
ATGCTCACCATAAA
------AAGGTCAC

Original motif     Consensus sequence: TTTATGGTGAGCAT Reverse complement motif     Consensus sequence: ATGCTCACCATAAA


Dataset #: 2
Motif ID: 22
Motif name: Motif 22
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 8
Similarity score: 0.0674765

Alignment:
GCTGGACTTTG
-GTGACCTT--

Original motif     Consensus sequence: CAAAGTCCAGC Reverse complement motif     Consensus sequence: GCTGGACTTTG


Dataset #: 4 Motif ID: 79 Motif name: cCGCGGrCACG

Original motif     Consensus sequence: CCGCGGRCACG Reverse complement motif     Consensus sequence: CGTGKCCGCGG

Best Matches for Top Significant Motif ID 79 (Highest to Lowest)

Dataset #: 5
Motif ID: 88
Motif name: TFF11
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0.0478408

Alignment:
HVCDBBDBCAGCAG
---CGTGKCCGCGG

Original motif     Consensus sequence: CTGCTGBDBBDGBD Reverse complement motif     Consensus sequence: HVCDBBDBCAGCAG


Dataset #: 3
Motif ID: 57
Motif name: REST
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 4
Number of overlap: 11
Similarity score: 0.0484441

Alignment:
TTCAGCACCATGGACAGCKCC
-------CCGCGGRCACG---

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 3
Motif ID: 53
Motif name: ESR1
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 3
Number of overlap: 11
Similarity score: 0.0486581

Alignment:
MGGTCAGGGTGACCTRDBHV
-------CGTGKCCGCGG--

Original motif     Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif     Consensus sequence: MGGTCAGGGTGACCTRDBHV


Dataset #: 3
Motif ID: 66
Motif name: CTCF
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 8
Number of overlap: 11
Similarity score: 0.0588663

Alignment:
YDRCCASYAGRKGGCRSYV
-------CCGCGGRCACG-

Original motif     Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif     Consensus sequence: BMSMGCCYMCTKSTGGMHM


Dataset #: 2
Motif ID: 7
Motif name: Motif 7
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 11
Similarity score: 0.0597806

Alignment:
HCAGRRVACASAG
-CCGCGGRCACG-

Original motif     Consensus sequence: HCAGRRVACASAG Reverse complement motif     Consensus sequence: CTSTGTBKMCTGH


Dataset #: 2
Motif ID: 6
Motif name: Motif 6
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 3
Number of overlap: 11
Similarity score: 0.0624268

Alignment:
GTGTGTGTGTGTGT
-CGTGKCCGCGG--

Original motif     Consensus sequence: ACACACACACACAC Reverse complement motif     Consensus sequence: GTGTGTGTGTGTGT


Dataset #: 5
Motif ID: 93
Motif name: TFM12
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 5
Number of overlap: 11
Similarity score: 0.0625015

Alignment:
RAGKGMAGVRRGSRCASAGV
-----CCGCGGRCACG----

Original motif     Consensus sequence: RAGKGMAGVRRGSRCASAGV Reverse complement motif     Consensus sequence: VCTSTGKSCMKBCTRCYCTK


Dataset #: 5
Motif ID: 89
Motif name: TFM1
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 3
Number of overlap: 11
Similarity score: 0.0628056

Alignment:
CACACACACACWCACACA
-----CCGCGGRCACG--

Original motif     Consensus sequence: CACACACACACWCACACA Reverse complement motif     Consensus sequence: TGTGTGWGTGTGTGTGTG


Dataset #: 3
Motif ID: 64
Motif name: PPARGRXRA
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 2
Number of overlap: 11
Similarity score: 0.0629476

Alignment:
TGRCCTKTGHCCKAB
---CGTGKCCGCGG-

Original motif     Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif     Consensus sequence: TGRCCTKTGHCCKAB


Dataset #: 5
Motif ID: 92
Motif name: TFM11
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 3
Number of overlap: 11
Similarity score: 0.0634175

Alignment:
CAMACACACACAYDCACACA
-------CCGCGGRCACG--

Original motif     Consensus sequence: CAMACACACACAYDCACACA Reverse complement motif     Consensus sequence: TGTGTGDKTGTGTGTGTRTG



Significant Motifs - Global and Local Matching (Highest to Lowest)

Dataset #: 3 Motif ID: 55 Motif name: ZEB1

Original motif     Consensus sequence: CACCTD Reverse complement motif     Consensus sequence: HAGGTG

Best Matches for Significant Motif ID 55 (Highest to Lowest)

Dataset #: 1
Motif ID: 1
Motif name: Motif 1
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 4
Number of overlap: 6
Similarity score: 0

Alignment:
YGCCACCTDSTGGY
---CACCTD-----

Original motif     Consensus sequence: YGCCACCTDSTGGY Reverse complement motif     Consensus sequence: KCCASDAGGTGGCK


Dataset #: 2
Motif ID: 9
Motif name: Motif 9
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 7
Number of overlap: 6
Similarity score: 0.00902841

Alignment:
CWGAGCCAYCTYTC
------CACCTD--

Original motif     Consensus sequence: CWGAGCCAYCTYTC Reverse complement motif     Consensus sequence: GAKAGKTGGCTCWG


Dataset #: 3
Motif ID: 66
Motif name: CTCF
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 8
Number of overlap: 6
Similarity score: 0.0118423

Alignment:
YDRCCASYAGRKGGCRSYV
-------HAGGTG------

Original motif     Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif     Consensus sequence: BMSMGCCYMCTKSTGGMHM


Dataset #: 3
Motif ID: 62
Motif name: RORA_1
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 4
Number of overlap: 6
Similarity score: 0.0187312

Alignment:
TGACCTDVWT
-CACCTD---

Original motif     Consensus sequence: AWVDAGGTCA Reverse complement motif     Consensus sequence: TGACCTDVWT


Dataset #: 3
Motif ID: 57
Motif name: REST
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 6
Number of overlap: 6
Similarity score: 0.0189156

Alignment:
GGYGCTGTCCATGGTGCTGAA
----------HAGGTG-----

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 3
Motif ID: 54
Motif name: Esrrb
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 6
Similarity score: 0.0248883

Alignment:
VBBYCAAGGTCA
-HAGGTG-----

Original motif     Consensus sequence: VBBYCAAGGTCA Reverse complement motif     Consensus sequence: TGACCTTGMBBB


Dataset #: 3
Motif ID: 60
Motif name: NR1H2RXRA
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 2
Number of overlap: 6
Similarity score: 0.0278775

Alignment:
GTTGACCTTTGACCTTT
----------CACCTD-

Original motif     Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif     Consensus sequence: GTTGACCTTTGACCTTT


Dataset #: 2
Motif ID: 50
Motif name: Motif 50
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 8
Number of overlap: 6
Similarity score: 0.0285279

Alignment:
TATKCTAAACCTAT
-CACCTD-------

Original motif     Consensus sequence: ATAGGTTTAGYATA Reverse complement motif     Consensus sequence: TATKCTAAACCTAT


Dataset #: 3
Motif ID: 64
Motif name: PPARGRXRA
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 9
Number of overlap: 6
Similarity score: 0.0310859

Alignment:
TGRCCTKTGHCCKAB
-CACCTD--------

Original motif     Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif     Consensus sequence: TGRCCTKTGHCCKAB


Dataset #: 3
Motif ID: 61
Motif name: NR4A2
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 6
Similarity score: 0.0334919

Alignment:
GTGACCTT
--CACCTD

Original motif     Consensus sequence: AAGGTCAC Reverse complement motif     Consensus sequence: GTGACCTT


Dataset #: 5 Motif ID: 84 Motif name: TFW3

Original motif     Consensus sequence: GCACTG Reverse complement motif     Consensus sequence: CAGTGC

Best Matches for Significant Motif ID 84 (Highest to Lowest)

Dataset #: 4
Motif ID: 67
Motif name: TgTGgTGTCACAGTGCTCC
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 11
Number of overlap: 6
Similarity score: 0

Alignment:
TGTGGTGTCACAGTGCTCC
---CAGTGC----------

Original motif     Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif     Consensus sequence: GGAGCACTGTGACACCACA


Dataset #: 4
Motif ID: 72
Motif name: CACTGTGrYrtCACAGTGswsCAcT
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 14
Number of overlap: 6
Similarity score: 0.000794289

Alignment:
AGTGSWSCACTGTGAMAMCACAGTG
-------------GCACTG------

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG


Dataset #: 4
Motif ID: 73
Motif name: TGGAGCACTGTGACAcCACAGTGg
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 5
Number of overlap: 6
Similarity score: 0.00482436

Alignment:
CCACTGTGVTGTCACAGTGCTCCA
--------------CAGTGC----

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA


Dataset #: 4
Motif ID: 76
Motif name: CAcCACAGTGGAGCAct
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 6
Number of overlap: 6
Similarity score: 0.0201914

Alignment:
CAHCACAGTGGAGCACT
------CAGTGC-----

Original motif     Consensus sequence: CAHCACAGTGGAGCACT Reverse complement motif     Consensus sequence: AGTGCTCCACTGTGDTG


Dataset #: 4
Motif ID: 70
Motif name: CagTGCTCCACTGTGgT
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 8
Number of overlap: 6
Similarity score: 0.0205497

Alignment:
ABCACAGTGGAGCACTG
----CAGTGC-------

Original motif     Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif     Consensus sequence: ABCACAGTGGAGCACTG


Dataset #: 4
Motif ID: 77
Motif name: AgTGCTCCACTGTGgTGTCACAgT
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 13
Number of overlap: 6
Similarity score: 0.0290883

Alignment:
AGTGCTCCACTGTGGTGTCACAGT
------GCACTG------------

Original motif     Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif     Consensus sequence: ACTGTGACACCACAGTGGAGCACT


Dataset #: 3
Motif ID: 57
Motif name: REST
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 15
Number of overlap: 6
Similarity score: 0.039883

Alignment:
TTCAGCACCATGGACAGCKCC
-CAGTGC--------------

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 3
Motif ID: 65
Motif name: Tcfcp2l1
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 2
Number of overlap: 6
Similarity score: 0.0447224

Alignment:
CCAGYYHVADCCRG
-------CAGTGC-

Original motif     Consensus sequence: CCAGYYHVADCCRG Reverse complement motif     Consensus sequence: CKGGDTBDMMCTGG


Dataset #: 2
Motif ID: 9
Motif name: Motif 9
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 9
Number of overlap: 6
Similarity score: 0.0459818

Alignment:
CWGAGCCAYCTYTC
--------CAGTGC

Original motif     Consensus sequence: CWGAGCCAYCTYTC Reverse complement motif     Consensus sequence: GAKAGKTGGCTCWG


Dataset #: 4
Motif ID: 75
Motif name: wwCCAmAGTCmt
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 6
Number of overlap: 6
Similarity score: 0.0587933

Alignment:
VDGACTRTGGDD
-----GCACTG-

Original motif     Consensus sequence: DDCCAMAGTCHB Reverse complement motif     Consensus sequence: VDGACTRTGGDD


Dataset #: 5 Motif ID: 85 Motif name: TFW1

Original motif     Consensus sequence: TTGCGCAA Reverse complement motif     Consensus sequence: TTGCGCAA

Best Matches for Significant Motif ID 85 (Highest to Lowest)

Dataset #: 2
Motif ID: 25
Motif name: Motif 25
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 8
Similarity score: 0.0195312

Alignment:
TTYGGAAAGCAG
----TTGCGCAA

Original motif     Consensus sequence: CTGCTTTCCMAA Reverse complement motif     Consensus sequence: TTYGGAAAGCAG


Dataset #: 3
Motif ID: 52
Motif name: NR2F1
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 1
Number of overlap: 8
Similarity score: 0.0276442

Alignment:
AKGYYCAAAGRTCA
TTGCGCAA------

Original motif     Consensus sequence: TGAMCTTTGMMCYT Reverse complement motif     Consensus sequence: AKGYYCAAAGRTCA


Dataset #: 3
Motif ID: 64
Motif name: PPARGRXRA
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 7
Number of overlap: 8
Similarity score: 0.0277567

Alignment:
BTRGGDCARAGGKCA
------TTGCGCAA-

Original motif     Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif     Consensus sequence: TGRCCTKTGHCCKAB


Dataset #: 2
Motif ID: 32
Motif name: Motif 32
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 8
Similarity score: 0.0328125

Alignment:
TTTACTAAAT
-TTGCGCAA-

Original motif     Consensus sequence: ATTTAGTAAA Reverse complement motif     Consensus sequence: TTTACTAAAT


Dataset #: 4
Motif ID: 76
Motif name: CAcCACAGTGGAGCAct
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 8
Similarity score: 0.0336914

Alignment:
CAHCACAGTGGAGCACT
-TTGCGCAA--------

Original motif     Consensus sequence: CAHCACAGTGGAGCACT Reverse complement motif     Consensus sequence: AGTGCTCCACTGTGDTG


Dataset #: 4
Motif ID: 73
Motif name: TGGAGCACTGTGACAcCACAGTGg
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 17
Number of overlap: 8
Similarity score: 0.0338471

Alignment:
TGGAGCACTGTGACAVCACAGTGG
TTGCGCAA----------------

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA


Dataset #: 4
Motif ID: 77
Motif name: AgTGCTCCACTGTGgTGTCACAgT
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 16
Number of overlap: 8
Similarity score: 0.034375

Alignment:
AGTGCTCCACTGTGGTGTCACAGT
---------------TTGCGCAA-

Original motif     Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif     Consensus sequence: ACTGTGACACCACAGTGGAGCACT


Dataset #: 4
Motif ID: 70
Motif name: CagTGCTCCACTGTGgT
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 8
Number of overlap: 8
Similarity score: 0.0354167

Alignment:
CAGTGCTCCACTGTGBT
-------TTGCGCAA--

Original motif     Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif     Consensus sequence: ABCACAGTGGAGCACTG


Dataset #: 5
Motif ID: 91
Motif name: TFM3
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 2
Number of overlap: 8
Similarity score: 0.0359375

Alignment:
KTTTTTTKTTTTTTDAAB
---------TTGCGCAA-

Original motif     Consensus sequence: KTTTTTTKTTTTTTDAAB Reverse complement motif     Consensus sequence: BTTHAAAAAAYAAAAAAR


Dataset #: 4
Motif ID: 72
Motif name: CACTGTGrYrtCACAGTGswsCAcT
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 3
Number of overlap: 8
Similarity score: 0.0407242

Alignment:
CACTGTGRTRTCACAGTGSWSCACT
---------------TTGCGCAA--

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG


Dataset #: 4 Motif ID: 83 Motif name: srACyCCGAyr

Original motif     Consensus sequence: SRACYCCGAYR Reverse complement motif     Consensus sequence: KKTCGGKGTKS

Best Matches for Significant Motif ID 83 (Highest to Lowest)

Dataset #: 5
Motif ID: 92
Motif name: TFM11
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 8
Number of overlap: 11
Similarity score: 0.0337509

Alignment:
TGTGTGDKTGTGTGTGTRTG
--KKTCGGKGTKS-------

Original motif     Consensus sequence: CAMACACACACAYDCACACA Reverse complement motif     Consensus sequence: TGTGTGDKTGTGTGTGTRTG


Dataset #: 3
Motif ID: 53
Motif name: ESR1
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 11
Similarity score: 0.0342809

Alignment:
MGGTCAGGGTGACCTRDBHV
-KKTCGGKGTKS--------

Original motif     Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif     Consensus sequence: MGGTCAGGGTGACCTRDBHV


Dataset #: 5
Motif ID: 89
Motif name: TFM1
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 2
Number of overlap: 11
Similarity score: 0.0348124

Alignment:
TGTGTGWGTGTGTGTGTG
------KKTCGGKGTKS-

Original motif     Consensus sequence: CACACACACACWCACACA Reverse complement motif     Consensus sequence: TGTGTGWGTGTGTGTGTG


Dataset #: 4
Motif ID: 73
Motif name: TGGAGCACTGTGACAcCACAGTGg
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 5
Number of overlap: 11
Similarity score: 0.0372475

Alignment:
CCACTGTGVTGTCACAGTGCTCCA
---------KKTCGGKGTKS----

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA


Dataset #: 3
Motif ID: 59
Motif name: ESR2
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 4
Number of overlap: 11
Similarity score: 0.0379796

Alignment:
BAGGYCABHBTGACCKHV
---SRACYCCGAYR----

Original motif     Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif     Consensus sequence: BAGGYCABHBTGACCKHV


Dataset #: 4
Motif ID: 67
Motif name: TgTGgTGTCACAGTGCTCC
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 6
Number of overlap: 11
Similarity score: 0.0381944

Alignment:
GGAGCACTGTGACACCACA
-----SRACYCCGAYR---

Original motif     Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif     Consensus sequence: GGAGCACTGTGACACCACA


Dataset #: 2
Motif ID: 10
Motif name: Motif 10
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 3
Number of overlap: 11
Similarity score: 0.039412

Alignment:
TGTGTSWGTBTSTG
--KKTCGGKGTKS-

Original motif     Consensus sequence: CASABACWSACACA Reverse complement motif     Consensus sequence: TGTGTSWGTBTSTG


Dataset #: 4
Motif ID: 72
Motif name: CACTGTGrYrtCACAGTGswsCAcT
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 7
Number of overlap: 11
Similarity score: 0.0397727

Alignment:
AGTGSWSCACTGTGAMAMCACAGTG
--------SRACYCCGAYR------

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG


Dataset #: 3
Motif ID: 57
Motif name: REST
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 5
Number of overlap: 11
Similarity score: 0.0402801

Alignment:
GGYGCTGTCCATGGTGCTGAA
------KKTCGGKGTKS----

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 2
Motif ID: 6
Motif name: Motif 6
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 11
Similarity score: 0.0438762

Alignment:
GTGTGTGTGTGTGT
-KKTCGGKGTKS--

Original motif     Consensus sequence: ACACACACACACAC Reverse complement motif     Consensus sequence: GTGTGTGTGTGTGT


Dataset #: 5 Motif ID: 87 Motif name: TFF1

Original motif     Consensus sequence: AGGACAAAGAVV Reverse complement motif     Consensus sequence: VVTCTTTGTCCT

Best Matches for Significant Motif ID 87 (Highest to Lowest)

Dataset #: 3
Motif ID: 51
Motif name: HNF4A
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 12
Similarity score: 0.0111472

Alignment:
TGMYCTTTGBCCK
-VVTCTTTGTCCT

Original motif     Consensus sequence: RGGBCAAAGKYCA Reverse complement motif     Consensus sequence: TGMYCTTTGBCCK


Dataset #: 3
Motif ID: 64
Motif name: PPARGRXRA
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 3
Number of overlap: 12
Similarity score: 0.0210867

Alignment:
BTRGGDCARAGGKCA
--AGGACAAAGAVV-

Original motif     Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif     Consensus sequence: TGRCCTKTGHCCKAB


Dataset #: 3
Motif ID: 59
Motif name: ESR2
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 5
Number of overlap: 12
Similarity score: 0.0351633

Alignment:
BAGGYCABHBTGACCKHV
----VVTCTTTGTCCT--

Original motif     Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif     Consensus sequence: BAGGYCABHBTGACCKHV


Dataset #: 3
Motif ID: 53
Motif name: ESR1
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 9
Number of overlap: 12
Similarity score: 0.039773

Alignment:
VDBHMAGGTCACCCTGACCY
VVTCTTTGTCCT--------

Original motif     Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif     Consensus sequence: MGGTCAGGGTGACCTRDBHV


Dataset #: 5
Motif ID: 93
Motif name: TFM12
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 8
Number of overlap: 12
Similarity score: 0.0408272

Alignment:
RAGKGMAGVRRGSRCASAGV
-AGGACAAAGAVV-------

Original motif     Consensus sequence: RAGKGMAGVRRGSRCASAGV Reverse complement motif     Consensus sequence: VCTSTGKSCMKBCTRCYCTK


Dataset #: 3
Motif ID: 52
Motif name: NR2F1
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 2
Number of overlap: 12
Similarity score: 0.0472374

Alignment:
AKGYYCAAAGRTCA
-AGGACAAAGAVV-

Original motif     Consensus sequence: TGAMCTTTGMMCYT Reverse complement motif     Consensus sequence: AKGYYCAAAGRTCA


Dataset #: 3
Motif ID: 60
Motif name: NR1H2RXRA
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 4
Number of overlap: 12
Similarity score: 0.0472884

Alignment:
GTTGACCTTTGACCTTT
---VVTCTTTGTCCT--

Original motif     Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif     Consensus sequence: GTTGACCTTTGACCTTT


Dataset #: 4
Motif ID: 72
Motif name: CACTGTGrYrtCACAGTGswsCAcT
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 7
Number of overlap: 12
Similarity score: 0.0530556

Alignment:
CACTGTGRTRTCACAGTGSWSCACT
-------AGGACAAAGAVV------

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG


Dataset #: 4
Motif ID: 73
Motif name: TGGAGCACTGTGACAcCACAGTGg
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 13
Number of overlap: 12
Similarity score: 0.0539204

Alignment:
TGGAGCACTGTGACAVCACAGTGG
------------AGGACAAAGAVV

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA


Dataset #: 3
Motif ID: 57
Motif name: REST
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 7
Number of overlap: 12
Similarity score: 0.0558379

Alignment:
TTCAGCACCATGGACAGCKCC
---AGGACAAAGAVV------

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 2 Motif ID: 7 Motif name: Motif 7

Original motif     Consensus sequence: HCAGRRVACASAG Reverse complement motif     Consensus sequence: CTSTGTBKMCTGH

Best Matches for Significant Motif ID 7 (Highest to Lowest)

Dataset #: 5
Motif ID: 93
Motif name: TFM12
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 7
Number of overlap: 13
Similarity score: 0.00926418

Alignment:
RAGKGMAGVRRGSRCASAGV
------HCAGRRVACASAG-

Original motif     Consensus sequence: RAGKGMAGVRRGSRCASAGV Reverse complement motif     Consensus sequence: VCTSTGKSCMKBCTRCYCTK


Dataset #: 3
Motif ID: 53
Motif name: ESR1
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 4
Number of overlap: 13
Similarity score: 0.0328703

Alignment:
VDBHMAGGTCACCCTGACCY
---HCAGRRVACASAG----

Original motif     Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif     Consensus sequence: MGGTCAGGGTGACCTRDBHV


Dataset #: 4
Motif ID: 72
Motif name: CACTGTGrYrtCACAGTGswsCAcT
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 3
Number of overlap: 13
Similarity score: 0.0400966

Alignment:
AGTGSWSCACTGTGAMAMCACAGTG
----------HCAGRRVACASAG--

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG


Dataset #: 5
Motif ID: 90
Motif name: TFM2
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 3
Number of overlap: 13
Similarity score: 0.0435274

Alignment:
GCAGAKGSAGGABDGHDG
--HCAGRRVACASAG---

Original motif     Consensus sequence: CHHCHBTCCTSCYTCTGC Reverse complement motif     Consensus sequence: GCAGAKGSAGGABDGHDG


Dataset #: 3
Motif ID: 66
Motif name: CTCF
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 7
Number of overlap: 13
Similarity score: 0.0448341

Alignment:
YDRCCASYAGRKGGCRSYV
------HCAGRRVACASAG

Original motif     Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif     Consensus sequence: BMSMGCCYMCTKSTGGMHM


Dataset #: 4
Motif ID: 73
Motif name: TGGAGCACTGTGACAcCACAGTGg
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 4
Number of overlap: 13
Similarity score: 0.045698

Alignment:
CCACTGTGVTGTCACAGTGCTCCA
---CTSTGTBKMCTGH--------

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA


Dataset #: 3
Motif ID: 64
Motif name: PPARGRXRA
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 13
Similarity score: 0.0457253

Alignment:
BTRGGDCARAGGKCA
HCAGRRVACASAG--

Original motif     Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif     Consensus sequence: TGRCCTKTGHCCKAB


Dataset #: 3
Motif ID: 65
Motif name: Tcfcp2l1
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 1
Number of overlap: 13
Similarity score: 0.0477557

Alignment:
CKGGDTBDMMCTGG
CTSTGTBKMCTGH-

Original motif     Consensus sequence: CCAGYYHVADCCRG Reverse complement motif     Consensus sequence: CKGGDTBDMMCTGG


Dataset #: 5
Motif ID: 94
Motif name: TFM13
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 4
Number of overlap: 13
Similarity score: 0.0478998

Alignment:
WHAATTAAARAARAAAAAAA
----HCAGRRVACASAG---

Original motif     Consensus sequence: TTTTTTTKTTKTTTAATTHW Reverse complement motif     Consensus sequence: WHAATTAAARAARAAAAAAA


Dataset #: 5
Motif ID: 88
Motif name: TFF11
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 13
Similarity score: 0.048132

Alignment:
HVCDBBDBCAGCAG
-HCAGRRVACASAG

Original motif     Consensus sequence: CTGCTGBDBBDGBD Reverse complement motif     Consensus sequence: HVCDBBDBCAGCAG


Dataset #: 3 Motif ID: 61 Motif name: NR4A2

Original motif     Consensus sequence: AAGGTCAC Reverse complement motif     Consensus sequence: GTGACCTT

Best Matches for Significant Motif ID 61 (Highest to Lowest)

Dataset #: 3
Motif ID: 60
Motif name: NR1H2RXRA
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 8
Similarity score: 0.0167759

Alignment:
AAAGGTCAAAGGTCAAC
-AAGGTCAC--------

Original motif     Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif     Consensus sequence: GTTGACCTTTGACCTTT


Dataset #: 3
Motif ID: 53
Motif name: ESR1
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 5
Number of overlap: 8
Similarity score: 0.0195235

Alignment:
VDBHMAGGTCACCCTGACCY
----AAGGTCAC--------

Original motif     Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif     Consensus sequence: MGGTCAGGGTGACCTRDBHV


Dataset #: 3
Motif ID: 59
Motif name: ESR2
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 10
Number of overlap: 8
Similarity score: 0.0198372

Alignment:
BAGGYCABHBTGACCKHV
---------GTGACCTT-

Original motif     Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif     Consensus sequence: BAGGYCABHBTGACCKHV


Dataset #: 2
Motif ID: 21
Motif name: Motif 21
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 8
Similarity score: 0.0393171

Alignment:
CTTCTGACCTC
GTGACCTT---

Original motif     Consensus sequence: CTTCTGACCTC Reverse complement motif     Consensus sequence: GAGGTCAGAAG


Dataset #: 2
Motif ID: 19
Motif name: Motif 19
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 8
Similarity score: 0.040519

Alignment:
AAAGRTMAAACTA
-AAGGTCAC----

Original motif     Consensus sequence: AAAGRTMAAACTA Reverse complement motif     Consensus sequence: TAGTTTYAKCTTT


Dataset #: 3
Motif ID: 64
Motif name: PPARGRXRA
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 7
Number of overlap: 8
Similarity score: 0.0495607

Alignment:
BTRGGDCARAGGKCA
-AAGGTCAC------

Original motif     Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif     Consensus sequence: TGRCCTKTGHCCKAB


Dataset #: 2
Motif ID: 28
Motif name: Motif 28
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 4
Number of overlap: 8
Similarity score: 0.0539119

Alignment:
TTWATGWCTTT
---GTGACCTT

Original motif     Consensus sequence: AAAGWCATWAA Reverse complement motif     Consensus sequence: TTWATGWCTTT


Dataset #: 4
Motif ID: 72
Motif name: CACTGTGrYrtCACAGTGswsCAcT
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 7
Number of overlap: 8
Similarity score: 0.0557243

Alignment:
CACTGTGRTRTCACAGTGSWSCACT
------AAGGTCAC-----------

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG


Dataset #: 3
Motif ID: 52
Motif name: NR2F1
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 7
Number of overlap: 8
Similarity score: 0.0564874

Alignment:
AKGYYCAAAGRTCA
------AAGGTCAC

Original motif     Consensus sequence: TGAMCTTTGMMCYT Reverse complement motif     Consensus sequence: AKGYYCAAAGRTCA


Dataset #: 2
Motif ID: 39
Motif name: Motif 39
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 3
Number of overlap: 8
Similarity score: 0.0566591

Alignment:
AGATGYTCTTG
-GTGACCTT--

Original motif     Consensus sequence: AGATGYTCTTG Reverse complement motif     Consensus sequence: CAAGAKCATCT


Dataset #: 1 Motif ID: 2 Motif name: Motif 2

Original motif     Consensus sequence: GCARRGGSAGS Reverse complement motif     Consensus sequence: SCTSCCKMTGC

Best Matches for Significant Motif ID 2 (Highest to Lowest)

Dataset #: 2
Motif ID: 5
Motif name: Motif 5
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0

Alignment:
GCAGAGGSAKG
GCARRGGSAGS

Original motif     Consensus sequence: CYTSCCTCTGC Reverse complement motif     Consensus sequence: GCAGAGGSAKG


Dataset #: 5
Motif ID: 90
Motif name: TFM2
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 1
Number of overlap: 11
Similarity score: 0.000952693

Alignment:
GCAGAKGSAGGABDGHDG
GCARRGGSAGS-------

Original motif     Consensus sequence: CHHCHBTCCTSCYTCTGC Reverse complement motif     Consensus sequence: GCAGAKGSAGGABDGHDG


Dataset #: 3
Motif ID: 66
Motif name: CTCF
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 3
Number of overlap: 11
Similarity score: 0.033658

Alignment:
YDRCCASYAGRKGGCRSYV
------GCARRGGSAGS--

Original motif     Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif     Consensus sequence: BMSMGCCYMCTKSTGGMHM


Dataset #: 5
Motif ID: 88
Motif name: TFF11
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 3
Number of overlap: 11
Similarity score: 0.0410341

Alignment:
CTGCTGBDBBDGBD
--SCTSCCKMTGC-

Original motif     Consensus sequence: CTGCTGBDBBDGBD Reverse complement motif     Consensus sequence: HVCDBBDBCAGCAG


Dataset #: 5
Motif ID: 93
Motif name: TFM12
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 6
Number of overlap: 11
Similarity score: 0.0422459

Alignment:
RAGKGMAGVRRGSRCASAGV
----GCARRGGSAGS-----

Original motif     Consensus sequence: RAGKGMAGVRRGSRCASAGV Reverse complement motif     Consensus sequence: VCTSTGKSCMKBCTRCYCTK


Dataset #: 3
Motif ID: 65
Motif name: Tcfcp2l1
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 11
Similarity score: 0.0533531

Alignment:
CCAGYYHVADCCRG
SCTSCCKMTGC---

Original motif     Consensus sequence: CCAGYYHVADCCRG Reverse complement motif     Consensus sequence: CKGGDTBDMMCTGG


Dataset #: 3
Motif ID: 57
Motif name: REST
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 4
Number of overlap: 11
Similarity score: 0.0578944

Alignment:
GGYGCTGTCCATGGTGCTGAA
---SCTSCCKMTGC-------

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 3
Motif ID: 53
Motif name: ESR1
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 3
Number of overlap: 11
Similarity score: 0.0620615

Alignment:
VDBHMAGGTCACCCTGACCY
--GCARRGGSAGS-------

Original motif     Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif     Consensus sequence: MGGTCAGGGTGACCTRDBHV


Dataset #: 2
Motif ID: 7
Motif name: Motif 7
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 3
Number of overlap: 11
Similarity score: 0.0627554

Alignment:
HCAGRRVACASAG
GCARRGGSAGS--

Original motif     Consensus sequence: HCAGRRVACASAG Reverse complement motif     Consensus sequence: CTSTGTBKMCTGH


Dataset #: 3
Motif ID: 59
Motif name: ESR2
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 5
Number of overlap: 11
Similarity score: 0.0646979

Alignment:
VHRGGTCABDBTGMCCTB
---SCTSCCKMTGC----

Original motif     Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif     Consensus sequence: BAGGYCABHBTGACCKHV


Dataset #: 4 Motif ID: 78 Motif name: ssGCkTGCssk

Original motif     Consensus sequence: SSGCKTGCSSK Reverse complement motif     Consensus sequence: YSSGCAYGCSS

Best Matches for Significant Motif ID 78 (Highest to Lowest)

Dataset #: 4
Motif ID: 82
Motif name: gCGCGCsCgsG
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0.0230178

Alignment:
GCGCGCSCGCG
SSGCKTGCSSK

Original motif     Consensus sequence: GCGCGCSCGCG Reverse complement motif     Consensus sequence: CGCGSGCGCGC


Dataset #: 4
Motif ID: 74
Motif name: ssCCCCGCSssk
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 2
Number of overlap: 11
Similarity score: 0.036087

Alignment:
SBCCCCGCCSBB
SSGCKTGCSSK-

Original motif     Consensus sequence: SBCCCCGCCSBB Reverse complement motif     Consensus sequence: BBSGGCGGGGBS


Dataset #: 4
Motif ID: 68
Motif name: sscCCCGCGcs
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0.0375477

Alignment:
SBCGCGGGGSB
YSSGCAYGCSS

Original motif     Consensus sequence: BSCCCCGCGBS Reverse complement motif     Consensus sequence: SBCGCGGGGSB


Dataset #: 4
Motif ID: 79
Motif name: cCGCGGrCACG
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0.0461039

Alignment:
CCGCGGRCACG
SSGCKTGCSSK

Original motif     Consensus sequence: CCGCGGRCACG Reverse complement motif     Consensus sequence: CGTGKCCGCGG


Dataset #: 2
Motif ID: 25
Motif name: Motif 25
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0.0529221

Alignment:
TTYGGAAAGCAG
-YSSGCAYGCSS

Original motif     Consensus sequence: CTGCTTTCCMAA Reverse complement motif     Consensus sequence: TTYGGAAAGCAG


Dataset #: 3
Motif ID: 66
Motif name: CTCF
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 8
Number of overlap: 11
Similarity score: 0.0533963

Alignment:
YDRCCASYAGRKGGCRSYV
-------SSGCKTGCSSK-

Original motif     Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif     Consensus sequence: BMSMGCCYMCTKSTGGMHM


Dataset #: 3
Motif ID: 54
Motif name: Esrrb
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0.0543224

Alignment:
VBBYCAAGGTCA
-YSSGCAYGCSS

Original motif     Consensus sequence: VBBYCAAGGTCA Reverse complement motif     Consensus sequence: TGACCTTGMBBB


Dataset #: 3
Motif ID: 59
Motif name: ESR2
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 3
Number of overlap: 11
Similarity score: 0.0563598

Alignment:
VHRGGTCABDBTGMCCTB
-----YSSGCAYGCSS--

Original motif     Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif     Consensus sequence: BAGGYCABHBTGACCKHV


Dataset #: 3
Motif ID: 57
Motif name: REST
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 10
Number of overlap: 11
Similarity score: 0.0593846

Alignment:
TTCAGCACCATGGACAGCKCC
-YSSGCAYGCSS---------

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 3
Motif ID: 64
Motif name: PPARGRXRA
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 3
Number of overlap: 11
Similarity score: 0.0598714

Alignment:
BTRGGDCARAGGKCA
--YSSGCAYGCSS--

Original motif     Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif     Consensus sequence: TGRCCTKTGHCCKAB


Dataset #: 4 Motif ID: 79 Motif name: cCGCGGrCACG

Original motif     Consensus sequence: CCGCGGRCACG Reverse complement motif     Consensus sequence: CGTGKCCGCGG

Best Matches for Significant Motif ID 79 (Highest to Lowest)

Dataset #: 4
Motif ID: 82
Motif name: gCGCGCsCgsG
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0.010473

Alignment:
GCGCGCSCGCG
CCGCGGRCACG

Original motif     Consensus sequence: GCGCGCSCGCG Reverse complement motif     Consensus sequence: CGCGSGCGCGC


Dataset #: 5
Motif ID: 88
Motif name: TFF11
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 4
Number of overlap: 11
Similarity score: 0.0478408

Alignment:
HVCDBBDBCAGCAG
---CGTGKCCGCGG

Original motif     Consensus sequence: CTGCTGBDBBDGBD Reverse complement motif     Consensus sequence: HVCDBBDBCAGCAG


Dataset #: 3
Motif ID: 57
Motif name: REST
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 4
Number of overlap: 11
Similarity score: 0.0484441

Alignment:
TTCAGCACCATGGACAGCKCC
-------CCGCGGRCACG---

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 3
Motif ID: 53
Motif name: ESR1
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 3
Number of overlap: 11
Similarity score: 0.0486581

Alignment:
MGGTCAGGGTGACCTRDBHV
-------CGTGKCCGCGG--

Original motif     Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif     Consensus sequence: MGGTCAGGGTGACCTRDBHV


Dataset #: 4
Motif ID: 78
Motif name: ssGCkTGCssk
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0.0503056

Alignment:
SSGCKTGCSSK
CCGCGGRCACG

Original motif     Consensus sequence: SSGCKTGCSSK Reverse complement motif     Consensus sequence: YSSGCAYGCSS


Dataset #: 4
Motif ID: 74
Motif name: ssCCCCGCSssk
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 2
Number of overlap: 11
Similarity score: 0.055777

Alignment:
BBSGGCGGGGBS
CGTGKCCGCGG-

Original motif     Consensus sequence: SBCCCCGCCSBB Reverse complement motif     Consensus sequence: BBSGGCGGGGBS


Dataset #: 3
Motif ID: 66
Motif name: CTCF
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 2
Number of overlap: 11
Similarity score: 0.0588663

Alignment:
YDRCCASYAGRKGGCRSYV
-------CCGCGGRCACG-

Original motif     Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif     Consensus sequence: BMSMGCCYMCTKSTGGMHM


Dataset #: 2
Motif ID: 7
Motif name: Motif 7
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 11
Similarity score: 0.0597806

Alignment:
HCAGRRVACASAG
-CCGCGGRCACG-

Original motif     Consensus sequence: HCAGRRVACASAG Reverse complement motif     Consensus sequence: CTSTGTBKMCTGH


Dataset #: 2
Motif ID: 6
Motif name: Motif 6
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 3
Number of overlap: 11
Similarity score: 0.0624268

Alignment:
GTGTGTGTGTGTGT
-CGTGKCCGCGG--

Original motif     Consensus sequence: ACACACACACACAC Reverse complement motif     Consensus sequence: GTGTGTGTGTGTGT


Dataset #: 5
Motif ID: 93
Motif name: TFM12
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 5
Number of overlap: 11
Similarity score: 0.0625015

Alignment:
RAGKGMAGVRRGSRCASAGV
-----CCGCGGRCACG----

Original motif     Consensus sequence: RAGKGMAGVRRGSRCASAGV Reverse complement motif     Consensus sequence: VCTSTGKSCMKBCTRCYCTK



Best Matches for Each Motif (Highest to Lowest)

Dataset #: 1 Motif ID: 1 Motif name: Motif 1

Original motif     Consensus sequence: YGCCACCTDSTGGY Reverse complement motif     Consensus sequence: KCCASDAGGTGGCK

Best Matches for Motif ID 1 (Highest to Lowest)

Dataset #: 3
Motif ID: 66
Motif name: CTCF
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 3
Number of overlap: 14
Similarity score: 0.0209936

Alignment:
BMSMGCCYMCTKSTGGMHM
---YGCCACCTDSTGGY--

Original motif     Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif     Consensus sequence: BMSMGCCYMCTKSTGGMHM


Dataset #: 4
Motif ID: 70
Motif name: CagTGCTCCACTGTGgT
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 4
Number of overlap: 14
Similarity score: 0.0790816

Alignment:
CAGTGCTCCACTGTGBT
---YGCCACCTDSTGGY

Original motif     Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif     Consensus sequence: ABCACAGTGGAGCACTG


Dataset #: 4
Motif ID: 76
Motif name: CAcCACAGTGGAGCAct
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 2
Number of overlap: 14
Similarity score: 0.0804767

Alignment:
AGTGCTCCACTGTGDTG
--YGCCACCTDSTGGY-

Original motif     Consensus sequence: CAHCACAGTGGAGCACT Reverse complement motif     Consensus sequence: AGTGCTCCACTGTGDTG


Dataset #: 4
Motif ID: 77
Motif name: AgTGCTCCACTGTGgTGTCACAgT
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 9
Number of overlap: 14
Similarity score: 0.0836896

Alignment:
AGTGCTCCACTGTGGTGTCACAGT
--YGCCACCTDSTGGY--------

Original motif     Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif     Consensus sequence: ACTGTGACACCACAGTGGAGCACT


Dataset #: 5
Motif ID: 93
Motif name: TFM12
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 4
Number of overlap: 14
Similarity score: 0.0913786

Alignment:
RAGKGMAGVRRGSRCASAGV
---KCCASDAGGTGGCK---

Original motif     Consensus sequence: RAGKGMAGVRRGSRCASAGV Reverse complement motif     Consensus sequence: VCTSTGKSCMKBCTRCYCTK


Dataset #: 5
Motif ID: 90
Motif name: TFM2
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 6
Number of overlap: 13
Similarity score: 0.582451

Alignment:
CHHCHBTCCTSCYTCTGC-
-----YGCCACCTDSTGGY

Original motif     Consensus sequence: CHHCHBTCCTSCYTCTGC Reverse complement motif     Consensus sequence: GCAGAKGSAGGABDGHDG


Dataset #: 3
Motif ID: 53
Motif name: ESR1
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 8
Number of overlap: 13
Similarity score: 0.590483

Alignment:
MGGTCAGGGTGACCTRDBHV-
-------YGCCACCTDSTGGY

Original motif     Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif     Consensus sequence: MGGTCAGGGTGACCTRDBHV


Dataset #: 3
Motif ID: 54
Motif name: Esrrb
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 12
Similarity score: 1.08988

Alignment:
VBBYCAAGGTCA--
KCCASDAGGTGGCK

Original motif     Consensus sequence: VBBYCAAGGTCA Reverse complement motif     Consensus sequence: TGACCTTGMBBB


Dataset #: 4
Motif ID: 73
Motif name: TGGAGCACTGTGACAcCACAGTGg
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 13
Number of overlap: 12
Similarity score: 1.09162

Alignment:
--CCACTGTGVTGTCACAGTGCTCCA
YGCCACCTDSTGGY------------

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA


Dataset #: 4
Motif ID: 74
Motif name: ssCCCCGCSssk
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 12
Similarity score: 1.09358

Alignment:
SBCCCCGCCSBB--
YGCCACCTDSTGGY

Original motif     Consensus sequence: SBCCCCGCCSBB Reverse complement motif     Consensus sequence: BBSGGCGGGGBS


Dataset #: 2
Motif ID: 9
Motif name: Motif 9
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 4
Number of overlap: 11
Similarity score: 1.53998

Alignment:
---GAKAGKTGGCTCWG
KCCASDAGGTGGCK---

Original motif     Consensus sequence: CWGAGCCAYCTYTC Reverse complement motif     Consensus sequence: GAKAGKTGGCTCWG


Dataset #: 1 Motif ID: 2 Motif name: Motif 2

Original motif     Consensus sequence: GCARRGGSAGS Reverse complement motif     Consensus sequence: SCTSCCKMTGC

Best Matches for Motif ID 2 (Highest to Lowest)

Dataset #: 2
Motif ID: 5
Motif name: Motif 5
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0

Alignment:
GCAGAGGSAKG
GCARRGGSAGS

Original motif     Consensus sequence: CYTSCCTCTGC Reverse complement motif     Consensus sequence: GCAGAGGSAKG


Dataset #: 5
Motif ID: 90
Motif name: TFM2
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 1
Number of overlap: 11
Similarity score: 0.000952693

Alignment:
GCAGAKGSAGGABDGHDG
GCARRGGSAGS-------

Original motif     Consensus sequence: CHHCHBTCCTSCYTCTGC Reverse complement motif     Consensus sequence: GCAGAKGSAGGABDGHDG


Dataset #: 3
Motif ID: 66
Motif name: CTCF
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 3
Number of overlap: 11
Similarity score: 0.033658

Alignment:
YDRCCASYAGRKGGCRSYV
------GCARRGGSAGS--

Original motif     Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif     Consensus sequence: BMSMGCCYMCTKSTGGMHM


Dataset #: 5
Motif ID: 88
Motif name: TFF11
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 3
Number of overlap: 11
Similarity score: 0.0410341

Alignment:
CTGCTGBDBBDGBD
--SCTSCCKMTGC-

Original motif     Consensus sequence: CTGCTGBDBBDGBD Reverse complement motif     Consensus sequence: HVCDBBDBCAGCAG


Dataset #: 5
Motif ID: 93
Motif name: TFM12
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 6
Number of overlap: 11
Similarity score: 0.0422459

Alignment:
RAGKGMAGVRRGSRCASAGV
----GCARRGGSAGS-----

Original motif     Consensus sequence: RAGKGMAGVRRGSRCASAGV Reverse complement motif     Consensus sequence: VCTSTGKSCMKBCTRCYCTK


Dataset #: 3
Motif ID: 65
Motif name: Tcfcp2l1
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 11
Similarity score: 0.0533531

Alignment:
CCAGYYHVADCCRG
SCTSCCKMTGC---

Original motif     Consensus sequence: CCAGYYHVADCCRG Reverse complement motif     Consensus sequence: CKGGDTBDMMCTGG


Dataset #: 3
Motif ID: 57
Motif name: REST
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 4
Number of overlap: 11
Similarity score: 0.0578944

Alignment:
GGYGCTGTCCATGGTGCTGAA
---SCTSCCKMTGC-------

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 3
Motif ID: 53
Motif name: ESR1
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 3
Number of overlap: 11
Similarity score: 0.0620615

Alignment:
VDBHMAGGTCACCCTGACCY
--GCARRGGSAGS-------

Original motif     Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif     Consensus sequence: MGGTCAGGGTGACCTRDBHV


Dataset #: 2
Motif ID: 7
Motif name: Motif 7
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 3
Number of overlap: 11
Similarity score: 0.0627554

Alignment:
HCAGRRVACASAG
GCARRGGSAGS--

Original motif     Consensus sequence: HCAGRRVACASAG Reverse complement motif     Consensus sequence: CTSTGTBKMCTGH


Dataset #: 3
Motif ID: 59
Motif name: ESR2
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 5
Number of overlap: 11
Similarity score: 0.0646979

Alignment:
VHRGGTCABDBTGMCCTB
---SCTSCCKMTGC----

Original motif     Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif     Consensus sequence: BAGGYCABHBTGACCKHV


Dataset #: 1 Motif ID: 3 Motif name: Motif 3

Original motif     Consensus sequence: AAAAAAAAAAAAAT Reverse complement motif     Consensus sequence: ATTTTTTTTTTTTT

Best Matches for Motif ID 3 (Highest to Lowest)

Dataset #: 5
Motif ID: 94
Motif name: TFM13
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 14
Similarity score: 0.0548469

Alignment:
TTTTTTTKTTKTTTAATTHW
ATTTTTTTTTTTTT------

Original motif     Consensus sequence: TTTTTTTKTTKTTTAATTHW Reverse complement motif     Consensus sequence: WHAATTAAARAARAAAAAAA


Dataset #: 5
Motif ID: 91
Motif name: TFM3
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 14
Similarity score: 0.0602679

Alignment:
KTTTTTTKTTTTTTDAAB
ATTTTTTTTTTTTT----

Original motif     Consensus sequence: KTTTTTTKTTTTTTDAAB Reverse complement motif     Consensus sequence: BTTHAAAAAAYAAAAAAR


Dataset #: 2
Motif ID: 8
Motif name: Motif 8
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 14
Similarity score: 0.0767857

Alignment:
HAAAAHAAARMAAA
AAAAAAAAAAAAAT

Original motif     Consensus sequence: HAAAAHAAARMAAA Reverse complement motif     Consensus sequence: TTTRKTTTHTTTTH


Dataset #: 2
Motif ID: 27
Motif name: Motif 27
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 1
Number of overlap: 14
Similarity score: 0.0982143

Alignment:
ATYAATGAAWACAT
AAAAAAAAAAAAAT

Original motif     Consensus sequence: ATGTWTTCATTMAT Reverse complement motif     Consensus sequence: ATYAATGAAWACAT


Dataset #: 2
Motif ID: 37
Motif name: Motif 37
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 14
Similarity score: 0.107143

Alignment:
TTTAATGTYTTTWA
ATTTTTTTTTTTTT

Original motif     Consensus sequence: TTTAATGTYTTTWA Reverse complement motif     Consensus sequence: TWAAAKACATTAAA


Dataset #: 2
Motif ID: 19
Motif name: Motif 19
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 13
Similarity score: 0.596154

Alignment:
-TAGTTTYAKCTTT
ATTTTTTTTTTTTT

Original motif     Consensus sequence: AAAGRTMAAACTA Reverse complement motif     Consensus sequence: TAGTTTYAKCTTT


Dataset #: 2
Motif ID: 49
Motif name: Motif 49
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 13
Similarity score: 0.605769

Alignment:
TTAAAAWAGASTTA-
-AAAAAAAAAAAAAT

Original motif     Consensus sequence: TAASTCTWTTTTAA Reverse complement motif     Consensus sequence: TTAAAAWAGASTTA


Dataset #: 2
Motif ID: 15
Motif name: Motif 15
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 12
Similarity score: 1.125

Alignment:
--TTYAAACATYTT
ATTTTTTTTTTTTT

Original motif     Consensus sequence: AAMATGTTTMAA Reverse complement motif     Consensus sequence: TTYAAACATYTT


Dataset #: 2
Motif ID: 13
Motif name: Motif 13
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 12
Similarity score: 1.125

Alignment:
--TGAAAATATGTT
AAAAAAAAAAAAAT

Original motif     Consensus sequence: AACATATTTTCA Reverse complement motif     Consensus sequence: TGAAAATATGTT


Dataset #: 2
Motif ID: 35
Motif name: Motif 35
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 1.56818

Alignment:
---TTGTTGATTTT
ATTTTTTTTTTTTT

Original motif     Consensus sequence: TTGTTGATTTT Reverse complement motif     Consensus sequence: AAAATCAACAA


Dataset #: 1 Motif ID: 4 Motif name: Motif 4

Original motif     Consensus sequence: GGAAM Reverse complement motif     Consensus sequence: YTTCC

Best Matches for Motif ID 4 (Highest to Lowest)

Dataset #: 2
Motif ID: 45
Motif name: Motif 45
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 5
Number of overlap: 5
Similarity score: 0.01875

Alignment:
TGGAGGAAA
----GGAAM

Original motif     Consensus sequence: TGGAGGAAA Reverse complement motif     Consensus sequence: TTTCCTCCA


Dataset #: 2
Motif ID: 25
Motif name: Motif 25
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 4
Number of overlap: 5
Similarity score: 0.01875

Alignment:
TTYGGAAAGCAG
---GGAAM----

Original motif     Consensus sequence: CTGCTTTCCMAA Reverse complement motif     Consensus sequence: TTYGGAAAGCAG


Dataset #: 2
Motif ID: 47
Motif name: Motif 47
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 5
Number of overlap: 5
Similarity score: 0.04375

Alignment:
TGCCTTTCYTT
----YTTCC--

Original motif     Consensus sequence: AAKGAAAGGCA Reverse complement motif     Consensus sequence: TGCCTTTCYTT


Dataset #: 2
Motif ID: 48
Motif name: Motif 48
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 4
Number of overlap: 5
Similarity score: 0.05625

Alignment:
TTCTTYCATT
--YTTCC---

Original motif     Consensus sequence: AATGKAAGAA Reverse complement motif     Consensus sequence: TTCTTYCATT


Dataset #: 2
Motif ID: 13
Motif name: Motif 13
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 1
Number of overlap: 5
Similarity score: 0.06875

Alignment:
TGAAAATATGTT
GGAAM-------

Original motif     Consensus sequence: AACATATTTTCA Reverse complement motif     Consensus sequence: TGAAAATATGTT


Dataset #: 2
Motif ID: 23
Motif name: Motif 23
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 2
Number of overlap: 5
Similarity score: 0.06875

Alignment:
AGAGAAAG
--GGAAM-

Original motif     Consensus sequence: AGAGAAAG Reverse complement motif     Consensus sequence: CTTTCTCT


Dataset #: 2
Motif ID: 12
Motif name: Motif 12
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 6
Number of overlap: 5
Similarity score: 0.06875

Alignment:
AAGSATTTTCA
-----YTTCC-

Original motif     Consensus sequence: TGAAAATSCTT Reverse complement motif     Consensus sequence: AAGSATTTTCA


Dataset #: 2
Motif ID: 32
Motif name: Motif 32
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 5
Similarity score: 0.06875

Alignment:
ATTTAGTAAA
-----GGAAM

Original motif     Consensus sequence: ATTTAGTAAA Reverse complement motif     Consensus sequence: TTTACTAAAT


Dataset #: 3
Motif ID: 57
Motif name: REST
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 6
Number of overlap: 5
Similarity score: 0.0747947

Alignment:
GGYGCTGTCCATGGTGCTGAA
-----YTTCC-----------

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 2
Motif ID: 27
Motif name: Motif 27
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 6
Number of overlap: 5
Similarity score: 0.075

Alignment:
ATYAATGAAWACAT
-----GGAAM----

Original motif     Consensus sequence: ATGTWTTCATTMAT Reverse complement motif     Consensus sequence: ATYAATGAAWACAT


Dataset #: 2 Motif ID: 5 Motif name: Motif 5

Original motif     Consensus sequence: CYTSCCTCTGC Reverse complement motif     Consensus sequence: GCAGAGGSAKG

Best Matches for Motif ID 5 (Highest to Lowest)

Dataset #: 5
Motif ID: 90
Motif name: TFM2
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0

Alignment:
CHHCHBTCCTSCYTCTGC
-------CYTSCCTCTGC

Original motif     Consensus sequence: CHHCHBTCCTSCYTCTGC Reverse complement motif     Consensus sequence: GCAGAKGSAGGABDGHDG


Dataset #: 1
Motif ID: 2
Motif name: Motif 2
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 11
Similarity score: 0.0204179

Alignment:
GCARRGGSAGS
GCAGAGGSAKG

Original motif     Consensus sequence: GCARRGGSAGS Reverse complement motif     Consensus sequence: SCTSCCKMTGC


Dataset #: 5
Motif ID: 88
Motif name: TFF11
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 3
Number of overlap: 11
Similarity score: 0.0606594

Alignment:
CTGCTGBDBBDGBD
--CYTSCCTCTGC-

Original motif     Consensus sequence: CTGCTGBDBBDGBD Reverse complement motif     Consensus sequence: HVCDBBDBCAGCAG


Dataset #: 5
Motif ID: 93
Motif name: TFM12
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 6
Number of overlap: 11
Similarity score: 0.0635403

Alignment:
RAGKGMAGVRRGSRCASAGV
----GCAGAGGSAKG-----

Original motif     Consensus sequence: RAGKGMAGVRRGSRCASAGV Reverse complement motif     Consensus sequence: VCTSTGKSCMKBCTRCYCTK


Dataset #: 3
Motif ID: 66
Motif name: CTCF
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 3
Number of overlap: 11
Similarity score: 0.0656459

Alignment:
YDRCCASYAGRKGGCRSYV
------GCAGAGGSAKG--

Original motif     Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif     Consensus sequence: BMSMGCCYMCTKSTGGMHM


Dataset #: 3
Motif ID: 57
Motif name: REST
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 4
Number of overlap: 11
Similarity score: 0.0782887

Alignment:
GGYGCTGTCCATGGTGCTGAA
---CYTSCCTCTGC-------

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 3
Motif ID: 53
Motif name: ESR1
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 2
Number of overlap: 11
Similarity score: 0.0788385

Alignment:
MGGTCAGGGTGACCTRDBHV
--------CYTSCCTCTGC-

Original motif     Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif     Consensus sequence: MGGTCAGGGTGACCTRDBHV


Dataset #: 3
Motif ID: 64
Motif name: PPARGRXRA
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 4
Number of overlap: 11
Similarity score: 0.0823596

Alignment:
TGRCCTKTGHCCKAB
---CYTSCCTCTGC-

Original motif     Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif     Consensus sequence: TGRCCTKTGHCCKAB


Dataset #: 3
Motif ID: 65
Motif name: Tcfcp2l1
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 11
Similarity score: 0.0826758

Alignment:
CCAGYYHVADCCRG
CYTSCCTCTGC---

Original motif     Consensus sequence: CCAGYYHVADCCRG Reverse complement motif     Consensus sequence: CKGGDTBDMMCTGG


Dataset #: 1
Motif ID: 1
Motif name: Motif 1
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 3
Number of overlap: 11
Similarity score: 0.0840726

Alignment:
YGCCACCTDSTGGY
--CYTSCCTCTGC-

Original motif     Consensus sequence: YGCCACCTDSTGGY Reverse complement motif     Consensus sequence: KCCASDAGGTGGCK


Dataset #: 2 Motif ID: 6 Motif name: Motif 6

Original motif     Consensus sequence: ACACACACACACAC Reverse complement motif     Consensus sequence: GTGTGTGTGTGTGT

Best Matches for Motif ID 6 (Highest to Lowest)

Dataset #: 5
Motif ID: 89
Motif name: TFM1
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 4
Number of overlap: 14
Similarity score: 0

Alignment:
TGTGTGWGTGTGTGTGTG
-GTGTGTGTGTGTGT---

Original motif     Consensus sequence: CACACACACACWCACACA Reverse complement motif     Consensus sequence: TGTGTGWGTGTGTGTGTG


Dataset #: 5
Motif ID: 92
Motif name: TFM11
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 14
Similarity score: 0.00332777

Alignment:
TGTGTGDKTGTGTGTGTRTG
-GTGTGTGTGTGTGT-----

Original motif     Consensus sequence: CAMACACACACAYDCACACA Reverse complement motif     Consensus sequence: TGTGTGDKTGTGTGTGTRTG


Dataset #: 4
Motif ID: 72
Motif name: CACTGTGrYrtCACAGTGswsCAcT
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 14
Similarity score: 0.0819161

Alignment:
AGTGSWSCACTGTGAMAMCACAGTG
-GTGTGTGTGTGTGT----------

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG


Dataset #: 5
Motif ID: 91
Motif name: TFM3
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 4
Number of overlap: 14
Similarity score: 0.082111

Alignment:
KTTTTTTKTTTTTTDAAB
-GTGTGTGTGTGTGT---

Original motif     Consensus sequence: KTTTTTTKTTTTTTDAAB Reverse complement motif     Consensus sequence: BTTHAAAAAAYAAAAAAR


Dataset #: 2
Motif ID: 10
Motif name: Motif 10
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 13
Similarity score: 0.531086

Alignment:
TGTGTSWGTBTSTG-
-GTGTGTGTGTGTGT

Original motif     Consensus sequence: CASABACWSACACA Reverse complement motif     Consensus sequence: TGTGTSWGTBTSTG


Dataset #: 5
Motif ID: 94
Motif name: TFM13
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 8
Number of overlap: 13
Similarity score: 0.576988

Alignment:
-TTTTTTTKTTKTTTAATTHW
GTGTGTGTGTGTGT-------

Original motif     Consensus sequence: TTTTTTTKTTKTTTAATTHW Reverse complement motif     Consensus sequence: WHAATTAAARAARAAAAAAA


Dataset #: 2
Motif ID: 8
Motif name: Motif 8
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 2
Number of overlap: 13
Similarity score: 0.579965

Alignment:
-TTTRKTTTHTTTTH
GTGTGTGTGTGTGT-

Original motif     Consensus sequence: HAAAAHAAARMAAA Reverse complement motif     Consensus sequence: TTTRKTTTHTTTTH


Dataset #: 5
Motif ID: 88
Motif name: TFF11
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 4
Number of overlap: 11
Similarity score: 1.5772

Alignment:
CTGCTGBDBBDGBD---
---GTGTGTGTGTGTGT

Original motif     Consensus sequence: CTGCTGBDBBDGBD Reverse complement motif     Consensus sequence: HVCDBBDBCAGCAG


Dataset #: 5
Motif ID: 87
Motif name: TFF1
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 11
Similarity score: 1.57782

Alignment:
AGGACAAAGAVV---
-ACACACACACACAC

Original motif     Consensus sequence: AGGACAAAGAVV Reverse complement motif     Consensus sequence: VVTCTTTGTCCT


Dataset #: 4
Motif ID: 83
Motif name: srACyCCGAyr
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 1.58018

Alignment:
---KKTCGGKGTKS
GTGTGTGTGTGTGT

Original motif     Consensus sequence: SRACYCCGAYR Reverse complement motif     Consensus sequence: KKTCGGKGTKS


Dataset #: 2 Motif ID: 7 Motif name: Motif 7

Original motif     Consensus sequence: HCAGRRVACASAG Reverse complement motif     Consensus sequence: CTSTGTBKMCTGH

Best Matches for Motif ID 7 (Highest to Lowest)

Dataset #: 5
Motif ID: 93
Motif name: TFM12
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 7
Number of overlap: 13
Similarity score: 0.00926418

Alignment:
RAGKGMAGVRRGSRCASAGV
------HCAGRRVACASAG-

Original motif     Consensus sequence: RAGKGMAGVRRGSRCASAGV Reverse complement motif     Consensus sequence: VCTSTGKSCMKBCTRCYCTK


Dataset #: 3
Motif ID: 53
Motif name: ESR1
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 4
Number of overlap: 13
Similarity score: 0.0328703

Alignment:
VDBHMAGGTCACCCTGACCY
---HCAGRRVACASAG----

Original motif     Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif     Consensus sequence: MGGTCAGGGTGACCTRDBHV


Dataset #: 4
Motif ID: 72
Motif name: CACTGTGrYrtCACAGTGswsCAcT
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 3
Number of overlap: 13
Similarity score: 0.0400966

Alignment:
AGTGSWSCACTGTGAMAMCACAGTG
----------HCAGRRVACASAG--

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG


Dataset #: 5
Motif ID: 90
Motif name: TFM2
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 3
Number of overlap: 13
Similarity score: 0.0435274

Alignment:
GCAGAKGSAGGABDGHDG
--HCAGRRVACASAG---

Original motif     Consensus sequence: CHHCHBTCCTSCYTCTGC Reverse complement motif     Consensus sequence: GCAGAKGSAGGABDGHDG


Dataset #: 3
Motif ID: 66
Motif name: CTCF
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 7
Number of overlap: 13
Similarity score: 0.0448341

Alignment:
YDRCCASYAGRKGGCRSYV
------HCAGRRVACASAG

Original motif     Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif     Consensus sequence: BMSMGCCYMCTKSTGGMHM


Dataset #: 4
Motif ID: 73
Motif name: TGGAGCACTGTGACAcCACAGTGg
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 4
Number of overlap: 13
Similarity score: 0.045698

Alignment:
CCACTGTGVTGTCACAGTGCTCCA
---CTSTGTBKMCTGH--------

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA


Dataset #: 3
Motif ID: 64
Motif name: PPARGRXRA
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 13
Similarity score: 0.0457253

Alignment:
BTRGGDCARAGGKCA
HCAGRRVACASAG--

Original motif     Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif     Consensus sequence: TGRCCTKTGHCCKAB


Dataset #: 3
Motif ID: 65
Motif name: Tcfcp2l1
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 1
Number of overlap: 13
Similarity score: 0.0477557

Alignment:
CKGGDTBDMMCTGG
CTSTGTBKMCTGH-

Original motif     Consensus sequence: CCAGYYHVADCCRG Reverse complement motif     Consensus sequence: CKGGDTBDMMCTGG


Dataset #: 5
Motif ID: 94
Motif name: TFM13
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 4
Number of overlap: 13
Similarity score: 0.0478998

Alignment:
WHAATTAAARAARAAAAAAA
----HCAGRRVACASAG---

Original motif     Consensus sequence: TTTTTTTKTTKTTTAATTHW Reverse complement motif     Consensus sequence: WHAATTAAARAARAAAAAAA


Dataset #: 5
Motif ID: 88
Motif name: TFF11
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 13
Similarity score: 0.048132

Alignment:
HVCDBBDBCAGCAG
-HCAGRRVACASAG

Original motif     Consensus sequence: CTGCTGBDBBDGBD Reverse complement motif     Consensus sequence: HVCDBBDBCAGCAG


Dataset #: 2 Motif ID: 8 Motif name: Motif 8

Original motif     Consensus sequence: HAAAAHAAARMAAA Reverse complement motif     Consensus sequence: TTTRKTTTHTTTTH

Best Matches for Motif ID 8 (Highest to Lowest)

Dataset #: 5
Motif ID: 94
Motif name: TFM13
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 6
Number of overlap: 14
Similarity score: 0.0333546

Alignment:
WHAATTAAARAARAAAAAAA
-----HAAAAHAAARMAAA-

Original motif     Consensus sequence: TTTTTTTKTTKTTTAATTHW Reverse complement motif     Consensus sequence: WHAATTAAARAARAAAAAAA


Dataset #: 5
Motif ID: 91
Motif name: TFM3
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 4
Number of overlap: 14
Similarity score: 0.0408482

Alignment:
BTTHAAAAAAYAAAAAAR
---HAAAAHAAARMAAA-

Original motif     Consensus sequence: KTTTTTTKTTTTTTDAAB Reverse complement motif     Consensus sequence: BTTHAAAAAAYAAAAAAR


Dataset #: 1
Motif ID: 3
Motif name: Motif 3
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 14
Similarity score: 0.0486607

Alignment:
AAAAAAAAAAAAAT
HAAAAHAAARMAAA

Original motif     Consensus sequence: AAAAAAAAAAAAAT Reverse complement motif     Consensus sequence: ATTTTTTTTTTTTT


Dataset #: 2
Motif ID: 37
Motif name: Motif 37
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 14
Similarity score: 0.0540179

Alignment:
TTTAATGTYTTTWA
TTTRKTTTHTTTTH

Original motif     Consensus sequence: TTTAATGTYTTTWA Reverse complement motif     Consensus sequence: TWAAAKACATTAAA


Dataset #: 5
Motif ID: 92
Motif name: TFM11
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 5
Number of overlap: 14
Similarity score: 0.0882898

Alignment:
TGTGTGDKTGTGTGTGTRTG
--TTTRKTTTHTTTTH----

Original motif     Consensus sequence: CAMACACACACAYDCACACA Reverse complement motif     Consensus sequence: TGTGTGDKTGTGTGTGTRTG


Dataset #: 5
Motif ID: 89
Motif name: TFM1
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 14
Similarity score: 0.0933036

Alignment:
CACACACACACWCACACA
HAAAAHAAARMAAA----

Original motif     Consensus sequence: CACACACACACWCACACA Reverse complement motif     Consensus sequence: TGTGTGWGTGTGTGTGTG


Dataset #: 2
Motif ID: 10
Motif name: Motif 10
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 14
Similarity score: 0.0942815

Alignment:
CASABACWSACACA
HAAAAHAAARMAAA

Original motif     Consensus sequence: CASABACWSACACA Reverse complement motif     Consensus sequence: TGTGTSWGTBTSTG


Dataset #: 5
Motif ID: 93
Motif name: TFM12
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 3
Number of overlap: 14
Similarity score: 0.096284

Alignment:
RAGKGMAGVRRGSRCASAGV
----HAAAAHAAARMAAA--

Original motif     Consensus sequence: RAGKGMAGVRRGSRCASAGV Reverse complement motif     Consensus sequence: VCTSTGKSCMKBCTRCYCTK


Dataset #: 2
Motif ID: 49
Motif name: Motif 49
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 2
Number of overlap: 13
Similarity score: 0.563221

Alignment:
-TAASTCTWTTTTAA
TTTRKTTTHTTTTH-

Original motif     Consensus sequence: TAASTCTWTTTTAA Reverse complement motif     Consensus sequence: TTAAAAWAGASTTA


Dataset #: 2
Motif ID: 19
Motif name: Motif 19
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 13
Similarity score: 0.572837

Alignment:
-TAGTTTYAKCTTT
TTTRKTTTHTTTTH

Original motif     Consensus sequence: AAAGRTMAAACTA Reverse complement motif     Consensus sequence: TAGTTTYAKCTTT


Dataset #: 2 Motif ID: 9 Motif name: Motif 9

Original motif     Consensus sequence: CWGAGCCAYCTYTC Reverse complement motif     Consensus sequence: GAKAGKTGGCTCWG

Best Matches for Motif ID 9 (Highest to Lowest)

Dataset #: 3
Motif ID: 66
Motif name: CTCF
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 14
Similarity score: 0.0474988

Alignment:
YDRCCASYAGRKGGCRSYV
-----GAKAGKTGGCTCWG

Original motif     Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif     Consensus sequence: BMSMGCCYMCTKSTGGMHM


Dataset #: 4
Motif ID: 73
Motif name: TGGAGCACTGTGACAcCACAGTGg
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 8
Number of overlap: 14
Similarity score: 0.0554531

Alignment:
CCACTGTGVTGTCACAGTGCTCCA
---GAKAGKTGGCTCWG-------

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA


Dataset #: 5
Motif ID: 93
Motif name: TFM12
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 4
Number of overlap: 14
Similarity score: 0.0576317

Alignment:
VCTSTGKSCMKBCTRCYCTK
---CWGAGCCAYCTYTC---

Original motif     Consensus sequence: RAGKGMAGVRRGSRCASAGV Reverse complement motif     Consensus sequence: VCTSTGKSCMKBCTRCYCTK


Dataset #: 4
Motif ID: 77
Motif name: AgTGCTCCACTGTGgTGTCACAgT
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 14
Similarity score: 0.0576632

Alignment:
ACTGTGACACCACAGTGGAGCACT
-CWGAGCCAYCTYTC---------

Original motif     Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif     Consensus sequence: ACTGTGACACCACAGTGGAGCACT


Dataset #: 4
Motif ID: 71
Motif name: AmTGTGACACCACAGT
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 14
Similarity score: 0.0578361

Alignment:
AMTGTGACACCACAGT
-CWGAGCCAYCTYTC-

Original motif     Consensus sequence: AMTGTGACACCACAGT Reverse complement motif     Consensus sequence: ACTGTGGTGTCACART


Dataset #: 4
Motif ID: 72
Motif name: CACTGTGrYrtCACAGTGswsCAcT
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 3
Number of overlap: 14
Similarity score: 0.065312

Alignment:
AGTGSWSCACTGTGAMAMCACAGTG
---------CWGAGCCAYCTYTC--

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG


Dataset #: 3
Motif ID: 59
Motif name: ESR2
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 14
Similarity score: 0.0658518

Alignment:
VHRGGTCABDBTGMCCTB
CWGAGCCAYCTYTC----

Original motif     Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif     Consensus sequence: BAGGYCABHBTGACCKHV


Dataset #: 3
Motif ID: 53
Motif name: ESR1
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 3
Number of overlap: 14
Similarity score: 0.0671359

Alignment:
MGGTCAGGGTGACCTRDBHV
----CWGAGCCAYCTYTC--

Original motif     Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif     Consensus sequence: MGGTCAGGGTGACCTRDBHV


Dataset #: 4
Motif ID: 67
Motif name: TgTGgTGTCACAGTGCTCC
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 7
Number of overlap: 13
Similarity score: 0.538291

Alignment:
GGAGCACTGTGACACCACA-
------CWGAGCCAYCTYTC

Original motif     Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif     Consensus sequence: GGAGCACTGTGACACCACA


Dataset #: 3
Motif ID: 65
Motif name: Tcfcp2l1
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 2
Number of overlap: 13
Similarity score: 0.560622

Alignment:
-CKGGDTBDMMCTGG
GAKAGKTGGCTCWG-

Original motif     Consensus sequence: CCAGYYHVADCCRG Reverse complement motif     Consensus sequence: CKGGDTBDMMCTGG


Dataset #: 2 Motif ID: 10 Motif name: Motif 10

Original motif     Consensus sequence: CASABACWSACACA Reverse complement motif     Consensus sequence: TGTGTSWGTBTSTG

Best Matches for Motif ID 10 (Highest to Lowest)

Dataset #: 5
Motif ID: 92
Motif name: TFM11
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 1
Number of overlap: 14
Similarity score: 0.0383879

Alignment:
TGTGTGDKTGTGTGTGTRTG
TGTGTSWGTBTSTG------

Original motif     Consensus sequence: CAMACACACACAYDCACACA Reverse complement motif     Consensus sequence: TGTGTGDKTGTGTGTGTRTG


Dataset #: 5
Motif ID: 89
Motif name: TFM1
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 5
Number of overlap: 14
Similarity score: 0.0411352

Alignment:
CACACACACACWCACACA
----CASABACWSACACA

Original motif     Consensus sequence: CACACACACACWCACACA Reverse complement motif     Consensus sequence: TGTGTGWGTGTGTGTGTG


Dataset #: 3
Motif ID: 57
Motif name: REST
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 3
Number of overlap: 14
Similarity score: 0.0803592

Alignment:
GGYGCTGTCCATGGTGCTGAA
-----TGTGTSWGTBTSTG--

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 3
Motif ID: 59
Motif name: ESR2
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 4
Number of overlap: 14
Similarity score: 0.0865284

Alignment:
VHRGGTCABDBTGMCCTB
-TGTGTSWGTBTSTG---

Original motif     Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif     Consensus sequence: BAGGYCABHBTGACCKHV


Dataset #: 4
Motif ID: 67
Motif name: TgTGgTGTCACAGTGCTCC
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 3
Number of overlap: 14
Similarity score: 0.0874787

Alignment:
TGTGGTGTCACAGTGCTCC
---TGTGTSWGTBTSTG--

Original motif     Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif     Consensus sequence: GGAGCACTGTGACACCACA


Dataset #: 5
Motif ID: 94
Motif name: TFM13
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 6
Number of overlap: 14
Similarity score: 0.0913053

Alignment:
TTTTTTTKTTKTTTAATTHW
-TGTGTSWGTBTSTG-----

Original motif     Consensus sequence: TTTTTTTKTTKTTTAATTHW Reverse complement motif     Consensus sequence: WHAATTAAARAARAAAAAAA


Dataset #: 4
Motif ID: 73
Motif name: TGGAGCACTGTGACAcCACAGTGg
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 4
Number of overlap: 14
Similarity score: 0.0930634

Alignment:
CCACTGTGVTGTCACAGTGCTCCA
-------TGTGTSWGTBTSTG---

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA


Dataset #: 2
Motif ID: 8
Motif name: Motif 8
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 14
Similarity score: 0.0933886

Alignment:
HAAAAHAAARMAAA
CASABACWSACACA

Original motif     Consensus sequence: HAAAAHAAARMAAA Reverse complement motif     Consensus sequence: TTTRKTTTHTTTTH


Dataset #: 5
Motif ID: 91
Motif name: TFM3
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 14
Similarity score: 0.0935906

Alignment:
KTTTTTTKTTTTTTDAAB
TGTGTSWGTBTSTG----

Original motif     Consensus sequence: KTTTTTTKTTTTTTDAAB Reverse complement motif     Consensus sequence: BTTHAAAAAAYAAAAAAR


Dataset #: 4
Motif ID: 77
Motif name: AgTGCTCCACTGTGgTGTCACAgT
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 11
Number of overlap: 14
Similarity score: 0.0939701

Alignment:
ACTGTGACACCACAGTGGAGCACT
----------CASABACWSACACA

Original motif     Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif     Consensus sequence: ACTGTGACACCACAGTGGAGCACT


Dataset #: 2 Motif ID: 11 Motif name: Motif 11

Original motif     Consensus sequence: AAAATKCTATT Reverse complement motif     Consensus sequence: AATAGYATTTT

Best Matches for Motif ID 11 (Highest to Lowest)

Dataset #: 2
Motif ID: 17
Motif name: Motif 17
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 1
Number of overlap: 11
Similarity score: 0.0795455

Alignment:
AAATAKATWTT
AAAATKCTATT

Original motif     Consensus sequence: AAWATRTATTT Reverse complement motif     Consensus sequence: AAATAKATWTT


Dataset #: 2
Motif ID: 29
Motif name: Motif 29
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0.0795455

Alignment:
AATCTGTTATT
AAAATKCTATT

Original motif     Consensus sequence: AATAACAGATT Reverse complement motif     Consensus sequence: AATCTGTTATT


Dataset #: 2
Motif ID: 49
Motif name: Motif 49
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 11
Similarity score: 0.0909091

Alignment:
TAASTCTWTTTTAA
-AATAGYATTTT--

Original motif     Consensus sequence: TAASTCTWTTTTAA Reverse complement motif     Consensus sequence: TTAAAAWAGASTTA


Dataset #: 2
Motif ID: 37
Motif name: Motif 37
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 4
Number of overlap: 11
Similarity score: 0.102273

Alignment:
TWAAAKACATTAAA
AAAATKCTATT---

Original motif     Consensus sequence: TTTAATGTYTTTWA Reverse complement motif     Consensus sequence: TWAAAKACATTAAA


Dataset #: 2
Motif ID: 13
Motif name: Motif 13
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 11
Similarity score: 0.102273

Alignment:
TGAAAATATGTT
-AAAATKCTATT

Original motif     Consensus sequence: AACATATTTTCA Reverse complement motif     Consensus sequence: TGAAAATATGTT


Dataset #: 2
Motif ID: 19
Motif name: Motif 19
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 11
Similarity score: 0.102273

Alignment:
TAGTTTYAKCTTT
-AATAGYATTTT-

Original motif     Consensus sequence: AAAGRTMAAACTA Reverse complement motif     Consensus sequence: TAGTTTYAKCTTT


Dataset #: 2
Motif ID: 16
Motif name: Motif 16
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 1
Number of overlap: 11
Similarity score: 0.102273

Alignment:
AAATGTGTTGT
AATAGYATTTT

Original motif     Consensus sequence: ACAACACATTT Reverse complement motif     Consensus sequence: AAATGTGTTGT


Dataset #: 1
Motif ID: 3
Motif name: Motif 3
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 4
Number of overlap: 11
Similarity score: 0.102273

Alignment:
ATTTTTTTTTTTTT
AATAGYATTTT---

Original motif     Consensus sequence: AAAAAAAAAAAAAT Reverse complement motif     Consensus sequence: ATTTTTTTTTTTTT


Dataset #: 2
Motif ID: 14
Motif name: Motif 14
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0.113636

Alignment:
AAAMATTGTTT
AAAATKCTATT

Original motif     Consensus sequence: AAAMATTGTTT Reverse complement motif     Consensus sequence: AAACAATYTTT


Dataset #: 2
Motif ID: 15
Motif name: Motif 15
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0.113636

Alignment:
TTYAAACATYTT
-AATAGYATTTT

Original motif     Consensus sequence: AAMATGTTTMAA Reverse complement motif     Consensus sequence: TTYAAACATYTT


Dataset #: 2 Motif ID: 12 Motif name: Motif 12

Original motif     Consensus sequence: TGAAAATSCTT Reverse complement motif     Consensus sequence: AAGSATTTTCA

Best Matches for Motif ID 12 (Highest to Lowest)

Dataset #: 2
Motif ID: 13
Motif name: Motif 13
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 11
Similarity score: 0.0681818

Alignment:
AACATATTTTCA
-AAGSATTTTCA

Original motif     Consensus sequence: AACATATTTTCA Reverse complement motif     Consensus sequence: TGAAAATATGTT


Dataset #: 2
Motif ID: 37
Motif name: Motif 37
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 4
Number of overlap: 11
Similarity score: 0.0909091

Alignment:
TTTAATGTYTTTWA
---AAGSATTTTCA

Original motif     Consensus sequence: TTTAATGTYTTTWA Reverse complement motif     Consensus sequence: TWAAAKACATTAAA


Dataset #: 2
Motif ID: 15
Motif name: Motif 15
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 2
Number of overlap: 11
Similarity score: 0.102273

Alignment:
AAMATGTTTMAA
AAGSATTTTCA-

Original motif     Consensus sequence: AAMATGTTTMAA Reverse complement motif     Consensus sequence: TTYAAACATYTT


Dataset #: 2
Motif ID: 14
Motif name: Motif 14
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0.102273

Alignment:
AAACAATYTTT
TGAAAATSCTT

Original motif     Consensus sequence: AAAMATTGTTT Reverse complement motif     Consensus sequence: AAACAATYTTT


Dataset #: 4
Motif ID: 73
Motif name: TGGAGCACTGTGACAcCACAGTGg
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 3
Number of overlap: 11
Similarity score: 0.111179

Alignment:
TGGAGCACTGTGACAVCACAGTGG
--AAGSATTTTCA-----------

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA


Dataset #: 4
Motif ID: 67
Motif name: TgTGgTGTCACAGTGCTCC
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 8
Number of overlap: 11
Similarity score: 0.113005

Alignment:
TGTGGTGTCACAGTGCTCC
-------TGAAAATSCTT-

Original motif     Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif     Consensus sequence: GGAGCACTGTGACACCACA


Dataset #: 2
Motif ID: 49
Motif name: Motif 49
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 3
Number of overlap: 11
Similarity score: 0.113636

Alignment:
TTAAAAWAGASTTA
-TGAAAATSCTT--

Original motif     Consensus sequence: TAASTCTWTTTTAA Reverse complement motif     Consensus sequence: TTAAAAWAGASTTA


Dataset #: 2
Motif ID: 47
Motif name: Motif 47
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 1
Number of overlap: 11
Similarity score: 0.113636

Alignment:
TGCCTTTCYTT
TGAAAATSCTT

Original motif     Consensus sequence: AAKGAAAGGCA Reverse complement motif     Consensus sequence: TGCCTTTCYTT


Dataset #: 2
Motif ID: 50
Motif name: Motif 50
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 11
Similarity score: 0.113636

Alignment:
ATAGGTTTAGYATA
-AAGSATTTTCA--

Original motif     Consensus sequence: ATAGGTTTAGYATA Reverse complement motif     Consensus sequence: TATKCTAAACCTAT


Dataset #: 2
Motif ID: 28
Motif name: Motif 28
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0.125

Alignment:
TTWATGWCTTT
TGAAAATSCTT

Original motif     Consensus sequence: AAAGWCATWAA Reverse complement motif     Consensus sequence: TTWATGWCTTT


Dataset #: 2 Motif ID: 13 Motif name: Motif 13

Original motif     Consensus sequence: AACATATTTTCA Reverse complement motif     Consensus sequence: TGAAAATATGTT

Best Matches for Motif ID 13 (Highest to Lowest)

Dataset #: 2
Motif ID: 15
Motif name: Motif 15
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 12
Similarity score: 0.0729167

Alignment:
AAMATGTTTMAA
AACATATTTTCA

Original motif     Consensus sequence: AAMATGTTTMAA Reverse complement motif     Consensus sequence: TTYAAACATYTT


Dataset #: 2
Motif ID: 49
Motif name: Motif 49
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 12
Similarity score: 0.09375

Alignment:
TAASTCTWTTTTAA
--AACATATTTTCA

Original motif     Consensus sequence: TAASTCTWTTTTAA Reverse complement motif     Consensus sequence: TTAAAAWAGASTTA


Dataset #: 2
Motif ID: 37
Motif name: Motif 37
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 12
Similarity score: 0.104167

Alignment:
TWAAAKACATTAAA
-AACATATTTTCA-

Original motif     Consensus sequence: TTTAATGTYTTTWA Reverse complement motif     Consensus sequence: TWAAAKACATTAAA


Dataset #: 4
Motif ID: 77
Motif name: AgTGCTCCACTGTGgTGTCACAgT
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 9
Number of overlap: 12
Similarity score: 0.120305

Alignment:
AGTGCTCCACTGTGGTGTCACAGT
--------AACATATTTTCA----

Original motif     Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif     Consensus sequence: ACTGTGACACCACAGTGGAGCACT


Dataset #: 5
Motif ID: 89
Motif name: TFM1
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 5
Number of overlap: 12
Similarity score: 0.12128

Alignment:
CACACACACACWCACACA
--AACATATTTTCA----

Original motif     Consensus sequence: CACACACACACWCACACA Reverse complement motif     Consensus sequence: TGTGTGWGTGTGTGTGTG


Dataset #: 4
Motif ID: 71
Motif name: AmTGTGACACCACAGT
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 5
Number of overlap: 12
Similarity score: 0.12207

Alignment:
AMTGTGACACCACAGT
----TGAAAATATGTT

Original motif     Consensus sequence: AMTGTGACACCACAGT Reverse complement motif     Consensus sequence: ACTGTGGTGTCACART


Dataset #: 4
Motif ID: 73
Motif name: TGGAGCACTGTGACAcCACAGTGg
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 11
Number of overlap: 12
Similarity score: 0.122466

Alignment:
CCACTGTGVTGTCACAGTGCTCCA
--AACATATTTTCA----------

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA


Dataset #: 5
Motif ID: 92
Motif name: TFM11
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 5
Number of overlap: 12
Similarity score: 0.123397

Alignment:
CAMACACACACAYDCACACA
----AACATATTTTCA----

Original motif     Consensus sequence: CAMACACACACAYDCACACA Reverse complement motif     Consensus sequence: TGTGTGDKTGTGTGTGTRTG


Dataset #: 4
Motif ID: 72
Motif name: CACTGTGrYrtCACAGTGswsCAcT
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 2
Number of overlap: 12
Similarity score: 0.124008

Alignment:
AGTGSWSCACTGTGAMAMCACAGTG
------------TGAAAATATGTT-

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG


Dataset #: 1
Motif ID: 3
Motif name: Motif 3
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 12
Similarity score: 0.125

Alignment:
AAAAAAAAAAAAAT
TGAAAATATGTT--

Original motif     Consensus sequence: AAAAAAAAAAAAAT Reverse complement motif     Consensus sequence: ATTTTTTTTTTTTT


Dataset #: 2 Motif ID: 14 Motif name: Motif 14

Original motif     Consensus sequence: AAAMATTGTTT Reverse complement motif     Consensus sequence: AAACAATYTTT

Best Matches for Motif ID 14 (Highest to Lowest)

Dataset #: 2
Motif ID: 49
Motif name: Motif 49
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0.0700758

Alignment:
TTAAAAWAGASTTA
---AAAMATTGTTT

Original motif     Consensus sequence: TAASTCTWTTTTAA Reverse complement motif     Consensus sequence: TTAAAAWAGASTTA


Dataset #: 2
Motif ID: 17
Motif name: Motif 17
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 11
Similarity score: 0.0700758

Alignment:
AAWATRTATTT
AAAMATTGTTT

Original motif     Consensus sequence: AAWATRTATTT Reverse complement motif     Consensus sequence: AAATAKATWTT


Dataset #: 2
Motif ID: 13
Motif name: Motif 13
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 1
Number of overlap: 11
Similarity score: 0.0814394

Alignment:
TGAAAATATGTT
AAAMATTGTTT-

Original motif     Consensus sequence: AACATATTTTCA Reverse complement motif     Consensus sequence: TGAAAATATGTT


Dataset #: 2
Motif ID: 12
Motif name: Motif 12
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 1
Number of overlap: 11
Similarity score: 0.0814394

Alignment:
AAGSATTTTCA
AAAMATTGTTT

Original motif     Consensus sequence: TGAAAATSCTT Reverse complement motif     Consensus sequence: AAGSATTTTCA


Dataset #: 2
Motif ID: 29
Motif name: Motif 29
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0.0814394

Alignment:
AATAACAGATT
AAAMATTGTTT

Original motif     Consensus sequence: AATAACAGATT Reverse complement motif     Consensus sequence: AATCTGTTATT


Dataset #: 1
Motif ID: 3
Motif name: Motif 3
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0.092803

Alignment:
ATTTTTTTTTTTTT
---AAAMATTGTTT

Original motif     Consensus sequence: AAAAAAAAAAAAAT Reverse complement motif     Consensus sequence: ATTTTTTTTTTTTT


Dataset #: 2
Motif ID: 11
Motif name: Motif 11
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0.092803

Alignment:
AAAATKCTATT
AAAMATTGTTT

Original motif     Consensus sequence: AAAATKCTATT Reverse complement motif     Consensus sequence: AATAGYATTTT


Dataset #: 2
Motif ID: 33
Motif name: Motif 33
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 11
Similarity score: 0.092803

Alignment:
ATTTATTGCTA
AAAMATTGTTT

Original motif     Consensus sequence: ATTTATTGCTA Reverse complement motif     Consensus sequence: TAGCAATAAAT


Dataset #: 2
Motif ID: 16
Motif name: Motif 16
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0.092803

Alignment:
AAATGTGTTGT
AAAMATTGTTT

Original motif     Consensus sequence: ACAACACATTT Reverse complement motif     Consensus sequence: AAATGTGTTGT


Dataset #: 2
Motif ID: 37
Motif name: Motif 37
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 11
Similarity score: 0.092803

Alignment:
TTTAATGTYTTTWA
-AAACAATYTTT--

Original motif     Consensus sequence: TTTAATGTYTTTWA Reverse complement motif     Consensus sequence: TWAAAKACATTAAA


Dataset #: 2 Motif ID: 15 Motif name: Motif 15

Original motif     Consensus sequence: AAMATGTTTMAA Reverse complement motif     Consensus sequence: TTYAAACATYTT

Best Matches for Motif ID 15 (Highest to Lowest)

Dataset #: 2
Motif ID: 13
Motif name: Motif 13
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 12
Similarity score: 0.0479167

Alignment:
AACATATTTTCA
AAMATGTTTMAA

Original motif     Consensus sequence: AACATATTTTCA Reverse complement motif     Consensus sequence: TGAAAATATGTT


Dataset #: 2
Motif ID: 37
Motif name: Motif 37
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 3
Number of overlap: 12
Similarity score: 0.06875

Alignment:
TTTAATGTYTTTWA
TTYAAACATYTT--

Original motif     Consensus sequence: TTTAATGTYTTTWA Reverse complement motif     Consensus sequence: TWAAAKACATTAAA


Dataset #: 2
Motif ID: 49
Motif name: Motif 49
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 3
Number of overlap: 12
Similarity score: 0.0791667

Alignment:
TTAAAAWAGASTTA
TTYAAACATYTT--

Original motif     Consensus sequence: TAASTCTWTTTTAA Reverse complement motif     Consensus sequence: TTAAAAWAGASTTA


Dataset #: 5
Motif ID: 91
Motif name: TFM3
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 12
Similarity score: 0.0830729

Alignment:
BTTHAAAAAAYAAAAAAR
-TTYAAACATYTT-----

Original motif     Consensus sequence: KTTTTTTKTTTTTTDAAB Reverse complement motif     Consensus sequence: BTTHAAAAAAYAAAAAAR


Dataset #: 5
Motif ID: 94
Motif name: TFM13
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 8
Number of overlap: 12
Similarity score: 0.0970238

Alignment:
WHAATTAAARAARAAAAAAA
-------AAMATGTTTMAA-

Original motif     Consensus sequence: TTTTTTTKTTKTTTAATTHW Reverse complement motif     Consensus sequence: WHAATTAAARAARAAAAAAA


Dataset #: 3
Motif ID: 60
Motif name: NR1H2RXRA
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 5
Number of overlap: 12
Similarity score: 0.0983333

Alignment:
AAAGGTCAAAGGTCAAC
----TTYAAACATYTT-

Original motif     Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif     Consensus sequence: GTTGACCTTTGACCTTT


Dataset #: 1
Motif ID: 3
Motif name: Motif 3
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 12
Similarity score: 0.1

Alignment:
ATTTTTTTTTTTTT
--TTYAAACATYTT

Original motif     Consensus sequence: AAAAAAAAAAAAAT Reverse complement motif     Consensus sequence: ATTTTTTTTTTTTT


Dataset #: 2
Motif ID: 17
Motif name: Motif 17
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 11
Similarity score: 0.565909

Alignment:
AAWATRTATTT-
AAMATGTTTMAA

Original motif     Consensus sequence: AAWATRTATTT Reverse complement motif     Consensus sequence: AAATAKATWTT


Dataset #: 2
Motif ID: 50
Motif name: Motif 50
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 4
Number of overlap: 11
Similarity score: 0.565909

Alignment:
TATKCTAAACCTAT-
---TTYAAACATYTT

Original motif     Consensus sequence: ATAGGTTTAGYATA Reverse complement motif     Consensus sequence: TATKCTAAACCTAT


Dataset #: 2
Motif ID: 16
Motif name: Motif 16
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0.577273

Alignment:
-AAATGTGTTGT
AAMATGTTTMAA

Original motif     Consensus sequence: ACAACACATTT Reverse complement motif     Consensus sequence: AAATGTGTTGT


Dataset #: 2 Motif ID: 16 Motif name: Motif 16

Original motif     Consensus sequence: ACAACACATTT Reverse complement motif     Consensus sequence: AAATGTGTTGT

Best Matches for Motif ID 16 (Highest to Lowest)

Dataset #: 4
Motif ID: 77
Motif name: AgTGCTCCACTGTGgTGTCACAgT
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 8
Number of overlap: 11
Similarity score: 0.074904

Alignment:
AGTGCTCCACTGTGGTGTCACAGT
-------AAATGTGTTGT------

Original motif     Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif     Consensus sequence: ACTGTGACACCACAGTGGAGCACT


Dataset #: 4
Motif ID: 73
Motif name: TGGAGCACTGTGACAcCACAGTGg
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 2
Number of overlap: 11
Similarity score: 0.0795455

Alignment:
TGGAGCACTGTGACAVCACAGTGG
------------ACAACACATTT-

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA


Dataset #: 2
Motif ID: 37
Motif name: Motif 37
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 11
Similarity score: 0.0795455

Alignment:
TWAAAKACATTAAA
-ACAACACATTT--

Original motif     Consensus sequence: TTTAATGTYTTTWA Reverse complement motif     Consensus sequence: TWAAAKACATTAAA


Dataset #: 4
Motif ID: 72
Motif name: CACTGTGrYrtCACAGTGswsCAcT
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0.0891053

Alignment:
AGTGSWSCACTGTGAMAMCACAGTG
--------------ACAACACATTT

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG


Dataset #: 2
Motif ID: 49
Motif name: Motif 49
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 2
Number of overlap: 11
Similarity score: 0.0909091

Alignment:
TTAAAAWAGASTTA
--ACAACACATTT-

Original motif     Consensus sequence: TAASTCTWTTTTAA Reverse complement motif     Consensus sequence: TTAAAAWAGASTTA


Dataset #: 2
Motif ID: 17
Motif name: Motif 17
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0.0909091

Alignment:
AAWATRTATTT
ACAACACATTT

Original motif     Consensus sequence: AAWATRTATTT Reverse complement motif     Consensus sequence: AAATAKATWTT


Dataset #: 2
Motif ID: 15
Motif name: Motif 15
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 11
Similarity score: 0.102273

Alignment:
TTYAAACATYTT
-ACAACACATTT

Original motif     Consensus sequence: AAMATGTTTMAA Reverse complement motif     Consensus sequence: TTYAAACATYTT


Dataset #: 2
Motif ID: 50
Motif name: Motif 50
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 4
Number of overlap: 11
Similarity score: 0.102273

Alignment:
ATAGGTTTAGYATA
AAATGTGTTGT---

Original motif     Consensus sequence: ATAGGTTTAGYATA Reverse complement motif     Consensus sequence: TATKCTAAACCTAT


Dataset #: 2
Motif ID: 11
Motif name: Motif 11
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0.102273

Alignment:
AATAGYATTTT
AAATGTGTTGT

Original motif     Consensus sequence: AAAATKCTATT Reverse complement motif     Consensus sequence: AATAGYATTTT


Dataset #: 1
Motif ID: 3
Motif name: Motif 3
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 4
Number of overlap: 11
Similarity score: 0.113636

Alignment:
AAAAAAAAAAAAAT
---ACAACACATTT

Original motif     Consensus sequence: AAAAAAAAAAAAAT Reverse complement motif     Consensus sequence: ATTTTTTTTTTTTT


Dataset #: 2 Motif ID: 17 Motif name: Motif 17

Original motif     Consensus sequence: AAWATRTATTT Reverse complement motif     Consensus sequence: AAATAKATWTT

Best Matches for Motif ID 17 (Highest to Lowest)

Dataset #: 2
Motif ID: 13
Motif name: Motif 13
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0.0795455

Alignment:
TGAAAATATGTT
-AAATAKATWTT

Original motif     Consensus sequence: AACATATTTTCA Reverse complement motif     Consensus sequence: TGAAAATATGTT


Dataset #: 2
Motif ID: 11
Motif name: Motif 11
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 1
Number of overlap: 11
Similarity score: 0.0795455

Alignment:
AATAGYATTTT
AAWATRTATTT

Original motif     Consensus sequence: AAAATKCTATT Reverse complement motif     Consensus sequence: AATAGYATTTT


Dataset #: 2
Motif ID: 49
Motif name: Motif 49
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 3
Number of overlap: 11
Similarity score: 0.0795455

Alignment:
TAASTCTWTTTTAA
-AAATAKATWTT--

Original motif     Consensus sequence: TAASTCTWTTTTAA Reverse complement motif     Consensus sequence: TTAAAAWAGASTTA


Dataset #: 2
Motif ID: 37
Motif name: Motif 37
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 2
Number of overlap: 11
Similarity score: 0.0909091

Alignment:
TWAAAKACATTAAA
--AAATAKATWTT-

Original motif     Consensus sequence: TTTAATGTYTTTWA Reverse complement motif     Consensus sequence: TWAAAKACATTAAA


Dataset #: 2
Motif ID: 29
Motif name: Motif 29
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 1
Number of overlap: 11
Similarity score: 0.0909091

Alignment:
AATCTGTTATT
AAWATRTATTT

Original motif     Consensus sequence: AATAACAGATT Reverse complement motif     Consensus sequence: AATCTGTTATT


Dataset #: 2
Motif ID: 28
Motif name: Motif 28
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0.0909091

Alignment:
TTWATGWCTTT
AAWATRTATTT

Original motif     Consensus sequence: AAAGWCATWAA Reverse complement motif     Consensus sequence: TTWATGWCTTT


Dataset #: 2
Motif ID: 14
Motif name: Motif 14
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 11
Similarity score: 0.0909091

Alignment:
AAAMATTGTTT
AAWATRTATTT

Original motif     Consensus sequence: AAAMATTGTTT Reverse complement motif     Consensus sequence: AAACAATYTTT


Dataset #: 2
Motif ID: 15
Motif name: Motif 15
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 11
Similarity score: 0.0909091

Alignment:
AAMATGTTTMAA
AAWATRTATTT-

Original motif     Consensus sequence: AAMATGTTTMAA Reverse complement motif     Consensus sequence: TTYAAACATYTT


Dataset #: 2
Motif ID: 16
Motif name: Motif 16
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 11
Similarity score: 0.0909091

Alignment:
ACAACACATTT
AAWATRTATTT

Original motif     Consensus sequence: ACAACACATTT Reverse complement motif     Consensus sequence: AAATGTGTTGT


Dataset #: 1
Motif ID: 3
Motif name: Motif 3
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 11
Similarity score: 0.102273

Alignment:
AAAAAAAAAAAAAT
AAATAKATWTT---

Original motif     Consensus sequence: AAAAAAAAAAAAAT Reverse complement motif     Consensus sequence: ATTTTTTTTTTTTT


Dataset #: 2 Motif ID: 18 Motif name: Motif 18

Original motif     Consensus sequence: TAATKATATAA Reverse complement motif     Consensus sequence: TTATATYATTA

Best Matches for Motif ID 18 (Highest to Lowest)

Dataset #: 2
Motif ID: 37
Motif name: Motif 37
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 3
Number of overlap: 11
Similarity score: 0.0482955

Alignment:
TTTAATGTYTTTWA
--TTATATYATTA-

Original motif     Consensus sequence: TTTAATGTYTTTWA Reverse complement motif     Consensus sequence: TWAAAKACATTAAA


Dataset #: 5
Motif ID: 94
Motif name: TFM13
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 9
Number of overlap: 11
Similarity score: 0.0629058

Alignment:
WHAATTAAARAARAAAAAAA
-TAATKATATAA--------

Original motif     Consensus sequence: TTTTTTTKTTKTTTAATTHW Reverse complement motif     Consensus sequence: WHAATTAAARAARAAAAAAA


Dataset #: 2
Motif ID: 33
Motif name: Motif 33
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0.0710227

Alignment:
ATTTATTGCTA
TTATATYATTA

Original motif     Consensus sequence: ATTTATTGCTA Reverse complement motif     Consensus sequence: TAGCAATAAAT


Dataset #: 1
Motif ID: 3
Motif name: Motif 3
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0.0710227

Alignment:
ATTTTTTTTTTTTT
---TTATATYATTA

Original motif     Consensus sequence: AAAAAAAAAAAAAT Reverse complement motif     Consensus sequence: ATTTTTTTTTTTTT


Dataset #: 2
Motif ID: 13
Motif name: Motif 13
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 11
Similarity score: 0.0710227

Alignment:
TGAAAATATGTT
-TAATKATATAA

Original motif     Consensus sequence: AACATATTTTCA Reverse complement motif     Consensus sequence: TGAAAATATGTT


Dataset #: 2
Motif ID: 20
Motif name: Motif 20
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 2
Number of overlap: 11
Similarity score: 0.0710227

Alignment:
TWTTGACAYAGA
TAATKATATAA-

Original motif     Consensus sequence: TCTKTGTCAAWA Reverse complement motif     Consensus sequence: TWTTGACAYAGA


Dataset #: 2
Motif ID: 27
Motif name: Motif 27
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 2
Number of overlap: 11
Similarity score: 0.0710227

Alignment:
ATYAATGAAWACAT
--TAATKATATAA-

Original motif     Consensus sequence: ATGTWTTCATTMAT Reverse complement motif     Consensus sequence: ATYAATGAAWACAT


Dataset #: 5
Motif ID: 91
Motif name: TFM3
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 6
Number of overlap: 11
Similarity score: 0.0752841

Alignment:
KTTTTTTKTTTTTTDAAB
-----TTATATYATTA--

Original motif     Consensus sequence: KTTTTTTKTTTTTTDAAB Reverse complement motif     Consensus sequence: BTTHAAAAAAYAAAAAAR


Dataset #: 2
Motif ID: 8
Motif name: Motif 8
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 11
Similarity score: 0.0778409

Alignment:
TTTRKTTTHTTTTH
-TTATATYATTA--

Original motif     Consensus sequence: HAAAAHAAARMAAA Reverse complement motif     Consensus sequence: TTTRKTTTHTTTTH


Dataset #: 2
Motif ID: 49
Motif name: Motif 49
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 11
Similarity score: 0.0823864

Alignment:
TAASTCTWTTTTAA
TAATKATATAA---

Original motif     Consensus sequence: TAASTCTWTTTTAA Reverse complement motif     Consensus sequence: TTAAAAWAGASTTA


Dataset #: 2 Motif ID: 19 Motif name: Motif 19

Original motif     Consensus sequence: AAAGRTMAAACTA Reverse complement motif     Consensus sequence: TAGTTTYAKCTTT

Best Matches for Motif ID 19 (Highest to Lowest)

Dataset #: 2
Motif ID: 50
Motif name: Motif 50
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 13
Similarity score: 0.0865385

Alignment:
ATAGGTTTAGYATA
-TAGTTTYAKCTTT

Original motif     Consensus sequence: ATAGGTTTAGYATA Reverse complement motif     Consensus sequence: TATKCTAAACCTAT


Dataset #: 3
Motif ID: 60
Motif name: NR1H2RXRA
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 13
Similarity score: 0.0938462

Alignment:
AAAGGTCAAAGGTCAAC
AAAGRTMAAACTA----

Original motif     Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif     Consensus sequence: GTTGACCTTTGACCTTT


Dataset #: 1
Motif ID: 3
Motif name: Motif 3
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 2
Number of overlap: 13
Similarity score: 0.0961538

Alignment:
AAAAAAAAAAAAAT
AAAGRTMAAACTA-

Original motif     Consensus sequence: AAAAAAAAAAAAAT Reverse complement motif     Consensus sequence: ATTTTTTTTTTTTT


Dataset #: 2
Motif ID: 8
Motif name: Motif 8
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 2
Number of overlap: 13
Similarity score: 0.100962

Alignment:
HAAAAHAAARMAAA
AAAGRTMAAACTA-

Original motif     Consensus sequence: HAAAAHAAARMAAA Reverse complement motif     Consensus sequence: TTTRKTTTHTTTTH


Dataset #: 5
Motif ID: 94
Motif name: TFM13
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 7
Number of overlap: 13
Similarity score: 0.101648

Alignment:
WHAATTAAARAARAAAAAAA
------AAAGRTMAAACTA-

Original motif     Consensus sequence: TTTTTTTKTTKTTTAATTHW Reverse complement motif     Consensus sequence: WHAATTAAARAARAAAAAAA


Dataset #: 5
Motif ID: 91
Motif name: TFM3
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 13
Similarity score: 0.110577

Alignment:
BTTHAAAAAAYAAAAAAR
-----AAAGRTMAAACTA

Original motif     Consensus sequence: KTTTTTTKTTTTTTDAAB Reverse complement motif     Consensus sequence: BTTHAAAAAAYAAAAAAR


Dataset #: 2
Motif ID: 9
Motif name: Motif 9
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 2
Number of overlap: 13
Similarity score: 0.125

Alignment:
GAKAGKTGGCTCWG
AAAGRTMAAACTA-

Original motif     Consensus sequence: CWGAGCCAYCTYTC Reverse complement motif     Consensus sequence: GAKAGKTGGCTCWG


Dataset #: 2
Motif ID: 49
Motif name: Motif 49
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 2
Number of overlap: 13
Similarity score: 0.125

Alignment:
TAASTCTWTTTTAA
TAGTTTYAKCTTT-

Original motif     Consensus sequence: TAASTCTWTTTTAA Reverse complement motif     Consensus sequence: TTAAAAWAGASTTA


Dataset #: 2
Motif ID: 27
Motif name: Motif 27
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 13
Similarity score: 0.125

Alignment:
ATGTWTTCATTMAT
-TAGTTTYAKCTTT

Original motif     Consensus sequence: ATGTWTTCATTMAT Reverse complement motif     Consensus sequence: ATYAATGAAWACAT


Dataset #: 2
Motif ID: 26
Motif name: Motif 26
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 3
Number of overlap: 12
Similarity score: 0.614583

Alignment:
TTTATGGTGAGCAT-
--TAGTTTYAKCTTT

Original motif     Consensus sequence: TTTATGGTGAGCAT Reverse complement motif     Consensus sequence: ATGCTCACCATAAA


Dataset #: 2 Motif ID: 20 Motif name: Motif 20

Original motif     Consensus sequence: TCTKTGTCAAWA Reverse complement motif     Consensus sequence: TWTTGACAYAGA

Best Matches for Motif ID 20 (Highest to Lowest)

Dataset #: 4
Motif ID: 73
Motif name: TGGAGCACTGTGACAcCACAGTGg
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 7
Number of overlap: 12
Similarity score: 0.100225

Alignment:
TGGAGCACTGTGACAVCACAGTGG
------TCTKTGTCAAWA------

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA


Dataset #: 4
Motif ID: 72
Motif name: CACTGTGrYrtCACAGTGswsCAcT
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 9
Number of overlap: 12
Similarity score: 0.100694

Alignment:
AGTGSWSCACTGTGAMAMCACAGTG
--------TCTKTGTCAAWA-----

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG


Dataset #: 4
Motif ID: 67
Motif name: TgTGgTGTCACAGTGCTCC
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 3
Number of overlap: 12
Similarity score: 0.102141

Alignment:
TGTGGTGTCACAGTGCTCC
--TWTTGACAYAGA-----

Original motif     Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif     Consensus sequence: GGAGCACTGTGACACCACA


Dataset #: 4
Motif ID: 77
Motif name: AgTGCTCCACTGTGgTGTCACAgT
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 13
Number of overlap: 12
Similarity score: 0.103433

Alignment:
AGTGCTCCACTGTGGTGTCACAGT
------------TWTTGACAYAGA

Original motif     Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif     Consensus sequence: ACTGTGACACCACAGTGGAGCACT


Dataset #: 4
Motif ID: 71
Motif name: AmTGTGACACCACAGT
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 12
Similarity score: 0.104492

Alignment:
AMTGTGACACCACAGT
TCTKTGTCAAWA----

Original motif     Consensus sequence: AMTGTGACACCACAGT Reverse complement motif     Consensus sequence: ACTGTGGTGTCACART


Dataset #: 5
Motif ID: 91
Motif name: TFM3
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 3
Number of overlap: 12
Similarity score: 0.11849

Alignment:
KTTTTTTKTTTTTTDAAB
----TCTKTGTCAAWA--

Original motif     Consensus sequence: KTTTTTTKTTTTTTDAAB Reverse complement motif     Consensus sequence: BTTHAAAAAAYAAAAAAR


Dataset #: 5
Motif ID: 94
Motif name: TFM13
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 8
Number of overlap: 12
Similarity score: 0.119048

Alignment:
TTTTTTTKTTKTTTAATTHW
-------TCTKTGTCAAWA-

Original motif     Consensus sequence: TTTTTTTKTTKTTTAATTHW Reverse complement motif     Consensus sequence: WHAATTAAARAARAAAAAAA


Dataset #: 3
Motif ID: 64
Motif name: PPARGRXRA
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 4
Number of overlap: 12
Similarity score: 0.121043

Alignment:
TGRCCTKTGHCCKAB
---TCTKTGTCAAWA

Original motif     Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif     Consensus sequence: TGRCCTKTGHCCKAB


Dataset #: 3
Motif ID: 60
Motif name: NR1H2RXRA
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 12
Similarity score: 0.121667

Alignment:
GTTGACCTTTGACCTTT
-----TCTKTGTCAAWA

Original motif     Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif     Consensus sequence: GTTGACCTTTGACCTTT


Dataset #: 2
Motif ID: 37
Motif name: Motif 37
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 12
Similarity score: 0.125

Alignment:
TWAAAKACATTAAA
-TWTTGACAYAGA-

Original motif     Consensus sequence: TTTAATGTYTTTWA Reverse complement motif     Consensus sequence: TWAAAKACATTAAA


Dataset #: 2 Motif ID: 21 Motif name: Motif 21

Original motif     Consensus sequence: CTTCTGACCTC Reverse complement motif     Consensus sequence: GAGGTCAGAAG

Best Matches for Motif ID 21 (Highest to Lowest)

Dataset #: 3
Motif ID: 60
Motif name: NR1H2RXRA
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 11
Similarity score: 0.0348052

Alignment:
AAAGGTCAAAGGTCAAC
-GAGGTCAGAAG-----

Original motif     Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif     Consensus sequence: GTTGACCTTTGACCTTT


Dataset #: 3
Motif ID: 64
Motif name: PPARGRXRA
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 11
Similarity score: 0.0792232

Alignment:
BTRGGDCARAGGKCA
-GAGGTCAGAAG---

Original motif     Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif     Consensus sequence: TGRCCTKTGHCCKAB


Dataset #: 2
Motif ID: 26
Motif name: Motif 26
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 4
Number of overlap: 11
Similarity score: 0.0793506

Alignment:
ATGCTCACCATAAA
CTTCTGACCTC---

Original motif     Consensus sequence: TTTATGGTGAGCAT Reverse complement motif     Consensus sequence: ATGCTCACCATAAA


Dataset #: 2
Motif ID: 28
Motif name: Motif 28
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0.0793506

Alignment:
TTWATGWCTTT
CTTCTGACCTC

Original motif     Consensus sequence: AAAGWCATWAA Reverse complement motif     Consensus sequence: TTWATGWCTTT


Dataset #: 2
Motif ID: 19
Motif name: Motif 19
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 11
Similarity score: 0.0793506

Alignment:
TAGTTTYAKCTTT
-CTTCTGACCTC-

Original motif     Consensus sequence: AAAGRTMAAACTA Reverse complement motif     Consensus sequence: TAGTTTYAKCTTT


Dataset #: 2
Motif ID: 25
Motif name: Motif 25
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 2
Number of overlap: 11
Similarity score: 0.0793506

Alignment:
CTGCTTTCCMAA
CTTCTGACCTC-

Original motif     Consensus sequence: CTGCTTTCCMAA Reverse complement motif     Consensus sequence: TTYGGAAAGCAG


Dataset #: 3
Motif ID: 59
Motif name: ESR2
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 2
Number of overlap: 11
Similarity score: 0.0794143

Alignment:
BAGGYCABHBTGACCKHV
------CTTCTGACCTC-

Original motif     Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif     Consensus sequence: BAGGYCABHBTGACCKHV


Dataset #: 4
Motif ID: 77
Motif name: AgTGCTCCACTGTGgTGTCACAgT
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 14
Number of overlap: 11
Similarity score: 0.0799909

Alignment:
ACTGTGACACCACAGTGGAGCACT
CTTCTGACCTC-------------

Original motif     Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif     Consensus sequence: ACTGTGACACCACAGTGGAGCACT


Dataset #: 4
Motif ID: 71
Motif name: AmTGTGACACCACAGT
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0.0800609

Alignment:
ACTGTGGTGTCACART
-----GAGGTCAGAAG

Original motif     Consensus sequence: AMTGTGACACCACAGT Reverse complement motif     Consensus sequence: ACTGTGGTGTCACART


Dataset #: 3
Motif ID: 57
Motif name: REST
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 11
Similarity score: 0.0877439

Alignment:
GGYGCTGTCCATGGTGCTGAA
-CTTCTGACCTC---------

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 2 Motif ID: 22 Motif name: Motif 22

Original motif     Consensus sequence: CAAAGTCCAGC Reverse complement motif     Consensus sequence: GCTGGACTTTG

Best Matches for Motif ID 22 (Highest to Lowest)

Dataset #: 3
Motif ID: 60
Motif name: NR1H2RXRA
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 7
Number of overlap: 11
Similarity score: 0.0763636

Alignment:
AAAGGTCAAAGGTCAAC
------CAAAGTCCAGC

Original motif     Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif     Consensus sequence: GTTGACCTTTGACCTTT


Dataset #: 4
Motif ID: 70
Motif name: CagTGCTCCACTGTGgT
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 3
Number of overlap: 11
Similarity score: 0.0780303

Alignment:
ABCACAGTGGAGCACTG
--CAAAGTCCAGC----

Original motif     Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif     Consensus sequence: ABCACAGTGGAGCACTG


Dataset #: 4
Motif ID: 76
Motif name: CAcCACAGTGGAGCAct
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 4
Number of overlap: 11
Similarity score: 0.0795455

Alignment:
AGTGCTCCACTGTGDTG
---GCTGGACTTTG---

Original motif     Consensus sequence: CAHCACAGTGGAGCACT Reverse complement motif     Consensus sequence: AGTGCTCCACTGTGDTG


Dataset #: 4
Motif ID: 77
Motif name: AgTGCTCCACTGTGgTGTCACAgT
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 4
Number of overlap: 11
Similarity score: 0.0797055

Alignment:
ACTGTGACACCACAGTGGAGCACT
----------CAAAGTCCAGC---

Original motif     Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif     Consensus sequence: ACTGTGACACCACAGTGGAGCACT


Dataset #: 4
Motif ID: 72
Motif name: CACTGTGrYrtCACAGTGswsCAcT
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 4
Number of overlap: 11
Similarity score: 0.0894661

Alignment:
AGTGSWSCACTGTGAMAMCACAGTG
---GCTGGACTTTG-----------

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG


Dataset #: 4
Motif ID: 73
Motif name: TGGAGCACTGTGACAcCACAGTGg
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 13
Number of overlap: 11
Similarity score: 0.10258

Alignment:
CCACTGTGVTGTCACAGTGCTCCA
------------CAAAGTCCAGC-

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA


Dataset #: 4
Motif ID: 67
Motif name: TgTGgTGTCACAGTGCTCC
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 9
Number of overlap: 11
Similarity score: 0.107008

Alignment:
TGTGGTGTCACAGTGCTCC
--------CAAAGTCCAGC

Original motif     Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif     Consensus sequence: GGAGCACTGTGACACCACA


Dataset #: 3
Motif ID: 57
Motif name: REST
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 4
Number of overlap: 11
Similarity score: 0.110715

Alignment:
TTCAGCACCATGGACAGCKCC
-------CAAAGTCCAGC---

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 2
Motif ID: 19
Motif name: Motif 19
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 3
Number of overlap: 11
Similarity score: 0.113636

Alignment:
AAAGRTMAAACTA
CAAAGTCCAGC--

Original motif     Consensus sequence: AAAGRTMAAACTA Reverse complement motif     Consensus sequence: TAGTTTYAKCTTT


Dataset #: 2
Motif ID: 8
Motif name: Motif 8
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 4
Number of overlap: 11
Similarity score: 0.120455

Alignment:
HAAAAHAAARMAAA
CAAAGTCCAGC---

Original motif     Consensus sequence: HAAAAHAAARMAAA Reverse complement motif     Consensus sequence: TTTRKTTTHTTTTH


Dataset #: 2 Motif ID: 23 Motif name: Motif 23

Original motif     Consensus sequence: AGAGAAAG Reverse complement motif     Consensus sequence: CTTTCTCT

Best Matches for Motif ID 23 (Highest to Lowest)

Dataset #: 2
Motif ID: 47
Motif name: Motif 47
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 4
Number of overlap: 8
Similarity score: 0.046875

Alignment:
TGCCTTTCYTT
---CTTTCTCT

Original motif     Consensus sequence: AAKGAAAGGCA Reverse complement motif     Consensus sequence: TGCCTTTCYTT


Dataset #: 2
Motif ID: 48
Motif name: Motif 48
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 8
Similarity score: 0.078125

Alignment:
TTCTTYCATT
--CTTTCTCT

Original motif     Consensus sequence: AATGKAAGAA Reverse complement motif     Consensus sequence: TTCTTYCATT


Dataset #: 2
Motif ID: 20
Motif name: Motif 20
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 8
Similarity score: 0.078125

Alignment:
TWTTGACAYAGA
-AGAGAAAG---

Original motif     Consensus sequence: TCTKTGTCAAWA Reverse complement motif     Consensus sequence: TWTTGACAYAGA


Dataset #: 2
Motif ID: 25
Motif name: Motif 25
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 4
Number of overlap: 8
Similarity score: 0.078125

Alignment:
CTGCTTTCCMAA
---CTTTCTCT-

Original motif     Consensus sequence: CTGCTTTCCMAA Reverse complement motif     Consensus sequence: TTYGGAAAGCAG


Dataset #: 2
Motif ID: 19
Motif name: Motif 19
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 4
Number of overlap: 8
Similarity score: 0.09375

Alignment:
AAAGRTMAAACTA
--AGAGAAAG---

Original motif     Consensus sequence: AAAGRTMAAACTA Reverse complement motif     Consensus sequence: TAGTTTYAKCTTT


Dataset #: 2
Motif ID: 45
Motif name: Motif 45
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 2
Number of overlap: 8
Similarity score: 0.09375

Alignment:
TTTCCTCCA
CTTTCTCT-

Original motif     Consensus sequence: TGGAGGAAA Reverse complement motif     Consensus sequence: TTTCCTCCA


Dataset #: 1
Motif ID: 3
Motif name: Motif 3
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 7
Number of overlap: 8
Similarity score: 0.09375

Alignment:
AAAAAAAAAAAAAT
AGAGAAAG------

Original motif     Consensus sequence: AAAAAAAAAAAAAT Reverse complement motif     Consensus sequence: ATTTTTTTTTTTTT


Dataset #: 5
Motif ID: 94
Motif name: TFM13
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 10
Number of overlap: 8
Similarity score: 0.0959821

Alignment:
WHAATTAAARAARAAAAAAA
---------AGAGAAAG---

Original motif     Consensus sequence: TTTTTTTKTTKTTTAATTHW Reverse complement motif     Consensus sequence: WHAATTAAARAARAAAAAAA


Dataset #: 3
Motif ID: 60
Motif name: NR1H2RXRA
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 7
Number of overlap: 8
Similarity score: 0.09625

Alignment:
GTTGACCTTTGACCTTT
------CTTTCTCT---

Original motif     Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif     Consensus sequence: GTTGACCTTTGACCTTT


Dataset #: 2
Motif ID: 8
Motif name: Motif 8
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 5
Number of overlap: 8
Similarity score: 0.101562

Alignment:
HAAAAHAAARMAAA
--AGAGAAAG----

Original motif     Consensus sequence: HAAAAHAAARMAAA Reverse complement motif     Consensus sequence: TTTRKTTTHTTTTH


Dataset #: 2 Motif ID: 24 Motif name: Motif 24

Original motif     Consensus sequence: TCCTCCTGGAA Reverse complement motif     Consensus sequence: TTCCAGGAGGA

Best Matches for Motif ID 24 (Highest to Lowest)

Dataset #: 3
Motif ID: 66
Motif name: CTCF
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 8
Number of overlap: 11
Similarity score: 0.102062

Alignment:
BMSMGCCYMCTKSTGGMHM
-------TCCTCCTGGAA-

Original motif     Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif     Consensus sequence: BMSMGCCYMCTKSTGGMHM


Dataset #: 1
Motif ID: 1
Motif name: Motif 1
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 11
Similarity score: 0.121753

Alignment:
YGCCACCTDSTGGY
-TCCTCCTGGAA--

Original motif     Consensus sequence: YGCCACCTDSTGGY Reverse complement motif     Consensus sequence: KCCASDAGGTGGCK


Dataset #: 2
Motif ID: 27
Motif name: Motif 27
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 1
Number of overlap: 11
Similarity score: 0.125

Alignment:
ATYAATGAAWACAT
TTCCAGGAGGA---

Original motif     Consensus sequence: ATGTWTTCATTMAT Reverse complement motif     Consensus sequence: ATYAATGAAWACAT


Dataset #: 2
Motif ID: 25
Motif name: Motif 25
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 1
Number of overlap: 11
Similarity score: 0.125

Alignment:
TTYGGAAAGCAG
TTCCAGGAGGA-

Original motif     Consensus sequence: CTGCTTTCCMAA Reverse complement motif     Consensus sequence: TTYGGAAAGCAG


Dataset #: 3
Motif ID: 56
Motif name: Mycn
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 1
Number of overlap: 10
Similarity score: 0.612329

Alignment:
GCCACGTGSD-
TCCTCCTGGAA

Original motif     Consensus sequence: HSCACGTGGC Reverse complement motif     Consensus sequence: GCCACGTGSD


Dataset #: 2
Motif ID: 31
Motif name: Motif 31
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 10
Similarity score: 0.6125

Alignment:
ATTCTGTRAAG-
-TTCCAGGAGGA

Original motif     Consensus sequence: ATTCTGTRAAG Reverse complement motif     Consensus sequence: CTTKACAGAAT


Dataset #: 3
Motif ID: 58
Motif name: Myc
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 1
Number of overlap: 10
Similarity score: 0.615419

Alignment:
DCCACGTGCV-
TCCTCCTGGAA

Original motif     Consensus sequence: VGCACGTGGH Reverse complement motif     Consensus sequence: DCCACGTGCV


Dataset #: 3
Motif ID: 57
Motif name: REST
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 12
Number of overlap: 10
Similarity score: 0.62065

Alignment:
-TTCAGCACCATGGACAGCKCC
TTCCAGGAGGA-----------

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 2
Motif ID: 26
Motif name: Motif 26
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 5
Number of overlap: 10
Similarity score: 0.625

Alignment:
ATGCTCACCATAAA-
----TCCTCCTGGAA

Original motif     Consensus sequence: TTTATGGTGAGCAT Reverse complement motif     Consensus sequence: ATGCTCACCATAAA


Dataset #: 4
Motif ID: 80
Motif name: taaacgatgcc
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 2
Number of overlap: 10
Similarity score: 0.625

Alignment:
-TAAACGATGCC
TTCCAGGAGGA-

Original motif     Consensus sequence: TAAACGATGCC Reverse complement motif     Consensus sequence: GGCATCGTTTA


Dataset #: 2 Motif ID: 25 Motif name: Motif 25

Original motif     Consensus sequence: CTGCTTTCCMAA Reverse complement motif     Consensus sequence: TTYGGAAAGCAG

Best Matches for Motif ID 25 (Highest to Lowest)

Dataset #: 2
Motif ID: 26
Motif name: Motif 26
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 3
Number of overlap: 12
Similarity score: 0.075

Alignment:
TTTATGGTGAGCAT
--TTYGGAAAGCAG

Original motif     Consensus sequence: TTTATGGTGAGCAT Reverse complement motif     Consensus sequence: ATGCTCACCATAAA


Dataset #: 5
Motif ID: 91
Motif name: TFM3
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 6
Number of overlap: 12
Similarity score: 0.0854167

Alignment:
BTTHAAAAAAYAAAAAAR
-TTYGGAAAGCAG-----

Original motif     Consensus sequence: KTTTTTTKTTTTTTDAAB Reverse complement motif     Consensus sequence: BTTHAAAAAAYAAAAAAR


Dataset #: 3
Motif ID: 57
Motif name: REST
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 9
Number of overlap: 12
Similarity score: 0.0868982

Alignment:
GGYGCTGTCCATGGTGCTGAA
-CTGCTTTCCMAA--------

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 4
Motif ID: 71
Motif name: AmTGTGACACCACAGT
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 4
Number of overlap: 12
Similarity score: 0.0938802

Alignment:
ACTGTGGTGTCACART
---CTGCTTTCCMAA-

Original motif     Consensus sequence: AMTGTGACACCACAGT Reverse complement motif     Consensus sequence: ACTGTGGTGTCACART


Dataset #: 4
Motif ID: 77
Motif name: AgTGCTCCACTGTGgTGTCACAgT
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 12
Number of overlap: 12
Similarity score: 0.0952465

Alignment:
AGTGCTCCACTGTGGTGTCACAGT
-----------CTGCTTTCCMAA-

Original motif     Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif     Consensus sequence: ACTGTGACACCACAGTGGAGCACT


Dataset #: 4
Motif ID: 73
Motif name: TGGAGCACTGTGACAcCACAGTGg
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 6
Number of overlap: 12
Similarity score: 0.0978041

Alignment:
CCACTGTGVTGTCACAGTGCTCCA
-----CTGCTTTCCMAA-------

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA


Dataset #: 4
Motif ID: 67
Motif name: TgTGgTGTCACAGTGCTCC
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 12
Similarity score: 0.100752

Alignment:
TGTGGTGTCACAGTGCTCC
-CTGCTTTCCMAA------

Original motif     Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif     Consensus sequence: GGAGCACTGTGACACCACA


Dataset #: 2
Motif ID: 27
Motif name: Motif 27
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 3
Number of overlap: 12
Similarity score: 0.10625

Alignment:
ATGTWTTCATTMAT
CTGCTTTCCMAA--

Original motif     Consensus sequence: ATGTWTTCATTMAT Reverse complement motif     Consensus sequence: ATYAATGAAWACAT


Dataset #: 2
Motif ID: 50
Motif name: Motif 50
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 2
Number of overlap: 12
Similarity score: 0.10625

Alignment:
TATKCTAAACCTAT
-CTGCTTTCCMAA-

Original motif     Consensus sequence: ATAGGTTTAGYATA Reverse complement motif     Consensus sequence: TATKCTAAACCTAT


Dataset #: 2
Motif ID: 47
Motif name: Motif 47
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 11
Similarity score: 0.583523

Alignment:
AAKGAAAGGCA-
TTYGGAAAGCAG

Original motif     Consensus sequence: AAKGAAAGGCA Reverse complement motif     Consensus sequence: TGCCTTTCYTT


Dataset #: 2 Motif ID: 26 Motif name: Motif 26

Original motif     Consensus sequence: TTTATGGTGAGCAT Reverse complement motif     Consensus sequence: ATGCTCACCATAAA

Best Matches for Motif ID 26 (Highest to Lowest)

Dataset #: 2
Motif ID: 27
Motif name: Motif 27
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 14
Similarity score: 0.125

Alignment:
ATYAATGAAWACAT
TTTATGGTGAGCAT

Original motif     Consensus sequence: ATGTWTTCATTMAT Reverse complement motif     Consensus sequence: ATYAATGAAWACAT


Dataset #: 2
Motif ID: 50
Motif name: Motif 50
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 2
Number of overlap: 13
Similarity score: 0.586538

Alignment:
-ATAGGTTTAGYATA
TTTATGGTGAGCAT-

Original motif     Consensus sequence: ATAGGTTTAGYATA Reverse complement motif     Consensus sequence: TATKCTAAACCTAT


Dataset #: 2
Motif ID: 37
Motif name: Motif 37
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 13
Similarity score: 0.625

Alignment:
TTTAATGTYTTTWA-
-TTTATGGTGAGCAT

Original motif     Consensus sequence: TTTAATGTYTTTWA Reverse complement motif     Consensus sequence: TWAAAKACATTAAA


Dataset #: 2
Motif ID: 25
Motif name: Motif 25
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 12
Similarity score: 1.09375

Alignment:
--CTGCTTTCCMAA
ATGCTCACCATAAA

Original motif     Consensus sequence: CTGCTTTCCMAA Reverse complement motif     Consensus sequence: TTYGGAAAGCAG


Dataset #: 3
Motif ID: 60
Motif name: NR1H2RXRA
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 6
Number of overlap: 12
Similarity score: 1.11167

Alignment:
AAAGGTCAAAGGTCAAC--
-----TTTATGGTGAGCAT

Original motif     Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif     Consensus sequence: GTTGACCTTTGACCTTT


Dataset #: 2
Motif ID: 19
Motif name: Motif 19
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 2
Number of overlap: 12
Similarity score: 1.11458

Alignment:
--AAAGRTMAAACTA
ATGCTCACCATAAA-

Original motif     Consensus sequence: AAAGRTMAAACTA Reverse complement motif     Consensus sequence: TAGTTTYAKCTTT


Dataset #: 2
Motif ID: 21
Motif name: Motif 21
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 1
Number of overlap: 11
Similarity score: 1.61364

Alignment:
GAGGTCAGAAG---
TTTATGGTGAGCAT

Original motif     Consensus sequence: CTTCTGACCTC Reverse complement motif     Consensus sequence: GAGGTCAGAAG


Dataset #: 2
Motif ID: 31
Motif name: Motif 31
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 11
Similarity score: 1.61364

Alignment:
ATTCTGTRAAG---
TTTATGGTGAGCAT

Original motif     Consensus sequence: ATTCTGTRAAG Reverse complement motif     Consensus sequence: CTTKACAGAAT


Dataset #: 2
Motif ID: 35
Motif name: Motif 35
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 1
Number of overlap: 11
Similarity score: 1.61364

Alignment:
AAAATCAACAA---
ATGCTCACCATAAA

Original motif     Consensus sequence: TTGTTGATTTT Reverse complement motif     Consensus sequence: AAAATCAACAA


Dataset #: 2
Motif ID: 28
Motif name: Motif 28
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 1
Number of overlap: 11
Similarity score: 1.625

Alignment:
TTWATGWCTTT---
TTTATGGTGAGCAT

Original motif     Consensus sequence: AAAGWCATWAA Reverse complement motif     Consensus sequence: TTWATGWCTTT


Dataset #: 2 Motif ID: 27 Motif name: Motif 27

Original motif     Consensus sequence: ATGTWTTCATTMAT Reverse complement motif     Consensus sequence: ATYAATGAAWACAT

Best Matches for Motif ID 27 (Highest to Lowest)

Dataset #: 1
Motif ID: 3
Motif name: Motif 3
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 1
Number of overlap: 14
Similarity score: 0.0825893

Alignment:
ATTTTTTTTTTTTT
ATGTWTTCATTMAT

Original motif     Consensus sequence: AAAAAAAAAAAAAT Reverse complement motif     Consensus sequence: ATTTTTTTTTTTTT


Dataset #: 5
Motif ID: 94
Motif name: TFM13
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 4
Number of overlap: 14
Similarity score: 0.0876913

Alignment:
WHAATTAAARAARAAAAAAA
---ATYAATGAAWACAT---

Original motif     Consensus sequence: TTTTTTTKTTKTTTAATTHW Reverse complement motif     Consensus sequence: WHAATTAAARAARAAAAAAA


Dataset #: 5
Motif ID: 91
Motif name: TFM3
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 4
Number of overlap: 14
Similarity score: 0.0959821

Alignment:
BTTHAAAAAAYAAAAAAR
-ATYAATGAAWACAT---

Original motif     Consensus sequence: KTTTTTTKTTTTTTDAAB Reverse complement motif     Consensus sequence: BTTHAAAAAAYAAAAAAR


Dataset #: 2
Motif ID: 26
Motif name: Motif 26
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 14
Similarity score: 0.109375

Alignment:
ATGCTCACCATAAA
ATGTWTTCATTMAT

Original motif     Consensus sequence: TTTATGGTGAGCAT Reverse complement motif     Consensus sequence: ATGCTCACCATAAA


Dataset #: 2
Motif ID: 37
Motif name: Motif 37
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 14
Similarity score: 0.109375

Alignment:
TWAAAKACATTAAA
ATGTWTTCATTMAT

Original motif     Consensus sequence: TTTAATGTYTTTWA Reverse complement motif     Consensus sequence: TWAAAKACATTAAA


Dataset #: 2
Motif ID: 49
Motif name: Motif 49
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 13
Similarity score: 0.590144

Alignment:
TAASTCTWTTTTAA-
-ATGTWTTCATTMAT

Original motif     Consensus sequence: TAASTCTWTTTTAA Reverse complement motif     Consensus sequence: TTAAAAWAGASTTA


Dataset #: 2
Motif ID: 8
Motif name: Motif 8
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 13
Similarity score: 0.601683

Alignment:
HAAAAHAAARMAAA-
-ATYAATGAAWACAT

Original motif     Consensus sequence: HAAAAHAAARMAAA Reverse complement motif     Consensus sequence: TTTRKTTTHTTTTH


Dataset #: 2
Motif ID: 19
Motif name: Motif 19
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 13
Similarity score: 0.609375

Alignment:
-AAAGRTMAAACTA
ATYAATGAAWACAT

Original motif     Consensus sequence: AAAGRTMAAACTA Reverse complement motif     Consensus sequence: TAGTTTYAKCTTT


Dataset #: 2
Motif ID: 50
Motif name: Motif 50
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 3
Number of overlap: 12
Similarity score: 1.09896

Alignment:
--TATKCTAAACCTAT
ATYAATGAAWACAT--

Original motif     Consensus sequence: ATAGGTTTAGYATA Reverse complement motif     Consensus sequence: TATKCTAAACCTAT


Dataset #: 2
Motif ID: 25
Motif name: Motif 25
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 12
Similarity score: 1.10938

Alignment:
CTGCTTTCCMAA--
ATGTWTTCATTMAT

Original motif     Consensus sequence: CTGCTTTCCMAA Reverse complement motif     Consensus sequence: TTYGGAAAGCAG


Dataset #: 2 Motif ID: 28 Motif name: Motif 28

Original motif     Consensus sequence: AAAGWCATWAA Reverse complement motif     Consensus sequence: TTWATGWCTTT

Best Matches for Motif ID 28 (Highest to Lowest)

Dataset #: 2
Motif ID: 37
Motif name: Motif 37
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 2
Number of overlap: 11
Similarity score: 0.0340909

Alignment:
TWAAAKACATTAAA
--AAAGWCATWAA-

Original motif     Consensus sequence: TTTAATGTYTTTWA Reverse complement motif     Consensus sequence: TWAAAKACATTAAA


Dataset #: 2
Motif ID: 35
Motif name: Motif 35
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0.0795455

Alignment:
AAAATCAACAA
AAAGWCATWAA

Original motif     Consensus sequence: TTGTTGATTTT Reverse complement motif     Consensus sequence: AAAATCAACAA


Dataset #: 1
Motif ID: 3
Motif name: Motif 3
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 4
Number of overlap: 11
Similarity score: 0.0909091

Alignment:
AAAAAAAAAAAAAT
AAAGWCATWAA---

Original motif     Consensus sequence: AAAAAAAAAAAAAT Reverse complement motif     Consensus sequence: ATTTTTTTTTTTTT


Dataset #: 2
Motif ID: 34
Motif name: Motif 34
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0.0909091

Alignment:
AAAAGCAGCAA
AAAGWCATWAA

Original motif     Consensus sequence: TTGCTGCTTTT Reverse complement motif     Consensus sequence: AAAAGCAGCAA


Dataset #: 2
Motif ID: 17
Motif name: Motif 17
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 1
Number of overlap: 11
Similarity score: 0.0909091

Alignment:
AAATAKATWTT
AAAGWCATWAA

Original motif     Consensus sequence: AAWATRTATTT Reverse complement motif     Consensus sequence: AAATAKATWTT


Dataset #: 5
Motif ID: 91
Motif name: TFM3
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 6
Number of overlap: 11
Similarity score: 0.0951705

Alignment:
KTTTTTTKTTTTTTDAAB
--TTWATGWCTTT-----

Original motif     Consensus sequence: KTTTTTTKTTTTTTDAAB Reverse complement motif     Consensus sequence: BTTHAAAAAAYAAAAAAR


Dataset #: 2
Motif ID: 8
Motif name: Motif 8
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 11
Similarity score: 0.0977273

Alignment:
TTTRKTTTHTTTTH
-TTWATGWCTTT--

Original motif     Consensus sequence: HAAAAHAAARMAAA Reverse complement motif     Consensus sequence: TTTRKTTTHTTTTH


Dataset #: 5
Motif ID: 94
Motif name: TFM13
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 9
Number of overlap: 11
Similarity score: 0.099026

Alignment:
TTTTTTTKTTKTTTAATTHW
-TTWATGWCTTT--------

Original motif     Consensus sequence: TTTTTTTKTTKTTTAATTHW Reverse complement motif     Consensus sequence: WHAATTAAARAARAAAAAAA


Dataset #: 2
Motif ID: 19
Motif name: Motif 19
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 11
Similarity score: 0.102273

Alignment:
AAAGRTMAAACTA
AAAGWCATWAA--

Original motif     Consensus sequence: AAAGRTMAAACTA Reverse complement motif     Consensus sequence: TAGTTTYAKCTTT


Dataset #: 5
Motif ID: 89
Motif name: TFM1
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 5
Number of overlap: 11
Similarity score: 0.112013

Alignment:
CACACACACACWCACACA
---AAAGWCATWAA----

Original motif     Consensus sequence: CACACACACACWCACACA Reverse complement motif     Consensus sequence: TGTGTGWGTGTGTGTGTG


Dataset #: 2 Motif ID: 29 Motif name: Motif 29

Original motif     Consensus sequence: AATAACAGATT Reverse complement motif     Consensus sequence: AATCTGTTATT

Best Matches for Motif ID 29 (Highest to Lowest)

Dataset #: 2
Motif ID: 11
Motif name: Motif 11
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 1
Number of overlap: 11
Similarity score: 0.0482955

Alignment:
AATAGYATTTT
AATAACAGATT

Original motif     Consensus sequence: AAAATKCTATT Reverse complement motif     Consensus sequence: AATAGYATTTT


Dataset #: 1
Motif ID: 3
Motif name: Motif 3
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 4
Number of overlap: 11
Similarity score: 0.0596591

Alignment:
ATTTTTTTTTTTTT
AATCTGTTATT---

Original motif     Consensus sequence: AAAAAAAAAAAAAT Reverse complement motif     Consensus sequence: ATTTTTTTTTTTTT


Dataset #: 2
Motif ID: 17
Motif name: Motif 17
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0.0596591

Alignment:
AAATAKATWTT
AATAACAGATT

Original motif     Consensus sequence: AAWATRTATTT Reverse complement motif     Consensus sequence: AAATAKATWTT


Dataset #: 2
Motif ID: 31
Motif name: Motif 31
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0.0596591

Alignment:
CTTKACAGAAT
AATAACAGATT

Original motif     Consensus sequence: ATTCTGTRAAG Reverse complement motif     Consensus sequence: CTTKACAGAAT


Dataset #: 2
Motif ID: 49
Motif name: Motif 49
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 11
Similarity score: 0.0596591

Alignment:
TTAAAAWAGASTTA
-AATAACAGATT--

Original motif     Consensus sequence: TAASTCTWTTTTAA Reverse complement motif     Consensus sequence: TTAAAAWAGASTTA


Dataset #: 2
Motif ID: 37
Motif name: Motif 37
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 4
Number of overlap: 11
Similarity score: 0.0710227

Alignment:
TWAAAKACATTAAA
AATAACAGATT---

Original motif     Consensus sequence: TTTAATGTYTTTWA Reverse complement motif     Consensus sequence: TWAAAKACATTAAA


Dataset #: 2
Motif ID: 14
Motif name: Motif 14
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 11
Similarity score: 0.0710227

Alignment:
AAAMATTGTTT
AATAACAGATT

Original motif     Consensus sequence: AAAMATTGTTT Reverse complement motif     Consensus sequence: AAACAATYTTT


Dataset #: 4
Motif ID: 77
Motif name: AgTGCTCCACTGTGgTGTCACAgT
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 6
Number of overlap: 11
Similarity score: 0.0798255

Alignment:
AGTGCTCCACTGTGGTGTCACAGT
--------AATCTGTTATT-----

Original motif     Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif     Consensus sequence: ACTGTGACACCACAGTGGAGCACT


Dataset #: 2
Motif ID: 34
Motif name: Motif 34
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0.0823864

Alignment:
AAAAGCAGCAA
AATAACAGATT

Original motif     Consensus sequence: TTGCTGCTTTT Reverse complement motif     Consensus sequence: AAAAGCAGCAA


Dataset #: 2
Motif ID: 15
Motif name: Motif 15
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 1
Number of overlap: 11
Similarity score: 0.0823864

Alignment:
TTYAAACATYTT
AATAACAGATT-

Original motif     Consensus sequence: AAMATGTTTMAA Reverse complement motif     Consensus sequence: TTYAAACATYTT


Dataset #: 2 Motif ID: 30 Motif name: Motif 30

Original motif     Consensus sequence: CTGTTTTWAT Reverse complement motif     Consensus sequence: ATWAAAACAG

Best Matches for Motif ID 30 (Highest to Lowest)

Dataset #: 2
Motif ID: 27
Motif name: Motif 27
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 5
Number of overlap: 10
Similarity score: 0.0625

Alignment:
ATGTWTTCATTMAT
CTGTTTTWAT----

Original motif     Consensus sequence: ATGTWTTCATTMAT Reverse complement motif     Consensus sequence: ATYAATGAAWACAT


Dataset #: 5
Motif ID: 94
Motif name: TFM13
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 8
Number of overlap: 10
Similarity score: 0.0821429

Alignment:
WHAATTAAARAARAAAAAAA
---ATWAAAACAG-------

Original motif     Consensus sequence: TTTTTTTKTTKTTTAATTHW Reverse complement motif     Consensus sequence: WHAATTAAARAARAAAAAAA


Dataset #: 2
Motif ID: 20
Motif name: Motif 20
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 2
Number of overlap: 10
Similarity score: 0.0875

Alignment:
TCTKTGTCAAWA
-CTGTTTTWAT-

Original motif     Consensus sequence: TCTKTGTCAAWA Reverse complement motif     Consensus sequence: TWTTGACAYAGA


Dataset #: 1
Motif ID: 3
Motif name: Motif 3
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 3
Number of overlap: 10
Similarity score: 0.0875

Alignment:
ATTTTTTTTTTTTT
--CTGTTTTWAT--

Original motif     Consensus sequence: AAAAAAAAAAAAAT Reverse complement motif     Consensus sequence: ATTTTTTTTTTTTT


Dataset #: 2
Motif ID: 37
Motif name: Motif 37
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 10
Similarity score: 0.0875

Alignment:
TTTAATGTYTTTWA
----CTGTTTTWAT

Original motif     Consensus sequence: TTTAATGTYTTTWA Reverse complement motif     Consensus sequence: TWAAAKACATTAAA


Dataset #: 2
Motif ID: 8
Motif name: Motif 8
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 2
Number of overlap: 10
Similarity score: 0.09

Alignment:
TTTRKTTTHTTTTH
---CTGTTTTWAT-

Original motif     Consensus sequence: HAAAAHAAARMAAA Reverse complement motif     Consensus sequence: TTTRKTTTHTTTTH


Dataset #: 5
Motif ID: 91
Motif name: TFM3
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 4
Number of overlap: 10
Similarity score: 0.096875

Alignment:
KTTTTTTKTTTTTTDAAB
-----CTGTTTTWAT---

Original motif     Consensus sequence: KTTTTTTKTTTTTTDAAB Reverse complement motif     Consensus sequence: BTTHAAAAAAYAAAAAAR


Dataset #: 2
Motif ID: 25
Motif name: Motif 25
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 10
Similarity score: 0.1

Alignment:
CTGCTTTCCMAA
CTGTTTTWAT--

Original motif     Consensus sequence: CTGCTTTCCMAA Reverse complement motif     Consensus sequence: TTYGGAAAGCAG


Dataset #: 2
Motif ID: 35
Motif name: Motif 35
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 10
Similarity score: 0.1125

Alignment:
TTGTTGATTTT
CTGTTTTWAT-

Original motif     Consensus sequence: TTGTTGATTTT Reverse complement motif     Consensus sequence: AAAATCAACAA


Dataset #: 2
Motif ID: 29
Motif name: Motif 29
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 1
Number of overlap: 10
Similarity score: 0.1125

Alignment:
AATCTGTTATT
CTGTTTTWAT-

Original motif     Consensus sequence: AATAACAGATT Reverse complement motif     Consensus sequence: AATCTGTTATT


Dataset #: 2 Motif ID: 31 Motif name: Motif 31

Original motif     Consensus sequence: ATTCTGTRAAG Reverse complement motif     Consensus sequence: CTTKACAGAAT

Best Matches for Motif ID 31 (Highest to Lowest)

Dataset #: 2
Motif ID: 29
Motif name: Motif 29
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 1
Number of overlap: 11
Similarity score: 0.0596591

Alignment:
AATCTGTTATT
ATTCTGTRAAG

Original motif     Consensus sequence: AATAACAGATT Reverse complement motif     Consensus sequence: AATCTGTTATT


Dataset #: 5
Motif ID: 91
Motif name: TFM3
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0.0696023

Alignment:
KTTTTTTKTTTTTTDAAB
-------ATTCTGTRAAG

Original motif     Consensus sequence: KTTTTTTKTTTTTTDAAB Reverse complement motif     Consensus sequence: BTTHAAAAAAYAAAAAAR


Dataset #: 2
Motif ID: 20
Motif name: Motif 20
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement