**************************************************************************************************************************************************************************************************** MOTIFSIM - Motif Similarity Detection Tool Version 2.1 **************************************************************************************************************************************************************************************************** INPUT **************************************************************************************************************************************************************************************************** Input Parameters Number of files: 2 Number of top significant motifs: 10 Number of best matches: 10 Similarity cutoff: >= 0.75 Matching motif database: UniProbe Mus Musculus Phylogenetic tree: Yes Combined similar motifs: Yes Output file type: All Output file format: All Input files and motif counts File name Count of motifs Dataset # PScanChIP_DM05.txt 16 1 RSAT_peak-motifs_DM05.txt 17 2 **************************************************************************************************************************************************************************************************** RESULTS **************************************************************************************************************************************************************************************************** ****************************************************************** Top 10 Significant Motifs - Global Matching (Highest to Lowest) ****************************************************************** Dataset #: 1 Motif ID: 5 Motif name: ZEB1 Original motif 0.024390 0.829268 0.024390 0.121951 0.926829 0.000000 0.048780 0.024390 0.000000 0.975610 0.024390 0.000000 0.000000 0.926829 0.073171 0.000000 0.000000 0.024390 0.000000 0.975610 0.243902 0.024390 0.390244 0.341463 Consensus sequence: CACCTD Reverse complement motif 0.243902 0.390244 0.024390 0.341463 0.975610 0.024390 0.000000 0.000000 0.000000 0.073171 0.926829 0.000000 0.000000 0.024390 0.975610 0.000000 0.024390 0.000000 0.048780 0.926829 0.024390 0.024390 0.829268 0.121951 Consensus sequence: HAGGTG *************************************************************** Best Matches for Top Significant Motif ID 5 (Highest to Lowest) *************************************************************** Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 21 AmTGTGACACCACAGT Reverse Complement Reverse Complement Backward 8 6 0.034978 Original motif 0.703125 0.187500 0.015625 0.093750 0.265625 0.500000 0.125000 0.109375 0.015625 0.046875 0.031250 0.906250 0.078125 0.015625 0.890625 0.015625 0.000000 0.000000 0.000000 1.000000 0.000000 0.031250 0.906250 0.062500 0.953125 0.000000 0.015625 0.031250 0.046875 0.890625 0.000000 0.062500 0.968750 0.000000 0.015625 0.015625 0.109375 0.781250 0.062500 0.046875 0.062500 0.890625 0.000000 0.046875 0.953125 0.000000 0.031250 0.015625 0.031250 0.781250 0.046875 0.140625 0.937500 0.015625 0.031250 0.015625 0.093750 0.078125 0.734375 0.093750 0.031250 0.078125 0.000000 0.890625 Consensus sequence: AMTGTGACACCACAGT Reverse complement motif 0.890625 0.078125 0.000000 0.031250 0.093750 0.734375 0.078125 0.093750 0.015625 0.015625 0.031250 0.937500 0.031250 0.046875 0.781250 0.140625 0.015625 0.000000 0.031250 0.953125 0.062500 0.000000 0.890625 0.046875 0.109375 0.062500 0.781250 0.046875 0.015625 0.000000 0.015625 0.968750 0.046875 0.000000 0.890625 0.062500 0.031250 0.000000 0.015625 0.953125 0.000000 0.906250 0.031250 0.062500 1.000000 0.000000 0.000000 0.000000 0.078125 0.890625 0.015625 0.015625 0.906250 0.046875 0.031250 0.015625 0.265625 0.125000 0.500000 0.109375 0.093750 0.187500 0.015625 0.703125 Consensus sequence: ACTGTGGTGTCACART Alignment: ACTGTGGTGTCACART ---HAGGTG------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 17 TgTGgTGTCACAGTGCTCC Reverse Complement Original Motif Backward 13 6 0.036277 Original motif 0.111111 0.083333 0.055556 0.750000 0.125000 0.097222 0.652778 0.125000 0.041667 0.097222 0.027778 0.833333 0.027778 0.027778 0.791667 0.152778 0.055556 0.166667 0.652778 0.125000 0.000000 0.041667 0.013889 0.944444 0.041667 0.000000 0.888889 0.069444 0.027778 0.027778 0.000000 0.944444 0.041667 0.944444 0.013889 0.000000 0.916667 0.027778 0.000000 0.055556 0.069444 0.875000 0.000000 0.055556 0.833333 0.013889 0.013889 0.138889 0.041667 0.069444 0.819444 0.069444 0.027778 0.027778 0.027778 0.916667 0.069444 0.013889 0.847222 0.069444 0.069444 0.777778 0.027778 0.125000 0.055556 0.041667 0.027778 0.875000 0.041667 0.708333 0.125000 0.125000 0.111111 0.819444 0.055556 0.013889 Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif 0.111111 0.055556 0.819444 0.013889 0.041667 0.125000 0.708333 0.125000 0.875000 0.041667 0.027778 0.055556 0.069444 0.027778 0.777778 0.125000 0.069444 0.847222 0.013889 0.069444 0.916667 0.027778 0.027778 0.027778 0.041667 0.819444 0.069444 0.069444 0.138889 0.013889 0.013889 0.833333 0.069444 0.000000 0.875000 0.055556 0.055556 0.027778 0.000000 0.916667 0.041667 0.013889 0.944444 0.000000 0.944444 0.027778 0.000000 0.027778 0.041667 0.888889 0.000000 0.069444 0.944444 0.041667 0.013889 0.000000 0.055556 0.652778 0.166667 0.125000 0.027778 0.791667 0.027778 0.152778 0.833333 0.097222 0.027778 0.041667 0.125000 0.652778 0.097222 0.125000 0.750000 0.083333 0.055556 0.111111 Consensus sequence: GGAGCACTGTGACACCACA Alignment: TGTGGTGTCACAGTGCTCC -HAGGTG------------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 27 AgTGCTCCACTGTGgTGTCACAgT Reverse Complement Original Motif Forward 12 6 0.040961 Original motif 0.690141 0.126761 0.042254 0.140845 0.169014 0.098592 0.676056 0.056338 0.042254 0.028169 0.028169 0.901408 0.056338 0.000000 0.774648 0.169014 0.042254 0.887324 0.042254 0.028169 0.000000 0.014085 0.000000 0.985915 0.056338 0.830986 0.042254 0.070423 0.028169 0.957746 0.014085 0.000000 0.957746 0.000000 0.014085 0.028169 0.084507 0.845070 0.014085 0.056338 0.028169 0.014085 0.000000 0.957746 0.140845 0.028169 0.802817 0.028169 0.014085 0.014085 0.014085 0.957746 0.014085 0.000000 0.929577 0.056338 0.056338 0.154930 0.619718 0.169014 0.014085 0.028169 0.000000 0.957746 0.056338 0.014085 0.873239 0.056338 0.014085 0.000000 0.000000 0.985915 0.042254 0.929577 0.000000 0.028169 0.957746 0.028169 0.000000 0.014085 0.028169 0.845070 0.028169 0.098592 0.873239 0.014085 0.042254 0.070423 0.098592 0.154930 0.563380 0.183099 0.070423 0.014085 0.112676 0.802817 Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif 0.802817 0.014085 0.112676 0.070423 0.098592 0.563380 0.154930 0.183099 0.070423 0.014085 0.042254 0.873239 0.028169 0.028169 0.845070 0.098592 0.014085 0.028169 0.000000 0.957746 0.042254 0.000000 0.929577 0.028169 0.985915 0.000000 0.000000 0.014085 0.056338 0.873239 0.014085 0.056338 0.957746 0.028169 0.000000 0.014085 0.056338 0.619718 0.154930 0.169014 0.014085 0.929577 0.000000 0.056338 0.957746 0.014085 0.014085 0.014085 0.140845 0.802817 0.028169 0.028169 0.957746 0.014085 0.000000 0.028169 0.084507 0.014085 0.845070 0.056338 0.028169 0.000000 0.014085 0.957746 0.028169 0.014085 0.957746 0.000000 0.056338 0.042254 0.830986 0.070423 0.985915 0.014085 0.000000 0.000000 0.042254 0.042254 0.887324 0.028169 0.056338 0.774648 0.000000 0.169014 0.901408 0.028169 0.028169 0.042254 0.169014 0.676056 0.098592 0.056338 0.140845 0.126761 0.042254 0.690141 Consensus sequence: ACTGTGACACCACAGTGGAGCACT Alignment: AGTGCTCCACTGTGGTGTCACAGT -----------HAGGTG------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 33 srACyCCGAyr Reverse Complement Reverse Complement Forward 3 6 0.042600 Original motif 0.000000 0.500000 0.500000 0.000000 0.500000 0.000000 0.500000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.000000 0.500000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.000000 0.500000 0.500000 0.000000 0.500000 0.000000 Consensus sequence: SRACYCCGAYR Reverse complement motif 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.500000 0.500000 0.000000 Consensus sequence: KKTCGGKGTKS Alignment: KKTCGGKGTKS --HAGGTG--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 23 TGGAGCACTGTGACAcCACAGTGg Reverse Complement Reverse Complement Forward 6 6 0.049618 Original motif 0.054054 0.040541 0.054054 0.851351 0.040541 0.013514 0.824324 0.121622 0.094595 0.135135 0.756757 0.013514 0.891892 0.000000 0.000000 0.108108 0.040541 0.094595 0.810811 0.054054 0.081081 0.797297 0.054054 0.067568 0.932432 0.027027 0.000000 0.040541 0.054054 0.756757 0.135135 0.054054 0.108108 0.027027 0.013514 0.851351 0.108108 0.000000 0.851351 0.040541 0.013514 0.000000 0.027027 0.959459 0.000000 0.013514 0.945946 0.040541 0.905405 0.000000 0.067568 0.027027 0.054054 0.837838 0.000000 0.108108 0.945946 0.013514 0.040541 0.000000 0.162162 0.500000 0.189189 0.148649 0.108108 0.824324 0.000000 0.067568 0.945946 0.000000 0.040541 0.013514 0.081081 0.837838 0.027027 0.054054 0.945946 0.000000 0.013514 0.040541 0.054054 0.067568 0.783784 0.094595 0.054054 0.027027 0.000000 0.918919 0.040541 0.013514 0.864865 0.081081 0.148649 0.121622 0.675676 0.054054 Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif 0.148649 0.675676 0.121622 0.054054 0.040541 0.864865 0.013514 0.081081 0.918919 0.027027 0.000000 0.054054 0.054054 0.783784 0.067568 0.094595 0.040541 0.000000 0.013514 0.945946 0.081081 0.027027 0.837838 0.054054 0.013514 0.000000 0.040541 0.945946 0.108108 0.000000 0.824324 0.067568 0.162162 0.189189 0.500000 0.148649 0.000000 0.013514 0.040541 0.945946 0.054054 0.000000 0.837838 0.108108 0.027027 0.000000 0.067568 0.905405 0.000000 0.945946 0.013514 0.040541 0.959459 0.000000 0.027027 0.013514 0.108108 0.851351 0.000000 0.040541 0.851351 0.027027 0.013514 0.108108 0.054054 0.135135 0.756757 0.054054 0.040541 0.027027 0.000000 0.932432 0.081081 0.054054 0.797297 0.067568 0.040541 0.810811 0.094595 0.054054 0.108108 0.000000 0.000000 0.891892 0.094595 0.756757 0.135135 0.013514 0.040541 0.824324 0.013514 0.121622 0.851351 0.040541 0.054054 0.054054 Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA Alignment: CCACTGTGVTGTCACAGTGCTCCA -----HAGGTG------------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 26 CAcCACAGTGGAGCAct Original Motif Original Motif Forward 1 6 0.053874 Original motif 0.078125 0.734375 0.046875 0.140625 0.828125 0.046875 0.078125 0.046875 0.203125 0.484375 0.156250 0.156250 0.015625 0.984375 0.000000 0.000000 0.968750 0.015625 0.015625 0.000000 0.000000 0.906250 0.015625 0.078125 0.859375 0.000000 0.000000 0.140625 0.031250 0.000000 0.906250 0.062500 0.000000 0.015625 0.000000 0.984375 0.000000 0.000000 0.968750 0.031250 0.046875 0.062500 0.812500 0.078125 0.937500 0.015625 0.015625 0.031250 0.015625 0.031250 0.921875 0.031250 0.125000 0.796875 0.000000 0.078125 0.875000 0.046875 0.046875 0.031250 0.093750 0.656250 0.093750 0.156250 0.156250 0.078125 0.109375 0.656250 Consensus sequence: CAHCACAGTGGAGCACT Reverse complement motif 0.656250 0.078125 0.109375 0.156250 0.093750 0.093750 0.656250 0.156250 0.031250 0.046875 0.046875 0.875000 0.125000 0.000000 0.796875 0.078125 0.015625 0.921875 0.031250 0.031250 0.031250 0.015625 0.015625 0.937500 0.046875 0.812500 0.062500 0.078125 0.000000 0.968750 0.000000 0.031250 0.984375 0.015625 0.000000 0.000000 0.031250 0.906250 0.000000 0.062500 0.140625 0.000000 0.000000 0.859375 0.000000 0.015625 0.906250 0.078125 0.000000 0.015625 0.015625 0.968750 0.015625 0.000000 0.984375 0.000000 0.203125 0.156250 0.484375 0.156250 0.046875 0.046875 0.078125 0.828125 0.078125 0.046875 0.734375 0.140625 Consensus sequence: AGTGCTCCACTGTGDTG Alignment: CAHCACAGTGGAGCACT CACCTD----------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 19 atactttggc Original Motif Original Motif Forward 2 6 0.055303 Original motif 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 Consensus sequence: ATACTTTGGC Reverse complement motif 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 Consensus sequence: GCCAAAGTAT Alignment: ATACTTTGGC -CACCTD--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 22 CACTGTGrYrtCACAGTGswsCAcT Original Motif Reverse Complement Backward 2 6 0.056465 Original motif 0.111111 0.746032 0.063492 0.079365 0.857143 0.047619 0.047619 0.047619 0.047619 0.857143 0.079365 0.015873 0.031746 0.000000 0.000000 0.968254 0.031746 0.015873 0.904762 0.047619 0.000000 0.000000 0.000000 1.000000 0.031746 0.000000 0.857143 0.111111 0.396825 0.111111 0.412698 0.079365 0.031746 0.253968 0.015873 0.698413 0.365079 0.000000 0.634921 0.000000 0.079365 0.206349 0.047619 0.666667 0.047619 0.936508 0.015873 0.000000 0.952381 0.000000 0.015873 0.031746 0.015873 0.920635 0.000000 0.063492 0.920635 0.000000 0.000000 0.079365 0.063492 0.047619 0.841270 0.047619 0.000000 0.000000 0.015873 0.984127 0.047619 0.015873 0.904762 0.031746 0.015873 0.603175 0.317460 0.063492 0.396825 0.000000 0.015873 0.587302 0.015873 0.476190 0.428571 0.079365 0.063492 0.920635 0.000000 0.015873 0.920635 0.015873 0.047619 0.015873 0.095238 0.682540 0.095238 0.126984 0.047619 0.015873 0.095238 0.841270 Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif 0.841270 0.015873 0.095238 0.047619 0.095238 0.095238 0.682540 0.126984 0.015873 0.015873 0.047619 0.920635 0.063492 0.000000 0.920635 0.015873 0.015873 0.428571 0.476190 0.079365 0.587302 0.000000 0.015873 0.396825 0.015873 0.317460 0.603175 0.063492 0.047619 0.904762 0.015873 0.031746 0.984127 0.000000 0.015873 0.000000 0.063492 0.841270 0.047619 0.047619 0.079365 0.000000 0.000000 0.920635 0.015873 0.000000 0.920635 0.063492 0.031746 0.000000 0.015873 0.952381 0.047619 0.015873 0.936508 0.000000 0.666667 0.206349 0.047619 0.079365 0.365079 0.634921 0.000000 0.000000 0.698413 0.253968 0.015873 0.031746 0.396825 0.412698 0.111111 0.079365 0.031746 0.857143 0.000000 0.111111 1.000000 0.000000 0.000000 0.000000 0.031746 0.904762 0.015873 0.047619 0.968254 0.000000 0.000000 0.031746 0.047619 0.079365 0.857143 0.015873 0.047619 0.047619 0.047619 0.857143 0.111111 0.063492 0.746032 0.079365 Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG Alignment: AGTGSWSCACTGTGAMAMCACAGTG ------------------CACCTD- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 24 ssCCCCGCSssk Original Motif Original Motif Backward 2 6 0.057185 Original motif 0.000000 0.444444 0.370370 0.185185 0.111111 0.407407 0.333333 0.148148 0.000000 0.888889 0.037037 0.074074 0.000000 0.888889 0.074074 0.037037 0.000000 0.777778 0.222222 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.037037 0.888889 0.000000 0.074074 0.000000 0.703704 0.296296 0.000000 0.000000 0.518519 0.370370 0.111111 0.111111 0.407407 0.259259 0.222222 0.074074 0.222222 0.407407 0.296296 Consensus sequence: SBCCCCGCCSBB Reverse complement motif 0.074074 0.407407 0.222222 0.296296 0.111111 0.259259 0.407407 0.222222 0.000000 0.370370 0.518519 0.111111 0.000000 0.296296 0.703704 0.000000 0.037037 0.000000 0.888889 0.074074 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.222222 0.777778 0.000000 0.000000 0.074074 0.888889 0.037037 0.000000 0.037037 0.888889 0.074074 0.111111 0.333333 0.407407 0.148148 0.000000 0.370370 0.444444 0.185185 Consensus sequence: BBSGGCGGGGBS Alignment: SBCCCCGCCSBB -----CACCTD- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 20 CagTGCTCCACTGTGgT Reverse Complement Reverse Complement Backward 8 6 0.059470 Original motif 0.150000 0.700000 0.016667 0.133333 0.650000 0.150000 0.050000 0.150000 0.166667 0.116667 0.633333 0.083333 0.050000 0.033333 0.066667 0.850000 0.050000 0.000000 0.833333 0.116667 0.016667 0.966667 0.000000 0.016667 0.050000 0.016667 0.000000 0.933333 0.066667 0.833333 0.066667 0.033333 0.033333 0.966667 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.050000 0.916667 0.016667 0.016667 0.166667 0.000000 0.000000 0.833333 0.083333 0.016667 0.900000 0.000000 0.000000 0.016667 0.016667 0.966667 0.000000 0.016667 0.966667 0.016667 0.116667 0.166667 0.483333 0.233333 0.066667 0.083333 0.050000 0.800000 Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif 0.800000 0.083333 0.050000 0.066667 0.116667 0.483333 0.166667 0.233333 0.000000 0.966667 0.016667 0.016667 0.966667 0.016667 0.016667 0.000000 0.083333 0.900000 0.016667 0.000000 0.833333 0.000000 0.000000 0.166667 0.050000 0.016667 0.916667 0.016667 0.000000 0.000000 0.000000 1.000000 0.033333 0.000000 0.966667 0.000000 0.066667 0.066667 0.833333 0.033333 0.933333 0.016667 0.000000 0.050000 0.016667 0.000000 0.966667 0.016667 0.050000 0.833333 0.000000 0.116667 0.850000 0.033333 0.066667 0.050000 0.166667 0.633333 0.116667 0.083333 0.150000 0.150000 0.050000 0.650000 0.150000 0.016667 0.700000 0.133333 Consensus sequence: ABCACAGTGGAGCACTG Alignment: ABCACAGTGGAGCACTG ----HAGGTG------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 6 Motif name: Mycn Original motif 0.349315 0.363014 0.143836 0.143836 0.089041 0.388128 0.447489 0.075342 0.015982 0.984018 0.000000 0.000000 0.945205 0.000000 0.041096 0.013699 0.000000 0.961187 0.018265 0.020548 0.070776 0.002283 0.924658 0.002283 0.054795 0.221461 0.004566 0.719178 0.000000 0.000000 0.938356 0.061644 0.061644 0.111872 0.739726 0.086758 0.139269 0.605023 0.091324 0.164384 Consensus sequence: HSCACGTGGC Reverse complement motif 0.139269 0.091324 0.605023 0.164384 0.061644 0.739726 0.111872 0.086758 0.000000 0.938356 0.000000 0.061644 0.719178 0.221461 0.004566 0.054795 0.070776 0.924658 0.002283 0.002283 0.000000 0.018265 0.961187 0.020548 0.013699 0.000000 0.041096 0.945205 0.015982 0.000000 0.984018 0.000000 0.089041 0.447489 0.388128 0.075342 0.349315 0.143836 0.363014 0.143836 Consensus sequence: GCCACGTGSD *************************************************************** Best Matches for Top Significant Motif ID 6 (Highest to Lowest) *************************************************************** Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 18 sscCCCGCGcs Reverse Complement Original Motif Backward 1 10 0.065482 Original motif 0.147059 0.441176 0.264706 0.147059 0.117647 0.529412 0.294118 0.058824 0.000000 0.676471 0.235294 0.088235 0.029412 0.852941 0.117647 0.000000 0.000000 0.823529 0.176471 0.000000 0.000000 0.794118 0.205882 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.058824 0.941176 0.000000 0.117647 0.470588 0.235294 0.176471 0.000000 0.323529 0.529412 0.147059 Consensus sequence: BSCCCCGCGBS Reverse complement motif 0.000000 0.529412 0.323529 0.147059 0.117647 0.235294 0.470588 0.176471 0.000000 0.941176 0.058824 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.205882 0.794118 0.000000 0.000000 0.176471 0.823529 0.000000 0.029412 0.117647 0.852941 0.000000 0.000000 0.235294 0.676471 0.088235 0.117647 0.294118 0.529412 0.058824 0.147059 0.264706 0.441176 0.147059 Consensus sequence: SBCGCGGGGSB Alignment: BSCCCCGCGBS -GCCACGTGSD ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 24 ssCCCCGCSssk Original Motif Reverse Complement Forward 2 10 0.070499 Original motif 0.000000 0.444444 0.370370 0.185185 0.111111 0.407407 0.333333 0.148148 0.000000 0.888889 0.037037 0.074074 0.000000 0.888889 0.074074 0.037037 0.000000 0.777778 0.222222 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.037037 0.888889 0.000000 0.074074 0.000000 0.703704 0.296296 0.000000 0.000000 0.518519 0.370370 0.111111 0.111111 0.407407 0.259259 0.222222 0.074074 0.222222 0.407407 0.296296 Consensus sequence: SBCCCCGCCSBB Reverse complement motif 0.074074 0.407407 0.222222 0.296296 0.111111 0.259259 0.407407 0.222222 0.000000 0.370370 0.518519 0.111111 0.000000 0.296296 0.703704 0.000000 0.037037 0.000000 0.888889 0.074074 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.222222 0.777778 0.000000 0.000000 0.074074 0.888889 0.037037 0.000000 0.037037 0.888889 0.074074 0.111111 0.333333 0.407407 0.148148 0.000000 0.370370 0.444444 0.185185 Consensus sequence: BBSGGCGGGGBS Alignment: BBSGGCGGGGBS -HSCACGTGGC- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 22 CACTGTGrYrtCACAGTGswsCAcT Reverse Complement Reverse Complement Backward 10 10 0.088322 Original motif 0.111111 0.746032 0.063492 0.079365 0.857143 0.047619 0.047619 0.047619 0.047619 0.857143 0.079365 0.015873 0.031746 0.000000 0.000000 0.968254 0.031746 0.015873 0.904762 0.047619 0.000000 0.000000 0.000000 1.000000 0.031746 0.000000 0.857143 0.111111 0.396825 0.111111 0.412698 0.079365 0.031746 0.253968 0.015873 0.698413 0.365079 0.000000 0.634921 0.000000 0.079365 0.206349 0.047619 0.666667 0.047619 0.936508 0.015873 0.000000 0.952381 0.000000 0.015873 0.031746 0.015873 0.920635 0.000000 0.063492 0.920635 0.000000 0.000000 0.079365 0.063492 0.047619 0.841270 0.047619 0.000000 0.000000 0.015873 0.984127 0.047619 0.015873 0.904762 0.031746 0.015873 0.603175 0.317460 0.063492 0.396825 0.000000 0.015873 0.587302 0.015873 0.476190 0.428571 0.079365 0.063492 0.920635 0.000000 0.015873 0.920635 0.015873 0.047619 0.015873 0.095238 0.682540 0.095238 0.126984 0.047619 0.015873 0.095238 0.841270 Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif 0.841270 0.015873 0.095238 0.047619 0.095238 0.095238 0.682540 0.126984 0.015873 0.015873 0.047619 0.920635 0.063492 0.000000 0.920635 0.015873 0.015873 0.428571 0.476190 0.079365 0.587302 0.000000 0.015873 0.396825 0.015873 0.317460 0.603175 0.063492 0.047619 0.904762 0.015873 0.031746 0.984127 0.000000 0.015873 0.000000 0.063492 0.841270 0.047619 0.047619 0.079365 0.000000 0.000000 0.920635 0.015873 0.000000 0.920635 0.063492 0.031746 0.000000 0.015873 0.952381 0.047619 0.015873 0.936508 0.000000 0.666667 0.206349 0.047619 0.079365 0.365079 0.634921 0.000000 0.000000 0.698413 0.253968 0.015873 0.031746 0.396825 0.412698 0.111111 0.079365 0.031746 0.857143 0.000000 0.111111 1.000000 0.000000 0.000000 0.000000 0.031746 0.904762 0.015873 0.047619 0.968254 0.000000 0.000000 0.031746 0.047619 0.079365 0.857143 0.015873 0.047619 0.047619 0.047619 0.857143 0.111111 0.063492 0.746032 0.079365 Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG Alignment: AGTGSWSCACTGTGAMAMCACAGTG ------GCCACGTGSD--------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 20 CagTGCTCCACTGTGgT Reverse Complement Reverse Complement Backward 7 10 0.094301 Original motif 0.150000 0.700000 0.016667 0.133333 0.650000 0.150000 0.050000 0.150000 0.166667 0.116667 0.633333 0.083333 0.050000 0.033333 0.066667 0.850000 0.050000 0.000000 0.833333 0.116667 0.016667 0.966667 0.000000 0.016667 0.050000 0.016667 0.000000 0.933333 0.066667 0.833333 0.066667 0.033333 0.033333 0.966667 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.050000 0.916667 0.016667 0.016667 0.166667 0.000000 0.000000 0.833333 0.083333 0.016667 0.900000 0.000000 0.000000 0.016667 0.016667 0.966667 0.000000 0.016667 0.966667 0.016667 0.116667 0.166667 0.483333 0.233333 0.066667 0.083333 0.050000 0.800000 Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif 0.800000 0.083333 0.050000 0.066667 0.116667 0.483333 0.166667 0.233333 0.000000 0.966667 0.016667 0.016667 0.966667 0.016667 0.016667 0.000000 0.083333 0.900000 0.016667 0.000000 0.833333 0.000000 0.000000 0.166667 0.050000 0.016667 0.916667 0.016667 0.000000 0.000000 0.000000 1.000000 0.033333 0.000000 0.966667 0.000000 0.066667 0.066667 0.833333 0.033333 0.933333 0.016667 0.000000 0.050000 0.016667 0.000000 0.966667 0.016667 0.050000 0.833333 0.000000 0.116667 0.850000 0.033333 0.066667 0.050000 0.166667 0.633333 0.116667 0.083333 0.150000 0.150000 0.050000 0.650000 0.150000 0.016667 0.700000 0.133333 Consensus sequence: ABCACAGTGGAGCACTG Alignment: ABCACAGTGGAGCACTG -GCCACGTGSD------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 27 AgTGCTCCACTGTGgTGTCACAgT Reverse Complement Reverse Complement Backward 6 10 0.094936 Original motif 0.690141 0.126761 0.042254 0.140845 0.169014 0.098592 0.676056 0.056338 0.042254 0.028169 0.028169 0.901408 0.056338 0.000000 0.774648 0.169014 0.042254 0.887324 0.042254 0.028169 0.000000 0.014085 0.000000 0.985915 0.056338 0.830986 0.042254 0.070423 0.028169 0.957746 0.014085 0.000000 0.957746 0.000000 0.014085 0.028169 0.084507 0.845070 0.014085 0.056338 0.028169 0.014085 0.000000 0.957746 0.140845 0.028169 0.802817 0.028169 0.014085 0.014085 0.014085 0.957746 0.014085 0.000000 0.929577 0.056338 0.056338 0.154930 0.619718 0.169014 0.014085 0.028169 0.000000 0.957746 0.056338 0.014085 0.873239 0.056338 0.014085 0.000000 0.000000 0.985915 0.042254 0.929577 0.000000 0.028169 0.957746 0.028169 0.000000 0.014085 0.028169 0.845070 0.028169 0.098592 0.873239 0.014085 0.042254 0.070423 0.098592 0.154930 0.563380 0.183099 0.070423 0.014085 0.112676 0.802817 Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif 0.802817 0.014085 0.112676 0.070423 0.098592 0.563380 0.154930 0.183099 0.070423 0.014085 0.042254 0.873239 0.028169 0.028169 0.845070 0.098592 0.014085 0.028169 0.000000 0.957746 0.042254 0.000000 0.929577 0.028169 0.985915 0.000000 0.000000 0.014085 0.056338 0.873239 0.014085 0.056338 0.957746 0.028169 0.000000 0.014085 0.056338 0.619718 0.154930 0.169014 0.014085 0.929577 0.000000 0.056338 0.957746 0.014085 0.014085 0.014085 0.140845 0.802817 0.028169 0.028169 0.957746 0.014085 0.000000 0.028169 0.084507 0.014085 0.845070 0.056338 0.028169 0.000000 0.014085 0.957746 0.028169 0.014085 0.957746 0.000000 0.056338 0.042254 0.830986 0.070423 0.985915 0.014085 0.000000 0.000000 0.042254 0.042254 0.887324 0.028169 0.056338 0.774648 0.000000 0.169014 0.901408 0.028169 0.028169 0.042254 0.169014 0.676056 0.098592 0.056338 0.140845 0.126761 0.042254 0.690141 Consensus sequence: ACTGTGACACCACAGTGGAGCACT Alignment: ACTGTGACACCACAGTGGAGCACT ---------GCCACGTGSD----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 23 TGGAGCACTGTGACAcCACAGTGg Original Motif Original Motif Backward 1 10 0.095511 Original motif 0.054054 0.040541 0.054054 0.851351 0.040541 0.013514 0.824324 0.121622 0.094595 0.135135 0.756757 0.013514 0.891892 0.000000 0.000000 0.108108 0.040541 0.094595 0.810811 0.054054 0.081081 0.797297 0.054054 0.067568 0.932432 0.027027 0.000000 0.040541 0.054054 0.756757 0.135135 0.054054 0.108108 0.027027 0.013514 0.851351 0.108108 0.000000 0.851351 0.040541 0.013514 0.000000 0.027027 0.959459 0.000000 0.013514 0.945946 0.040541 0.905405 0.000000 0.067568 0.027027 0.054054 0.837838 0.000000 0.108108 0.945946 0.013514 0.040541 0.000000 0.162162 0.500000 0.189189 0.148649 0.108108 0.824324 0.000000 0.067568 0.945946 0.000000 0.040541 0.013514 0.081081 0.837838 0.027027 0.054054 0.945946 0.000000 0.013514 0.040541 0.054054 0.067568 0.783784 0.094595 0.054054 0.027027 0.000000 0.918919 0.040541 0.013514 0.864865 0.081081 0.148649 0.121622 0.675676 0.054054 Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif 0.148649 0.675676 0.121622 0.054054 0.040541 0.864865 0.013514 0.081081 0.918919 0.027027 0.000000 0.054054 0.054054 0.783784 0.067568 0.094595 0.040541 0.000000 0.013514 0.945946 0.081081 0.027027 0.837838 0.054054 0.013514 0.000000 0.040541 0.945946 0.108108 0.000000 0.824324 0.067568 0.162162 0.189189 0.500000 0.148649 0.000000 0.013514 0.040541 0.945946 0.054054 0.000000 0.837838 0.108108 0.027027 0.000000 0.067568 0.905405 0.000000 0.945946 0.013514 0.040541 0.959459 0.000000 0.027027 0.013514 0.108108 0.851351 0.000000 0.040541 0.851351 0.027027 0.013514 0.108108 0.054054 0.135135 0.756757 0.054054 0.040541 0.027027 0.000000 0.932432 0.081081 0.054054 0.797297 0.067568 0.040541 0.810811 0.094595 0.054054 0.108108 0.000000 0.000000 0.891892 0.094595 0.756757 0.135135 0.013514 0.040541 0.824324 0.013514 0.121622 0.851351 0.040541 0.054054 0.054054 Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA Alignment: TGGAGCACTGTGACAVCACAGTGG --------------HSCACGTGGC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 26 CAcCACAGTGGAGCAct Reverse Complement Original Motif Forward 3 10 0.095963 Original motif 0.078125 0.734375 0.046875 0.140625 0.828125 0.046875 0.078125 0.046875 0.203125 0.484375 0.156250 0.156250 0.015625 0.984375 0.000000 0.000000 0.968750 0.015625 0.015625 0.000000 0.000000 0.906250 0.015625 0.078125 0.859375 0.000000 0.000000 0.140625 0.031250 0.000000 0.906250 0.062500 0.000000 0.015625 0.000000 0.984375 0.000000 0.000000 0.968750 0.031250 0.046875 0.062500 0.812500 0.078125 0.937500 0.015625 0.015625 0.031250 0.015625 0.031250 0.921875 0.031250 0.125000 0.796875 0.000000 0.078125 0.875000 0.046875 0.046875 0.031250 0.093750 0.656250 0.093750 0.156250 0.156250 0.078125 0.109375 0.656250 Consensus sequence: CAHCACAGTGGAGCACT Reverse complement motif 0.656250 0.078125 0.109375 0.156250 0.093750 0.093750 0.656250 0.156250 0.031250 0.046875 0.046875 0.875000 0.125000 0.000000 0.796875 0.078125 0.015625 0.921875 0.031250 0.031250 0.031250 0.015625 0.015625 0.937500 0.046875 0.812500 0.062500 0.078125 0.000000 0.968750 0.000000 0.031250 0.984375 0.015625 0.000000 0.000000 0.031250 0.906250 0.000000 0.062500 0.140625 0.000000 0.000000 0.859375 0.000000 0.015625 0.906250 0.078125 0.000000 0.015625 0.015625 0.968750 0.015625 0.000000 0.984375 0.000000 0.203125 0.156250 0.484375 0.156250 0.046875 0.046875 0.078125 0.828125 0.078125 0.046875 0.734375 0.140625 Consensus sequence: AGTGCTCCACTGTGDTG Alignment: CAHCACAGTGGAGCACT --GCCACGTGSD----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 32 gCGCGCsCgsG Original Motif Original Motif Forward 2 10 0.098993 Original motif 0.105263 0.210526 0.526316 0.157895 0.000000 0.736842 0.105263 0.157895 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.368421 0.631579 0.000000 0.000000 0.894737 0.105263 0.000000 0.157895 0.157895 0.631579 0.052632 0.052632 0.631579 0.263158 0.052632 0.105263 0.052632 0.789474 0.052632 Consensus sequence: GCGCGCSCGCG Reverse complement motif 0.105263 0.789474 0.052632 0.052632 0.052632 0.263158 0.631579 0.052632 0.157895 0.631579 0.157895 0.052632 0.000000 0.105263 0.894737 0.000000 0.000000 0.631579 0.368421 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.105263 0.736842 0.157895 0.105263 0.526316 0.210526 0.157895 Consensus sequence: CGCGSGCGCGC Alignment: GCGCGCSCGCG -HSCACGTGGC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 17 TgTGgTGTCACAGTGCTCC Reverse Complement Reverse Complement Forward 4 10 0.099169 Original motif 0.111111 0.083333 0.055556 0.750000 0.125000 0.097222 0.652778 0.125000 0.041667 0.097222 0.027778 0.833333 0.027778 0.027778 0.791667 0.152778 0.055556 0.166667 0.652778 0.125000 0.000000 0.041667 0.013889 0.944444 0.041667 0.000000 0.888889 0.069444 0.027778 0.027778 0.000000 0.944444 0.041667 0.944444 0.013889 0.000000 0.916667 0.027778 0.000000 0.055556 0.069444 0.875000 0.000000 0.055556 0.833333 0.013889 0.013889 0.138889 0.041667 0.069444 0.819444 0.069444 0.027778 0.027778 0.027778 0.916667 0.069444 0.013889 0.847222 0.069444 0.069444 0.777778 0.027778 0.125000 0.055556 0.041667 0.027778 0.875000 0.041667 0.708333 0.125000 0.125000 0.111111 0.819444 0.055556 0.013889 Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif 0.111111 0.055556 0.819444 0.013889 0.041667 0.125000 0.708333 0.125000 0.875000 0.041667 0.027778 0.055556 0.069444 0.027778 0.777778 0.125000 0.069444 0.847222 0.013889 0.069444 0.916667 0.027778 0.027778 0.027778 0.041667 0.819444 0.069444 0.069444 0.138889 0.013889 0.013889 0.833333 0.069444 0.000000 0.875000 0.055556 0.055556 0.027778 0.000000 0.916667 0.041667 0.013889 0.944444 0.000000 0.944444 0.027778 0.000000 0.027778 0.041667 0.888889 0.000000 0.069444 0.944444 0.041667 0.013889 0.000000 0.055556 0.652778 0.166667 0.125000 0.027778 0.791667 0.027778 0.152778 0.833333 0.097222 0.027778 0.041667 0.125000 0.652778 0.097222 0.125000 0.750000 0.083333 0.055556 0.111111 Consensus sequence: GGAGCACTGTGACACCACA Alignment: GGAGCACTGTGACACCACA ---GCCACGTGSD------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 28 ssGCkTGCssk Original Motif Reverse Complement Forward 1 10 0.101333 Original motif 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 0.500000 0.500000 Consensus sequence: SSGCKTGCSSK Reverse complement motif 0.000000 0.500000 0.000000 0.500000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.000000 0.500000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 Consensus sequence: YSSGCAYGCSS Alignment: YSSGCAYGCSS HSCACGTGGC- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 8 Motif name: Myc Original motif 0.295154 0.422907 0.158590 0.123348 0.149780 0.233480 0.572687 0.044053 0.035242 0.964758 0.000000 0.000000 0.955947 0.017621 0.022026 0.004405 0.000000 0.933921 0.013216 0.052863 0.083700 0.008811 0.898678 0.008811 0.039648 0.193833 0.000000 0.766520 0.000000 0.008811 0.951542 0.039648 0.000000 0.074890 0.806167 0.118943 0.198238 0.471366 0.105727 0.224670 Consensus sequence: VGCACGTGGH Reverse complement motif 0.198238 0.105727 0.471366 0.224670 0.000000 0.806167 0.074890 0.118943 0.000000 0.951542 0.008811 0.039648 0.766520 0.193833 0.000000 0.039648 0.083700 0.898678 0.008811 0.008811 0.000000 0.013216 0.933921 0.052863 0.004405 0.017621 0.022026 0.955947 0.035242 0.000000 0.964758 0.000000 0.149780 0.572687 0.233480 0.044053 0.295154 0.158590 0.422907 0.123348 Consensus sequence: DCCACGTGCV *************************************************************** Best Matches for Top Significant Motif ID 8 (Highest to Lowest) *************************************************************** Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 18 sscCCCGCGcs Reverse Complement Original Motif Forward 2 10 0.064853 Original motif 0.147059 0.441176 0.264706 0.147059 0.117647 0.529412 0.294118 0.058824 0.000000 0.676471 0.235294 0.088235 0.029412 0.852941 0.117647 0.000000 0.000000 0.823529 0.176471 0.000000 0.000000 0.794118 0.205882 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.058824 0.941176 0.000000 0.117647 0.470588 0.235294 0.176471 0.000000 0.323529 0.529412 0.147059 Consensus sequence: BSCCCCGCGBS Reverse complement motif 0.000000 0.529412 0.323529 0.147059 0.117647 0.235294 0.470588 0.176471 0.000000 0.941176 0.058824 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.205882 0.794118 0.000000 0.000000 0.176471 0.823529 0.000000 0.029412 0.117647 0.852941 0.000000 0.000000 0.235294 0.676471 0.088235 0.117647 0.294118 0.529412 0.058824 0.147059 0.264706 0.441176 0.147059 Consensus sequence: SBCGCGGGGSB Alignment: BSCCCCGCGBS -DCCACGTGCV ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 24 ssCCCCGCSssk Reverse Complement Original Motif Backward 2 10 0.072859 Original motif 0.000000 0.444444 0.370370 0.185185 0.111111 0.407407 0.333333 0.148148 0.000000 0.888889 0.037037 0.074074 0.000000 0.888889 0.074074 0.037037 0.000000 0.777778 0.222222 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.037037 0.888889 0.000000 0.074074 0.000000 0.703704 0.296296 0.000000 0.000000 0.518519 0.370370 0.111111 0.111111 0.407407 0.259259 0.222222 0.074074 0.222222 0.407407 0.296296 Consensus sequence: SBCCCCGCCSBB Reverse complement motif 0.074074 0.407407 0.222222 0.296296 0.111111 0.259259 0.407407 0.222222 0.000000 0.370370 0.518519 0.111111 0.000000 0.296296 0.703704 0.000000 0.037037 0.000000 0.888889 0.074074 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.222222 0.777778 0.000000 0.000000 0.074074 0.888889 0.037037 0.000000 0.037037 0.888889 0.074074 0.111111 0.333333 0.407407 0.148148 0.000000 0.370370 0.444444 0.185185 Consensus sequence: BBSGGCGGGGBS Alignment: SBCCCCGCCSBB -DCCACGTGCV- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 22 CACTGTGrYrtCACAGTGswsCAcT Reverse Complement Original Motif Backward 6 10 0.088891 Original motif 0.111111 0.746032 0.063492 0.079365 0.857143 0.047619 0.047619 0.047619 0.047619 0.857143 0.079365 0.015873 0.031746 0.000000 0.000000 0.968254 0.031746 0.015873 0.904762 0.047619 0.000000 0.000000 0.000000 1.000000 0.031746 0.000000 0.857143 0.111111 0.396825 0.111111 0.412698 0.079365 0.031746 0.253968 0.015873 0.698413 0.365079 0.000000 0.634921 0.000000 0.079365 0.206349 0.047619 0.666667 0.047619 0.936508 0.015873 0.000000 0.952381 0.000000 0.015873 0.031746 0.015873 0.920635 0.000000 0.063492 0.920635 0.000000 0.000000 0.079365 0.063492 0.047619 0.841270 0.047619 0.000000 0.000000 0.015873 0.984127 0.047619 0.015873 0.904762 0.031746 0.015873 0.603175 0.317460 0.063492 0.396825 0.000000 0.015873 0.587302 0.015873 0.476190 0.428571 0.079365 0.063492 0.920635 0.000000 0.015873 0.920635 0.015873 0.047619 0.015873 0.095238 0.682540 0.095238 0.126984 0.047619 0.015873 0.095238 0.841270 Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif 0.841270 0.015873 0.095238 0.047619 0.095238 0.095238 0.682540 0.126984 0.015873 0.015873 0.047619 0.920635 0.063492 0.000000 0.920635 0.015873 0.015873 0.428571 0.476190 0.079365 0.587302 0.000000 0.015873 0.396825 0.015873 0.317460 0.603175 0.063492 0.047619 0.904762 0.015873 0.031746 0.984127 0.000000 0.015873 0.000000 0.063492 0.841270 0.047619 0.047619 0.079365 0.000000 0.000000 0.920635 0.015873 0.000000 0.920635 0.063492 0.031746 0.000000 0.015873 0.952381 0.047619 0.015873 0.936508 0.000000 0.666667 0.206349 0.047619 0.079365 0.365079 0.634921 0.000000 0.000000 0.698413 0.253968 0.015873 0.031746 0.396825 0.412698 0.111111 0.079365 0.031746 0.857143 0.000000 0.111111 1.000000 0.000000 0.000000 0.000000 0.031746 0.904762 0.015873 0.047619 0.968254 0.000000 0.000000 0.031746 0.047619 0.079365 0.857143 0.015873 0.047619 0.047619 0.047619 0.857143 0.111111 0.063492 0.746032 0.079365 Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG Alignment: CACTGTGRTRTCACAGTGSWSCACT ----------DCCACGTGCV----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 20 CagTGCTCCACTGTGgT Reverse Complement Reverse Complement Backward 7 10 0.095523 Original motif 0.150000 0.700000 0.016667 0.133333 0.650000 0.150000 0.050000 0.150000 0.166667 0.116667 0.633333 0.083333 0.050000 0.033333 0.066667 0.850000 0.050000 0.000000 0.833333 0.116667 0.016667 0.966667 0.000000 0.016667 0.050000 0.016667 0.000000 0.933333 0.066667 0.833333 0.066667 0.033333 0.033333 0.966667 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.050000 0.916667 0.016667 0.016667 0.166667 0.000000 0.000000 0.833333 0.083333 0.016667 0.900000 0.000000 0.000000 0.016667 0.016667 0.966667 0.000000 0.016667 0.966667 0.016667 0.116667 0.166667 0.483333 0.233333 0.066667 0.083333 0.050000 0.800000 Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif 0.800000 0.083333 0.050000 0.066667 0.116667 0.483333 0.166667 0.233333 0.000000 0.966667 0.016667 0.016667 0.966667 0.016667 0.016667 0.000000 0.083333 0.900000 0.016667 0.000000 0.833333 0.000000 0.000000 0.166667 0.050000 0.016667 0.916667 0.016667 0.000000 0.000000 0.000000 1.000000 0.033333 0.000000 0.966667 0.000000 0.066667 0.066667 0.833333 0.033333 0.933333 0.016667 0.000000 0.050000 0.016667 0.000000 0.966667 0.016667 0.050000 0.833333 0.000000 0.116667 0.850000 0.033333 0.066667 0.050000 0.166667 0.633333 0.116667 0.083333 0.150000 0.150000 0.050000 0.650000 0.150000 0.016667 0.700000 0.133333 Consensus sequence: ABCACAGTGGAGCACTG Alignment: ABCACAGTGGAGCACTG -DCCACGTGCV------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 23 TGGAGCACTGTGACAcCACAGTGg Reverse Complement Original Motif Backward 11 10 0.097113 Original motif 0.054054 0.040541 0.054054 0.851351 0.040541 0.013514 0.824324 0.121622 0.094595 0.135135 0.756757 0.013514 0.891892 0.000000 0.000000 0.108108 0.040541 0.094595 0.810811 0.054054 0.081081 0.797297 0.054054 0.067568 0.932432 0.027027 0.000000 0.040541 0.054054 0.756757 0.135135 0.054054 0.108108 0.027027 0.013514 0.851351 0.108108 0.000000 0.851351 0.040541 0.013514 0.000000 0.027027 0.959459 0.000000 0.013514 0.945946 0.040541 0.905405 0.000000 0.067568 0.027027 0.054054 0.837838 0.000000 0.108108 0.945946 0.013514 0.040541 0.000000 0.162162 0.500000 0.189189 0.148649 0.108108 0.824324 0.000000 0.067568 0.945946 0.000000 0.040541 0.013514 0.081081 0.837838 0.027027 0.054054 0.945946 0.000000 0.013514 0.040541 0.054054 0.067568 0.783784 0.094595 0.054054 0.027027 0.000000 0.918919 0.040541 0.013514 0.864865 0.081081 0.148649 0.121622 0.675676 0.054054 Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif 0.148649 0.675676 0.121622 0.054054 0.040541 0.864865 0.013514 0.081081 0.918919 0.027027 0.000000 0.054054 0.054054 0.783784 0.067568 0.094595 0.040541 0.000000 0.013514 0.945946 0.081081 0.027027 0.837838 0.054054 0.013514 0.000000 0.040541 0.945946 0.108108 0.000000 0.824324 0.067568 0.162162 0.189189 0.500000 0.148649 0.000000 0.013514 0.040541 0.945946 0.054054 0.000000 0.837838 0.108108 0.027027 0.000000 0.067568 0.905405 0.000000 0.945946 0.013514 0.040541 0.959459 0.000000 0.027027 0.013514 0.108108 0.851351 0.000000 0.040541 0.851351 0.027027 0.013514 0.108108 0.054054 0.135135 0.756757 0.054054 0.040541 0.027027 0.000000 0.932432 0.081081 0.054054 0.797297 0.067568 0.040541 0.810811 0.094595 0.054054 0.108108 0.000000 0.000000 0.891892 0.094595 0.756757 0.135135 0.013514 0.040541 0.824324 0.013514 0.121622 0.851351 0.040541 0.054054 0.054054 Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA Alignment: TGGAGCACTGTGACAVCACAGTGG ----DCCACGTGCV---------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 25 wwCCAmAGTCmt Original Motif Reverse Complement Forward 2 10 0.097404 Original motif 0.454545 0.045455 0.227273 0.272727 0.363636 0.136364 0.136364 0.363636 0.000000 1.000000 0.000000 0.000000 0.000000 0.954545 0.045455 0.000000 1.000000 0.000000 0.000000 0.000000 0.409091 0.590909 0.000000 0.000000 0.909091 0.045455 0.045455 0.000000 0.000000 0.000000 1.000000 0.000000 0.045455 0.000000 0.000000 0.954545 0.045455 0.909091 0.000000 0.045455 0.272727 0.318182 0.181818 0.227273 0.181818 0.227273 0.227273 0.363636 Consensus sequence: DDCCAMAGTCHB Reverse complement motif 0.363636 0.227273 0.227273 0.181818 0.272727 0.181818 0.318182 0.227273 0.045455 0.000000 0.909091 0.045455 0.954545 0.000000 0.000000 0.045455 0.000000 1.000000 0.000000 0.000000 0.000000 0.045455 0.045455 0.909091 0.409091 0.000000 0.590909 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.045455 0.954545 0.000000 0.000000 0.000000 1.000000 0.000000 0.363636 0.136364 0.136364 0.363636 0.272727 0.045455 0.227273 0.454545 Consensus sequence: VDGACTRTGGDD Alignment: VDGACTRTGGDD -VGCACGTGGH- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 26 CAcCACAGTGGAGCAct Reverse Complement Original Motif Forward 3 10 0.097970 Original motif 0.078125 0.734375 0.046875 0.140625 0.828125 0.046875 0.078125 0.046875 0.203125 0.484375 0.156250 0.156250 0.015625 0.984375 0.000000 0.000000 0.968750 0.015625 0.015625 0.000000 0.000000 0.906250 0.015625 0.078125 0.859375 0.000000 0.000000 0.140625 0.031250 0.000000 0.906250 0.062500 0.000000 0.015625 0.000000 0.984375 0.000000 0.000000 0.968750 0.031250 0.046875 0.062500 0.812500 0.078125 0.937500 0.015625 0.015625 0.031250 0.015625 0.031250 0.921875 0.031250 0.125000 0.796875 0.000000 0.078125 0.875000 0.046875 0.046875 0.031250 0.093750 0.656250 0.093750 0.156250 0.156250 0.078125 0.109375 0.656250 Consensus sequence: CAHCACAGTGGAGCACT Reverse complement motif 0.656250 0.078125 0.109375 0.156250 0.093750 0.093750 0.656250 0.156250 0.031250 0.046875 0.046875 0.875000 0.125000 0.000000 0.796875 0.078125 0.015625 0.921875 0.031250 0.031250 0.031250 0.015625 0.015625 0.937500 0.046875 0.812500 0.062500 0.078125 0.000000 0.968750 0.000000 0.031250 0.984375 0.015625 0.000000 0.000000 0.031250 0.906250 0.000000 0.062500 0.140625 0.000000 0.000000 0.859375 0.000000 0.015625 0.906250 0.078125 0.000000 0.015625 0.015625 0.968750 0.015625 0.000000 0.984375 0.000000 0.203125 0.156250 0.484375 0.156250 0.046875 0.046875 0.078125 0.828125 0.078125 0.046875 0.734375 0.140625 Consensus sequence: AGTGCTCCACTGTGDTG Alignment: CAHCACAGTGGAGCACT --DCCACGTGCV----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 27 AgTGCTCCACTGTGgTGTCACAgT Reverse Complement Reverse Complement Backward 6 10 0.098002 Original motif 0.690141 0.126761 0.042254 0.140845 0.169014 0.098592 0.676056 0.056338 0.042254 0.028169 0.028169 0.901408 0.056338 0.000000 0.774648 0.169014 0.042254 0.887324 0.042254 0.028169 0.000000 0.014085 0.000000 0.985915 0.056338 0.830986 0.042254 0.070423 0.028169 0.957746 0.014085 0.000000 0.957746 0.000000 0.014085 0.028169 0.084507 0.845070 0.014085 0.056338 0.028169 0.014085 0.000000 0.957746 0.140845 0.028169 0.802817 0.028169 0.014085 0.014085 0.014085 0.957746 0.014085 0.000000 0.929577 0.056338 0.056338 0.154930 0.619718 0.169014 0.014085 0.028169 0.000000 0.957746 0.056338 0.014085 0.873239 0.056338 0.014085 0.000000 0.000000 0.985915 0.042254 0.929577 0.000000 0.028169 0.957746 0.028169 0.000000 0.014085 0.028169 0.845070 0.028169 0.098592 0.873239 0.014085 0.042254 0.070423 0.098592 0.154930 0.563380 0.183099 0.070423 0.014085 0.112676 0.802817 Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif 0.802817 0.014085 0.112676 0.070423 0.098592 0.563380 0.154930 0.183099 0.070423 0.014085 0.042254 0.873239 0.028169 0.028169 0.845070 0.098592 0.014085 0.028169 0.000000 0.957746 0.042254 0.000000 0.929577 0.028169 0.985915 0.000000 0.000000 0.014085 0.056338 0.873239 0.014085 0.056338 0.957746 0.028169 0.000000 0.014085 0.056338 0.619718 0.154930 0.169014 0.014085 0.929577 0.000000 0.056338 0.957746 0.014085 0.014085 0.014085 0.140845 0.802817 0.028169 0.028169 0.957746 0.014085 0.000000 0.028169 0.084507 0.014085 0.845070 0.056338 0.028169 0.000000 0.014085 0.957746 0.028169 0.014085 0.957746 0.000000 0.056338 0.042254 0.830986 0.070423 0.985915 0.014085 0.000000 0.000000 0.042254 0.042254 0.887324 0.028169 0.056338 0.774648 0.000000 0.169014 0.901408 0.028169 0.028169 0.042254 0.169014 0.676056 0.098592 0.056338 0.140845 0.126761 0.042254 0.690141 Consensus sequence: ACTGTGACACCACAGTGGAGCACT Alignment: ACTGTGACACCACAGTGGAGCACT ---------DCCACGTGCV----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 32 gCGCGCsCgsG Original Motif Reverse Complement Backward 2 10 0.098912 Original motif 0.105263 0.210526 0.526316 0.157895 0.000000 0.736842 0.105263 0.157895 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.368421 0.631579 0.000000 0.000000 0.894737 0.105263 0.000000 0.157895 0.157895 0.631579 0.052632 0.052632 0.631579 0.263158 0.052632 0.105263 0.052632 0.789474 0.052632 Consensus sequence: GCGCGCSCGCG Reverse complement motif 0.105263 0.789474 0.052632 0.052632 0.052632 0.263158 0.631579 0.052632 0.157895 0.631579 0.157895 0.052632 0.000000 0.105263 0.894737 0.000000 0.000000 0.631579 0.368421 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.105263 0.736842 0.157895 0.105263 0.526316 0.210526 0.157895 Consensus sequence: CGCGSGCGCGC Alignment: CGCGSGCGCGC VGCACGTGGH- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 17 TgTGgTGTCACAGTGCTCC Reverse Complement Reverse Complement Forward 4 10 0.099320 Original motif 0.111111 0.083333 0.055556 0.750000 0.125000 0.097222 0.652778 0.125000 0.041667 0.097222 0.027778 0.833333 0.027778 0.027778 0.791667 0.152778 0.055556 0.166667 0.652778 0.125000 0.000000 0.041667 0.013889 0.944444 0.041667 0.000000 0.888889 0.069444 0.027778 0.027778 0.000000 0.944444 0.041667 0.944444 0.013889 0.000000 0.916667 0.027778 0.000000 0.055556 0.069444 0.875000 0.000000 0.055556 0.833333 0.013889 0.013889 0.138889 0.041667 0.069444 0.819444 0.069444 0.027778 0.027778 0.027778 0.916667 0.069444 0.013889 0.847222 0.069444 0.069444 0.777778 0.027778 0.125000 0.055556 0.041667 0.027778 0.875000 0.041667 0.708333 0.125000 0.125000 0.111111 0.819444 0.055556 0.013889 Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif 0.111111 0.055556 0.819444 0.013889 0.041667 0.125000 0.708333 0.125000 0.875000 0.041667 0.027778 0.055556 0.069444 0.027778 0.777778 0.125000 0.069444 0.847222 0.013889 0.069444 0.916667 0.027778 0.027778 0.027778 0.041667 0.819444 0.069444 0.069444 0.138889 0.013889 0.013889 0.833333 0.069444 0.000000 0.875000 0.055556 0.055556 0.027778 0.000000 0.916667 0.041667 0.013889 0.944444 0.000000 0.944444 0.027778 0.000000 0.027778 0.041667 0.888889 0.000000 0.069444 0.944444 0.041667 0.013889 0.000000 0.055556 0.652778 0.166667 0.125000 0.027778 0.791667 0.027778 0.152778 0.833333 0.097222 0.027778 0.041667 0.125000 0.652778 0.097222 0.125000 0.750000 0.083333 0.055556 0.111111 Consensus sequence: GGAGCACTGTGACACCACA Alignment: GGAGCACTGTGACACCACA ---DCCACGTGCV------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 11 Motif name: NR4A2 Original motif 0.615385 0.076923 0.230769 0.076923 0.928571 0.000000 0.071429 0.000000 0.000000 0.000000 0.928571 0.071429 0.214286 0.000000 0.785714 0.000000 0.142857 0.142857 0.000000 0.714286 0.000000 0.928571 0.000000 0.071429 1.000000 0.000000 0.000000 0.000000 0.230769 0.615385 0.153846 0.000000 Consensus sequence: AAGGTCAC Reverse complement motif 0.230769 0.153846 0.615385 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.928571 0.071429 0.714286 0.142857 0.000000 0.142857 0.214286 0.785714 0.000000 0.000000 0.000000 0.928571 0.000000 0.071429 0.000000 0.000000 0.071429 0.928571 0.076923 0.076923 0.230769 0.615385 Consensus sequence: GTGACCTT *************************************************************** Best Matches for Top Significant Motif ID 11 (Highest to Lowest) *************************************************************** Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 22 CACTGTGrYrtCACAGTGswsCAcT Original Motif Original Motif Forward 7 8 0.055724 Original motif 0.111111 0.746032 0.063492 0.079365 0.857143 0.047619 0.047619 0.047619 0.047619 0.857143 0.079365 0.015873 0.031746 0.000000 0.000000 0.968254 0.031746 0.015873 0.904762 0.047619 0.000000 0.000000 0.000000 1.000000 0.031746 0.000000 0.857143 0.111111 0.396825 0.111111 0.412698 0.079365 0.031746 0.253968 0.015873 0.698413 0.365079 0.000000 0.634921 0.000000 0.079365 0.206349 0.047619 0.666667 0.047619 0.936508 0.015873 0.000000 0.952381 0.000000 0.015873 0.031746 0.015873 0.920635 0.000000 0.063492 0.920635 0.000000 0.000000 0.079365 0.063492 0.047619 0.841270 0.047619 0.000000 0.000000 0.015873 0.984127 0.047619 0.015873 0.904762 0.031746 0.015873 0.603175 0.317460 0.063492 0.396825 0.000000 0.015873 0.587302 0.015873 0.476190 0.428571 0.079365 0.063492 0.920635 0.000000 0.015873 0.920635 0.015873 0.047619 0.015873 0.095238 0.682540 0.095238 0.126984 0.047619 0.015873 0.095238 0.841270 Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif 0.841270 0.015873 0.095238 0.047619 0.095238 0.095238 0.682540 0.126984 0.015873 0.015873 0.047619 0.920635 0.063492 0.000000 0.920635 0.015873 0.015873 0.428571 0.476190 0.079365 0.587302 0.000000 0.015873 0.396825 0.015873 0.317460 0.603175 0.063492 0.047619 0.904762 0.015873 0.031746 0.984127 0.000000 0.015873 0.000000 0.063492 0.841270 0.047619 0.047619 0.079365 0.000000 0.000000 0.920635 0.015873 0.000000 0.920635 0.063492 0.031746 0.000000 0.015873 0.952381 0.047619 0.015873 0.936508 0.000000 0.666667 0.206349 0.047619 0.079365 0.365079 0.634921 0.000000 0.000000 0.698413 0.253968 0.015873 0.031746 0.396825 0.412698 0.111111 0.079365 0.031746 0.857143 0.000000 0.111111 1.000000 0.000000 0.000000 0.000000 0.031746 0.904762 0.015873 0.047619 0.968254 0.000000 0.000000 0.031746 0.047619 0.079365 0.857143 0.015873 0.047619 0.047619 0.047619 0.857143 0.111111 0.063492 0.746032 0.079365 Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG Alignment: CACTGTGRTRTCACAGTGSWSCACT ------AAGGTCAC----------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 23 TGGAGCACTGTGACAcCACAGTGg Original Motif Reverse Complement Forward 8 8 0.060729 Original motif 0.054054 0.040541 0.054054 0.851351 0.040541 0.013514 0.824324 0.121622 0.094595 0.135135 0.756757 0.013514 0.891892 0.000000 0.000000 0.108108 0.040541 0.094595 0.810811 0.054054 0.081081 0.797297 0.054054 0.067568 0.932432 0.027027 0.000000 0.040541 0.054054 0.756757 0.135135 0.054054 0.108108 0.027027 0.013514 0.851351 0.108108 0.000000 0.851351 0.040541 0.013514 0.000000 0.027027 0.959459 0.000000 0.013514 0.945946 0.040541 0.905405 0.000000 0.067568 0.027027 0.054054 0.837838 0.000000 0.108108 0.945946 0.013514 0.040541 0.000000 0.162162 0.500000 0.189189 0.148649 0.108108 0.824324 0.000000 0.067568 0.945946 0.000000 0.040541 0.013514 0.081081 0.837838 0.027027 0.054054 0.945946 0.000000 0.013514 0.040541 0.054054 0.067568 0.783784 0.094595 0.054054 0.027027 0.000000 0.918919 0.040541 0.013514 0.864865 0.081081 0.148649 0.121622 0.675676 0.054054 Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif 0.148649 0.675676 0.121622 0.054054 0.040541 0.864865 0.013514 0.081081 0.918919 0.027027 0.000000 0.054054 0.054054 0.783784 0.067568 0.094595 0.040541 0.000000 0.013514 0.945946 0.081081 0.027027 0.837838 0.054054 0.013514 0.000000 0.040541 0.945946 0.108108 0.000000 0.824324 0.067568 0.162162 0.189189 0.500000 0.148649 0.000000 0.013514 0.040541 0.945946 0.054054 0.000000 0.837838 0.108108 0.027027 0.000000 0.067568 0.905405 0.000000 0.945946 0.013514 0.040541 0.959459 0.000000 0.027027 0.013514 0.108108 0.851351 0.000000 0.040541 0.851351 0.027027 0.013514 0.108108 0.054054 0.135135 0.756757 0.054054 0.040541 0.027027 0.000000 0.932432 0.081081 0.054054 0.797297 0.067568 0.040541 0.810811 0.094595 0.054054 0.108108 0.000000 0.000000 0.891892 0.094595 0.756757 0.135135 0.013514 0.040541 0.824324 0.013514 0.121622 0.851351 0.040541 0.054054 0.054054 Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA Alignment: CCACTGTGVTGTCACAGTGCTCCA -------AAGGTCAC--------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 21 AmTGTGACACCACAGT Original Motif Reverse Complement Forward 6 8 0.064515 Original motif 0.703125 0.187500 0.015625 0.093750 0.265625 0.500000 0.125000 0.109375 0.015625 0.046875 0.031250 0.906250 0.078125 0.015625 0.890625 0.015625 0.000000 0.000000 0.000000 1.000000 0.000000 0.031250 0.906250 0.062500 0.953125 0.000000 0.015625 0.031250 0.046875 0.890625 0.000000 0.062500 0.968750 0.000000 0.015625 0.015625 0.109375 0.781250 0.062500 0.046875 0.062500 0.890625 0.000000 0.046875 0.953125 0.000000 0.031250 0.015625 0.031250 0.781250 0.046875 0.140625 0.937500 0.015625 0.031250 0.015625 0.093750 0.078125 0.734375 0.093750 0.031250 0.078125 0.000000 0.890625 Consensus sequence: AMTGTGACACCACAGT Reverse complement motif 0.890625 0.078125 0.000000 0.031250 0.093750 0.734375 0.078125 0.093750 0.015625 0.015625 0.031250 0.937500 0.031250 0.046875 0.781250 0.140625 0.015625 0.000000 0.031250 0.953125 0.062500 0.000000 0.890625 0.046875 0.109375 0.062500 0.781250 0.046875 0.015625 0.000000 0.015625 0.968750 0.046875 0.000000 0.890625 0.062500 0.031250 0.000000 0.015625 0.953125 0.000000 0.906250 0.031250 0.062500 1.000000 0.000000 0.000000 0.000000 0.078125 0.890625 0.015625 0.015625 0.906250 0.046875 0.031250 0.015625 0.265625 0.125000 0.500000 0.109375 0.093750 0.187500 0.015625 0.703125 Consensus sequence: ACTGTGGTGTCACART Alignment: ACTGTGGTGTCACART -----AAGGTCAC--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 17 TgTGgTGTCACAGTGCTCC Original Motif Original Motif Backward 9 8 0.069551 Original motif 0.111111 0.083333 0.055556 0.750000 0.125000 0.097222 0.652778 0.125000 0.041667 0.097222 0.027778 0.833333 0.027778 0.027778 0.791667 0.152778 0.055556 0.166667 0.652778 0.125000 0.000000 0.041667 0.013889 0.944444 0.041667 0.000000 0.888889 0.069444 0.027778 0.027778 0.000000 0.944444 0.041667 0.944444 0.013889 0.000000 0.916667 0.027778 0.000000 0.055556 0.069444 0.875000 0.000000 0.055556 0.833333 0.013889 0.013889 0.138889 0.041667 0.069444 0.819444 0.069444 0.027778 0.027778 0.027778 0.916667 0.069444 0.013889 0.847222 0.069444 0.069444 0.777778 0.027778 0.125000 0.055556 0.041667 0.027778 0.875000 0.041667 0.708333 0.125000 0.125000 0.111111 0.819444 0.055556 0.013889 Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif 0.111111 0.055556 0.819444 0.013889 0.041667 0.125000 0.708333 0.125000 0.875000 0.041667 0.027778 0.055556 0.069444 0.027778 0.777778 0.125000 0.069444 0.847222 0.013889 0.069444 0.916667 0.027778 0.027778 0.027778 0.041667 0.819444 0.069444 0.069444 0.138889 0.013889 0.013889 0.833333 0.069444 0.000000 0.875000 0.055556 0.055556 0.027778 0.000000 0.916667 0.041667 0.013889 0.944444 0.000000 0.944444 0.027778 0.000000 0.027778 0.041667 0.888889 0.000000 0.069444 0.944444 0.041667 0.013889 0.000000 0.055556 0.652778 0.166667 0.125000 0.027778 0.791667 0.027778 0.152778 0.833333 0.097222 0.027778 0.041667 0.125000 0.652778 0.097222 0.125000 0.750000 0.083333 0.055556 0.111111 Consensus sequence: GGAGCACTGTGACACCACA Alignment: TGTGGTGTCACAGTGCTCC ---AAGGTCAC-------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 27 AgTGCTCCACTGTGgTGTCACAgT Original Motif Original Motif Backward 4 8 0.070983 Original motif 0.690141 0.126761 0.042254 0.140845 0.169014 0.098592 0.676056 0.056338 0.042254 0.028169 0.028169 0.901408 0.056338 0.000000 0.774648 0.169014 0.042254 0.887324 0.042254 0.028169 0.000000 0.014085 0.000000 0.985915 0.056338 0.830986 0.042254 0.070423 0.028169 0.957746 0.014085 0.000000 0.957746 0.000000 0.014085 0.028169 0.084507 0.845070 0.014085 0.056338 0.028169 0.014085 0.000000 0.957746 0.140845 0.028169 0.802817 0.028169 0.014085 0.014085 0.014085 0.957746 0.014085 0.000000 0.929577 0.056338 0.056338 0.154930 0.619718 0.169014 0.014085 0.028169 0.000000 0.957746 0.056338 0.014085 0.873239 0.056338 0.014085 0.000000 0.000000 0.985915 0.042254 0.929577 0.000000 0.028169 0.957746 0.028169 0.000000 0.014085 0.028169 0.845070 0.028169 0.098592 0.873239 0.014085 0.042254 0.070423 0.098592 0.154930 0.563380 0.183099 0.070423 0.014085 0.112676 0.802817 Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif 0.802817 0.014085 0.112676 0.070423 0.098592 0.563380 0.154930 0.183099 0.070423 0.014085 0.042254 0.873239 0.028169 0.028169 0.845070 0.098592 0.014085 0.028169 0.000000 0.957746 0.042254 0.000000 0.929577 0.028169 0.985915 0.000000 0.000000 0.014085 0.056338 0.873239 0.014085 0.056338 0.957746 0.028169 0.000000 0.014085 0.056338 0.619718 0.154930 0.169014 0.014085 0.929577 0.000000 0.056338 0.957746 0.014085 0.014085 0.014085 0.140845 0.802817 0.028169 0.028169 0.957746 0.014085 0.000000 0.028169 0.084507 0.014085 0.845070 0.056338 0.028169 0.000000 0.014085 0.957746 0.028169 0.014085 0.957746 0.000000 0.056338 0.042254 0.830986 0.070423 0.985915 0.014085 0.000000 0.000000 0.042254 0.042254 0.887324 0.028169 0.056338 0.774648 0.000000 0.169014 0.901408 0.028169 0.028169 0.042254 0.169014 0.676056 0.098592 0.056338 0.140845 0.126761 0.042254 0.690141 Consensus sequence: ACTGTGACACCACAGTGGAGCACT Alignment: AGTGCTCCACTGTGGTGTCACAGT -------------AAGGTCAC--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 29 cCGCGGrCACG Original Motif Original Motif Forward 3 8 0.077229 Original motif 0.000000 0.600000 0.200000 0.200000 0.000000 0.800000 0.000000 0.200000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.600000 0.000000 0.400000 0.000000 0.000000 0.800000 0.200000 0.000000 0.800000 0.000000 0.200000 0.000000 0.000000 0.800000 0.200000 0.000000 0.200000 0.000000 0.800000 0.000000 Consensus sequence: CCGCGGRCACG Reverse complement motif 0.200000 0.800000 0.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.200000 0.800000 0.000000 0.000000 0.000000 0.400000 0.600000 0.000000 0.800000 0.200000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.800000 0.200000 0.000000 0.200000 0.600000 0.200000 Consensus sequence: CGTGKCCGCGG Alignment: CCGCGGRCACG --AAGGTCAC- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 25 wwCCAmAGTCmt Original Motif Original Motif Forward 5 8 0.078840 Original motif 0.454545 0.045455 0.227273 0.272727 0.363636 0.136364 0.136364 0.363636 0.000000 1.000000 0.000000 0.000000 0.000000 0.954545 0.045455 0.000000 1.000000 0.000000 0.000000 0.000000 0.409091 0.590909 0.000000 0.000000 0.909091 0.045455 0.045455 0.000000 0.000000 0.000000 1.000000 0.000000 0.045455 0.000000 0.000000 0.954545 0.045455 0.909091 0.000000 0.045455 0.272727 0.318182 0.181818 0.227273 0.181818 0.227273 0.227273 0.363636 Consensus sequence: DDCCAMAGTCHB Reverse complement motif 0.363636 0.227273 0.227273 0.181818 0.272727 0.181818 0.318182 0.227273 0.045455 0.000000 0.909091 0.045455 0.954545 0.000000 0.000000 0.045455 0.000000 1.000000 0.000000 0.000000 0.000000 0.045455 0.045455 0.909091 0.409091 0.000000 0.590909 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.045455 0.954545 0.000000 0.000000 0.000000 1.000000 0.000000 0.363636 0.136364 0.136364 0.363636 0.272727 0.045455 0.227273 0.454545 Consensus sequence: VDGACTRTGGDD Alignment: DDCCAMAGTCHB ----AAGGTCAC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 20 CagTGCTCCACTGTGgT Reverse Complement Reverse Complement Forward 10 8 0.086404 Original motif 0.150000 0.700000 0.016667 0.133333 0.650000 0.150000 0.050000 0.150000 0.166667 0.116667 0.633333 0.083333 0.050000 0.033333 0.066667 0.850000 0.050000 0.000000 0.833333 0.116667 0.016667 0.966667 0.000000 0.016667 0.050000 0.016667 0.000000 0.933333 0.066667 0.833333 0.066667 0.033333 0.033333 0.966667 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.050000 0.916667 0.016667 0.016667 0.166667 0.000000 0.000000 0.833333 0.083333 0.016667 0.900000 0.000000 0.000000 0.016667 0.016667 0.966667 0.000000 0.016667 0.966667 0.016667 0.116667 0.166667 0.483333 0.233333 0.066667 0.083333 0.050000 0.800000 Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif 0.800000 0.083333 0.050000 0.066667 0.116667 0.483333 0.166667 0.233333 0.000000 0.966667 0.016667 0.016667 0.966667 0.016667 0.016667 0.000000 0.083333 0.900000 0.016667 0.000000 0.833333 0.000000 0.000000 0.166667 0.050000 0.016667 0.916667 0.016667 0.000000 0.000000 0.000000 1.000000 0.033333 0.000000 0.966667 0.000000 0.066667 0.066667 0.833333 0.033333 0.933333 0.016667 0.000000 0.050000 0.016667 0.000000 0.966667 0.016667 0.050000 0.833333 0.000000 0.116667 0.850000 0.033333 0.066667 0.050000 0.166667 0.633333 0.116667 0.083333 0.150000 0.150000 0.050000 0.650000 0.150000 0.016667 0.700000 0.133333 Consensus sequence: ABCACAGTGGAGCACTG Alignment: ABCACAGTGGAGCACTG ---------GTGACCTT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 28 ssGCkTGCssk Reverse Complement Original Motif Forward 5 7 0.568556 Original motif 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 0.500000 0.500000 Consensus sequence: SSGCKTGCSSK Reverse complement motif 0.000000 0.500000 0.000000 0.500000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.000000 0.500000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 Consensus sequence: YSSGCAYGCSS Alignment: SSGCKTGCSSK- ----GTGACCTT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 26 CAcCACAGTGGAGCAct Reverse Complement Original Motif Forward 11 7 0.581814 Original motif 0.078125 0.734375 0.046875 0.140625 0.828125 0.046875 0.078125 0.046875 0.203125 0.484375 0.156250 0.156250 0.015625 0.984375 0.000000 0.000000 0.968750 0.015625 0.015625 0.000000 0.000000 0.906250 0.015625 0.078125 0.859375 0.000000 0.000000 0.140625 0.031250 0.000000 0.906250 0.062500 0.000000 0.015625 0.000000 0.984375 0.000000 0.000000 0.968750 0.031250 0.046875 0.062500 0.812500 0.078125 0.937500 0.015625 0.015625 0.031250 0.015625 0.031250 0.921875 0.031250 0.125000 0.796875 0.000000 0.078125 0.875000 0.046875 0.046875 0.031250 0.093750 0.656250 0.093750 0.156250 0.156250 0.078125 0.109375 0.656250 Consensus sequence: CAHCACAGTGGAGCACT Reverse complement motif 0.656250 0.078125 0.109375 0.156250 0.093750 0.093750 0.656250 0.156250 0.031250 0.046875 0.046875 0.875000 0.125000 0.000000 0.796875 0.078125 0.015625 0.921875 0.031250 0.031250 0.031250 0.015625 0.015625 0.937500 0.046875 0.812500 0.062500 0.078125 0.000000 0.968750 0.000000 0.031250 0.984375 0.015625 0.000000 0.000000 0.031250 0.906250 0.000000 0.062500 0.140625 0.000000 0.000000 0.859375 0.000000 0.015625 0.906250 0.078125 0.000000 0.015625 0.015625 0.968750 0.015625 0.000000 0.984375 0.000000 0.203125 0.156250 0.484375 0.156250 0.046875 0.046875 0.078125 0.828125 0.078125 0.046875 0.734375 0.140625 Consensus sequence: AGTGCTCCACTGTGDTG Alignment: CAHCACAGTGGAGCACT- ----------GTGACCTT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 2 Motif ID: 25 Motif name: wwCCAmAGTCmt Original motif 0.454545 0.045455 0.227273 0.272727 0.363636 0.136364 0.136364 0.363636 0.000000 1.000000 0.000000 0.000000 0.000000 0.954545 0.045455 0.000000 1.000000 0.000000 0.000000 0.000000 0.409091 0.590909 0.000000 0.000000 0.909091 0.045455 0.045455 0.000000 0.000000 0.000000 1.000000 0.000000 0.045455 0.000000 0.000000 0.954545 0.045455 0.909091 0.000000 0.045455 0.272727 0.318182 0.181818 0.227273 0.181818 0.227273 0.227273 0.363636 Consensus sequence: DDCCAMAGTCHB Reverse complement motif 0.363636 0.227273 0.227273 0.181818 0.272727 0.181818 0.318182 0.227273 0.045455 0.000000 0.909091 0.045455 0.954545 0.000000 0.000000 0.045455 0.000000 1.000000 0.000000 0.000000 0.000000 0.045455 0.045455 0.909091 0.409091 0.000000 0.590909 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.045455 0.954545 0.000000 0.000000 0.000000 1.000000 0.000000 0.363636 0.136364 0.136364 0.363636 0.272727 0.045455 0.227273 0.454545 Consensus sequence: VDGACTRTGGDD *************************************************************** Best Matches for Top Significant Motif ID 25 (Highest to Lowest) *************************************************************** Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 1 HNF4A Original Motif Original Motif Forward 2 12 0.032442 Original motif 0.417910 0.104478 0.402985 0.074627 0.029851 0.029851 0.835821 0.104478 0.179104 0.059701 0.522388 0.238806 0.074627 0.343284 0.298507 0.283582 0.044776 0.761194 0.059701 0.134328 0.880597 0.014925 0.044776 0.059701 0.791045 0.029851 0.149254 0.029851 0.835821 0.014925 0.119403 0.029851 0.059701 0.059701 0.865672 0.014925 0.089552 0.029851 0.492537 0.388060 0.044776 0.328358 0.164179 0.462687 0.059701 0.731343 0.074627 0.134328 0.626866 0.104478 0.149254 0.119403 Consensus sequence: RGGBCAAAGKYCA Reverse complement motif 0.119403 0.104478 0.149254 0.626866 0.059701 0.074627 0.731343 0.134328 0.462687 0.328358 0.164179 0.044776 0.089552 0.492537 0.029851 0.388060 0.059701 0.865672 0.059701 0.014925 0.029851 0.014925 0.119403 0.835821 0.029851 0.029851 0.149254 0.791045 0.059701 0.014925 0.044776 0.880597 0.044776 0.059701 0.761194 0.134328 0.074627 0.298507 0.343284 0.283582 0.179104 0.522388 0.059701 0.238806 0.029851 0.835821 0.029851 0.104478 0.074627 0.104478 0.402985 0.417910 Consensus sequence: TGMYCTTTGBCCK Alignment: RGGBCAAAGKYCA -DDCCAMAGTCHB ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 7 REST Original Motif Reverse Complement Forward 4 12 0.039123 Original motif 0.132621 0.109365 0.230044 0.527970 0.036318 0.168441 0.091421 0.703820 0.047589 0.855354 0.031309 0.065748 0.906367 0.018727 0.058677 0.016230 0.021197 0.027431 0.945137 0.006234 0.076012 0.609346 0.201246 0.113396 0.980697 0.004359 0.007472 0.007472 0.001868 0.987547 0.007472 0.003113 0.021793 0.922167 0.012453 0.043587 0.568847 0.125234 0.100935 0.204984 0.136534 0.233791 0.077307 0.552369 0.024314 0.004364 0.966958 0.004364 0.012469 0.003117 0.983167 0.001247 0.877105 0.069869 0.021210 0.031815 0.008125 0.800000 0.145625 0.046250 0.983750 0.005625 0.004375 0.006250 0.026349 0.008156 0.959849 0.005646 0.128688 0.632141 0.114878 0.124294 0.229899 0.019472 0.432161 0.318467 0.133962 0.586792 0.200629 0.078616 0.112579 0.700629 0.023270 0.163522 Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif 0.112579 0.023270 0.700629 0.163522 0.133962 0.200629 0.586792 0.078616 0.229899 0.432161 0.019472 0.318467 0.128688 0.114878 0.632141 0.124294 0.026349 0.959849 0.008156 0.005646 0.006250 0.005625 0.004375 0.983750 0.008125 0.145625 0.800000 0.046250 0.031815 0.069869 0.021210 0.877105 0.012469 0.983167 0.003117 0.001247 0.024314 0.966958 0.004364 0.004364 0.552369 0.233791 0.077307 0.136534 0.204984 0.125234 0.100935 0.568847 0.021793 0.012453 0.922167 0.043587 0.001868 0.007472 0.987547 0.003113 0.007472 0.004359 0.007472 0.980697 0.076012 0.201246 0.609346 0.113396 0.021197 0.945137 0.027431 0.006234 0.016230 0.018727 0.058677 0.906367 0.047589 0.031309 0.855354 0.065748 0.703820 0.168441 0.091421 0.036318 0.527970 0.109365 0.230044 0.132621 Consensus sequence: GGYGCTGTCCATGGTGCTGAA Alignment: GGYGCTGTCCATGGTGCTGAA ---DDCCAMAGTCHB------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 3 ESR1 Original Motif Original Motif Backward 9 12 0.040730 Original motif 0.261242 0.256959 0.329764 0.152034 0.228632 0.170940 0.350427 0.250000 0.136752 0.369658 0.318376 0.175214 0.176596 0.487234 0.138298 0.197872 0.285106 0.493617 0.100000 0.121277 0.651163 0.059197 0.188161 0.101480 0.075949 0.016878 0.816456 0.090717 0.040000 0.037895 0.884211 0.037895 0.069474 0.086316 0.191579 0.652632 0.008421 0.829474 0.111579 0.050526 0.837895 0.027368 0.056842 0.077895 0.122105 0.526316 0.225263 0.126316 0.132632 0.581053 0.111579 0.174737 0.134737 0.543158 0.204211 0.117895 0.067368 0.040000 0.016842 0.875789 0.044211 0.046316 0.896842 0.012632 0.642105 0.223158 0.065263 0.069474 0.021053 0.917895 0.025263 0.035789 0.124211 0.743158 0.004211 0.128421 0.054737 0.347368 0.046316 0.551579 Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif 0.551579 0.347368 0.046316 0.054737 0.124211 0.004211 0.743158 0.128421 0.021053 0.025263 0.917895 0.035789 0.069474 0.223158 0.065263 0.642105 0.044211 0.896842 0.046316 0.012632 0.875789 0.040000 0.016842 0.067368 0.134737 0.204211 0.543158 0.117895 0.132632 0.111579 0.581053 0.174737 0.122105 0.225263 0.526316 0.126316 0.077895 0.027368 0.056842 0.837895 0.008421 0.111579 0.829474 0.050526 0.652632 0.086316 0.191579 0.069474 0.040000 0.884211 0.037895 0.037895 0.075949 0.816456 0.016878 0.090717 0.101480 0.059197 0.188161 0.651163 0.285106 0.100000 0.493617 0.121277 0.176596 0.138298 0.487234 0.197872 0.136752 0.318376 0.369658 0.175214 0.228632 0.350427 0.170940 0.250000 0.261242 0.329764 0.256959 0.152034 Consensus sequence: MGGTCAGGGTGACCTRDBHV Alignment: VDBHMAGGTCACCCTGACCY DDCCAMAGTCHB-------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 10 NR1H2RXRA Original Motif Original Motif Backward 2 12 0.046338 Original motif 0.680000 0.200000 0.000000 0.120000 0.680000 0.040000 0.200000 0.080000 0.800000 0.000000 0.200000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.040000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.000000 0.040000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.800000 0.040000 0.080000 0.080000 0.000000 0.600000 0.240000 0.160000 Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif 0.000000 0.240000 0.600000 0.160000 0.080000 0.040000 0.080000 0.800000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.040000 0.000000 0.000000 0.960000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.040000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.200000 0.800000 0.080000 0.040000 0.200000 0.680000 0.120000 0.200000 0.000000 0.680000 Consensus sequence: GTTGACCTTTGACCTTT Alignment: AAAGGTCAAAGGTCAAC ----DDCCAMAGTCHB- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 14 PPARGRXRA Original Motif Reverse Complement Forward 3 12 0.048041 Original motif 0.109685 0.369895 0.373396 0.147025 0.117716 0.193473 0.148019 0.540793 0.453488 0.026744 0.427907 0.091860 0.116144 0.003484 0.779326 0.101045 0.161253 0.017401 0.781903 0.039443 0.168213 0.149652 0.458237 0.223898 0.082271 0.633835 0.207416 0.076477 0.949015 0.024334 0.017381 0.009270 0.604867 0.055620 0.312862 0.026651 0.825231 0.005787 0.158565 0.010417 0.095017 0.002317 0.888760 0.013905 0.047509 0.010429 0.803013 0.139050 0.025492 0.114716 0.304751 0.555041 0.062645 0.643852 0.167053 0.126450 0.784223 0.067285 0.054524 0.093968 Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif 0.093968 0.067285 0.054524 0.784223 0.062645 0.167053 0.643852 0.126450 0.555041 0.114716 0.304751 0.025492 0.047509 0.803013 0.010429 0.139050 0.095017 0.888760 0.002317 0.013905 0.010417 0.005787 0.158565 0.825231 0.026651 0.055620 0.312862 0.604867 0.009270 0.024334 0.017381 0.949015 0.082271 0.207416 0.633835 0.076477 0.168213 0.458237 0.149652 0.223898 0.161253 0.781903 0.017401 0.039443 0.116144 0.779326 0.003484 0.101045 0.091860 0.026744 0.427907 0.453488 0.540793 0.193473 0.148019 0.117716 0.109685 0.373396 0.369895 0.147025 Consensus sequence: TGRCCTKTGHCCKAB Alignment: TGRCCTKTGHCCKAB --DDCCAMAGTCHB- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 2 NR2F1 Reverse Complement Original Motif Forward 3 12 0.050651 Original motif 0.000000 0.000000 0.153846 0.846154 0.076923 0.000000 0.923077 0.000000 0.923077 0.000000 0.076923 0.000000 0.461538 0.538462 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.230769 0.000000 0.769231 0.000000 0.153846 0.000000 0.846154 0.076923 0.000000 0.000000 0.923077 0.153846 0.000000 0.846154 0.000000 0.461538 0.307692 0.230769 0.000000 0.461538 0.384615 0.076923 0.076923 0.076923 0.769231 0.076923 0.076923 0.230769 0.461538 0.000000 0.307692 0.000000 0.230769 0.230769 0.538462 Consensus sequence: TGAMCTTTGMMCYT Reverse complement motif 0.538462 0.230769 0.230769 0.000000 0.230769 0.000000 0.461538 0.307692 0.076923 0.076923 0.769231 0.076923 0.076923 0.384615 0.076923 0.461538 0.000000 0.307692 0.230769 0.461538 0.153846 0.846154 0.000000 0.000000 0.923077 0.000000 0.000000 0.076923 0.846154 0.153846 0.000000 0.000000 0.769231 0.230769 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.461538 0.000000 0.538462 0.000000 0.000000 0.000000 0.076923 0.923077 0.076923 0.923077 0.000000 0.000000 0.846154 0.000000 0.153846 0.000000 Consensus sequence: AKGYYCAAAGRTCA Alignment: TGAMCTTTGMMCYT --VDGACTRTGGDD ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 16 CTCF Original Motif Reverse Complement Backward 8 12 0.052358 Original motif 0.095290 0.318729 0.083242 0.502738 0.182913 0.158817 0.453450 0.204819 0.307777 0.053669 0.491785 0.146769 0.061336 0.876232 0.023001 0.039430 0.008762 0.989047 0.000000 0.002191 0.814896 0.014239 0.071194 0.099671 0.043812 0.578313 0.365827 0.012048 0.117325 0.474781 0.052632 0.355263 0.933114 0.012061 0.035088 0.019737 0.005488 0.000000 0.991218 0.003293 0.365532 0.003293 0.621295 0.009879 0.059276 0.013172 0.553238 0.374314 0.013187 0.000000 0.978022 0.008791 0.061538 0.008791 0.851648 0.078022 0.114411 0.806381 0.005501 0.073707 0.409241 0.014301 0.557756 0.018702 0.090308 0.530837 0.338106 0.040749 0.128855 0.354626 0.080396 0.436123 0.442731 0.199339 0.292952 0.064978 Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif 0.064978 0.199339 0.292952 0.442731 0.436123 0.354626 0.080396 0.128855 0.090308 0.338106 0.530837 0.040749 0.409241 0.557756 0.014301 0.018702 0.114411 0.005501 0.806381 0.073707 0.061538 0.851648 0.008791 0.078022 0.013187 0.978022 0.000000 0.008791 0.059276 0.553238 0.013172 0.374314 0.365532 0.621295 0.003293 0.009879 0.005488 0.991218 0.000000 0.003293 0.019737 0.012061 0.035088 0.933114 0.117325 0.052632 0.474781 0.355263 0.043812 0.365827 0.578313 0.012048 0.099671 0.014239 0.071194 0.814896 0.008762 0.000000 0.989047 0.002191 0.061336 0.023001 0.876232 0.039430 0.307777 0.491785 0.053669 0.146769 0.182913 0.453450 0.158817 0.204819 0.502738 0.318729 0.083242 0.095290 Consensus sequence: BMSMGCCYMCTKSTGGMHM Alignment: BMSMGCCYMCTKSTGGMHM DDCCAMAGTCHB------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 9 ESR2 Original Motif Original Motif Backward 4 12 0.057672 Original motif 0.218487 0.450980 0.176471 0.154062 0.442577 0.142857 0.114846 0.299720 0.521008 0.042017 0.431373 0.005602 0.075630 0.000000 0.770308 0.154062 0.050420 0.056022 0.893557 0.000000 0.036415 0.053221 0.092437 0.817927 0.000000 1.000000 0.000000 0.000000 0.943978 0.002801 0.000000 0.053221 0.137255 0.344538 0.316527 0.201681 0.179272 0.176471 0.417367 0.226891 0.145658 0.170868 0.411765 0.271709 0.058824 0.092437 0.067227 0.781513 0.176471 0.070028 0.742297 0.011204 0.498599 0.277311 0.053221 0.170868 0.095238 0.750700 0.005602 0.148459 0.128852 0.809524 0.000000 0.061625 0.075630 0.252101 0.000000 0.672269 0.168067 0.263305 0.380952 0.187675 Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif 0.168067 0.380952 0.263305 0.187675 0.672269 0.252101 0.000000 0.075630 0.128852 0.000000 0.809524 0.061625 0.095238 0.005602 0.750700 0.148459 0.170868 0.277311 0.053221 0.498599 0.176471 0.742297 0.070028 0.011204 0.781513 0.092437 0.067227 0.058824 0.145658 0.411765 0.170868 0.271709 0.179272 0.417367 0.176471 0.226891 0.137255 0.316527 0.344538 0.201681 0.053221 0.002801 0.000000 0.943978 0.000000 0.000000 1.000000 0.000000 0.817927 0.053221 0.092437 0.036415 0.050420 0.893557 0.056022 0.000000 0.075630 0.770308 0.000000 0.154062 0.005602 0.042017 0.431373 0.521008 0.299720 0.142857 0.114846 0.442577 0.218487 0.176471 0.450980 0.154062 Consensus sequence: BAGGYCABHBTGACCKHV Alignment: VHRGGTCABDBTGMCCTB ---DDCCAMAGTCHB--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 4 Esrrb Original Motif Original Motif Forward 2 11 0.525631 Original motif 0.290198 0.220264 0.271200 0.218337 0.184941 0.227810 0.376477 0.210772 0.115226 0.332236 0.331687 0.220850 0.070959 0.342466 0.122740 0.463836 0.084862 0.729264 0.171640 0.014235 0.909737 0.008753 0.067834 0.013676 0.975656 0.000547 0.016411 0.007385 0.008758 0.001368 0.981390 0.008484 0.005750 0.003286 0.986309 0.004655 0.049904 0.012613 0.066904 0.870579 0.002473 0.927473 0.046703 0.023352 0.951569 0.005504 0.035498 0.007430 Consensus sequence: VBBYCAAGGTCA Reverse complement motif 0.007430 0.005504 0.035498 0.951569 0.002473 0.046703 0.927473 0.023352 0.870579 0.012613 0.066904 0.049904 0.005750 0.986309 0.003286 0.004655 0.008758 0.981390 0.001368 0.008484 0.007385 0.000547 0.016411 0.975656 0.013676 0.008753 0.067834 0.909737 0.084862 0.171640 0.729264 0.014235 0.463836 0.342466 0.122740 0.070959 0.115226 0.331687 0.332236 0.220850 0.184941 0.376477 0.227810 0.210772 0.218337 0.220264 0.271200 0.290198 Consensus sequence: TGACCTTGMBBB Alignment: VBBYCAAGGTCA- -DDCCAMAGTCHB ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 8 Myc Reverse Complement Original Motif Backward 1 10 1.057800 Original motif 0.295154 0.422907 0.158590 0.123348 0.149780 0.233480 0.572687 0.044053 0.035242 0.964758 0.000000 0.000000 0.955947 0.017621 0.022026 0.004405 0.000000 0.933921 0.013216 0.052863 0.083700 0.008811 0.898678 0.008811 0.039648 0.193833 0.000000 0.766520 0.000000 0.008811 0.951542 0.039648 0.000000 0.074890 0.806167 0.118943 0.198238 0.471366 0.105727 0.224670 Consensus sequence: VGCACGTGGH Reverse complement motif 0.198238 0.105727 0.471366 0.224670 0.000000 0.806167 0.074890 0.118943 0.000000 0.951542 0.008811 0.039648 0.766520 0.193833 0.000000 0.039648 0.083700 0.898678 0.008811 0.008811 0.000000 0.013216 0.933921 0.052863 0.004405 0.017621 0.022026 0.955947 0.035242 0.000000 0.964758 0.000000 0.149780 0.572687 0.233480 0.044053 0.295154 0.158590 0.422907 0.123348 Consensus sequence: DCCACGTGCV Alignment: --VGCACGTGGH VDGACTRTGGDD ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 2 Motif ID: 28 Motif name: ssGCkTGCssk Original motif 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 0.500000 0.500000 Consensus sequence: SSGCKTGCSSK Reverse complement motif 0.000000 0.500000 0.000000 0.500000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.000000 0.500000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 Consensus sequence: YSSGCAYGCSS *************************************************************** Best Matches for Top Significant Motif ID 28 (Highest to Lowest) *************************************************************** Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 16 CTCF Original Motif Original Motif Forward 8 11 0.034944 Original motif 0.095290 0.318729 0.083242 0.502738 0.182913 0.158817 0.453450 0.204819 0.307777 0.053669 0.491785 0.146769 0.061336 0.876232 0.023001 0.039430 0.008762 0.989047 0.000000 0.002191 0.814896 0.014239 0.071194 0.099671 0.043812 0.578313 0.365827 0.012048 0.117325 0.474781 0.052632 0.355263 0.933114 0.012061 0.035088 0.019737 0.005488 0.000000 0.991218 0.003293 0.365532 0.003293 0.621295 0.009879 0.059276 0.013172 0.553238 0.374314 0.013187 0.000000 0.978022 0.008791 0.061538 0.008791 0.851648 0.078022 0.114411 0.806381 0.005501 0.073707 0.409241 0.014301 0.557756 0.018702 0.090308 0.530837 0.338106 0.040749 0.128855 0.354626 0.080396 0.436123 0.442731 0.199339 0.292952 0.064978 Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif 0.064978 0.199339 0.292952 0.442731 0.436123 0.354626 0.080396 0.128855 0.090308 0.338106 0.530837 0.040749 0.409241 0.557756 0.014301 0.018702 0.114411 0.005501 0.806381 0.073707 0.061538 0.851648 0.008791 0.078022 0.013187 0.978022 0.000000 0.008791 0.059276 0.553238 0.013172 0.374314 0.365532 0.621295 0.003293 0.009879 0.005488 0.991218 0.000000 0.003293 0.019737 0.012061 0.035088 0.933114 0.117325 0.052632 0.474781 0.355263 0.043812 0.365827 0.578313 0.012048 0.099671 0.014239 0.071194 0.814896 0.008762 0.000000 0.989047 0.002191 0.061336 0.023001 0.876232 0.039430 0.307777 0.491785 0.053669 0.146769 0.182913 0.453450 0.158817 0.204819 0.502738 0.318729 0.083242 0.095290 Consensus sequence: BMSMGCCYMCTKSTGGMHM Alignment: YDRCCASYAGRKGGCRSYV -------SSGCKTGCSSK- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 4 Esrrb Reverse Complement Original Motif Forward 2 11 0.035870 Original motif 0.290198 0.220264 0.271200 0.218337 0.184941 0.227810 0.376477 0.210772 0.115226 0.332236 0.331687 0.220850 0.070959 0.342466 0.122740 0.463836 0.084862 0.729264 0.171640 0.014235 0.909737 0.008753 0.067834 0.013676 0.975656 0.000547 0.016411 0.007385 0.008758 0.001368 0.981390 0.008484 0.005750 0.003286 0.986309 0.004655 0.049904 0.012613 0.066904 0.870579 0.002473 0.927473 0.046703 0.023352 0.951569 0.005504 0.035498 0.007430 Consensus sequence: VBBYCAAGGTCA Reverse complement motif 0.007430 0.005504 0.035498 0.951569 0.002473 0.046703 0.927473 0.023352 0.870579 0.012613 0.066904 0.049904 0.005750 0.986309 0.003286 0.004655 0.008758 0.981390 0.001368 0.008484 0.007385 0.000547 0.016411 0.975656 0.013676 0.008753 0.067834 0.909737 0.084862 0.171640 0.729264 0.014235 0.463836 0.342466 0.122740 0.070959 0.115226 0.331687 0.332236 0.220850 0.184941 0.376477 0.227810 0.210772 0.218337 0.220264 0.271200 0.290198 Consensus sequence: TGACCTTGMBBB Alignment: VBBYCAAGGTCA -YSSGCAYGCSS ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 9 ESR2 Reverse Complement Original Motif Backward 3 11 0.037907 Original motif 0.218487 0.450980 0.176471 0.154062 0.442577 0.142857 0.114846 0.299720 0.521008 0.042017 0.431373 0.005602 0.075630 0.000000 0.770308 0.154062 0.050420 0.056022 0.893557 0.000000 0.036415 0.053221 0.092437 0.817927 0.000000 1.000000 0.000000 0.000000 0.943978 0.002801 0.000000 0.053221 0.137255 0.344538 0.316527 0.201681 0.179272 0.176471 0.417367 0.226891 0.145658 0.170868 0.411765 0.271709 0.058824 0.092437 0.067227 0.781513 0.176471 0.070028 0.742297 0.011204 0.498599 0.277311 0.053221 0.170868 0.095238 0.750700 0.005602 0.148459 0.128852 0.809524 0.000000 0.061625 0.075630 0.252101 0.000000 0.672269 0.168067 0.263305 0.380952 0.187675 Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif 0.168067 0.380952 0.263305 0.187675 0.672269 0.252101 0.000000 0.075630 0.128852 0.000000 0.809524 0.061625 0.095238 0.005602 0.750700 0.148459 0.170868 0.277311 0.053221 0.498599 0.176471 0.742297 0.070028 0.011204 0.781513 0.092437 0.067227 0.058824 0.145658 0.411765 0.170868 0.271709 0.179272 0.417367 0.176471 0.226891 0.137255 0.316527 0.344538 0.201681 0.053221 0.002801 0.000000 0.943978 0.000000 0.000000 1.000000 0.000000 0.817927 0.053221 0.092437 0.036415 0.050420 0.893557 0.056022 0.000000 0.075630 0.770308 0.000000 0.154062 0.005602 0.042017 0.431373 0.521008 0.299720 0.142857 0.114846 0.442577 0.218487 0.176471 0.450980 0.154062 Consensus sequence: BAGGYCABHBTGACCKHV Alignment: VHRGGTCABDBTGMCCTB -----YSSGCAYGCSS-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 7 REST Reverse Complement Original Motif Backward 10 11 0.040932 Original motif 0.132621 0.109365 0.230044 0.527970 0.036318 0.168441 0.091421 0.703820 0.047589 0.855354 0.031309 0.065748 0.906367 0.018727 0.058677 0.016230 0.021197 0.027431 0.945137 0.006234 0.076012 0.609346 0.201246 0.113396 0.980697 0.004359 0.007472 0.007472 0.001868 0.987547 0.007472 0.003113 0.021793 0.922167 0.012453 0.043587 0.568847 0.125234 0.100935 0.204984 0.136534 0.233791 0.077307 0.552369 0.024314 0.004364 0.966958 0.004364 0.012469 0.003117 0.983167 0.001247 0.877105 0.069869 0.021210 0.031815 0.008125 0.800000 0.145625 0.046250 0.983750 0.005625 0.004375 0.006250 0.026349 0.008156 0.959849 0.005646 0.128688 0.632141 0.114878 0.124294 0.229899 0.019472 0.432161 0.318467 0.133962 0.586792 0.200629 0.078616 0.112579 0.700629 0.023270 0.163522 Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif 0.112579 0.023270 0.700629 0.163522 0.133962 0.200629 0.586792 0.078616 0.229899 0.432161 0.019472 0.318467 0.128688 0.114878 0.632141 0.124294 0.026349 0.959849 0.008156 0.005646 0.006250 0.005625 0.004375 0.983750 0.008125 0.145625 0.800000 0.046250 0.031815 0.069869 0.021210 0.877105 0.012469 0.983167 0.003117 0.001247 0.024314 0.966958 0.004364 0.004364 0.552369 0.233791 0.077307 0.136534 0.204984 0.125234 0.100935 0.568847 0.021793 0.012453 0.922167 0.043587 0.001868 0.007472 0.987547 0.003113 0.007472 0.004359 0.007472 0.980697 0.076012 0.201246 0.609346 0.113396 0.021197 0.945137 0.027431 0.006234 0.016230 0.018727 0.058677 0.906367 0.047589 0.031309 0.855354 0.065748 0.703820 0.168441 0.091421 0.036318 0.527970 0.109365 0.230044 0.132621 Consensus sequence: GGYGCTGTCCATGGTGCTGAA Alignment: TTCAGCACCATGGACAGCKCC -YSSGCAYGCSS--------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 14 PPARGRXRA Reverse Complement Original Motif Forward 3 11 0.041419 Original motif 0.109685 0.369895 0.373396 0.147025 0.117716 0.193473 0.148019 0.540793 0.453488 0.026744 0.427907 0.091860 0.116144 0.003484 0.779326 0.101045 0.161253 0.017401 0.781903 0.039443 0.168213 0.149652 0.458237 0.223898 0.082271 0.633835 0.207416 0.076477 0.949015 0.024334 0.017381 0.009270 0.604867 0.055620 0.312862 0.026651 0.825231 0.005787 0.158565 0.010417 0.095017 0.002317 0.888760 0.013905 0.047509 0.010429 0.803013 0.139050 0.025492 0.114716 0.304751 0.555041 0.062645 0.643852 0.167053 0.126450 0.784223 0.067285 0.054524 0.093968 Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif 0.093968 0.067285 0.054524 0.784223 0.062645 0.167053 0.643852 0.126450 0.555041 0.114716 0.304751 0.025492 0.047509 0.803013 0.010429 0.139050 0.095017 0.888760 0.002317 0.013905 0.010417 0.005787 0.158565 0.825231 0.026651 0.055620 0.312862 0.604867 0.009270 0.024334 0.017381 0.949015 0.082271 0.207416 0.633835 0.076477 0.168213 0.458237 0.149652 0.223898 0.161253 0.781903 0.017401 0.039443 0.116144 0.779326 0.003484 0.101045 0.091860 0.026744 0.427907 0.453488 0.540793 0.193473 0.148019 0.117716 0.109685 0.373396 0.369895 0.147025 Consensus sequence: TGRCCTKTGHCCKAB Alignment: BTRGGDCARAGGKCA --YSSGCAYGCSS-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 1 HNF4A Reverse Complement Original Motif Forward 3 11 0.043798 Original motif 0.417910 0.104478 0.402985 0.074627 0.029851 0.029851 0.835821 0.104478 0.179104 0.059701 0.522388 0.238806 0.074627 0.343284 0.298507 0.283582 0.044776 0.761194 0.059701 0.134328 0.880597 0.014925 0.044776 0.059701 0.791045 0.029851 0.149254 0.029851 0.835821 0.014925 0.119403 0.029851 0.059701 0.059701 0.865672 0.014925 0.089552 0.029851 0.492537 0.388060 0.044776 0.328358 0.164179 0.462687 0.059701 0.731343 0.074627 0.134328 0.626866 0.104478 0.149254 0.119403 Consensus sequence: RGGBCAAAGKYCA Reverse complement motif 0.119403 0.104478 0.149254 0.626866 0.059701 0.074627 0.731343 0.134328 0.462687 0.328358 0.164179 0.044776 0.089552 0.492537 0.029851 0.388060 0.059701 0.865672 0.059701 0.014925 0.029851 0.014925 0.119403 0.835821 0.029851 0.029851 0.149254 0.791045 0.059701 0.014925 0.044776 0.880597 0.044776 0.059701 0.761194 0.134328 0.074627 0.298507 0.343284 0.283582 0.179104 0.522388 0.059701 0.238806 0.029851 0.835821 0.029851 0.104478 0.074627 0.104478 0.402985 0.417910 Consensus sequence: TGMYCTTTGBCCK Alignment: RGGBCAAAGKYCA --YSSGCAYGCSS ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 6 Mycn Original Motif Reverse Complement Forward 1 10 0.538870 Original motif 0.349315 0.363014 0.143836 0.143836 0.089041 0.388128 0.447489 0.075342 0.015982 0.984018 0.000000 0.000000 0.945205 0.000000 0.041096 0.013699 0.000000 0.961187 0.018265 0.020548 0.070776 0.002283 0.924658 0.002283 0.054795 0.221461 0.004566 0.719178 0.000000 0.000000 0.938356 0.061644 0.061644 0.111872 0.739726 0.086758 0.139269 0.605023 0.091324 0.164384 Consensus sequence: HSCACGTGGC Reverse complement motif 0.139269 0.091324 0.605023 0.164384 0.061644 0.739726 0.111872 0.086758 0.000000 0.938356 0.000000 0.061644 0.719178 0.221461 0.004566 0.054795 0.070776 0.924658 0.002283 0.002283 0.000000 0.018265 0.961187 0.020548 0.013699 0.000000 0.041096 0.945205 0.015982 0.000000 0.984018 0.000000 0.089041 0.447489 0.388128 0.075342 0.349315 0.143836 0.363014 0.143836 Consensus sequence: GCCACGTGSD Alignment: GCCACGTGSD- SSGCKTGCSSK ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 8 Myc Original Motif Reverse Complement Forward 1 10 0.542915 Original motif 0.295154 0.422907 0.158590 0.123348 0.149780 0.233480 0.572687 0.044053 0.035242 0.964758 0.000000 0.000000 0.955947 0.017621 0.022026 0.004405 0.000000 0.933921 0.013216 0.052863 0.083700 0.008811 0.898678 0.008811 0.039648 0.193833 0.000000 0.766520 0.000000 0.008811 0.951542 0.039648 0.000000 0.074890 0.806167 0.118943 0.198238 0.471366 0.105727 0.224670 Consensus sequence: VGCACGTGGH Reverse complement motif 0.198238 0.105727 0.471366 0.224670 0.000000 0.806167 0.074890 0.118943 0.000000 0.951542 0.008811 0.039648 0.766520 0.193833 0.000000 0.039648 0.083700 0.898678 0.008811 0.008811 0.000000 0.013216 0.933921 0.052863 0.004405 0.017621 0.022026 0.955947 0.035242 0.000000 0.964758 0.000000 0.149780 0.572687 0.233480 0.044053 0.295154 0.158590 0.422907 0.123348 Consensus sequence: DCCACGTGCV Alignment: DCCACGTGCV- SSGCKTGCSSK ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 10 NR1H2RXRA Reverse Complement Original Motif Backward 10 8 1.535833 Original motif 0.680000 0.200000 0.000000 0.120000 0.680000 0.040000 0.200000 0.080000 0.800000 0.000000 0.200000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.040000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.000000 0.040000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.800000 0.040000 0.080000 0.080000 0.000000 0.600000 0.240000 0.160000 Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif 0.000000 0.240000 0.600000 0.160000 0.080000 0.040000 0.080000 0.800000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.040000 0.000000 0.000000 0.960000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.040000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.200000 0.800000 0.080000 0.040000 0.200000 0.680000 0.120000 0.200000 0.000000 0.680000 Consensus sequence: GTTGACCTTTGACCTTT Alignment: ---AAAGGTCAAAGGTCAAC YSSGCAYGCSS--------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 15 Tcfcp2l1 Reverse Complement Original Motif Backward 7 8 1.537042 Original motif 0.001968 0.925480 0.062715 0.009838 0.069973 0.807513 0.005401 0.117113 0.594508 0.005148 0.275803 0.124540 0.005884 0.023780 0.967149 0.003187 0.175477 0.336270 0.025698 0.462555 0.098385 0.289280 0.062163 0.550171 0.173924 0.397260 0.151174 0.277642 0.357213 0.224939 0.252323 0.165526 0.631540 0.069682 0.190954 0.107824 0.394421 0.051382 0.310497 0.243700 0.003669 0.933219 0.054795 0.008317 0.061719 0.812148 0.002939 0.123194 0.536555 0.007360 0.305937 0.150147 0.012039 0.028993 0.954791 0.004177 Consensus sequence: CCAGYYHVADCCRG Reverse complement motif 0.012039 0.954791 0.028993 0.004177 0.150147 0.007360 0.305937 0.536555 0.061719 0.002939 0.812148 0.123194 0.003669 0.054795 0.933219 0.008317 0.243700 0.051382 0.310497 0.394421 0.107824 0.069682 0.190954 0.631540 0.165526 0.224939 0.252323 0.357213 0.173924 0.151174 0.397260 0.277642 0.550171 0.289280 0.062163 0.098385 0.462555 0.336270 0.025698 0.175477 0.005884 0.967149 0.023780 0.003187 0.124540 0.005148 0.275803 0.594508 0.069973 0.005401 0.807513 0.117113 0.001968 0.062715 0.925480 0.009838 Consensus sequence: CKGGDTBDMMCTGG Alignment: ---CCAGYYHVADCCRG YSSGCAYGCSS------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 2 Motif ID: 24 Motif name: ssCCCCGCSssk Original motif 0.000000 0.444444 0.370370 0.185185 0.111111 0.407407 0.333333 0.148148 0.000000 0.888889 0.037037 0.074074 0.000000 0.888889 0.074074 0.037037 0.000000 0.777778 0.222222 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.037037 0.888889 0.000000 0.074074 0.000000 0.703704 0.296296 0.000000 0.000000 0.518519 0.370370 0.111111 0.111111 0.407407 0.259259 0.222222 0.074074 0.222222 0.407407 0.296296 Consensus sequence: SBCCCCGCCSBB Reverse complement motif 0.074074 0.407407 0.222222 0.296296 0.111111 0.259259 0.407407 0.222222 0.000000 0.370370 0.518519 0.111111 0.000000 0.296296 0.703704 0.000000 0.037037 0.000000 0.888889 0.074074 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.222222 0.777778 0.000000 0.000000 0.074074 0.888889 0.037037 0.000000 0.037037 0.888889 0.074074 0.111111 0.333333 0.407407 0.148148 0.000000 0.370370 0.444444 0.185185 Consensus sequence: BBSGGCGGGGBS *************************************************************** Best Matches for Top Significant Motif ID 24 (Highest to Lowest) *************************************************************** Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 3 ESR1 Reverse Complement Reverse Complement Backward 2 12 0.063076 Original motif 0.261242 0.256959 0.329764 0.152034 0.228632 0.170940 0.350427 0.250000 0.136752 0.369658 0.318376 0.175214 0.176596 0.487234 0.138298 0.197872 0.285106 0.493617 0.100000 0.121277 0.651163 0.059197 0.188161 0.101480 0.075949 0.016878 0.816456 0.090717 0.040000 0.037895 0.884211 0.037895 0.069474 0.086316 0.191579 0.652632 0.008421 0.829474 0.111579 0.050526 0.837895 0.027368 0.056842 0.077895 0.122105 0.526316 0.225263 0.126316 0.132632 0.581053 0.111579 0.174737 0.134737 0.543158 0.204211 0.117895 0.067368 0.040000 0.016842 0.875789 0.044211 0.046316 0.896842 0.012632 0.642105 0.223158 0.065263 0.069474 0.021053 0.917895 0.025263 0.035789 0.124211 0.743158 0.004211 0.128421 0.054737 0.347368 0.046316 0.551579 Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif 0.551579 0.347368 0.046316 0.054737 0.124211 0.004211 0.743158 0.128421 0.021053 0.025263 0.917895 0.035789 0.069474 0.223158 0.065263 0.642105 0.044211 0.896842 0.046316 0.012632 0.875789 0.040000 0.016842 0.067368 0.134737 0.204211 0.543158 0.117895 0.132632 0.111579 0.581053 0.174737 0.122105 0.225263 0.526316 0.126316 0.077895 0.027368 0.056842 0.837895 0.008421 0.111579 0.829474 0.050526 0.652632 0.086316 0.191579 0.069474 0.040000 0.884211 0.037895 0.037895 0.075949 0.816456 0.016878 0.090717 0.101480 0.059197 0.188161 0.651163 0.285106 0.100000 0.493617 0.121277 0.176596 0.138298 0.487234 0.197872 0.136752 0.318376 0.369658 0.175214 0.228632 0.350427 0.170940 0.250000 0.261242 0.329764 0.256959 0.152034 Consensus sequence: MGGTCAGGGTGACCTRDBHV Alignment: MGGTCAGGGTGACCTRDBHV -------BBSGGCGGGGBS- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 16 CTCF Reverse Complement Original Motif Forward 2 12 0.064209 Original motif 0.095290 0.318729 0.083242 0.502738 0.182913 0.158817 0.453450 0.204819 0.307777 0.053669 0.491785 0.146769 0.061336 0.876232 0.023001 0.039430 0.008762 0.989047 0.000000 0.002191 0.814896 0.014239 0.071194 0.099671 0.043812 0.578313 0.365827 0.012048 0.117325 0.474781 0.052632 0.355263 0.933114 0.012061 0.035088 0.019737 0.005488 0.000000 0.991218 0.003293 0.365532 0.003293 0.621295 0.009879 0.059276 0.013172 0.553238 0.374314 0.013187 0.000000 0.978022 0.008791 0.061538 0.008791 0.851648 0.078022 0.114411 0.806381 0.005501 0.073707 0.409241 0.014301 0.557756 0.018702 0.090308 0.530837 0.338106 0.040749 0.128855 0.354626 0.080396 0.436123 0.442731 0.199339 0.292952 0.064978 Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif 0.064978 0.199339 0.292952 0.442731 0.436123 0.354626 0.080396 0.128855 0.090308 0.338106 0.530837 0.040749 0.409241 0.557756 0.014301 0.018702 0.114411 0.005501 0.806381 0.073707 0.061538 0.851648 0.008791 0.078022 0.013187 0.978022 0.000000 0.008791 0.059276 0.553238 0.013172 0.374314 0.365532 0.621295 0.003293 0.009879 0.005488 0.991218 0.000000 0.003293 0.019737 0.012061 0.035088 0.933114 0.117325 0.052632 0.474781 0.355263 0.043812 0.365827 0.578313 0.012048 0.099671 0.014239 0.071194 0.814896 0.008762 0.000000 0.989047 0.002191 0.061336 0.023001 0.876232 0.039430 0.307777 0.491785 0.053669 0.146769 0.182913 0.453450 0.158817 0.204819 0.502738 0.318729 0.083242 0.095290 Consensus sequence: BMSMGCCYMCTKSTGGMHM Alignment: YDRCCASYAGRKGGCRSYV -BBSGGCGGGGBS------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 14 PPARGRXRA Original Motif Reverse Complement Forward 2 12 0.067155 Original motif 0.109685 0.369895 0.373396 0.147025 0.117716 0.193473 0.148019 0.540793 0.453488 0.026744 0.427907 0.091860 0.116144 0.003484 0.779326 0.101045 0.161253 0.017401 0.781903 0.039443 0.168213 0.149652 0.458237 0.223898 0.082271 0.633835 0.207416 0.076477 0.949015 0.024334 0.017381 0.009270 0.604867 0.055620 0.312862 0.026651 0.825231 0.005787 0.158565 0.010417 0.095017 0.002317 0.888760 0.013905 0.047509 0.010429 0.803013 0.139050 0.025492 0.114716 0.304751 0.555041 0.062645 0.643852 0.167053 0.126450 0.784223 0.067285 0.054524 0.093968 Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif 0.093968 0.067285 0.054524 0.784223 0.062645 0.167053 0.643852 0.126450 0.555041 0.114716 0.304751 0.025492 0.047509 0.803013 0.010429 0.139050 0.095017 0.888760 0.002317 0.013905 0.010417 0.005787 0.158565 0.825231 0.026651 0.055620 0.312862 0.604867 0.009270 0.024334 0.017381 0.949015 0.082271 0.207416 0.633835 0.076477 0.168213 0.458237 0.149652 0.223898 0.161253 0.781903 0.017401 0.039443 0.116144 0.779326 0.003484 0.101045 0.091860 0.026744 0.427907 0.453488 0.540793 0.193473 0.148019 0.117716 0.109685 0.373396 0.369895 0.147025 Consensus sequence: TGRCCTKTGHCCKAB Alignment: TGRCCTKTGHCCKAB -SBCCCCGCCSBB-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 9 ESR2 Original Motif Reverse Complement Forward 2 12 0.073448 Original motif 0.218487 0.450980 0.176471 0.154062 0.442577 0.142857 0.114846 0.299720 0.521008 0.042017 0.431373 0.005602 0.075630 0.000000 0.770308 0.154062 0.050420 0.056022 0.893557 0.000000 0.036415 0.053221 0.092437 0.817927 0.000000 1.000000 0.000000 0.000000 0.943978 0.002801 0.000000 0.053221 0.137255 0.344538 0.316527 0.201681 0.179272 0.176471 0.417367 0.226891 0.145658 0.170868 0.411765 0.271709 0.058824 0.092437 0.067227 0.781513 0.176471 0.070028 0.742297 0.011204 0.498599 0.277311 0.053221 0.170868 0.095238 0.750700 0.005602 0.148459 0.128852 0.809524 0.000000 0.061625 0.075630 0.252101 0.000000 0.672269 0.168067 0.263305 0.380952 0.187675 Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif 0.168067 0.380952 0.263305 0.187675 0.672269 0.252101 0.000000 0.075630 0.128852 0.000000 0.809524 0.061625 0.095238 0.005602 0.750700 0.148459 0.170868 0.277311 0.053221 0.498599 0.176471 0.742297 0.070028 0.011204 0.781513 0.092437 0.067227 0.058824 0.145658 0.411765 0.170868 0.271709 0.179272 0.417367 0.176471 0.226891 0.137255 0.316527 0.344538 0.201681 0.053221 0.002801 0.000000 0.943978 0.000000 0.000000 1.000000 0.000000 0.817927 0.053221 0.092437 0.036415 0.050420 0.893557 0.056022 0.000000 0.075630 0.770308 0.000000 0.154062 0.005602 0.042017 0.431373 0.521008 0.299720 0.142857 0.114846 0.442577 0.218487 0.176471 0.450980 0.154062 Consensus sequence: BAGGYCABHBTGACCKHV Alignment: BAGGYCABHBTGACCKHV -SBCCCCGCCSBB----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 7 REST Reverse Complement Original Motif Backward 10 12 0.075108 Original motif 0.132621 0.109365 0.230044 0.527970 0.036318 0.168441 0.091421 0.703820 0.047589 0.855354 0.031309 0.065748 0.906367 0.018727 0.058677 0.016230 0.021197 0.027431 0.945137 0.006234 0.076012 0.609346 0.201246 0.113396 0.980697 0.004359 0.007472 0.007472 0.001868 0.987547 0.007472 0.003113 0.021793 0.922167 0.012453 0.043587 0.568847 0.125234 0.100935 0.204984 0.136534 0.233791 0.077307 0.552369 0.024314 0.004364 0.966958 0.004364 0.012469 0.003117 0.983167 0.001247 0.877105 0.069869 0.021210 0.031815 0.008125 0.800000 0.145625 0.046250 0.983750 0.005625 0.004375 0.006250 0.026349 0.008156 0.959849 0.005646 0.128688 0.632141 0.114878 0.124294 0.229899 0.019472 0.432161 0.318467 0.133962 0.586792 0.200629 0.078616 0.112579 0.700629 0.023270 0.163522 Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif 0.112579 0.023270 0.700629 0.163522 0.133962 0.200629 0.586792 0.078616 0.229899 0.432161 0.019472 0.318467 0.128688 0.114878 0.632141 0.124294 0.026349 0.959849 0.008156 0.005646 0.006250 0.005625 0.004375 0.983750 0.008125 0.145625 0.800000 0.046250 0.031815 0.069869 0.021210 0.877105 0.012469 0.983167 0.003117 0.001247 0.024314 0.966958 0.004364 0.004364 0.552369 0.233791 0.077307 0.136534 0.204984 0.125234 0.100935 0.568847 0.021793 0.012453 0.922167 0.043587 0.001868 0.007472 0.987547 0.003113 0.007472 0.004359 0.007472 0.980697 0.076012 0.201246 0.609346 0.113396 0.021197 0.945137 0.027431 0.006234 0.016230 0.018727 0.058677 0.906367 0.047589 0.031309 0.855354 0.065748 0.703820 0.168441 0.091421 0.036318 0.527970 0.109365 0.230044 0.132621 Consensus sequence: GGYGCTGTCCATGGTGCTGAA Alignment: TTCAGCACCATGGACAGCKCC BBSGGCGGGGBS--------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 4 Esrrb Reverse Complement Original Motif Forward 2 11 0.571364 Original motif 0.290198 0.220264 0.271200 0.218337 0.184941 0.227810 0.376477 0.210772 0.115226 0.332236 0.331687 0.220850 0.070959 0.342466 0.122740 0.463836 0.084862 0.729264 0.171640 0.014235 0.909737 0.008753 0.067834 0.013676 0.975656 0.000547 0.016411 0.007385 0.008758 0.001368 0.981390 0.008484 0.005750 0.003286 0.986309 0.004655 0.049904 0.012613 0.066904 0.870579 0.002473 0.927473 0.046703 0.023352 0.951569 0.005504 0.035498 0.007430 Consensus sequence: VBBYCAAGGTCA Reverse complement motif 0.007430 0.005504 0.035498 0.951569 0.002473 0.046703 0.927473 0.023352 0.870579 0.012613 0.066904 0.049904 0.005750 0.986309 0.003286 0.004655 0.008758 0.981390 0.001368 0.008484 0.007385 0.000547 0.016411 0.975656 0.013676 0.008753 0.067834 0.909737 0.084862 0.171640 0.729264 0.014235 0.463836 0.342466 0.122740 0.070959 0.115226 0.331687 0.332236 0.220850 0.184941 0.376477 0.227810 0.210772 0.218337 0.220264 0.271200 0.290198 Consensus sequence: TGACCTTGMBBB Alignment: VBBYCAAGGTCA- -BBSGGCGGGGBS ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 1 HNF4A Original Motif Reverse Complement Backward 3 11 0.573202 Original motif 0.417910 0.104478 0.402985 0.074627 0.029851 0.029851 0.835821 0.104478 0.179104 0.059701 0.522388 0.238806 0.074627 0.343284 0.298507 0.283582 0.044776 0.761194 0.059701 0.134328 0.880597 0.014925 0.044776 0.059701 0.791045 0.029851 0.149254 0.029851 0.835821 0.014925 0.119403 0.029851 0.059701 0.059701 0.865672 0.014925 0.089552 0.029851 0.492537 0.388060 0.044776 0.328358 0.164179 0.462687 0.059701 0.731343 0.074627 0.134328 0.626866 0.104478 0.149254 0.119403 Consensus sequence: RGGBCAAAGKYCA Reverse complement motif 0.119403 0.104478 0.149254 0.626866 0.059701 0.074627 0.731343 0.134328 0.462687 0.328358 0.164179 0.044776 0.089552 0.492537 0.029851 0.388060 0.059701 0.865672 0.059701 0.014925 0.029851 0.014925 0.119403 0.835821 0.029851 0.029851 0.149254 0.791045 0.059701 0.014925 0.044776 0.880597 0.044776 0.059701 0.761194 0.134328 0.074627 0.298507 0.343284 0.283582 0.179104 0.522388 0.059701 0.238806 0.029851 0.835821 0.029851 0.104478 0.074627 0.104478 0.402985 0.417910 Consensus sequence: TGMYCTTTGBCCK Alignment: -TGMYCTTTGBCCK SBCCCCGCCSBB-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 15 Tcfcp2l1 Reverse Complement Reverse Complement Forward 6 9 1.549134 Original motif 0.001968 0.925480 0.062715 0.009838 0.069973 0.807513 0.005401 0.117113 0.594508 0.005148 0.275803 0.124540 0.005884 0.023780 0.967149 0.003187 0.175477 0.336270 0.025698 0.462555 0.098385 0.289280 0.062163 0.550171 0.173924 0.397260 0.151174 0.277642 0.357213 0.224939 0.252323 0.165526 0.631540 0.069682 0.190954 0.107824 0.394421 0.051382 0.310497 0.243700 0.003669 0.933219 0.054795 0.008317 0.061719 0.812148 0.002939 0.123194 0.536555 0.007360 0.305937 0.150147 0.012039 0.028993 0.954791 0.004177 Consensus sequence: CCAGYYHVADCCRG Reverse complement motif 0.012039 0.954791 0.028993 0.004177 0.150147 0.007360 0.305937 0.536555 0.061719 0.002939 0.812148 0.123194 0.003669 0.054795 0.933219 0.008317 0.243700 0.051382 0.310497 0.394421 0.107824 0.069682 0.190954 0.631540 0.165526 0.224939 0.252323 0.357213 0.173924 0.151174 0.397260 0.277642 0.550171 0.289280 0.062163 0.098385 0.462555 0.336270 0.025698 0.175477 0.005884 0.967149 0.023780 0.003187 0.124540 0.005148 0.275803 0.594508 0.069973 0.005401 0.807513 0.117113 0.001968 0.062715 0.925480 0.009838 Consensus sequence: CKGGDTBDMMCTGG Alignment: CKGGDTBDMMCTGG--- -----BBSGGCGGGGBS ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 6 Mycn Original Motif Original Motif Backward 2 9 1.575069 Original motif 0.349315 0.363014 0.143836 0.143836 0.089041 0.388128 0.447489 0.075342 0.015982 0.984018 0.000000 0.000000 0.945205 0.000000 0.041096 0.013699 0.000000 0.961187 0.018265 0.020548 0.070776 0.002283 0.924658 0.002283 0.054795 0.221461 0.004566 0.719178 0.000000 0.000000 0.938356 0.061644 0.061644 0.111872 0.739726 0.086758 0.139269 0.605023 0.091324 0.164384 Consensus sequence: HSCACGTGGC Reverse complement motif 0.139269 0.091324 0.605023 0.164384 0.061644 0.739726 0.111872 0.086758 0.000000 0.938356 0.000000 0.061644 0.719178 0.221461 0.004566 0.054795 0.070776 0.924658 0.002283 0.002283 0.000000 0.018265 0.961187 0.020548 0.013699 0.000000 0.041096 0.945205 0.015982 0.000000 0.984018 0.000000 0.089041 0.447489 0.388128 0.075342 0.349315 0.143836 0.363014 0.143836 Consensus sequence: GCCACGTGSD Alignment: ---HSCACGTGGC SBCCCCGCCSBB- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 8 Myc Reverse Complement Original Motif Forward 2 9 1.577367 Original motif 0.295154 0.422907 0.158590 0.123348 0.149780 0.233480 0.572687 0.044053 0.035242 0.964758 0.000000 0.000000 0.955947 0.017621 0.022026 0.004405 0.000000 0.933921 0.013216 0.052863 0.083700 0.008811 0.898678 0.008811 0.039648 0.193833 0.000000 0.766520 0.000000 0.008811 0.951542 0.039648 0.000000 0.074890 0.806167 0.118943 0.198238 0.471366 0.105727 0.224670 Consensus sequence: VGCACGTGGH Reverse complement motif 0.198238 0.105727 0.471366 0.224670 0.000000 0.806167 0.074890 0.118943 0.000000 0.951542 0.008811 0.039648 0.766520 0.193833 0.000000 0.039648 0.083700 0.898678 0.008811 0.008811 0.000000 0.013216 0.933921 0.052863 0.004405 0.017621 0.022026 0.955947 0.035242 0.000000 0.964758 0.000000 0.149780 0.572687 0.233480 0.044053 0.295154 0.158590 0.422907 0.123348 Consensus sequence: DCCACGTGCV Alignment: VGCACGTGGH--- -BBSGGCGGGGBS ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 2 Motif ID: 29 Motif name: cCGCGGrCACG Original motif 0.000000 0.600000 0.200000 0.200000 0.000000 0.800000 0.000000 0.200000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.600000 0.000000 0.400000 0.000000 0.000000 0.800000 0.200000 0.000000 0.800000 0.000000 0.200000 0.000000 0.000000 0.800000 0.200000 0.000000 0.200000 0.000000 0.800000 0.000000 Consensus sequence: CCGCGGRCACG Reverse complement motif 0.200000 0.800000 0.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.200000 0.800000 0.000000 0.000000 0.000000 0.400000 0.600000 0.000000 0.800000 0.200000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.800000 0.200000 0.000000 0.200000 0.600000 0.200000 Consensus sequence: CGTGKCCGCGG *************************************************************** Best Matches for Top Significant Motif ID 29 (Highest to Lowest) *************************************************************** Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 7 REST Original Motif Original Motif Backward 4 11 0.048444 Original motif 0.132621 0.109365 0.230044 0.527970 0.036318 0.168441 0.091421 0.703820 0.047589 0.855354 0.031309 0.065748 0.906367 0.018727 0.058677 0.016230 0.021197 0.027431 0.945137 0.006234 0.076012 0.609346 0.201246 0.113396 0.980697 0.004359 0.007472 0.007472 0.001868 0.987547 0.007472 0.003113 0.021793 0.922167 0.012453 0.043587 0.568847 0.125234 0.100935 0.204984 0.136534 0.233791 0.077307 0.552369 0.024314 0.004364 0.966958 0.004364 0.012469 0.003117 0.983167 0.001247 0.877105 0.069869 0.021210 0.031815 0.008125 0.800000 0.145625 0.046250 0.983750 0.005625 0.004375 0.006250 0.026349 0.008156 0.959849 0.005646 0.128688 0.632141 0.114878 0.124294 0.229899 0.019472 0.432161 0.318467 0.133962 0.586792 0.200629 0.078616 0.112579 0.700629 0.023270 0.163522 Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif 0.112579 0.023270 0.700629 0.163522 0.133962 0.200629 0.586792 0.078616 0.229899 0.432161 0.019472 0.318467 0.128688 0.114878 0.632141 0.124294 0.026349 0.959849 0.008156 0.005646 0.006250 0.005625 0.004375 0.983750 0.008125 0.145625 0.800000 0.046250 0.031815 0.069869 0.021210 0.877105 0.012469 0.983167 0.003117 0.001247 0.024314 0.966958 0.004364 0.004364 0.552369 0.233791 0.077307 0.136534 0.204984 0.125234 0.100935 0.568847 0.021793 0.012453 0.922167 0.043587 0.001868 0.007472 0.987547 0.003113 0.007472 0.004359 0.007472 0.980697 0.076012 0.201246 0.609346 0.113396 0.021197 0.945137 0.027431 0.006234 0.016230 0.018727 0.058677 0.906367 0.047589 0.031309 0.855354 0.065748 0.703820 0.168441 0.091421 0.036318 0.527970 0.109365 0.230044 0.132621 Consensus sequence: GGYGCTGTCCATGGTGCTGAA Alignment: TTCAGCACCATGGACAGCKCC -------CCGCGGRCACG--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 3 ESR1 Reverse Complement Reverse Complement Backward 3 11 0.048658 Original motif 0.261242 0.256959 0.329764 0.152034 0.228632 0.170940 0.350427 0.250000 0.136752 0.369658 0.318376 0.175214 0.176596 0.487234 0.138298 0.197872 0.285106 0.493617 0.100000 0.121277 0.651163 0.059197 0.188161 0.101480 0.075949 0.016878 0.816456 0.090717 0.040000 0.037895 0.884211 0.037895 0.069474 0.086316 0.191579 0.652632 0.008421 0.829474 0.111579 0.050526 0.837895 0.027368 0.056842 0.077895 0.122105 0.526316 0.225263 0.126316 0.132632 0.581053 0.111579 0.174737 0.134737 0.543158 0.204211 0.117895 0.067368 0.040000 0.016842 0.875789 0.044211 0.046316 0.896842 0.012632 0.642105 0.223158 0.065263 0.069474 0.021053 0.917895 0.025263 0.035789 0.124211 0.743158 0.004211 0.128421 0.054737 0.347368 0.046316 0.551579 Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif 0.551579 0.347368 0.046316 0.054737 0.124211 0.004211 0.743158 0.128421 0.021053 0.025263 0.917895 0.035789 0.069474 0.223158 0.065263 0.642105 0.044211 0.896842 0.046316 0.012632 0.875789 0.040000 0.016842 0.067368 0.134737 0.204211 0.543158 0.117895 0.132632 0.111579 0.581053 0.174737 0.122105 0.225263 0.526316 0.126316 0.077895 0.027368 0.056842 0.837895 0.008421 0.111579 0.829474 0.050526 0.652632 0.086316 0.191579 0.069474 0.040000 0.884211 0.037895 0.037895 0.075949 0.816456 0.016878 0.090717 0.101480 0.059197 0.188161 0.651163 0.285106 0.100000 0.493617 0.121277 0.176596 0.138298 0.487234 0.197872 0.136752 0.318376 0.369658 0.175214 0.228632 0.350427 0.170940 0.250000 0.261242 0.329764 0.256959 0.152034 Consensus sequence: MGGTCAGGGTGACCTRDBHV Alignment: MGGTCAGGGTGACCTRDBHV -------CGTGKCCGCGG-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 16 CTCF Original Motif Original Motif Backward 2 11 0.058866 Original motif 0.095290 0.318729 0.083242 0.502738 0.182913 0.158817 0.453450 0.204819 0.307777 0.053669 0.491785 0.146769 0.061336 0.876232 0.023001 0.039430 0.008762 0.989047 0.000000 0.002191 0.814896 0.014239 0.071194 0.099671 0.043812 0.578313 0.365827 0.012048 0.117325 0.474781 0.052632 0.355263 0.933114 0.012061 0.035088 0.019737 0.005488 0.000000 0.991218 0.003293 0.365532 0.003293 0.621295 0.009879 0.059276 0.013172 0.553238 0.374314 0.013187 0.000000 0.978022 0.008791 0.061538 0.008791 0.851648 0.078022 0.114411 0.806381 0.005501 0.073707 0.409241 0.014301 0.557756 0.018702 0.090308 0.530837 0.338106 0.040749 0.128855 0.354626 0.080396 0.436123 0.442731 0.199339 0.292952 0.064978 Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif 0.064978 0.199339 0.292952 0.442731 0.436123 0.354626 0.080396 0.128855 0.090308 0.338106 0.530837 0.040749 0.409241 0.557756 0.014301 0.018702 0.114411 0.005501 0.806381 0.073707 0.061538 0.851648 0.008791 0.078022 0.013187 0.978022 0.000000 0.008791 0.059276 0.553238 0.013172 0.374314 0.365532 0.621295 0.003293 0.009879 0.005488 0.991218 0.000000 0.003293 0.019737 0.012061 0.035088 0.933114 0.117325 0.052632 0.474781 0.355263 0.043812 0.365827 0.578313 0.012048 0.099671 0.014239 0.071194 0.814896 0.008762 0.000000 0.989047 0.002191 0.061336 0.023001 0.876232 0.039430 0.307777 0.491785 0.053669 0.146769 0.182913 0.453450 0.158817 0.204819 0.502738 0.318729 0.083242 0.095290 Consensus sequence: BMSMGCCYMCTKSTGGMHM Alignment: YDRCCASYAGRKGGCRSYV -------CCGCGGRCACG- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 14 PPARGRXRA Reverse Complement Reverse Complement Forward 4 11 0.062948 Original motif 0.109685 0.369895 0.373396 0.147025 0.117716 0.193473 0.148019 0.540793 0.453488 0.026744 0.427907 0.091860 0.116144 0.003484 0.779326 0.101045 0.161253 0.017401 0.781903 0.039443 0.168213 0.149652 0.458237 0.223898 0.082271 0.633835 0.207416 0.076477 0.949015 0.024334 0.017381 0.009270 0.604867 0.055620 0.312862 0.026651 0.825231 0.005787 0.158565 0.010417 0.095017 0.002317 0.888760 0.013905 0.047509 0.010429 0.803013 0.139050 0.025492 0.114716 0.304751 0.555041 0.062645 0.643852 0.167053 0.126450 0.784223 0.067285 0.054524 0.093968 Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif 0.093968 0.067285 0.054524 0.784223 0.062645 0.167053 0.643852 0.126450 0.555041 0.114716 0.304751 0.025492 0.047509 0.803013 0.010429 0.139050 0.095017 0.888760 0.002317 0.013905 0.010417 0.005787 0.158565 0.825231 0.026651 0.055620 0.312862 0.604867 0.009270 0.024334 0.017381 0.949015 0.082271 0.207416 0.633835 0.076477 0.168213 0.458237 0.149652 0.223898 0.161253 0.781903 0.017401 0.039443 0.116144 0.779326 0.003484 0.101045 0.091860 0.026744 0.427907 0.453488 0.540793 0.193473 0.148019 0.117716 0.109685 0.373396 0.369895 0.147025 Consensus sequence: TGRCCTKTGHCCKAB Alignment: TGRCCTKTGHCCKAB ---CGTGKCCGCGG- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 9 ESR2 Reverse Complement Reverse Complement Forward 9 10 0.551597 Original motif 0.218487 0.450980 0.176471 0.154062 0.442577 0.142857 0.114846 0.299720 0.521008 0.042017 0.431373 0.005602 0.075630 0.000000 0.770308 0.154062 0.050420 0.056022 0.893557 0.000000 0.036415 0.053221 0.092437 0.817927 0.000000 1.000000 0.000000 0.000000 0.943978 0.002801 0.000000 0.053221 0.137255 0.344538 0.316527 0.201681 0.179272 0.176471 0.417367 0.226891 0.145658 0.170868 0.411765 0.271709 0.058824 0.092437 0.067227 0.781513 0.176471 0.070028 0.742297 0.011204 0.498599 0.277311 0.053221 0.170868 0.095238 0.750700 0.005602 0.148459 0.128852 0.809524 0.000000 0.061625 0.075630 0.252101 0.000000 0.672269 0.168067 0.263305 0.380952 0.187675 Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif 0.168067 0.380952 0.263305 0.187675 0.672269 0.252101 0.000000 0.075630 0.128852 0.000000 0.809524 0.061625 0.095238 0.005602 0.750700 0.148459 0.170868 0.277311 0.053221 0.498599 0.176471 0.742297 0.070028 0.011204 0.781513 0.092437 0.067227 0.058824 0.145658 0.411765 0.170868 0.271709 0.179272 0.417367 0.176471 0.226891 0.137255 0.316527 0.344538 0.201681 0.053221 0.002801 0.000000 0.943978 0.000000 0.000000 1.000000 0.000000 0.817927 0.053221 0.092437 0.036415 0.050420 0.893557 0.056022 0.000000 0.075630 0.770308 0.000000 0.154062 0.005602 0.042017 0.431373 0.521008 0.299720 0.142857 0.114846 0.442577 0.218487 0.176471 0.450980 0.154062 Consensus sequence: BAGGYCABHBTGACCKHV Alignment: BAGGYCABHBTGACCKHV- --------CGTGKCCGCGG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 8 Myc Reverse Complement Original Motif Forward 2 9 1.048798 Original motif 0.295154 0.422907 0.158590 0.123348 0.149780 0.233480 0.572687 0.044053 0.035242 0.964758 0.000000 0.000000 0.955947 0.017621 0.022026 0.004405 0.000000 0.933921 0.013216 0.052863 0.083700 0.008811 0.898678 0.008811 0.039648 0.193833 0.000000 0.766520 0.000000 0.008811 0.951542 0.039648 0.000000 0.074890 0.806167 0.118943 0.198238 0.471366 0.105727 0.224670 Consensus sequence: VGCACGTGGH Reverse complement motif 0.198238 0.105727 0.471366 0.224670 0.000000 0.806167 0.074890 0.118943 0.000000 0.951542 0.008811 0.039648 0.766520 0.193833 0.000000 0.039648 0.083700 0.898678 0.008811 0.008811 0.000000 0.013216 0.933921 0.052863 0.004405 0.017621 0.022026 0.955947 0.035242 0.000000 0.964758 0.000000 0.149780 0.572687 0.233480 0.044053 0.295154 0.158590 0.422907 0.123348 Consensus sequence: DCCACGTGCV Alignment: VGCACGTGGH-- -CGTGKCCGCGG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 6 Mycn Reverse Complement Original Motif Forward 2 9 1.048916 Original motif 0.349315 0.363014 0.143836 0.143836 0.089041 0.388128 0.447489 0.075342 0.015982 0.984018 0.000000 0.000000 0.945205 0.000000 0.041096 0.013699 0.000000 0.961187 0.018265 0.020548 0.070776 0.002283 0.924658 0.002283 0.054795 0.221461 0.004566 0.719178 0.000000 0.000000 0.938356 0.061644 0.061644 0.111872 0.739726 0.086758 0.139269 0.605023 0.091324 0.164384 Consensus sequence: HSCACGTGGC Reverse complement motif 0.139269 0.091324 0.605023 0.164384 0.061644 0.739726 0.111872 0.086758 0.000000 0.938356 0.000000 0.061644 0.719178 0.221461 0.004566 0.054795 0.070776 0.924658 0.002283 0.002283 0.000000 0.018265 0.961187 0.020548 0.013699 0.000000 0.041096 0.945205 0.015982 0.000000 0.984018 0.000000 0.089041 0.447489 0.388128 0.075342 0.349315 0.143836 0.363014 0.143836 Consensus sequence: GCCACGTGSD Alignment: HSCACGTGGC-- -CGTGKCCGCGG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 13 MIZF Reverse Complement Original Motif Backward 2 9 1.049043 Original motif 0.100000 0.300000 0.250000 0.350000 0.650000 0.050000 0.000000 0.300000 1.000000 0.000000 0.000000 0.000000 0.100000 0.850000 0.050000 0.000000 0.000000 0.000000 0.950000 0.050000 0.000000 0.050000 0.000000 0.950000 0.000000 0.950000 0.000000 0.050000 0.000000 0.900000 0.100000 0.000000 0.000000 0.000000 0.950000 0.050000 0.100000 0.650000 0.050000 0.200000 Consensus sequence: BAACGTCCGC Reverse complement motif 0.100000 0.050000 0.650000 0.200000 0.000000 0.950000 0.000000 0.050000 0.000000 0.100000 0.900000 0.000000 0.000000 0.000000 0.950000 0.050000 0.950000 0.050000 0.000000 0.000000 0.000000 0.950000 0.000000 0.050000 0.100000 0.050000 0.850000 0.000000 0.000000 0.000000 0.000000 1.000000 0.300000 0.050000 0.000000 0.650000 0.350000 0.300000 0.250000 0.100000 Consensus sequence: GCGGACGTTV Alignment: --BAACGTCCGC CGTGKCCGCGG- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 4 Esrrb Original Motif Original Motif Forward 4 9 1.052910 Original motif 0.290198 0.220264 0.271200 0.218337 0.184941 0.227810 0.376477 0.210772 0.115226 0.332236 0.331687 0.220850 0.070959 0.342466 0.122740 0.463836 0.084862 0.729264 0.171640 0.014235 0.909737 0.008753 0.067834 0.013676 0.975656 0.000547 0.016411 0.007385 0.008758 0.001368 0.981390 0.008484 0.005750 0.003286 0.986309 0.004655 0.049904 0.012613 0.066904 0.870579 0.002473 0.927473 0.046703 0.023352 0.951569 0.005504 0.035498 0.007430 Consensus sequence: VBBYCAAGGTCA Reverse complement motif 0.007430 0.005504 0.035498 0.951569 0.002473 0.046703 0.927473 0.023352 0.870579 0.012613 0.066904 0.049904 0.005750 0.986309 0.003286 0.004655 0.008758 0.981390 0.001368 0.008484 0.007385 0.000547 0.016411 0.975656 0.013676 0.008753 0.067834 0.909737 0.084862 0.171640 0.729264 0.014235 0.463836 0.342466 0.122740 0.070959 0.115226 0.331687 0.332236 0.220850 0.184941 0.376477 0.227810 0.210772 0.218337 0.220264 0.271200 0.290198 Consensus sequence: TGACCTTGMBBB Alignment: VBBYCAAGGTCA-- ---CCGCGGRCACG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 1 HNF4A Reverse Complement Reverse Complement Forward 6 8 1.557946 Original motif 0.417910 0.104478 0.402985 0.074627 0.029851 0.029851 0.835821 0.104478 0.179104 0.059701 0.522388 0.238806 0.074627 0.343284 0.298507 0.283582 0.044776 0.761194 0.059701 0.134328 0.880597 0.014925 0.044776 0.059701 0.791045 0.029851 0.149254 0.029851 0.835821 0.014925 0.119403 0.029851 0.059701 0.059701 0.865672 0.014925 0.089552 0.029851 0.492537 0.388060 0.044776 0.328358 0.164179 0.462687 0.059701 0.731343 0.074627 0.134328 0.626866 0.104478 0.149254 0.119403 Consensus sequence: RGGBCAAAGKYCA Reverse complement motif 0.119403 0.104478 0.149254 0.626866 0.059701 0.074627 0.731343 0.134328 0.462687 0.328358 0.164179 0.044776 0.089552 0.492537 0.029851 0.388060 0.059701 0.865672 0.059701 0.014925 0.029851 0.014925 0.119403 0.835821 0.029851 0.029851 0.149254 0.791045 0.059701 0.014925 0.044776 0.880597 0.044776 0.059701 0.761194 0.134328 0.074627 0.298507 0.343284 0.283582 0.179104 0.522388 0.059701 0.238806 0.029851 0.835821 0.029851 0.104478 0.074627 0.104478 0.402985 0.417910 Consensus sequence: TGMYCTTTGBCCK Alignment: TGMYCTTTGBCCK--- -----CGTGKCCGCGG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 4 Motif name: Esrrb Original motif 0.290198 0.220264 0.271200 0.218337 0.184941 0.227810 0.376477 0.210772 0.115226 0.332236 0.331687 0.220850 0.070959 0.342466 0.122740 0.463836 0.084862 0.729264 0.171640 0.014235 0.909737 0.008753 0.067834 0.013676 0.975656 0.000547 0.016411 0.007385 0.008758 0.001368 0.981390 0.008484 0.005750 0.003286 0.986309 0.004655 0.049904 0.012613 0.066904 0.870579 0.002473 0.927473 0.046703 0.023352 0.951569 0.005504 0.035498 0.007430 Consensus sequence: VBBYCAAGGTCA Reverse complement motif 0.007430 0.005504 0.035498 0.951569 0.002473 0.046703 0.927473 0.023352 0.870579 0.012613 0.066904 0.049904 0.005750 0.986309 0.003286 0.004655 0.008758 0.981390 0.001368 0.008484 0.007385 0.000547 0.016411 0.975656 0.013676 0.008753 0.067834 0.909737 0.084862 0.171640 0.729264 0.014235 0.463836 0.342466 0.122740 0.070959 0.115226 0.331687 0.332236 0.220850 0.184941 0.376477 0.227810 0.210772 0.218337 0.220264 0.271200 0.290198 Consensus sequence: TGACCTTGMBBB *************************************************************** Best Matches for Top Significant Motif ID 4 (Highest to Lowest) *************************************************************** Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 17 TgTGgTGTCACAGTGCTCC Reverse Complement Original Motif Backward 1 12 0.077256 Original motif 0.111111 0.083333 0.055556 0.750000 0.125000 0.097222 0.652778 0.125000 0.041667 0.097222 0.027778 0.833333 0.027778 0.027778 0.791667 0.152778 0.055556 0.166667 0.652778 0.125000 0.000000 0.041667 0.013889 0.944444 0.041667 0.000000 0.888889 0.069444 0.027778 0.027778 0.000000 0.944444 0.041667 0.944444 0.013889 0.000000 0.916667 0.027778 0.000000 0.055556 0.069444 0.875000 0.000000 0.055556 0.833333 0.013889 0.013889 0.138889 0.041667 0.069444 0.819444 0.069444 0.027778 0.027778 0.027778 0.916667 0.069444 0.013889 0.847222 0.069444 0.069444 0.777778 0.027778 0.125000 0.055556 0.041667 0.027778 0.875000 0.041667 0.708333 0.125000 0.125000 0.111111 0.819444 0.055556 0.013889 Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif 0.111111 0.055556 0.819444 0.013889 0.041667 0.125000 0.708333 0.125000 0.875000 0.041667 0.027778 0.055556 0.069444 0.027778 0.777778 0.125000 0.069444 0.847222 0.013889 0.069444 0.916667 0.027778 0.027778 0.027778 0.041667 0.819444 0.069444 0.069444 0.138889 0.013889 0.013889 0.833333 0.069444 0.000000 0.875000 0.055556 0.055556 0.027778 0.000000 0.916667 0.041667 0.013889 0.944444 0.000000 0.944444 0.027778 0.000000 0.027778 0.041667 0.888889 0.000000 0.069444 0.944444 0.041667 0.013889 0.000000 0.055556 0.652778 0.166667 0.125000 0.027778 0.791667 0.027778 0.152778 0.833333 0.097222 0.027778 0.041667 0.125000 0.652778 0.097222 0.125000 0.750000 0.083333 0.055556 0.111111 Consensus sequence: GGAGCACTGTGACACCACA Alignment: TGTGGTGTCACAGTGCTCC -------TGACCTTGMBBB ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 23 TGGAGCACTGTGACAcCACAGTGg Reverse Complement Reverse Complement Forward 12 12 0.078539 Original motif 0.054054 0.040541 0.054054 0.851351 0.040541 0.013514 0.824324 0.121622 0.094595 0.135135 0.756757 0.013514 0.891892 0.000000 0.000000 0.108108 0.040541 0.094595 0.810811 0.054054 0.081081 0.797297 0.054054 0.067568 0.932432 0.027027 0.000000 0.040541 0.054054 0.756757 0.135135 0.054054 0.108108 0.027027 0.013514 0.851351 0.108108 0.000000 0.851351 0.040541 0.013514 0.000000 0.027027 0.959459 0.000000 0.013514 0.945946 0.040541 0.905405 0.000000 0.067568 0.027027 0.054054 0.837838 0.000000 0.108108 0.945946 0.013514 0.040541 0.000000 0.162162 0.500000 0.189189 0.148649 0.108108 0.824324 0.000000 0.067568 0.945946 0.000000 0.040541 0.013514 0.081081 0.837838 0.027027 0.054054 0.945946 0.000000 0.013514 0.040541 0.054054 0.067568 0.783784 0.094595 0.054054 0.027027 0.000000 0.918919 0.040541 0.013514 0.864865 0.081081 0.148649 0.121622 0.675676 0.054054 Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif 0.148649 0.675676 0.121622 0.054054 0.040541 0.864865 0.013514 0.081081 0.918919 0.027027 0.000000 0.054054 0.054054 0.783784 0.067568 0.094595 0.040541 0.000000 0.013514 0.945946 0.081081 0.027027 0.837838 0.054054 0.013514 0.000000 0.040541 0.945946 0.108108 0.000000 0.824324 0.067568 0.162162 0.189189 0.500000 0.148649 0.000000 0.013514 0.040541 0.945946 0.054054 0.000000 0.837838 0.108108 0.027027 0.000000 0.067568 0.905405 0.000000 0.945946 0.013514 0.040541 0.959459 0.000000 0.027027 0.013514 0.108108 0.851351 0.000000 0.040541 0.851351 0.027027 0.013514 0.108108 0.054054 0.135135 0.756757 0.054054 0.040541 0.027027 0.000000 0.932432 0.081081 0.054054 0.797297 0.067568 0.040541 0.810811 0.094595 0.054054 0.108108 0.000000 0.000000 0.891892 0.094595 0.756757 0.135135 0.013514 0.040541 0.824324 0.013514 0.121622 0.851351 0.040541 0.054054 0.054054 Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA Alignment: CCACTGTGVTGTCACAGTGCTCCA -----------TGACCTTGMBBB- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 22 CACTGTGrYrtCACAGTGswsCAcT Original Motif Reverse Complement Backward 11 12 0.083272 Original motif 0.111111 0.746032 0.063492 0.079365 0.857143 0.047619 0.047619 0.047619 0.047619 0.857143 0.079365 0.015873 0.031746 0.000000 0.000000 0.968254 0.031746 0.015873 0.904762 0.047619 0.000000 0.000000 0.000000 1.000000 0.031746 0.000000 0.857143 0.111111 0.396825 0.111111 0.412698 0.079365 0.031746 0.253968 0.015873 0.698413 0.365079 0.000000 0.634921 0.000000 0.079365 0.206349 0.047619 0.666667 0.047619 0.936508 0.015873 0.000000 0.952381 0.000000 0.015873 0.031746 0.015873 0.920635 0.000000 0.063492 0.920635 0.000000 0.000000 0.079365 0.063492 0.047619 0.841270 0.047619 0.000000 0.000000 0.015873 0.984127 0.047619 0.015873 0.904762 0.031746 0.015873 0.603175 0.317460 0.063492 0.396825 0.000000 0.015873 0.587302 0.015873 0.476190 0.428571 0.079365 0.063492 0.920635 0.000000 0.015873 0.920635 0.015873 0.047619 0.015873 0.095238 0.682540 0.095238 0.126984 0.047619 0.015873 0.095238 0.841270 Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif 0.841270 0.015873 0.095238 0.047619 0.095238 0.095238 0.682540 0.126984 0.015873 0.015873 0.047619 0.920635 0.063492 0.000000 0.920635 0.015873 0.015873 0.428571 0.476190 0.079365 0.587302 0.000000 0.015873 0.396825 0.015873 0.317460 0.603175 0.063492 0.047619 0.904762 0.015873 0.031746 0.984127 0.000000 0.015873 0.000000 0.063492 0.841270 0.047619 0.047619 0.079365 0.000000 0.000000 0.920635 0.015873 0.000000 0.920635 0.063492 0.031746 0.000000 0.015873 0.952381 0.047619 0.015873 0.936508 0.000000 0.666667 0.206349 0.047619 0.079365 0.365079 0.634921 0.000000 0.000000 0.698413 0.253968 0.015873 0.031746 0.396825 0.412698 0.111111 0.079365 0.031746 0.857143 0.000000 0.111111 1.000000 0.000000 0.000000 0.000000 0.031746 0.904762 0.015873 0.047619 0.968254 0.000000 0.000000 0.031746 0.047619 0.079365 0.857143 0.015873 0.047619 0.047619 0.047619 0.857143 0.111111 0.063492 0.746032 0.079365 Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG Alignment: AGTGSWSCACTGTGAMAMCACAGTG ---VBBYCAAGGTCA---------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 25 wwCCAmAGTCmt Original Motif Original Motif Backward 2 11 0.558919 Original motif 0.454545 0.045455 0.227273 0.272727 0.363636 0.136364 0.136364 0.363636 0.000000 1.000000 0.000000 0.000000 0.000000 0.954545 0.045455 0.000000 1.000000 0.000000 0.000000 0.000000 0.409091 0.590909 0.000000 0.000000 0.909091 0.045455 0.045455 0.000000 0.000000 0.000000 1.000000 0.000000 0.045455 0.000000 0.000000 0.954545 0.045455 0.909091 0.000000 0.045455 0.272727 0.318182 0.181818 0.227273 0.181818 0.227273 0.227273 0.363636 Consensus sequence: DDCCAMAGTCHB Reverse complement motif 0.363636 0.227273 0.227273 0.181818 0.272727 0.181818 0.318182 0.227273 0.045455 0.000000 0.909091 0.045455 0.954545 0.000000 0.000000 0.045455 0.000000 1.000000 0.000000 0.000000 0.000000 0.045455 0.045455 0.909091 0.409091 0.000000 0.590909 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.045455 0.954545 0.000000 0.000000 0.000000 1.000000 0.000000 0.363636 0.136364 0.136364 0.363636 0.272727 0.045455 0.227273 0.454545 Consensus sequence: VDGACTRTGGDD Alignment: -DDCCAMAGTCHB VBBYCAAGGTCA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 28 ssGCkTGCssk Reverse Complement Original Motif Backward 1 11 0.581406 Original motif 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 0.500000 0.500000 Consensus sequence: SSGCKTGCSSK Reverse complement motif 0.000000 0.500000 0.000000 0.500000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.000000 0.500000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 Consensus sequence: YSSGCAYGCSS Alignment: -SSGCKTGCSSK TGACCTTGMBBB ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 24 ssCCCCGCSssk Reverse Complement Original Motif Backward 2 11 0.583683 Original motif 0.000000 0.444444 0.370370 0.185185 0.111111 0.407407 0.333333 0.148148 0.000000 0.888889 0.037037 0.074074 0.000000 0.888889 0.074074 0.037037 0.000000 0.777778 0.222222 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.037037 0.888889 0.000000 0.074074 0.000000 0.703704 0.296296 0.000000 0.000000 0.518519 0.370370 0.111111 0.111111 0.407407 0.259259 0.222222 0.074074 0.222222 0.407407 0.296296 Consensus sequence: SBCCCCGCCSBB Reverse complement motif 0.074074 0.407407 0.222222 0.296296 0.111111 0.259259 0.407407 0.222222 0.000000 0.370370 0.518519 0.111111 0.000000 0.296296 0.703704 0.000000 0.037037 0.000000 0.888889 0.074074 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.222222 0.777778 0.000000 0.000000 0.074074 0.888889 0.037037 0.000000 0.037037 0.888889 0.074074 0.111111 0.333333 0.407407 0.148148 0.000000 0.370370 0.444444 0.185185 Consensus sequence: BBSGGCGGGGBS Alignment: -SBCCCCGCCSBB TGACCTTGMBBB- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 27 AgTGCTCCACTGTGgTGTCACAgT Original Motif Original Motif Forward 15 10 1.086832 Original motif 0.690141 0.126761 0.042254 0.140845 0.169014 0.098592 0.676056 0.056338 0.042254 0.028169 0.028169 0.901408 0.056338 0.000000 0.774648 0.169014 0.042254 0.887324 0.042254 0.028169 0.000000 0.014085 0.000000 0.985915 0.056338 0.830986 0.042254 0.070423 0.028169 0.957746 0.014085 0.000000 0.957746 0.000000 0.014085 0.028169 0.084507 0.845070 0.014085 0.056338 0.028169 0.014085 0.000000 0.957746 0.140845 0.028169 0.802817 0.028169 0.014085 0.014085 0.014085 0.957746 0.014085 0.000000 0.929577 0.056338 0.056338 0.154930 0.619718 0.169014 0.014085 0.028169 0.000000 0.957746 0.056338 0.014085 0.873239 0.056338 0.014085 0.000000 0.000000 0.985915 0.042254 0.929577 0.000000 0.028169 0.957746 0.028169 0.000000 0.014085 0.028169 0.845070 0.028169 0.098592 0.873239 0.014085 0.042254 0.070423 0.098592 0.154930 0.563380 0.183099 0.070423 0.014085 0.112676 0.802817 Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif 0.802817 0.014085 0.112676 0.070423 0.098592 0.563380 0.154930 0.183099 0.070423 0.014085 0.042254 0.873239 0.028169 0.028169 0.845070 0.098592 0.014085 0.028169 0.000000 0.957746 0.042254 0.000000 0.929577 0.028169 0.985915 0.000000 0.000000 0.014085 0.056338 0.873239 0.014085 0.056338 0.957746 0.028169 0.000000 0.014085 0.056338 0.619718 0.154930 0.169014 0.014085 0.929577 0.000000 0.056338 0.957746 0.014085 0.014085 0.014085 0.140845 0.802817 0.028169 0.028169 0.957746 0.014085 0.000000 0.028169 0.084507 0.014085 0.845070 0.056338 0.028169 0.000000 0.014085 0.957746 0.028169 0.014085 0.957746 0.000000 0.056338 0.042254 0.830986 0.070423 0.985915 0.014085 0.000000 0.000000 0.042254 0.042254 0.887324 0.028169 0.056338 0.774648 0.000000 0.169014 0.901408 0.028169 0.028169 0.042254 0.169014 0.676056 0.098592 0.056338 0.140845 0.126761 0.042254 0.690141 Consensus sequence: ACTGTGACACCACAGTGGAGCACT Alignment: AGTGCTCCACTGTGGTGTCACAGT-- --------------VBBYCAAGGTCA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 19 atactttggc Original Motif Reverse Complement Backward 1 10 1.087261 Original motif 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 Consensus sequence: ATACTTTGGC Reverse complement motif 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 Consensus sequence: GCCAAAGTAT Alignment: --GCCAAAGTAT VBBYCAAGGTCA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 29 cCGCGGrCACG Original Motif Original Motif Backward 3 9 1.575793 Original motif 0.000000 0.600000 0.200000 0.200000 0.000000 0.800000 0.000000 0.200000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.600000 0.000000 0.400000 0.000000 0.000000 0.800000 0.200000 0.000000 0.800000 0.000000 0.200000 0.000000 0.000000 0.800000 0.200000 0.000000 0.200000 0.000000 0.800000 0.000000 Consensus sequence: CCGCGGRCACG Reverse complement motif 0.200000 0.800000 0.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.200000 0.800000 0.000000 0.000000 0.000000 0.400000 0.600000 0.000000 0.800000 0.200000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.800000 0.200000 0.000000 0.200000 0.600000 0.200000 Consensus sequence: CGTGKCCGCGG Alignment: ---CCGCGGRCACG VBBYCAAGGTCA-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 21 AmTGTGACACCACAGT Original Motif Original Motif Backward 10 7 2.575947 Original motif 0.703125 0.187500 0.015625 0.093750 0.265625 0.500000 0.125000 0.109375 0.015625 0.046875 0.031250 0.906250 0.078125 0.015625 0.890625 0.015625 0.000000 0.000000 0.000000 1.000000 0.000000 0.031250 0.906250 0.062500 0.953125 0.000000 0.015625 0.031250 0.046875 0.890625 0.000000 0.062500 0.968750 0.000000 0.015625 0.015625 0.109375 0.781250 0.062500 0.046875 0.062500 0.890625 0.000000 0.046875 0.953125 0.000000 0.031250 0.015625 0.031250 0.781250 0.046875 0.140625 0.937500 0.015625 0.031250 0.015625 0.093750 0.078125 0.734375 0.093750 0.031250 0.078125 0.000000 0.890625 Consensus sequence: AMTGTGACACCACAGT Reverse complement motif 0.890625 0.078125 0.000000 0.031250 0.093750 0.734375 0.078125 0.093750 0.015625 0.015625 0.031250 0.937500 0.031250 0.046875 0.781250 0.140625 0.015625 0.000000 0.031250 0.953125 0.062500 0.000000 0.890625 0.046875 0.109375 0.062500 0.781250 0.046875 0.015625 0.000000 0.015625 0.968750 0.046875 0.000000 0.890625 0.062500 0.031250 0.000000 0.015625 0.953125 0.000000 0.906250 0.031250 0.062500 1.000000 0.000000 0.000000 0.000000 0.078125 0.890625 0.015625 0.015625 0.906250 0.046875 0.031250 0.015625 0.265625 0.125000 0.500000 0.109375 0.093750 0.187500 0.015625 0.703125 Consensus sequence: ACTGTGGTGTCACART Alignment: -----AMTGTGACACCACAGT VBBYCAAGGTCA--------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 13 Motif name: MIZF Original motif 0.100000 0.300000 0.250000 0.350000 0.650000 0.050000 0.000000 0.300000 1.000000 0.000000 0.000000 0.000000 0.100000 0.850000 0.050000 0.000000 0.000000 0.000000 0.950000 0.050000 0.000000 0.050000 0.000000 0.950000 0.000000 0.950000 0.000000 0.050000 0.000000 0.900000 0.100000 0.000000 0.000000 0.000000 0.950000 0.050000 0.100000 0.650000 0.050000 0.200000 Consensus sequence: BAACGTCCGC Reverse complement motif 0.100000 0.050000 0.650000 0.200000 0.000000 0.950000 0.000000 0.050000 0.000000 0.100000 0.900000 0.000000 0.000000 0.000000 0.950000 0.050000 0.950000 0.050000 0.000000 0.000000 0.000000 0.950000 0.000000 0.050000 0.100000 0.050000 0.850000 0.000000 0.000000 0.000000 0.000000 1.000000 0.300000 0.050000 0.000000 0.650000 0.350000 0.300000 0.250000 0.100000 Consensus sequence: GCGGACGTTV *************************************************************** Best Matches for Top Significant Motif ID 13 (Highest to Lowest) *************************************************************** Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 32 gCGCGCsCgsG Original Motif Original Motif Forward 1 10 0.065160 Original motif 0.105263 0.210526 0.526316 0.157895 0.000000 0.736842 0.105263 0.157895 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.368421 0.631579 0.000000 0.000000 0.894737 0.105263 0.000000 0.157895 0.157895 0.631579 0.052632 0.052632 0.631579 0.263158 0.052632 0.105263 0.052632 0.789474 0.052632 Consensus sequence: GCGCGCSCGCG Reverse complement motif 0.105263 0.789474 0.052632 0.052632 0.052632 0.263158 0.631579 0.052632 0.157895 0.631579 0.157895 0.052632 0.000000 0.105263 0.894737 0.000000 0.000000 0.631579 0.368421 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.105263 0.736842 0.157895 0.105263 0.526316 0.210526 0.157895 Consensus sequence: CGCGSGCGCGC Alignment: GCGCGCSCGCG BAACGTCCGC- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 19 atactttggc Original Motif Original Motif Forward 1 10 0.080357 Original motif 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 Consensus sequence: ATACTTTGGC Reverse complement motif 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 Consensus sequence: GCCAAAGTAT Alignment: ATACTTTGGC BAACGTCCGC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 29 cCGCGGrCACG Reverse Complement Original Motif Forward 3 9 0.560913 Original motif 0.000000 0.600000 0.200000 0.200000 0.000000 0.800000 0.000000 0.200000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.600000 0.000000 0.400000 0.000000 0.000000 0.800000 0.200000 0.000000 0.800000 0.000000 0.200000 0.000000 0.000000 0.800000 0.200000 0.000000 0.200000 0.000000 0.800000 0.000000 Consensus sequence: CCGCGGRCACG Reverse complement motif 0.200000 0.800000 0.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.200000 0.800000 0.000000 0.000000 0.000000 0.400000 0.600000 0.000000 0.800000 0.200000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.800000 0.200000 0.000000 0.200000 0.600000 0.200000 Consensus sequence: CGTGKCCGCGG Alignment: CCGCGGRCACG- --GCGGACGTTV ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 31 ctatacggacg Reverse Complement Reverse Complement Backward 3 9 0.562302 Original motif 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 Consensus sequence: CTATACGGACG Reverse complement motif 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 Consensus sequence: CGTCCGTATAG Alignment: -CGTCCGTATAG GCGGACGTTV-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 25 wwCCAmAGTCmt Original Motif Original Motif Forward 4 9 0.562428 Original motif 0.454545 0.045455 0.227273 0.272727 0.363636 0.136364 0.136364 0.363636 0.000000 1.000000 0.000000 0.000000 0.000000 0.954545 0.045455 0.000000 1.000000 0.000000 0.000000 0.000000 0.409091 0.590909 0.000000 0.000000 0.909091 0.045455 0.045455 0.000000 0.000000 0.000000 1.000000 0.000000 0.045455 0.000000 0.000000 0.954545 0.045455 0.909091 0.000000 0.045455 0.272727 0.318182 0.181818 0.227273 0.181818 0.227273 0.227273 0.363636 Consensus sequence: DDCCAMAGTCHB Reverse complement motif 0.363636 0.227273 0.227273 0.181818 0.272727 0.181818 0.318182 0.227273 0.045455 0.000000 0.909091 0.045455 0.954545 0.000000 0.000000 0.045455 0.000000 1.000000 0.000000 0.000000 0.000000 0.045455 0.045455 0.909091 0.409091 0.000000 0.590909 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.045455 0.954545 0.000000 0.000000 0.000000 1.000000 0.000000 0.363636 0.136364 0.136364 0.363636 0.272727 0.045455 0.227273 0.454545 Consensus sequence: VDGACTRTGGDD Alignment: DDCCAMAGTCHB- ---BAACGTCCGC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 18 sscCCCGCGcs Reverse Complement Reverse Complement Forward 4 8 1.064456 Original motif 0.147059 0.441176 0.264706 0.147059 0.117647 0.529412 0.294118 0.058824 0.000000 0.676471 0.235294 0.088235 0.029412 0.852941 0.117647 0.000000 0.000000 0.823529 0.176471 0.000000 0.000000 0.794118 0.205882 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.058824 0.941176 0.000000 0.117647 0.470588 0.235294 0.176471 0.000000 0.323529 0.529412 0.147059 Consensus sequence: BSCCCCGCGBS Reverse complement motif 0.000000 0.529412 0.323529 0.147059 0.117647 0.235294 0.470588 0.176471 0.000000 0.941176 0.058824 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.205882 0.794118 0.000000 0.000000 0.176471 0.823529 0.000000 0.029412 0.117647 0.852941 0.000000 0.000000 0.235294 0.676471 0.088235 0.117647 0.294118 0.529412 0.058824 0.147059 0.264706 0.441176 0.147059 Consensus sequence: SBCGCGGGGSB Alignment: SBCGCGGGGSB-- ---GCGGACGTTV ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 24 ssCCCCGCSssk Reverse Complement Reverse Complement Forward 5 8 1.071966 Original motif 0.000000 0.444444 0.370370 0.185185 0.111111 0.407407 0.333333 0.148148 0.000000 0.888889 0.037037 0.074074 0.000000 0.888889 0.074074 0.037037 0.000000 0.777778 0.222222 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.037037 0.888889 0.000000 0.074074 0.000000 0.703704 0.296296 0.000000 0.000000 0.518519 0.370370 0.111111 0.111111 0.407407 0.259259 0.222222 0.074074 0.222222 0.407407 0.296296 Consensus sequence: SBCCCCGCCSBB Reverse complement motif 0.074074 0.407407 0.222222 0.296296 0.111111 0.259259 0.407407 0.222222 0.000000 0.370370 0.518519 0.111111 0.000000 0.296296 0.703704 0.000000 0.037037 0.000000 0.888889 0.074074 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.222222 0.777778 0.000000 0.000000 0.074074 0.888889 0.037037 0.000000 0.037037 0.888889 0.074074 0.111111 0.333333 0.407407 0.148148 0.000000 0.370370 0.444444 0.185185 Consensus sequence: BBSGGCGGGGBS Alignment: BBSGGCGGGGBS-- ----GCGGACGTTV ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 33 srACyCCGAyr Reverse Complement Original Motif Forward 5 7 1.550000 Original motif 0.000000 0.500000 0.500000 0.000000 0.500000 0.000000 0.500000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.000000 0.500000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.000000 0.500000 0.500000 0.000000 0.500000 0.000000 Consensus sequence: SRACYCCGAYR Reverse complement motif 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.500000 0.500000 0.000000 Consensus sequence: KKTCGGKGTKS Alignment: SRACYCCGAYR--- ----GCGGACGTTV ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 27 AgTGCTCCACTGTGgTGTCACAgT Original Motif Original Motif Backward 18 7 1.570599 Original motif 0.690141 0.126761 0.042254 0.140845 0.169014 0.098592 0.676056 0.056338 0.042254 0.028169 0.028169 0.901408 0.056338 0.000000 0.774648 0.169014 0.042254 0.887324 0.042254 0.028169 0.000000 0.014085 0.000000 0.985915 0.056338 0.830986 0.042254 0.070423 0.028169 0.957746 0.014085 0.000000 0.957746 0.000000 0.014085 0.028169 0.084507 0.845070 0.014085 0.056338 0.028169 0.014085 0.000000 0.957746 0.140845 0.028169 0.802817 0.028169 0.014085 0.014085 0.014085 0.957746 0.014085 0.000000 0.929577 0.056338 0.056338 0.154930 0.619718 0.169014 0.014085 0.028169 0.000000 0.957746 0.056338 0.014085 0.873239 0.056338 0.014085 0.000000 0.000000 0.985915 0.042254 0.929577 0.000000 0.028169 0.957746 0.028169 0.000000 0.014085 0.028169 0.845070 0.028169 0.098592 0.873239 0.014085 0.042254 0.070423 0.098592 0.154930 0.563380 0.183099 0.070423 0.014085 0.112676 0.802817 Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif 0.802817 0.014085 0.112676 0.070423 0.098592 0.563380 0.154930 0.183099 0.070423 0.014085 0.042254 0.873239 0.028169 0.028169 0.845070 0.098592 0.014085 0.028169 0.000000 0.957746 0.042254 0.000000 0.929577 0.028169 0.985915 0.000000 0.000000 0.014085 0.056338 0.873239 0.014085 0.056338 0.957746 0.028169 0.000000 0.014085 0.056338 0.619718 0.154930 0.169014 0.014085 0.929577 0.000000 0.056338 0.957746 0.014085 0.014085 0.014085 0.140845 0.802817 0.028169 0.028169 0.957746 0.014085 0.000000 0.028169 0.084507 0.014085 0.845070 0.056338 0.028169 0.000000 0.014085 0.957746 0.028169 0.014085 0.957746 0.000000 0.056338 0.042254 0.830986 0.070423 0.985915 0.014085 0.000000 0.000000 0.042254 0.042254 0.887324 0.028169 0.056338 0.774648 0.000000 0.169014 0.901408 0.028169 0.028169 0.042254 0.169014 0.676056 0.098592 0.056338 0.140845 0.126761 0.042254 0.690141 Consensus sequence: ACTGTGACACCACAGTGGAGCACT Alignment: ---AGTGCTCCACTGTGGTGTCACAGT BAACGTCCGC----------------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 26 CAcCACAGTGGAGCAct Reverse Complement Original Motif Forward 11 7 1.571763 Original motif 0.078125 0.734375 0.046875 0.140625 0.828125 0.046875 0.078125 0.046875 0.203125 0.484375 0.156250 0.156250 0.015625 0.984375 0.000000 0.000000 0.968750 0.015625 0.015625 0.000000 0.000000 0.906250 0.015625 0.078125 0.859375 0.000000 0.000000 0.140625 0.031250 0.000000 0.906250 0.062500 0.000000 0.015625 0.000000 0.984375 0.000000 0.000000 0.968750 0.031250 0.046875 0.062500 0.812500 0.078125 0.937500 0.015625 0.015625 0.031250 0.015625 0.031250 0.921875 0.031250 0.125000 0.796875 0.000000 0.078125 0.875000 0.046875 0.046875 0.031250 0.093750 0.656250 0.093750 0.156250 0.156250 0.078125 0.109375 0.656250 Consensus sequence: CAHCACAGTGGAGCACT Reverse complement motif 0.656250 0.078125 0.109375 0.156250 0.093750 0.093750 0.656250 0.156250 0.031250 0.046875 0.046875 0.875000 0.125000 0.000000 0.796875 0.078125 0.015625 0.921875 0.031250 0.031250 0.031250 0.015625 0.015625 0.937500 0.046875 0.812500 0.062500 0.078125 0.000000 0.968750 0.000000 0.031250 0.984375 0.015625 0.000000 0.000000 0.031250 0.906250 0.000000 0.062500 0.140625 0.000000 0.000000 0.859375 0.000000 0.015625 0.906250 0.078125 0.000000 0.015625 0.015625 0.968750 0.015625 0.000000 0.984375 0.000000 0.203125 0.156250 0.484375 0.156250 0.046875 0.046875 0.078125 0.828125 0.078125 0.046875 0.734375 0.140625 Consensus sequence: AGTGCTCCACTGTGDTG Alignment: CAHCACAGTGGAGCACT--- ----------GCGGACGTTV ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- **************************************************************************************************************************************************************************************************** **************************************************************** Significant Motifs - Global and Local Matching (Highest to Lowest) **************************************************************** Dataset #: 1 Motif ID: 5 Motif name: ZEB1 Original motif 0.024390 0.829268 0.024390 0.121951 0.926829 0.000000 0.048780 0.024390 0.000000 0.975610 0.024390 0.000000 0.000000 0.926829 0.073171 0.000000 0.000000 0.024390 0.000000 0.975610 0.243902 0.024390 0.390244 0.341463 Consensus sequence: CACCTD Reverse complement motif 0.243902 0.390244 0.024390 0.341463 0.975610 0.024390 0.000000 0.000000 0.000000 0.073171 0.926829 0.000000 0.000000 0.024390 0.975610 0.000000 0.024390 0.000000 0.048780 0.926829 0.024390 0.024390 0.829268 0.121951 Consensus sequence: HAGGTG ******************************************************************* Best Matches for Significant Motif ID 5 (Highest to Lowest) ******************************************************************* Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 16 CTCF Reverse Complement Original Motif Forward 8 6 0.000000 Original motif 0.095290 0.318729 0.083242 0.502738 0.182913 0.158817 0.453450 0.204819 0.307777 0.053669 0.491785 0.146769 0.061336 0.876232 0.023001 0.039430 0.008762 0.989047 0.000000 0.002191 0.814896 0.014239 0.071194 0.099671 0.043812 0.578313 0.365827 0.012048 0.117325 0.474781 0.052632 0.355263 0.933114 0.012061 0.035088 0.019737 0.005488 0.000000 0.991218 0.003293 0.365532 0.003293 0.621295 0.009879 0.059276 0.013172 0.553238 0.374314 0.013187 0.000000 0.978022 0.008791 0.061538 0.008791 0.851648 0.078022 0.114411 0.806381 0.005501 0.073707 0.409241 0.014301 0.557756 0.018702 0.090308 0.530837 0.338106 0.040749 0.128855 0.354626 0.080396 0.436123 0.442731 0.199339 0.292952 0.064978 Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif 0.064978 0.199339 0.292952 0.442731 0.436123 0.354626 0.080396 0.128855 0.090308 0.338106 0.530837 0.040749 0.409241 0.557756 0.014301 0.018702 0.114411 0.005501 0.806381 0.073707 0.061538 0.851648 0.008791 0.078022 0.013187 0.978022 0.000000 0.008791 0.059276 0.553238 0.013172 0.374314 0.365532 0.621295 0.003293 0.009879 0.005488 0.991218 0.000000 0.003293 0.019737 0.012061 0.035088 0.933114 0.117325 0.052632 0.474781 0.355263 0.043812 0.365827 0.578313 0.012048 0.099671 0.014239 0.071194 0.814896 0.008762 0.000000 0.989047 0.002191 0.061336 0.023001 0.876232 0.039430 0.307777 0.491785 0.053669 0.146769 0.182913 0.453450 0.158817 0.204819 0.502738 0.318729 0.083242 0.095290 Consensus sequence: BMSMGCCYMCTKSTGGMHM Alignment: YDRCCASYAGRKGGCRSYV -------HAGGTG------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 12 RORA_1 Original Motif Reverse Complement Backward 4 6 0.006889 Original motif 0.600000 0.040000 0.080000 0.280000 0.360000 0.040000 0.000000 0.600000 0.240000 0.480000 0.160000 0.120000 0.440000 0.080000 0.200000 0.280000 0.840000 0.000000 0.160000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 Consensus sequence: AWVDAGGTCA Reverse complement motif 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.160000 0.840000 0.280000 0.080000 0.200000 0.440000 0.240000 0.160000 0.480000 0.120000 0.600000 0.040000 0.000000 0.360000 0.280000 0.040000 0.080000 0.600000 Consensus sequence: TGACCTDVWT Alignment: TGACCTDVWT -CACCTD--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 7 REST Reverse Complement Reverse Complement Backward 6 6 0.007073 Original motif 0.132621 0.109365 0.230044 0.527970 0.036318 0.168441 0.091421 0.703820 0.047589 0.855354 0.031309 0.065748 0.906367 0.018727 0.058677 0.016230 0.021197 0.027431 0.945137 0.006234 0.076012 0.609346 0.201246 0.113396 0.980697 0.004359 0.007472 0.007472 0.001868 0.987547 0.007472 0.003113 0.021793 0.922167 0.012453 0.043587 0.568847 0.125234 0.100935 0.204984 0.136534 0.233791 0.077307 0.552369 0.024314 0.004364 0.966958 0.004364 0.012469 0.003117 0.983167 0.001247 0.877105 0.069869 0.021210 0.031815 0.008125 0.800000 0.145625 0.046250 0.983750 0.005625 0.004375 0.006250 0.026349 0.008156 0.959849 0.005646 0.128688 0.632141 0.114878 0.124294 0.229899 0.019472 0.432161 0.318467 0.133962 0.586792 0.200629 0.078616 0.112579 0.700629 0.023270 0.163522 Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif 0.112579 0.023270 0.700629 0.163522 0.133962 0.200629 0.586792 0.078616 0.229899 0.432161 0.019472 0.318467 0.128688 0.114878 0.632141 0.124294 0.026349 0.959849 0.008156 0.005646 0.006250 0.005625 0.004375 0.983750 0.008125 0.145625 0.800000 0.046250 0.031815 0.069869 0.021210 0.877105 0.012469 0.983167 0.003117 0.001247 0.024314 0.966958 0.004364 0.004364 0.552369 0.233791 0.077307 0.136534 0.204984 0.125234 0.100935 0.568847 0.021793 0.012453 0.922167 0.043587 0.001868 0.007472 0.987547 0.003113 0.007472 0.004359 0.007472 0.980697 0.076012 0.201246 0.609346 0.113396 0.021197 0.945137 0.027431 0.006234 0.016230 0.018727 0.058677 0.906367 0.047589 0.031309 0.855354 0.065748 0.703820 0.168441 0.091421 0.036318 0.527970 0.109365 0.230044 0.132621 Consensus sequence: GGYGCTGTCCATGGTGCTGAA Alignment: GGYGCTGTCCATGGTGCTGAA ----------HAGGTG----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 4 Esrrb Reverse Complement Original Motif Forward 2 6 0.013046 Original motif 0.290198 0.220264 0.271200 0.218337 0.184941 0.227810 0.376477 0.210772 0.115226 0.332236 0.331687 0.220850 0.070959 0.342466 0.122740 0.463836 0.084862 0.729264 0.171640 0.014235 0.909737 0.008753 0.067834 0.013676 0.975656 0.000547 0.016411 0.007385 0.008758 0.001368 0.981390 0.008484 0.005750 0.003286 0.986309 0.004655 0.049904 0.012613 0.066904 0.870579 0.002473 0.927473 0.046703 0.023352 0.951569 0.005504 0.035498 0.007430 Consensus sequence: VBBYCAAGGTCA Reverse complement motif 0.007430 0.005504 0.035498 0.951569 0.002473 0.046703 0.927473 0.023352 0.870579 0.012613 0.066904 0.049904 0.005750 0.986309 0.003286 0.004655 0.008758 0.981390 0.001368 0.008484 0.007385 0.000547 0.016411 0.975656 0.013676 0.008753 0.067834 0.909737 0.084862 0.171640 0.729264 0.014235 0.463836 0.342466 0.122740 0.070959 0.115226 0.331687 0.332236 0.220850 0.184941 0.376477 0.227810 0.210772 0.218337 0.220264 0.271200 0.290198 Consensus sequence: TGACCTTGMBBB Alignment: VBBYCAAGGTCA -HAGGTG----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 10 NR1H2RXRA Original Motif Reverse Complement Backward 2 6 0.016035 Original motif 0.680000 0.200000 0.000000 0.120000 0.680000 0.040000 0.200000 0.080000 0.800000 0.000000 0.200000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.040000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.000000 0.040000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.800000 0.040000 0.080000 0.080000 0.000000 0.600000 0.240000 0.160000 Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif 0.000000 0.240000 0.600000 0.160000 0.080000 0.040000 0.080000 0.800000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.040000 0.000000 0.000000 0.960000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.040000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.200000 0.800000 0.080000 0.040000 0.200000 0.680000 0.120000 0.200000 0.000000 0.680000 Consensus sequence: GTTGACCTTTGACCTTT Alignment: GTTGACCTTTGACCTTT ----------CACCTD- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 14 PPARGRXRA Original Motif Reverse Complement Backward 9 6 0.019244 Original motif 0.109685 0.369895 0.373396 0.147025 0.117716 0.193473 0.148019 0.540793 0.453488 0.026744 0.427907 0.091860 0.116144 0.003484 0.779326 0.101045 0.161253 0.017401 0.781903 0.039443 0.168213 0.149652 0.458237 0.223898 0.082271 0.633835 0.207416 0.076477 0.949015 0.024334 0.017381 0.009270 0.604867 0.055620 0.312862 0.026651 0.825231 0.005787 0.158565 0.010417 0.095017 0.002317 0.888760 0.013905 0.047509 0.010429 0.803013 0.139050 0.025492 0.114716 0.304751 0.555041 0.062645 0.643852 0.167053 0.126450 0.784223 0.067285 0.054524 0.093968 Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif 0.093968 0.067285 0.054524 0.784223 0.062645 0.167053 0.643852 0.126450 0.555041 0.114716 0.304751 0.025492 0.047509 0.803013 0.010429 0.139050 0.095017 0.888760 0.002317 0.013905 0.010417 0.005787 0.158565 0.825231 0.026651 0.055620 0.312862 0.604867 0.009270 0.024334 0.017381 0.949015 0.082271 0.207416 0.633835 0.076477 0.168213 0.458237 0.149652 0.223898 0.161253 0.781903 0.017401 0.039443 0.116144 0.779326 0.003484 0.101045 0.091860 0.026744 0.427907 0.453488 0.540793 0.193473 0.148019 0.117716 0.109685 0.373396 0.369895 0.147025 Consensus sequence: TGRCCTKTGHCCKAB Alignment: TGRCCTKTGHCCKAB -CACCTD-------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 11 NR4A2 Original Motif Reverse Complement Backward 1 6 0.021650 Original motif 0.615385 0.076923 0.230769 0.076923 0.928571 0.000000 0.071429 0.000000 0.000000 0.000000 0.928571 0.071429 0.214286 0.000000 0.785714 0.000000 0.142857 0.142857 0.000000 0.714286 0.000000 0.928571 0.000000 0.071429 1.000000 0.000000 0.000000 0.000000 0.230769 0.615385 0.153846 0.000000 Consensus sequence: AAGGTCAC Reverse complement motif 0.230769 0.153846 0.615385 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.928571 0.071429 0.714286 0.142857 0.000000 0.142857 0.214286 0.785714 0.000000 0.000000 0.000000 0.928571 0.000000 0.071429 0.000000 0.000000 0.071429 0.928571 0.076923 0.076923 0.230769 0.615385 Consensus sequence: GTGACCTT Alignment: GTGACCTT --CACCTD ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 3 ESR1 Original Motif Reverse Complement Backward 11 6 0.022947 Original motif 0.261242 0.256959 0.329764 0.152034 0.228632 0.170940 0.350427 0.250000 0.136752 0.369658 0.318376 0.175214 0.176596 0.487234 0.138298 0.197872 0.285106 0.493617 0.100000 0.121277 0.651163 0.059197 0.188161 0.101480 0.075949 0.016878 0.816456 0.090717 0.040000 0.037895 0.884211 0.037895 0.069474 0.086316 0.191579 0.652632 0.008421 0.829474 0.111579 0.050526 0.837895 0.027368 0.056842 0.077895 0.122105 0.526316 0.225263 0.126316 0.132632 0.581053 0.111579 0.174737 0.134737 0.543158 0.204211 0.117895 0.067368 0.040000 0.016842 0.875789 0.044211 0.046316 0.896842 0.012632 0.642105 0.223158 0.065263 0.069474 0.021053 0.917895 0.025263 0.035789 0.124211 0.743158 0.004211 0.128421 0.054737 0.347368 0.046316 0.551579 Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif 0.551579 0.347368 0.046316 0.054737 0.124211 0.004211 0.743158 0.128421 0.021053 0.025263 0.917895 0.035789 0.069474 0.223158 0.065263 0.642105 0.044211 0.896842 0.046316 0.012632 0.875789 0.040000 0.016842 0.067368 0.134737 0.204211 0.543158 0.117895 0.132632 0.111579 0.581053 0.174737 0.122105 0.225263 0.526316 0.126316 0.077895 0.027368 0.056842 0.837895 0.008421 0.111579 0.829474 0.050526 0.652632 0.086316 0.191579 0.069474 0.040000 0.884211 0.037895 0.037895 0.075949 0.816456 0.016878 0.090717 0.101480 0.059197 0.188161 0.651163 0.285106 0.100000 0.493617 0.121277 0.176596 0.138298 0.487234 0.197872 0.136752 0.318376 0.369658 0.175214 0.228632 0.350427 0.170940 0.250000 0.261242 0.329764 0.256959 0.152034 Consensus sequence: MGGTCAGGGTGACCTRDBHV Alignment: MGGTCAGGGTGACCTRDBHV ----CACCTD---------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 6 Mycn Original Motif Original Motif Forward 3 6 0.024646 Original motif 0.349315 0.363014 0.143836 0.143836 0.089041 0.388128 0.447489 0.075342 0.015982 0.984018 0.000000 0.000000 0.945205 0.000000 0.041096 0.013699 0.000000 0.961187 0.018265 0.020548 0.070776 0.002283 0.924658 0.002283 0.054795 0.221461 0.004566 0.719178 0.000000 0.000000 0.938356 0.061644 0.061644 0.111872 0.739726 0.086758 0.139269 0.605023 0.091324 0.164384 Consensus sequence: HSCACGTGGC Reverse complement motif 0.139269 0.091324 0.605023 0.164384 0.061644 0.739726 0.111872 0.086758 0.000000 0.938356 0.000000 0.061644 0.719178 0.221461 0.004566 0.054795 0.070776 0.924658 0.002283 0.002283 0.000000 0.018265 0.961187 0.020548 0.013699 0.000000 0.041096 0.945205 0.015982 0.000000 0.984018 0.000000 0.089041 0.447489 0.388128 0.075342 0.349315 0.143836 0.363014 0.143836 Consensus sequence: GCCACGTGSD Alignment: HSCACGTGGC --CACCTD-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 8 Myc Reverse Complement Reverse Complement Forward 3 6 0.025129 Original motif 0.295154 0.422907 0.158590 0.123348 0.149780 0.233480 0.572687 0.044053 0.035242 0.964758 0.000000 0.000000 0.955947 0.017621 0.022026 0.004405 0.000000 0.933921 0.013216 0.052863 0.083700 0.008811 0.898678 0.008811 0.039648 0.193833 0.000000 0.766520 0.000000 0.008811 0.951542 0.039648 0.000000 0.074890 0.806167 0.118943 0.198238 0.471366 0.105727 0.224670 Consensus sequence: VGCACGTGGH Reverse complement motif 0.198238 0.105727 0.471366 0.224670 0.000000 0.806167 0.074890 0.118943 0.000000 0.951542 0.008811 0.039648 0.766520 0.193833 0.000000 0.039648 0.083700 0.898678 0.008811 0.008811 0.000000 0.013216 0.933921 0.052863 0.004405 0.017621 0.022026 0.955947 0.035242 0.000000 0.964758 0.000000 0.149780 0.572687 0.233480 0.044053 0.295154 0.158590 0.422907 0.123348 Consensus sequence: DCCACGTGCV Alignment: DCCACGTGCV --HAGGTG-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 2 Motif ID: 28 Motif name: ssGCkTGCssk Original motif 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 0.500000 0.500000 Consensus sequence: SSGCKTGCSSK Reverse complement motif 0.000000 0.500000 0.000000 0.500000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.000000 0.500000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 Consensus sequence: YSSGCAYGCSS ******************************************************************* Best Matches for Significant Motif ID 28 (Highest to Lowest) ******************************************************************* Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 32 gCGCGCsCgsG Original Motif Original Motif Backward 1 11 0.004565 Original motif 0.105263 0.210526 0.526316 0.157895 0.000000 0.736842 0.105263 0.157895 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.368421 0.631579 0.000000 0.000000 0.894737 0.105263 0.000000 0.157895 0.157895 0.631579 0.052632 0.052632 0.631579 0.263158 0.052632 0.105263 0.052632 0.789474 0.052632 Consensus sequence: GCGCGCSCGCG Reverse complement motif 0.105263 0.789474 0.052632 0.052632 0.052632 0.263158 0.631579 0.052632 0.157895 0.631579 0.157895 0.052632 0.000000 0.105263 0.894737 0.000000 0.000000 0.631579 0.368421 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.105263 0.736842 0.157895 0.105263 0.526316 0.210526 0.157895 Consensus sequence: CGCGSGCGCGC Alignment: GCGCGCSCGCG SSGCKTGCSSK ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 24 ssCCCCGCSssk Original Motif Original Motif Backward 2 11 0.017635 Original motif 0.000000 0.444444 0.370370 0.185185 0.111111 0.407407 0.333333 0.148148 0.000000 0.888889 0.037037 0.074074 0.000000 0.888889 0.074074 0.037037 0.000000 0.777778 0.222222 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.037037 0.888889 0.000000 0.074074 0.000000 0.703704 0.296296 0.000000 0.000000 0.518519 0.370370 0.111111 0.111111 0.407407 0.259259 0.222222 0.074074 0.222222 0.407407 0.296296 Consensus sequence: SBCCCCGCCSBB Reverse complement motif 0.074074 0.407407 0.222222 0.296296 0.111111 0.259259 0.407407 0.222222 0.000000 0.370370 0.518519 0.111111 0.000000 0.296296 0.703704 0.000000 0.037037 0.000000 0.888889 0.074074 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.222222 0.777778 0.000000 0.000000 0.074074 0.888889 0.037037 0.000000 0.037037 0.888889 0.074074 0.111111 0.333333 0.407407 0.148148 0.000000 0.370370 0.444444 0.185185 Consensus sequence: BBSGGCGGGGBS Alignment: SBCCCCGCCSBB SSGCKTGCSSK- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 18 sscCCCGCGcs Original Motif Original Motif Forward 1 11 0.019095 Original motif 0.147059 0.441176 0.264706 0.147059 0.117647 0.529412 0.294118 0.058824 0.000000 0.676471 0.235294 0.088235 0.029412 0.852941 0.117647 0.000000 0.000000 0.823529 0.176471 0.000000 0.000000 0.794118 0.205882 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.058824 0.941176 0.000000 0.117647 0.470588 0.235294 0.176471 0.000000 0.323529 0.529412 0.147059 Consensus sequence: BSCCCCGCGBS Reverse complement motif 0.000000 0.529412 0.323529 0.147059 0.117647 0.235294 0.470588 0.176471 0.000000 0.941176 0.058824 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.205882 0.794118 0.000000 0.000000 0.176471 0.823529 0.000000 0.029412 0.117647 0.852941 0.000000 0.000000 0.235294 0.676471 0.088235 0.117647 0.294118 0.529412 0.058824 0.147059 0.264706 0.441176 0.147059 Consensus sequence: SBCGCGGGGSB Alignment: BSCCCCGCGBS SSGCKTGCSSK ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 29 cCGCGGrCACG Original Motif Original Motif Backward 1 11 0.027652 Original motif 0.000000 0.600000 0.200000 0.200000 0.000000 0.800000 0.000000 0.200000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.600000 0.000000 0.400000 0.000000 0.000000 0.800000 0.200000 0.000000 0.800000 0.000000 0.200000 0.000000 0.000000 0.800000 0.200000 0.000000 0.200000 0.000000 0.800000 0.000000 Consensus sequence: CCGCGGRCACG Reverse complement motif 0.200000 0.800000 0.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.200000 0.800000 0.000000 0.000000 0.000000 0.400000 0.600000 0.000000 0.800000 0.200000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.800000 0.200000 0.000000 0.200000 0.600000 0.200000 Consensus sequence: CGTGKCCGCGG Alignment: CCGCGGRCACG SSGCKTGCSSK ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 16 CTCF Original Motif Original Motif Forward 8 11 0.034944 Original motif 0.095290 0.318729 0.083242 0.502738 0.182913 0.158817 0.453450 0.204819 0.307777 0.053669 0.491785 0.146769 0.061336 0.876232 0.023001 0.039430 0.008762 0.989047 0.000000 0.002191 0.814896 0.014239 0.071194 0.099671 0.043812 0.578313 0.365827 0.012048 0.117325 0.474781 0.052632 0.355263 0.933114 0.012061 0.035088 0.019737 0.005488 0.000000 0.991218 0.003293 0.365532 0.003293 0.621295 0.009879 0.059276 0.013172 0.553238 0.374314 0.013187 0.000000 0.978022 0.008791 0.061538 0.008791 0.851648 0.078022 0.114411 0.806381 0.005501 0.073707 0.409241 0.014301 0.557756 0.018702 0.090308 0.530837 0.338106 0.040749 0.128855 0.354626 0.080396 0.436123 0.442731 0.199339 0.292952 0.064978 Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif 0.064978 0.199339 0.292952 0.442731 0.436123 0.354626 0.080396 0.128855 0.090308 0.338106 0.530837 0.040749 0.409241 0.557756 0.014301 0.018702 0.114411 0.005501 0.806381 0.073707 0.061538 0.851648 0.008791 0.078022 0.013187 0.978022 0.000000 0.008791 0.059276 0.553238 0.013172 0.374314 0.365532 0.621295 0.003293 0.009879 0.005488 0.991218 0.000000 0.003293 0.019737 0.012061 0.035088 0.933114 0.117325 0.052632 0.474781 0.355263 0.043812 0.365827 0.578313 0.012048 0.099671 0.014239 0.071194 0.814896 0.008762 0.000000 0.989047 0.002191 0.061336 0.023001 0.876232 0.039430 0.307777 0.491785 0.053669 0.146769 0.182913 0.453450 0.158817 0.204819 0.502738 0.318729 0.083242 0.095290 Consensus sequence: BMSMGCCYMCTKSTGGMHM Alignment: YDRCCASYAGRKGGCRSYV -------SSGCKTGCSSK- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 4 Esrrb Reverse Complement Original Motif Backward 1 11 0.035870 Original motif 0.290198 0.220264 0.271200 0.218337 0.184941 0.227810 0.376477 0.210772 0.115226 0.332236 0.331687 0.220850 0.070959 0.342466 0.122740 0.463836 0.084862 0.729264 0.171640 0.014235 0.909737 0.008753 0.067834 0.013676 0.975656 0.000547 0.016411 0.007385 0.008758 0.001368 0.981390 0.008484 0.005750 0.003286 0.986309 0.004655 0.049904 0.012613 0.066904 0.870579 0.002473 0.927473 0.046703 0.023352 0.951569 0.005504 0.035498 0.007430 Consensus sequence: VBBYCAAGGTCA Reverse complement motif 0.007430 0.005504 0.035498 0.951569 0.002473 0.046703 0.927473 0.023352 0.870579 0.012613 0.066904 0.049904 0.005750 0.986309 0.003286 0.004655 0.008758 0.981390 0.001368 0.008484 0.007385 0.000547 0.016411 0.975656 0.013676 0.008753 0.067834 0.909737 0.084862 0.171640 0.729264 0.014235 0.463836 0.342466 0.122740 0.070959 0.115226 0.331687 0.332236 0.220850 0.184941 0.376477 0.227810 0.210772 0.218337 0.220264 0.271200 0.290198 Consensus sequence: TGACCTTGMBBB Alignment: VBBYCAAGGTCA -YSSGCAYGCSS ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 9 ESR2 Reverse Complement Original Motif Backward 3 11 0.037907 Original motif 0.218487 0.450980 0.176471 0.154062 0.442577 0.142857 0.114846 0.299720 0.521008 0.042017 0.431373 0.005602 0.075630 0.000000 0.770308 0.154062 0.050420 0.056022 0.893557 0.000000 0.036415 0.053221 0.092437 0.817927 0.000000 1.000000 0.000000 0.000000 0.943978 0.002801 0.000000 0.053221 0.137255 0.344538 0.316527 0.201681 0.179272 0.176471 0.417367 0.226891 0.145658 0.170868 0.411765 0.271709 0.058824 0.092437 0.067227 0.781513 0.176471 0.070028 0.742297 0.011204 0.498599 0.277311 0.053221 0.170868 0.095238 0.750700 0.005602 0.148459 0.128852 0.809524 0.000000 0.061625 0.075630 0.252101 0.000000 0.672269 0.168067 0.263305 0.380952 0.187675 Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif 0.168067 0.380952 0.263305 0.187675 0.672269 0.252101 0.000000 0.075630 0.128852 0.000000 0.809524 0.061625 0.095238 0.005602 0.750700 0.148459 0.170868 0.277311 0.053221 0.498599 0.176471 0.742297 0.070028 0.011204 0.781513 0.092437 0.067227 0.058824 0.145658 0.411765 0.170868 0.271709 0.179272 0.417367 0.176471 0.226891 0.137255 0.316527 0.344538 0.201681 0.053221 0.002801 0.000000 0.943978 0.000000 0.000000 1.000000 0.000000 0.817927 0.053221 0.092437 0.036415 0.050420 0.893557 0.056022 0.000000 0.075630 0.770308 0.000000 0.154062 0.005602 0.042017 0.431373 0.521008 0.299720 0.142857 0.114846 0.442577 0.218487 0.176471 0.450980 0.154062 Consensus sequence: BAGGYCABHBTGACCKHV Alignment: VHRGGTCABDBTGMCCTB -----YSSGCAYGCSS-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 7 REST Reverse Complement Original Motif Backward 10 11 0.040932 Original motif 0.132621 0.109365 0.230044 0.527970 0.036318 0.168441 0.091421 0.703820 0.047589 0.855354 0.031309 0.065748 0.906367 0.018727 0.058677 0.016230 0.021197 0.027431 0.945137 0.006234 0.076012 0.609346 0.201246 0.113396 0.980697 0.004359 0.007472 0.007472 0.001868 0.987547 0.007472 0.003113 0.021793 0.922167 0.012453 0.043587 0.568847 0.125234 0.100935 0.204984 0.136534 0.233791 0.077307 0.552369 0.024314 0.004364 0.966958 0.004364 0.012469 0.003117 0.983167 0.001247 0.877105 0.069869 0.021210 0.031815 0.008125 0.800000 0.145625 0.046250 0.983750 0.005625 0.004375 0.006250 0.026349 0.008156 0.959849 0.005646 0.128688 0.632141 0.114878 0.124294 0.229899 0.019472 0.432161 0.318467 0.133962 0.586792 0.200629 0.078616 0.112579 0.700629 0.023270 0.163522 Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif 0.112579 0.023270 0.700629 0.163522 0.133962 0.200629 0.586792 0.078616 0.229899 0.432161 0.019472 0.318467 0.128688 0.114878 0.632141 0.124294 0.026349 0.959849 0.008156 0.005646 0.006250 0.005625 0.004375 0.983750 0.008125 0.145625 0.800000 0.046250 0.031815 0.069869 0.021210 0.877105 0.012469 0.983167 0.003117 0.001247 0.024314 0.966958 0.004364 0.004364 0.552369 0.233791 0.077307 0.136534 0.204984 0.125234 0.100935 0.568847 0.021793 0.012453 0.922167 0.043587 0.001868 0.007472 0.987547 0.003113 0.007472 0.004359 0.007472 0.980697 0.076012 0.201246 0.609346 0.113396 0.021197 0.945137 0.027431 0.006234 0.016230 0.018727 0.058677 0.906367 0.047589 0.031309 0.855354 0.065748 0.703820 0.168441 0.091421 0.036318 0.527970 0.109365 0.230044 0.132621 Consensus sequence: GGYGCTGTCCATGGTGCTGAA Alignment: TTCAGCACCATGGACAGCKCC -YSSGCAYGCSS--------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 14 PPARGRXRA Reverse Complement Original Motif Forward 3 11 0.041419 Original motif 0.109685 0.369895 0.373396 0.147025 0.117716 0.193473 0.148019 0.540793 0.453488 0.026744 0.427907 0.091860 0.116144 0.003484 0.779326 0.101045 0.161253 0.017401 0.781903 0.039443 0.168213 0.149652 0.458237 0.223898 0.082271 0.633835 0.207416 0.076477 0.949015 0.024334 0.017381 0.009270 0.604867 0.055620 0.312862 0.026651 0.825231 0.005787 0.158565 0.010417 0.095017 0.002317 0.888760 0.013905 0.047509 0.010429 0.803013 0.139050 0.025492 0.114716 0.304751 0.555041 0.062645 0.643852 0.167053 0.126450 0.784223 0.067285 0.054524 0.093968 Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif 0.093968 0.067285 0.054524 0.784223 0.062645 0.167053 0.643852 0.126450 0.555041 0.114716 0.304751 0.025492 0.047509 0.803013 0.010429 0.139050 0.095017 0.888760 0.002317 0.013905 0.010417 0.005787 0.158565 0.825231 0.026651 0.055620 0.312862 0.604867 0.009270 0.024334 0.017381 0.949015 0.082271 0.207416 0.633835 0.076477 0.168213 0.458237 0.149652 0.223898 0.161253 0.781903 0.017401 0.039443 0.116144 0.779326 0.003484 0.101045 0.091860 0.026744 0.427907 0.453488 0.540793 0.193473 0.148019 0.117716 0.109685 0.373396 0.369895 0.147025 Consensus sequence: TGRCCTKTGHCCKAB Alignment: BTRGGDCARAGGKCA --YSSGCAYGCSS-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 1 HNF4A Reverse Complement Original Motif Forward 3 11 0.043798 Original motif 0.417910 0.104478 0.402985 0.074627 0.029851 0.029851 0.835821 0.104478 0.179104 0.059701 0.522388 0.238806 0.074627 0.343284 0.298507 0.283582 0.044776 0.761194 0.059701 0.134328 0.880597 0.014925 0.044776 0.059701 0.791045 0.029851 0.149254 0.029851 0.835821 0.014925 0.119403 0.029851 0.059701 0.059701 0.865672 0.014925 0.089552 0.029851 0.492537 0.388060 0.044776 0.328358 0.164179 0.462687 0.059701 0.731343 0.074627 0.134328 0.626866 0.104478 0.149254 0.119403 Consensus sequence: RGGBCAAAGKYCA Reverse complement motif 0.119403 0.104478 0.149254 0.626866 0.059701 0.074627 0.731343 0.134328 0.462687 0.328358 0.164179 0.044776 0.089552 0.492537 0.029851 0.388060 0.059701 0.865672 0.059701 0.014925 0.029851 0.014925 0.119403 0.835821 0.029851 0.029851 0.149254 0.791045 0.059701 0.014925 0.044776 0.880597 0.044776 0.059701 0.761194 0.134328 0.074627 0.298507 0.343284 0.283582 0.179104 0.522388 0.059701 0.238806 0.029851 0.835821 0.029851 0.104478 0.074627 0.104478 0.402985 0.417910 Consensus sequence: TGMYCTTTGBCCK Alignment: RGGBCAAAGKYCA --YSSGCAYGCSS ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 2 Motif ID: 25 Motif name: wwCCAmAGTCmt Original motif 0.454545 0.045455 0.227273 0.272727 0.363636 0.136364 0.136364 0.363636 0.000000 1.000000 0.000000 0.000000 0.000000 0.954545 0.045455 0.000000 1.000000 0.000000 0.000000 0.000000 0.409091 0.590909 0.000000 0.000000 0.909091 0.045455 0.045455 0.000000 0.000000 0.000000 1.000000 0.000000 0.045455 0.000000 0.000000 0.954545 0.045455 0.909091 0.000000 0.045455 0.272727 0.318182 0.181818 0.227273 0.181818 0.227273 0.227273 0.363636 Consensus sequence: DDCCAMAGTCHB Reverse complement motif 0.363636 0.227273 0.227273 0.181818 0.272727 0.181818 0.318182 0.227273 0.045455 0.000000 0.909091 0.045455 0.954545 0.000000 0.000000 0.045455 0.000000 1.000000 0.000000 0.000000 0.000000 0.045455 0.045455 0.909091 0.409091 0.000000 0.590909 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.045455 0.954545 0.000000 0.000000 0.000000 1.000000 0.000000 0.363636 0.136364 0.136364 0.363636 0.272727 0.045455 0.227273 0.454545 Consensus sequence: VDGACTRTGGDD ******************************************************************* Best Matches for Significant Motif ID 25 (Highest to Lowest) ******************************************************************* Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 22 CACTGTGrYrtCACAGTGswsCAcT Original Motif Original Motif Backward 6 12 0.026365 Original motif 0.111111 0.746032 0.063492 0.079365 0.857143 0.047619 0.047619 0.047619 0.047619 0.857143 0.079365 0.015873 0.031746 0.000000 0.000000 0.968254 0.031746 0.015873 0.904762 0.047619 0.000000 0.000000 0.000000 1.000000 0.031746 0.000000 0.857143 0.111111 0.396825 0.111111 0.412698 0.079365 0.031746 0.253968 0.015873 0.698413 0.365079 0.000000 0.634921 0.000000 0.079365 0.206349 0.047619 0.666667 0.047619 0.936508 0.015873 0.000000 0.952381 0.000000 0.015873 0.031746 0.015873 0.920635 0.000000 0.063492 0.920635 0.000000 0.000000 0.079365 0.063492 0.047619 0.841270 0.047619 0.000000 0.000000 0.015873 0.984127 0.047619 0.015873 0.904762 0.031746 0.015873 0.603175 0.317460 0.063492 0.396825 0.000000 0.015873 0.587302 0.015873 0.476190 0.428571 0.079365 0.063492 0.920635 0.000000 0.015873 0.920635 0.015873 0.047619 0.015873 0.095238 0.682540 0.095238 0.126984 0.047619 0.015873 0.095238 0.841270 Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif 0.841270 0.015873 0.095238 0.047619 0.095238 0.095238 0.682540 0.126984 0.015873 0.015873 0.047619 0.920635 0.063492 0.000000 0.920635 0.015873 0.015873 0.428571 0.476190 0.079365 0.587302 0.000000 0.015873 0.396825 0.015873 0.317460 0.603175 0.063492 0.047619 0.904762 0.015873 0.031746 0.984127 0.000000 0.015873 0.000000 0.063492 0.841270 0.047619 0.047619 0.079365 0.000000 0.000000 0.920635 0.015873 0.000000 0.920635 0.063492 0.031746 0.000000 0.015873 0.952381 0.047619 0.015873 0.936508 0.000000 0.666667 0.206349 0.047619 0.079365 0.365079 0.634921 0.000000 0.000000 0.698413 0.253968 0.015873 0.031746 0.396825 0.412698 0.111111 0.079365 0.031746 0.857143 0.000000 0.111111 1.000000 0.000000 0.000000 0.000000 0.031746 0.904762 0.015873 0.047619 0.968254 0.000000 0.000000 0.031746 0.047619 0.079365 0.857143 0.015873 0.047619 0.047619 0.047619 0.857143 0.111111 0.063492 0.746032 0.079365 Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG Alignment: CACTGTGRTRTCACAGTGSWSCACT --------DDCCAMAGTCHB----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 20 CagTGCTCCACTGTGgT Reverse Complement Reverse Complement Backward 6 12 0.028283 Original motif 0.150000 0.700000 0.016667 0.133333 0.650000 0.150000 0.050000 0.150000 0.166667 0.116667 0.633333 0.083333 0.050000 0.033333 0.066667 0.850000 0.050000 0.000000 0.833333 0.116667 0.016667 0.966667 0.000000 0.016667 0.050000 0.016667 0.000000 0.933333 0.066667 0.833333 0.066667 0.033333 0.033333 0.966667 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.050000 0.916667 0.016667 0.016667 0.166667 0.000000 0.000000 0.833333 0.083333 0.016667 0.900000 0.000000 0.000000 0.016667 0.016667 0.966667 0.000000 0.016667 0.966667 0.016667 0.116667 0.166667 0.483333 0.233333 0.066667 0.083333 0.050000 0.800000 Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif 0.800000 0.083333 0.050000 0.066667 0.116667 0.483333 0.166667 0.233333 0.000000 0.966667 0.016667 0.016667 0.966667 0.016667 0.016667 0.000000 0.083333 0.900000 0.016667 0.000000 0.833333 0.000000 0.000000 0.166667 0.050000 0.016667 0.916667 0.016667 0.000000 0.000000 0.000000 1.000000 0.033333 0.000000 0.966667 0.000000 0.066667 0.066667 0.833333 0.033333 0.933333 0.016667 0.000000 0.050000 0.016667 0.000000 0.966667 0.016667 0.050000 0.833333 0.000000 0.116667 0.850000 0.033333 0.066667 0.050000 0.166667 0.633333 0.116667 0.083333 0.150000 0.150000 0.050000 0.650000 0.150000 0.016667 0.700000 0.133333 Consensus sequence: ABCACAGTGGAGCACTG Alignment: ABCACAGTGGAGCACTG VDGACTRTGGDD----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 26 CAcCACAGTGGAGCAct Reverse Complement Reverse Complement Forward 6 12 0.029109 Original motif 0.078125 0.734375 0.046875 0.140625 0.828125 0.046875 0.078125 0.046875 0.203125 0.484375 0.156250 0.156250 0.015625 0.984375 0.000000 0.000000 0.968750 0.015625 0.015625 0.000000 0.000000 0.906250 0.015625 0.078125 0.859375 0.000000 0.000000 0.140625 0.031250 0.000000 0.906250 0.062500 0.000000 0.015625 0.000000 0.984375 0.000000 0.000000 0.968750 0.031250 0.046875 0.062500 0.812500 0.078125 0.937500 0.015625 0.015625 0.031250 0.015625 0.031250 0.921875 0.031250 0.125000 0.796875 0.000000 0.078125 0.875000 0.046875 0.046875 0.031250 0.093750 0.656250 0.093750 0.156250 0.156250 0.078125 0.109375 0.656250 Consensus sequence: CAHCACAGTGGAGCACT Reverse complement motif 0.656250 0.078125 0.109375 0.156250 0.093750 0.093750 0.656250 0.156250 0.031250 0.046875 0.046875 0.875000 0.125000 0.000000 0.796875 0.078125 0.015625 0.921875 0.031250 0.031250 0.031250 0.015625 0.015625 0.937500 0.046875 0.812500 0.062500 0.078125 0.000000 0.968750 0.000000 0.031250 0.984375 0.015625 0.000000 0.000000 0.031250 0.906250 0.000000 0.062500 0.140625 0.000000 0.000000 0.859375 0.000000 0.015625 0.906250 0.078125 0.000000 0.015625 0.015625 0.968750 0.015625 0.000000 0.984375 0.000000 0.203125 0.156250 0.484375 0.156250 0.046875 0.046875 0.078125 0.828125 0.078125 0.046875 0.734375 0.140625 Consensus sequence: AGTGCTCCACTGTGDTG Alignment: AGTGCTCCACTGTGDTG -----VDGACTRTGGDD ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 27 AgTGCTCCACTGTGgTGTCACAgT Reverse Complement Original Motif Forward 6 12 0.030192 Original motif 0.690141 0.126761 0.042254 0.140845 0.169014 0.098592 0.676056 0.056338 0.042254 0.028169 0.028169 0.901408 0.056338 0.000000 0.774648 0.169014 0.042254 0.887324 0.042254 0.028169 0.000000 0.014085 0.000000 0.985915 0.056338 0.830986 0.042254 0.070423 0.028169 0.957746 0.014085 0.000000 0.957746 0.000000 0.014085 0.028169 0.084507 0.845070 0.014085 0.056338 0.028169 0.014085 0.000000 0.957746 0.140845 0.028169 0.802817 0.028169 0.014085 0.014085 0.014085 0.957746 0.014085 0.000000 0.929577 0.056338 0.056338 0.154930 0.619718 0.169014 0.014085 0.028169 0.000000 0.957746 0.056338 0.014085 0.873239 0.056338 0.014085 0.000000 0.000000 0.985915 0.042254 0.929577 0.000000 0.028169 0.957746 0.028169 0.000000 0.014085 0.028169 0.845070 0.028169 0.098592 0.873239 0.014085 0.042254 0.070423 0.098592 0.154930 0.563380 0.183099 0.070423 0.014085 0.112676 0.802817 Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif 0.802817 0.014085 0.112676 0.070423 0.098592 0.563380 0.154930 0.183099 0.070423 0.014085 0.042254 0.873239 0.028169 0.028169 0.845070 0.098592 0.014085 0.028169 0.000000 0.957746 0.042254 0.000000 0.929577 0.028169 0.985915 0.000000 0.000000 0.014085 0.056338 0.873239 0.014085 0.056338 0.957746 0.028169 0.000000 0.014085 0.056338 0.619718 0.154930 0.169014 0.014085 0.929577 0.000000 0.056338 0.957746 0.014085 0.014085 0.014085 0.140845 0.802817 0.028169 0.028169 0.957746 0.014085 0.000000 0.028169 0.084507 0.014085 0.845070 0.056338 0.028169 0.000000 0.014085 0.957746 0.028169 0.014085 0.957746 0.000000 0.056338 0.042254 0.830986 0.070423 0.985915 0.014085 0.000000 0.000000 0.042254 0.042254 0.887324 0.028169 0.056338 0.774648 0.000000 0.169014 0.901408 0.028169 0.028169 0.042254 0.169014 0.676056 0.098592 0.056338 0.140845 0.126761 0.042254 0.690141 Consensus sequence: ACTGTGACACCACAGTGGAGCACT Alignment: AGTGCTCCACTGTGGTGTCACAGT -----VDGACTRTGGDD------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 1 HNF4A Original Motif Original Motif Forward 2 12 0.032442 Original motif 0.417910 0.104478 0.402985 0.074627 0.029851 0.029851 0.835821 0.104478 0.179104 0.059701 0.522388 0.238806 0.074627 0.343284 0.298507 0.283582 0.044776 0.761194 0.059701 0.134328 0.880597 0.014925 0.044776 0.059701 0.791045 0.029851 0.149254 0.029851 0.835821 0.014925 0.119403 0.029851 0.059701 0.059701 0.865672 0.014925 0.089552 0.029851 0.492537 0.388060 0.044776 0.328358 0.164179 0.462687 0.059701 0.731343 0.074627 0.134328 0.626866 0.104478 0.149254 0.119403 Consensus sequence: RGGBCAAAGKYCA Reverse complement motif 0.119403 0.104478 0.149254 0.626866 0.059701 0.074627 0.731343 0.134328 0.462687 0.328358 0.164179 0.044776 0.089552 0.492537 0.029851 0.388060 0.059701 0.865672 0.059701 0.014925 0.029851 0.014925 0.119403 0.835821 0.029851 0.029851 0.149254 0.791045 0.059701 0.014925 0.044776 0.880597 0.044776 0.059701 0.761194 0.134328 0.074627 0.298507 0.343284 0.283582 0.179104 0.522388 0.059701 0.238806 0.029851 0.835821 0.029851 0.104478 0.074627 0.104478 0.402985 0.417910 Consensus sequence: TGMYCTTTGBCCK Alignment: RGGBCAAAGKYCA -DDCCAMAGTCHB ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 23 TGGAGCACTGTGACAcCACAGTGg Original Motif Reverse Complement Forward 4 12 0.036070 Original motif 0.054054 0.040541 0.054054 0.851351 0.040541 0.013514 0.824324 0.121622 0.094595 0.135135 0.756757 0.013514 0.891892 0.000000 0.000000 0.108108 0.040541 0.094595 0.810811 0.054054 0.081081 0.797297 0.054054 0.067568 0.932432 0.027027 0.000000 0.040541 0.054054 0.756757 0.135135 0.054054 0.108108 0.027027 0.013514 0.851351 0.108108 0.000000 0.851351 0.040541 0.013514 0.000000 0.027027 0.959459 0.000000 0.013514 0.945946 0.040541 0.905405 0.000000 0.067568 0.027027 0.054054 0.837838 0.000000 0.108108 0.945946 0.013514 0.040541 0.000000 0.162162 0.500000 0.189189 0.148649 0.108108 0.824324 0.000000 0.067568 0.945946 0.000000 0.040541 0.013514 0.081081 0.837838 0.027027 0.054054 0.945946 0.000000 0.013514 0.040541 0.054054 0.067568 0.783784 0.094595 0.054054 0.027027 0.000000 0.918919 0.040541 0.013514 0.864865 0.081081 0.148649 0.121622 0.675676 0.054054 Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif 0.148649 0.675676 0.121622 0.054054 0.040541 0.864865 0.013514 0.081081 0.918919 0.027027 0.000000 0.054054 0.054054 0.783784 0.067568 0.094595 0.040541 0.000000 0.013514 0.945946 0.081081 0.027027 0.837838 0.054054 0.013514 0.000000 0.040541 0.945946 0.108108 0.000000 0.824324 0.067568 0.162162 0.189189 0.500000 0.148649 0.000000 0.013514 0.040541 0.945946 0.054054 0.000000 0.837838 0.108108 0.027027 0.000000 0.067568 0.905405 0.000000 0.945946 0.013514 0.040541 0.959459 0.000000 0.027027 0.013514 0.108108 0.851351 0.000000 0.040541 0.851351 0.027027 0.013514 0.108108 0.054054 0.135135 0.756757 0.054054 0.040541 0.027027 0.000000 0.932432 0.081081 0.054054 0.797297 0.067568 0.040541 0.810811 0.094595 0.054054 0.108108 0.000000 0.000000 0.891892 0.094595 0.756757 0.135135 0.013514 0.040541 0.824324 0.013514 0.121622 0.851351 0.040541 0.054054 0.054054 Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA Alignment: CCACTGTGVTGTCACAGTGCTCCA ---DDCCAMAGTCHB--------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 7 REST Original Motif Reverse Complement Forward 4 12 0.039123 Original motif 0.132621 0.109365 0.230044 0.527970 0.036318 0.168441 0.091421 0.703820 0.047589 0.855354 0.031309 0.065748 0.906367 0.018727 0.058677 0.016230 0.021197 0.027431 0.945137 0.006234 0.076012 0.609346 0.201246 0.113396 0.980697 0.004359 0.007472 0.007472 0.001868 0.987547 0.007472 0.003113 0.021793 0.922167 0.012453 0.043587 0.568847 0.125234 0.100935 0.204984 0.136534 0.233791 0.077307 0.552369 0.024314 0.004364 0.966958 0.004364 0.012469 0.003117 0.983167 0.001247 0.877105 0.069869 0.021210 0.031815 0.008125 0.800000 0.145625 0.046250 0.983750 0.005625 0.004375 0.006250 0.026349 0.008156 0.959849 0.005646 0.128688 0.632141 0.114878 0.124294 0.229899 0.019472 0.432161 0.318467 0.133962 0.586792 0.200629 0.078616 0.112579 0.700629 0.023270 0.163522 Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif 0.112579 0.023270 0.700629 0.163522 0.133962 0.200629 0.586792 0.078616 0.229899 0.432161 0.019472 0.318467 0.128688 0.114878 0.632141 0.124294 0.026349 0.959849 0.008156 0.005646 0.006250 0.005625 0.004375 0.983750 0.008125 0.145625 0.800000 0.046250 0.031815 0.069869 0.021210 0.877105 0.012469 0.983167 0.003117 0.001247 0.024314 0.966958 0.004364 0.004364 0.552369 0.233791 0.077307 0.136534 0.204984 0.125234 0.100935 0.568847 0.021793 0.012453 0.922167 0.043587 0.001868 0.007472 0.987547 0.003113 0.007472 0.004359 0.007472 0.980697 0.076012 0.201246 0.609346 0.113396 0.021197 0.945137 0.027431 0.006234 0.016230 0.018727 0.058677 0.906367 0.047589 0.031309 0.855354 0.065748 0.703820 0.168441 0.091421 0.036318 0.527970 0.109365 0.230044 0.132621 Consensus sequence: GGYGCTGTCCATGGTGCTGAA Alignment: GGYGCTGTCCATGGTGCTGAA ---DDCCAMAGTCHB------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 17 TgTGgTGTCACAGTGCTCC Original Motif Original Motif Backward 3 12 0.039378 Original motif 0.111111 0.083333 0.055556 0.750000 0.125000 0.097222 0.652778 0.125000 0.041667 0.097222 0.027778 0.833333 0.027778 0.027778 0.791667 0.152778 0.055556 0.166667 0.652778 0.125000 0.000000 0.041667 0.013889 0.944444 0.041667 0.000000 0.888889 0.069444 0.027778 0.027778 0.000000 0.944444 0.041667 0.944444 0.013889 0.000000 0.916667 0.027778 0.000000 0.055556 0.069444 0.875000 0.000000 0.055556 0.833333 0.013889 0.013889 0.138889 0.041667 0.069444 0.819444 0.069444 0.027778 0.027778 0.027778 0.916667 0.069444 0.013889 0.847222 0.069444 0.069444 0.777778 0.027778 0.125000 0.055556 0.041667 0.027778 0.875000 0.041667 0.708333 0.125000 0.125000 0.111111 0.819444 0.055556 0.013889 Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif 0.111111 0.055556 0.819444 0.013889 0.041667 0.125000 0.708333 0.125000 0.875000 0.041667 0.027778 0.055556 0.069444 0.027778 0.777778 0.125000 0.069444 0.847222 0.013889 0.069444 0.916667 0.027778 0.027778 0.027778 0.041667 0.819444 0.069444 0.069444 0.138889 0.013889 0.013889 0.833333 0.069444 0.000000 0.875000 0.055556 0.055556 0.027778 0.000000 0.916667 0.041667 0.013889 0.944444 0.000000 0.944444 0.027778 0.000000 0.027778 0.041667 0.888889 0.000000 0.069444 0.944444 0.041667 0.013889 0.000000 0.055556 0.652778 0.166667 0.125000 0.027778 0.791667 0.027778 0.152778 0.833333 0.097222 0.027778 0.041667 0.125000 0.652778 0.097222 0.125000 0.750000 0.083333 0.055556 0.111111 Consensus sequence: GGAGCACTGTGACACCACA Alignment: TGTGGTGTCACAGTGCTCC -----DDCCAMAGTCHB-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 3 ESR1 Original Motif Original Motif Forward 1 12 0.040730 Original motif 0.261242 0.256959 0.329764 0.152034 0.228632 0.170940 0.350427 0.250000 0.136752 0.369658 0.318376 0.175214 0.176596 0.487234 0.138298 0.197872 0.285106 0.493617 0.100000 0.121277 0.651163 0.059197 0.188161 0.101480 0.075949 0.016878 0.816456 0.090717 0.040000 0.037895 0.884211 0.037895 0.069474 0.086316 0.191579 0.652632 0.008421 0.829474 0.111579 0.050526 0.837895 0.027368 0.056842 0.077895 0.122105 0.526316 0.225263 0.126316 0.132632 0.581053 0.111579 0.174737 0.134737 0.543158 0.204211 0.117895 0.067368 0.040000 0.016842 0.875789 0.044211 0.046316 0.896842 0.012632 0.642105 0.223158 0.065263 0.069474 0.021053 0.917895 0.025263 0.035789 0.124211 0.743158 0.004211 0.128421 0.054737 0.347368 0.046316 0.551579 Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif 0.551579 0.347368 0.046316 0.054737 0.124211 0.004211 0.743158 0.128421 0.021053 0.025263 0.917895 0.035789 0.069474 0.223158 0.065263 0.642105 0.044211 0.896842 0.046316 0.012632 0.875789 0.040000 0.016842 0.067368 0.134737 0.204211 0.543158 0.117895 0.132632 0.111579 0.581053 0.174737 0.122105 0.225263 0.526316 0.126316 0.077895 0.027368 0.056842 0.837895 0.008421 0.111579 0.829474 0.050526 0.652632 0.086316 0.191579 0.069474 0.040000 0.884211 0.037895 0.037895 0.075949 0.816456 0.016878 0.090717 0.101480 0.059197 0.188161 0.651163 0.285106 0.100000 0.493617 0.121277 0.176596 0.138298 0.487234 0.197872 0.136752 0.318376 0.369658 0.175214 0.228632 0.350427 0.170940 0.250000 0.261242 0.329764 0.256959 0.152034 Consensus sequence: MGGTCAGGGTGACCTRDBHV Alignment: VDBHMAGGTCACCCTGACCY DDCCAMAGTCHB-------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 10 NR1H2RXRA Original Motif Original Motif Backward 2 12 0.046338 Original motif 0.680000 0.200000 0.000000 0.120000 0.680000 0.040000 0.200000 0.080000 0.800000 0.000000 0.200000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.040000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.000000 0.040000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.800000 0.040000 0.080000 0.080000 0.000000 0.600000 0.240000 0.160000 Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif 0.000000 0.240000 0.600000 0.160000 0.080000 0.040000 0.080000 0.800000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.040000 0.000000 0.000000 0.960000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.040000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.200000 0.800000 0.080000 0.040000 0.200000 0.680000 0.120000 0.200000 0.000000 0.680000 Consensus sequence: GTTGACCTTTGACCTTT Alignment: AAAGGTCAAAGGTCAAC ----DDCCAMAGTCHB- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 2 Motif ID: 19 Motif name: atactttggc Original motif 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 Consensus sequence: ATACTTTGGC Reverse complement motif 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 Consensus sequence: GCCAAAGTAT ******************************************************************* Best Matches for Significant Motif ID 19 (Highest to Lowest) ******************************************************************* Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 25 wwCCAmAGTCmt Reverse Complement Original Motif Forward 2 10 0.021591 Original motif 0.454545 0.045455 0.227273 0.272727 0.363636 0.136364 0.136364 0.363636 0.000000 1.000000 0.000000 0.000000 0.000000 0.954545 0.045455 0.000000 1.000000 0.000000 0.000000 0.000000 0.409091 0.590909 0.000000 0.000000 0.909091 0.045455 0.045455 0.000000 0.000000 0.000000 1.000000 0.000000 0.045455 0.000000 0.000000 0.954545 0.045455 0.909091 0.000000 0.045455 0.272727 0.318182 0.181818 0.227273 0.181818 0.227273 0.227273 0.363636 Consensus sequence: DDCCAMAGTCHB Reverse complement motif 0.363636 0.227273 0.227273 0.181818 0.272727 0.181818 0.318182 0.227273 0.045455 0.000000 0.909091 0.045455 0.954545 0.000000 0.000000 0.045455 0.000000 1.000000 0.000000 0.000000 0.000000 0.045455 0.045455 0.909091 0.409091 0.000000 0.590909 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.045455 0.954545 0.000000 0.000000 0.000000 1.000000 0.000000 0.363636 0.136364 0.136364 0.363636 0.272727 0.045455 0.227273 0.454545 Consensus sequence: VDGACTRTGGDD Alignment: DDCCAMAGTCHB -GCCAAAGTAT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 30 taaacgatgcc Reverse Complement Reverse Complement Backward 2 10 0.037500 Original motif 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 Consensus sequence: TAAACGATGCC Reverse complement motif 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 Consensus sequence: GGCATCGTTTA Alignment: GGCATCGTTTA GCCAAAGTAT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 10 NR1H2RXRA Original Motif Reverse Complement Forward 5 10 0.039500 Original motif 0.680000 0.200000 0.000000 0.120000 0.680000 0.040000 0.200000 0.080000 0.800000 0.000000 0.200000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.040000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.000000 0.040000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.800000 0.040000 0.080000 0.080000 0.000000 0.600000 0.240000 0.160000 Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif 0.000000 0.240000 0.600000 0.160000 0.080000 0.040000 0.080000 0.800000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.040000 0.000000 0.000000 0.960000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.040000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.200000 0.800000 0.080000 0.040000 0.200000 0.680000 0.120000 0.200000 0.000000 0.680000 Consensus sequence: GTTGACCTTTGACCTTT Alignment: GTTGACCTTTGACCTTT ----ATACTTTGGC--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 17 TgTGgTGTCACAGTGCTCC Original Motif Reverse Complement Backward 4 10 0.047222 Original motif 0.111111 0.083333 0.055556 0.750000 0.125000 0.097222 0.652778 0.125000 0.041667 0.097222 0.027778 0.833333 0.027778 0.027778 0.791667 0.152778 0.055556 0.166667 0.652778 0.125000 0.000000 0.041667 0.013889 0.944444 0.041667 0.000000 0.888889 0.069444 0.027778 0.027778 0.000000 0.944444 0.041667 0.944444 0.013889 0.000000 0.916667 0.027778 0.000000 0.055556 0.069444 0.875000 0.000000 0.055556 0.833333 0.013889 0.013889 0.138889 0.041667 0.069444 0.819444 0.069444 0.027778 0.027778 0.027778 0.916667 0.069444 0.013889 0.847222 0.069444 0.069444 0.777778 0.027778 0.125000 0.055556 0.041667 0.027778 0.875000 0.041667 0.708333 0.125000 0.125000 0.111111 0.819444 0.055556 0.013889 Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif 0.111111 0.055556 0.819444 0.013889 0.041667 0.125000 0.708333 0.125000 0.875000 0.041667 0.027778 0.055556 0.069444 0.027778 0.777778 0.125000 0.069444 0.847222 0.013889 0.069444 0.916667 0.027778 0.027778 0.027778 0.041667 0.819444 0.069444 0.069444 0.138889 0.013889 0.013889 0.833333 0.069444 0.000000 0.875000 0.055556 0.055556 0.027778 0.000000 0.916667 0.041667 0.013889 0.944444 0.000000 0.944444 0.027778 0.000000 0.027778 0.041667 0.888889 0.000000 0.069444 0.944444 0.041667 0.013889 0.000000 0.055556 0.652778 0.166667 0.125000 0.027778 0.791667 0.027778 0.152778 0.833333 0.097222 0.027778 0.041667 0.125000 0.652778 0.097222 0.125000 0.750000 0.083333 0.055556 0.111111 Consensus sequence: GGAGCACTGTGACACCACA Alignment: GGAGCACTGTGACACCACA ------ATACTTTGGC--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 22 CACTGTGrYrtCACAGTGswsCAcT Reverse Complement Original Motif Forward 10 10 0.047421 Original motif 0.111111 0.746032 0.063492 0.079365 0.857143 0.047619 0.047619 0.047619 0.047619 0.857143 0.079365 0.015873 0.031746 0.000000 0.000000 0.968254 0.031746 0.015873 0.904762 0.047619 0.000000 0.000000 0.000000 1.000000 0.031746 0.000000 0.857143 0.111111 0.396825 0.111111 0.412698 0.079365 0.031746 0.253968 0.015873 0.698413 0.365079 0.000000 0.634921 0.000000 0.079365 0.206349 0.047619 0.666667 0.047619 0.936508 0.015873 0.000000 0.952381 0.000000 0.015873 0.031746 0.015873 0.920635 0.000000 0.063492 0.920635 0.000000 0.000000 0.079365 0.063492 0.047619 0.841270 0.047619 0.000000 0.000000 0.015873 0.984127 0.047619 0.015873 0.904762 0.031746 0.015873 0.603175 0.317460 0.063492 0.396825 0.000000 0.015873 0.587302 0.015873 0.476190 0.428571 0.079365 0.063492 0.920635 0.000000 0.015873 0.920635 0.015873 0.047619 0.015873 0.095238 0.682540 0.095238 0.126984 0.047619 0.015873 0.095238 0.841270 Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif 0.841270 0.015873 0.095238 0.047619 0.095238 0.095238 0.682540 0.126984 0.015873 0.015873 0.047619 0.920635 0.063492 0.000000 0.920635 0.015873 0.015873 0.428571 0.476190 0.079365 0.587302 0.000000 0.015873 0.396825 0.015873 0.317460 0.603175 0.063492 0.047619 0.904762 0.015873 0.031746 0.984127 0.000000 0.015873 0.000000 0.063492 0.841270 0.047619 0.047619 0.079365 0.000000 0.000000 0.920635 0.015873 0.000000 0.920635 0.063492 0.031746 0.000000 0.015873 0.952381 0.047619 0.015873 0.936508 0.000000 0.666667 0.206349 0.047619 0.079365 0.365079 0.634921 0.000000 0.000000 0.698413 0.253968 0.015873 0.031746 0.396825 0.412698 0.111111 0.079365 0.031746 0.857143 0.000000 0.111111 1.000000 0.000000 0.000000 0.000000 0.031746 0.904762 0.015873 0.047619 0.968254 0.000000 0.000000 0.031746 0.047619 0.079365 0.857143 0.015873 0.047619 0.047619 0.047619 0.857143 0.111111 0.063492 0.746032 0.079365 Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG Alignment: CACTGTGRTRTCACAGTGSWSCACT ---------GCCAAAGTAT------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 1 HNF4A Original Motif Reverse Complement Forward 3 10 0.048321 Original motif 0.417910 0.104478 0.402985 0.074627 0.029851 0.029851 0.835821 0.104478 0.179104 0.059701 0.522388 0.238806 0.074627 0.343284 0.298507 0.283582 0.044776 0.761194 0.059701 0.134328 0.880597 0.014925 0.044776 0.059701 0.791045 0.029851 0.149254 0.029851 0.835821 0.014925 0.119403 0.029851 0.059701 0.059701 0.865672 0.014925 0.089552 0.029851 0.492537 0.388060 0.044776 0.328358 0.164179 0.462687 0.059701 0.731343 0.074627 0.134328 0.626866 0.104478 0.149254 0.119403 Consensus sequence: RGGBCAAAGKYCA Reverse complement motif 0.119403 0.104478 0.149254 0.626866 0.059701 0.074627 0.731343 0.134328 0.462687 0.328358 0.164179 0.044776 0.089552 0.492537 0.029851 0.388060 0.059701 0.865672 0.059701 0.014925 0.029851 0.014925 0.119403 0.835821 0.029851 0.029851 0.149254 0.791045 0.059701 0.014925 0.044776 0.880597 0.044776 0.059701 0.761194 0.134328 0.074627 0.298507 0.343284 0.283582 0.179104 0.522388 0.059701 0.238806 0.029851 0.835821 0.029851 0.104478 0.074627 0.104478 0.402985 0.417910 Consensus sequence: TGMYCTTTGBCCK Alignment: TGMYCTTTGBCCK --ATACTTTGGC- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 2 NR2F1 Original Motif Original Motif Forward 2 10 0.049038 Original motif 0.000000 0.000000 0.153846 0.846154 0.076923 0.000000 0.923077 0.000000 0.923077 0.000000 0.076923 0.000000 0.461538 0.538462 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.230769 0.000000 0.769231 0.000000 0.153846 0.000000 0.846154 0.076923 0.000000 0.000000 0.923077 0.153846 0.000000 0.846154 0.000000 0.461538 0.307692 0.230769 0.000000 0.461538 0.384615 0.076923 0.076923 0.076923 0.769231 0.076923 0.076923 0.230769 0.461538 0.000000 0.307692 0.000000 0.230769 0.230769 0.538462 Consensus sequence: TGAMCTTTGMMCYT Reverse complement motif 0.538462 0.230769 0.230769 0.000000 0.230769 0.000000 0.461538 0.307692 0.076923 0.076923 0.769231 0.076923 0.076923 0.384615 0.076923 0.461538 0.000000 0.307692 0.230769 0.461538 0.153846 0.846154 0.000000 0.000000 0.923077 0.000000 0.000000 0.076923 0.846154 0.153846 0.000000 0.000000 0.769231 0.230769 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.461538 0.000000 0.538462 0.000000 0.000000 0.000000 0.076923 0.923077 0.076923 0.923077 0.000000 0.000000 0.846154 0.000000 0.153846 0.000000 Consensus sequence: AKGYYCAAAGRTCA Alignment: TGAMCTTTGMMCYT -ATACTTTGGC--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 23 TGGAGCACTGTGACAcCACAGTGg Reverse Complement Reverse Complement Backward 5 10 0.049324 Original motif 0.054054 0.040541 0.054054 0.851351 0.040541 0.013514 0.824324 0.121622 0.094595 0.135135 0.756757 0.013514 0.891892 0.000000 0.000000 0.108108 0.040541 0.094595 0.810811 0.054054 0.081081 0.797297 0.054054 0.067568 0.932432 0.027027 0.000000 0.040541 0.054054 0.756757 0.135135 0.054054 0.108108 0.027027 0.013514 0.851351 0.108108 0.000000 0.851351 0.040541 0.013514 0.000000 0.027027 0.959459 0.000000 0.013514 0.945946 0.040541 0.905405 0.000000 0.067568 0.027027 0.054054 0.837838 0.000000 0.108108 0.945946 0.013514 0.040541 0.000000 0.162162 0.500000 0.189189 0.148649 0.108108 0.824324 0.000000 0.067568 0.945946 0.000000 0.040541 0.013514 0.081081 0.837838 0.027027 0.054054 0.945946 0.000000 0.013514 0.040541 0.054054 0.067568 0.783784 0.094595 0.054054 0.027027 0.000000 0.918919 0.040541 0.013514 0.864865 0.081081 0.148649 0.121622 0.675676 0.054054 Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif 0.148649 0.675676 0.121622 0.054054 0.040541 0.864865 0.013514 0.081081 0.918919 0.027027 0.000000 0.054054 0.054054 0.783784 0.067568 0.094595 0.040541 0.000000 0.013514 0.945946 0.081081 0.027027 0.837838 0.054054 0.013514 0.000000 0.040541 0.945946 0.108108 0.000000 0.824324 0.067568 0.162162 0.189189 0.500000 0.148649 0.000000 0.013514 0.040541 0.945946 0.054054 0.000000 0.837838 0.108108 0.027027 0.000000 0.067568 0.905405 0.000000 0.945946 0.013514 0.040541 0.959459 0.000000 0.027027 0.013514 0.108108 0.851351 0.000000 0.040541 0.851351 0.027027 0.013514 0.108108 0.054054 0.135135 0.756757 0.054054 0.040541 0.027027 0.000000 0.932432 0.081081 0.054054 0.797297 0.067568 0.040541 0.810811 0.094595 0.054054 0.108108 0.000000 0.000000 0.891892 0.094595 0.756757 0.135135 0.013514 0.040541 0.824324 0.013514 0.121622 0.851351 0.040541 0.054054 0.054054 Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA Alignment: CCACTGTGVTGTCACAGTGCTCCA ----------GCCAAAGTAT---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 27 AgTGCTCCACTGTGgTGTCACAgT Reverse Complement Reverse Complement Forward 9 10 0.049824 Original motif 0.690141 0.126761 0.042254 0.140845 0.169014 0.098592 0.676056 0.056338 0.042254 0.028169 0.028169 0.901408 0.056338 0.000000 0.774648 0.169014 0.042254 0.887324 0.042254 0.028169 0.000000 0.014085 0.000000 0.985915 0.056338 0.830986 0.042254 0.070423 0.028169 0.957746 0.014085 0.000000 0.957746 0.000000 0.014085 0.028169 0.084507 0.845070 0.014085 0.056338 0.028169 0.014085 0.000000 0.957746 0.140845 0.028169 0.802817 0.028169 0.014085 0.014085 0.014085 0.957746 0.014085 0.000000 0.929577 0.056338 0.056338 0.154930 0.619718 0.169014 0.014085 0.028169 0.000000 0.957746 0.056338 0.014085 0.873239 0.056338 0.014085 0.000000 0.000000 0.985915 0.042254 0.929577 0.000000 0.028169 0.957746 0.028169 0.000000 0.014085 0.028169 0.845070 0.028169 0.098592 0.873239 0.014085 0.042254 0.070423 0.098592 0.154930 0.563380 0.183099 0.070423 0.014085 0.112676 0.802817 Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif 0.802817 0.014085 0.112676 0.070423 0.098592 0.563380 0.154930 0.183099 0.070423 0.014085 0.042254 0.873239 0.028169 0.028169 0.845070 0.098592 0.014085 0.028169 0.000000 0.957746 0.042254 0.000000 0.929577 0.028169 0.985915 0.000000 0.000000 0.014085 0.056338 0.873239 0.014085 0.056338 0.957746 0.028169 0.000000 0.014085 0.056338 0.619718 0.154930 0.169014 0.014085 0.929577 0.000000 0.056338 0.957746 0.014085 0.014085 0.014085 0.140845 0.802817 0.028169 0.028169 0.957746 0.014085 0.000000 0.028169 0.084507 0.014085 0.845070 0.056338 0.028169 0.000000 0.014085 0.957746 0.028169 0.014085 0.957746 0.000000 0.056338 0.042254 0.830986 0.070423 0.985915 0.014085 0.000000 0.000000 0.042254 0.042254 0.887324 0.028169 0.056338 0.774648 0.000000 0.169014 0.901408 0.028169 0.028169 0.042254 0.169014 0.676056 0.098592 0.056338 0.140845 0.126761 0.042254 0.690141 Consensus sequence: ACTGTGACACCACAGTGGAGCACT Alignment: ACTGTGACACCACAGTGGAGCACT --------GCCAAAGTAT------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 26 CAcCACAGTGGAGCAct Original Motif Reverse Complement Backward 2 10 0.052734 Original motif 0.078125 0.734375 0.046875 0.140625 0.828125 0.046875 0.078125 0.046875 0.203125 0.484375 0.156250 0.156250 0.015625 0.984375 0.000000 0.000000 0.968750 0.015625 0.015625 0.000000 0.000000 0.906250 0.015625 0.078125 0.859375 0.000000 0.000000 0.140625 0.031250 0.000000 0.906250 0.062500 0.000000 0.015625 0.000000 0.984375 0.000000 0.000000 0.968750 0.031250 0.046875 0.062500 0.812500 0.078125 0.937500 0.015625 0.015625 0.031250 0.015625 0.031250 0.921875 0.031250 0.125000 0.796875 0.000000 0.078125 0.875000 0.046875 0.046875 0.031250 0.093750 0.656250 0.093750 0.156250 0.156250 0.078125 0.109375 0.656250 Consensus sequence: CAHCACAGTGGAGCACT Reverse complement motif 0.656250 0.078125 0.109375 0.156250 0.093750 0.093750 0.656250 0.156250 0.031250 0.046875 0.046875 0.875000 0.125000 0.000000 0.796875 0.078125 0.015625 0.921875 0.031250 0.031250 0.031250 0.015625 0.015625 0.937500 0.046875 0.812500 0.062500 0.078125 0.000000 0.968750 0.000000 0.031250 0.984375 0.015625 0.000000 0.000000 0.031250 0.906250 0.000000 0.062500 0.140625 0.000000 0.000000 0.859375 0.000000 0.015625 0.906250 0.078125 0.000000 0.015625 0.015625 0.968750 0.015625 0.000000 0.984375 0.000000 0.203125 0.156250 0.484375 0.156250 0.046875 0.046875 0.078125 0.828125 0.078125 0.046875 0.734375 0.140625 Consensus sequence: AGTGCTCCACTGTGDTG Alignment: AGTGCTCCACTGTGDTG ------ATACTTTGGC- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 11 Motif name: NR4A2 Original motif 0.615385 0.076923 0.230769 0.076923 0.928571 0.000000 0.071429 0.000000 0.000000 0.000000 0.928571 0.071429 0.214286 0.000000 0.785714 0.000000 0.142857 0.142857 0.000000 0.714286 0.000000 0.928571 0.000000 0.071429 1.000000 0.000000 0.000000 0.000000 0.230769 0.615385 0.153846 0.000000 Consensus sequence: AAGGTCAC Reverse complement motif 0.230769 0.153846 0.615385 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.928571 0.071429 0.714286 0.142857 0.000000 0.142857 0.214286 0.785714 0.000000 0.000000 0.000000 0.928571 0.000000 0.071429 0.000000 0.000000 0.071429 0.928571 0.076923 0.076923 0.230769 0.615385 Consensus sequence: GTGACCTT ******************************************************************* Best Matches for Significant Motif ID 11 (Highest to Lowest) ******************************************************************* Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 10 NR1H2RXRA Original Motif Original Motif Backward 9 8 0.016776 Original motif 0.680000 0.200000 0.000000 0.120000 0.680000 0.040000 0.200000 0.080000 0.800000 0.000000 0.200000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.040000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.000000 0.040000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.800000 0.040000 0.080000 0.080000 0.000000 0.600000 0.240000 0.160000 Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif 0.000000 0.240000 0.600000 0.160000 0.080000 0.040000 0.080000 0.800000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.040000 0.000000 0.000000 0.960000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.040000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.200000 0.800000 0.080000 0.040000 0.200000 0.680000 0.120000 0.200000 0.000000 0.680000 Consensus sequence: GTTGACCTTTGACCTTT Alignment: AAAGGTCAAAGGTCAAC -AAGGTCAC-------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 3 ESR1 Original Motif Original Motif Forward 5 8 0.019523 Original motif 0.261242 0.256959 0.329764 0.152034 0.228632 0.170940 0.350427 0.250000 0.136752 0.369658 0.318376 0.175214 0.176596 0.487234 0.138298 0.197872 0.285106 0.493617 0.100000 0.121277 0.651163 0.059197 0.188161 0.101480 0.075949 0.016878 0.816456 0.090717 0.040000 0.037895 0.884211 0.037895 0.069474 0.086316 0.191579 0.652632 0.008421 0.829474 0.111579 0.050526 0.837895 0.027368 0.056842 0.077895 0.122105 0.526316 0.225263 0.126316 0.132632 0.581053 0.111579 0.174737 0.134737 0.543158 0.204211 0.117895 0.067368 0.040000 0.016842 0.875789 0.044211 0.046316 0.896842 0.012632 0.642105 0.223158 0.065263 0.069474 0.021053 0.917895 0.025263 0.035789 0.124211 0.743158 0.004211 0.128421 0.054737 0.347368 0.046316 0.551579 Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif 0.551579 0.347368 0.046316 0.054737 0.124211 0.004211 0.743158 0.128421 0.021053 0.025263 0.917895 0.035789 0.069474 0.223158 0.065263 0.642105 0.044211 0.896842 0.046316 0.012632 0.875789 0.040000 0.016842 0.067368 0.134737 0.204211 0.543158 0.117895 0.132632 0.111579 0.581053 0.174737 0.122105 0.225263 0.526316 0.126316 0.077895 0.027368 0.056842 0.837895 0.008421 0.111579 0.829474 0.050526 0.652632 0.086316 0.191579 0.069474 0.040000 0.884211 0.037895 0.037895 0.075949 0.816456 0.016878 0.090717 0.101480 0.059197 0.188161 0.651163 0.285106 0.100000 0.493617 0.121277 0.176596 0.138298 0.487234 0.197872 0.136752 0.318376 0.369658 0.175214 0.228632 0.350427 0.170940 0.250000 0.261242 0.329764 0.256959 0.152034 Consensus sequence: MGGTCAGGGTGACCTRDBHV Alignment: VDBHMAGGTCACCCTGACCY ----AAGGTCAC-------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 9 ESR2 Reverse Complement Reverse Complement Backward 2 8 0.019837 Original motif 0.218487 0.450980 0.176471 0.154062 0.442577 0.142857 0.114846 0.299720 0.521008 0.042017 0.431373 0.005602 0.075630 0.000000 0.770308 0.154062 0.050420 0.056022 0.893557 0.000000 0.036415 0.053221 0.092437 0.817927 0.000000 1.000000 0.000000 0.000000 0.943978 0.002801 0.000000 0.053221 0.137255 0.344538 0.316527 0.201681 0.179272 0.176471 0.417367 0.226891 0.145658 0.170868 0.411765 0.271709 0.058824 0.092437 0.067227 0.781513 0.176471 0.070028 0.742297 0.011204 0.498599 0.277311 0.053221 0.170868 0.095238 0.750700 0.005602 0.148459 0.128852 0.809524 0.000000 0.061625 0.075630 0.252101 0.000000 0.672269 0.168067 0.263305 0.380952 0.187675 Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif 0.168067 0.380952 0.263305 0.187675 0.672269 0.252101 0.000000 0.075630 0.128852 0.000000 0.809524 0.061625 0.095238 0.005602 0.750700 0.148459 0.170868 0.277311 0.053221 0.498599 0.176471 0.742297 0.070028 0.011204 0.781513 0.092437 0.067227 0.058824 0.145658 0.411765 0.170868 0.271709 0.179272 0.417367 0.176471 0.226891 0.137255 0.316527 0.344538 0.201681 0.053221 0.002801 0.000000 0.943978 0.000000 0.000000 1.000000 0.000000 0.817927 0.053221 0.092437 0.036415 0.050420 0.893557 0.056022 0.000000 0.075630 0.770308 0.000000 0.154062 0.005602 0.042017 0.431373 0.521008 0.299720 0.142857 0.114846 0.442577 0.218487 0.176471 0.450980 0.154062 Consensus sequence: BAGGYCABHBTGACCKHV Alignment: BAGGYCABHBTGACCKHV ---------GTGACCTT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 14 PPARGRXRA Original Motif Original Motif Backward 7 8 0.049561 Original motif 0.109685 0.369895 0.373396 0.147025 0.117716 0.193473 0.148019 0.540793 0.453488 0.026744 0.427907 0.091860 0.116144 0.003484 0.779326 0.101045 0.161253 0.017401 0.781903 0.039443 0.168213 0.149652 0.458237 0.223898 0.082271 0.633835 0.207416 0.076477 0.949015 0.024334 0.017381 0.009270 0.604867 0.055620 0.312862 0.026651 0.825231 0.005787 0.158565 0.010417 0.095017 0.002317 0.888760 0.013905 0.047509 0.010429 0.803013 0.139050 0.025492 0.114716 0.304751 0.555041 0.062645 0.643852 0.167053 0.126450 0.784223 0.067285 0.054524 0.093968 Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif 0.093968 0.067285 0.054524 0.784223 0.062645 0.167053 0.643852 0.126450 0.555041 0.114716 0.304751 0.025492 0.047509 0.803013 0.010429 0.139050 0.095017 0.888760 0.002317 0.013905 0.010417 0.005787 0.158565 0.825231 0.026651 0.055620 0.312862 0.604867 0.009270 0.024334 0.017381 0.949015 0.082271 0.207416 0.633835 0.076477 0.168213 0.458237 0.149652 0.223898 0.161253 0.781903 0.017401 0.039443 0.116144 0.779326 0.003484 0.101045 0.091860 0.026744 0.427907 0.453488 0.540793 0.193473 0.148019 0.117716 0.109685 0.373396 0.369895 0.147025 Consensus sequence: TGRCCTKTGHCCKAB Alignment: BTRGGDCARAGGKCA -AAGGTCAC------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 22 CACTGTGrYrtCACAGTGswsCAcT Original Motif Original Motif Forward 7 8 0.055724 Original motif 0.111111 0.746032 0.063492 0.079365 0.857143 0.047619 0.047619 0.047619 0.047619 0.857143 0.079365 0.015873 0.031746 0.000000 0.000000 0.968254 0.031746 0.015873 0.904762 0.047619 0.000000 0.000000 0.000000 1.000000 0.031746 0.000000 0.857143 0.111111 0.396825 0.111111 0.412698 0.079365 0.031746 0.253968 0.015873 0.698413 0.365079 0.000000 0.634921 0.000000 0.079365 0.206349 0.047619 0.666667 0.047619 0.936508 0.015873 0.000000 0.952381 0.000000 0.015873 0.031746 0.015873 0.920635 0.000000 0.063492 0.920635 0.000000 0.000000 0.079365 0.063492 0.047619 0.841270 0.047619 0.000000 0.000000 0.015873 0.984127 0.047619 0.015873 0.904762 0.031746 0.015873 0.603175 0.317460 0.063492 0.396825 0.000000 0.015873 0.587302 0.015873 0.476190 0.428571 0.079365 0.063492 0.920635 0.000000 0.015873 0.920635 0.015873 0.047619 0.015873 0.095238 0.682540 0.095238 0.126984 0.047619 0.015873 0.095238 0.841270 Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif 0.841270 0.015873 0.095238 0.047619 0.095238 0.095238 0.682540 0.126984 0.015873 0.015873 0.047619 0.920635 0.063492 0.000000 0.920635 0.015873 0.015873 0.428571 0.476190 0.079365 0.587302 0.000000 0.015873 0.396825 0.015873 0.317460 0.603175 0.063492 0.047619 0.904762 0.015873 0.031746 0.984127 0.000000 0.015873 0.000000 0.063492 0.841270 0.047619 0.047619 0.079365 0.000000 0.000000 0.920635 0.015873 0.000000 0.920635 0.063492 0.031746 0.000000 0.015873 0.952381 0.047619 0.015873 0.936508 0.000000 0.666667 0.206349 0.047619 0.079365 0.365079 0.634921 0.000000 0.000000 0.698413 0.253968 0.015873 0.031746 0.396825 0.412698 0.111111 0.079365 0.031746 0.857143 0.000000 0.111111 1.000000 0.000000 0.000000 0.000000 0.031746 0.904762 0.015873 0.047619 0.968254 0.000000 0.000000 0.031746 0.047619 0.079365 0.857143 0.015873 0.047619 0.047619 0.047619 0.857143 0.111111 0.063492 0.746032 0.079365 Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG Alignment: CACTGTGRTRTCACAGTGSWSCACT ------AAGGTCAC----------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 2 NR2F1 Original Motif Reverse Complement Forward 7 8 0.056487 Original motif 0.000000 0.000000 0.153846 0.846154 0.076923 0.000000 0.923077 0.000000 0.923077 0.000000 0.076923 0.000000 0.461538 0.538462 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.230769 0.000000 0.769231 0.000000 0.153846 0.000000 0.846154 0.076923 0.000000 0.000000 0.923077 0.153846 0.000000 0.846154 0.000000 0.461538 0.307692 0.230769 0.000000 0.461538 0.384615 0.076923 0.076923 0.076923 0.769231 0.076923 0.076923 0.230769 0.461538 0.000000 0.307692 0.000000 0.230769 0.230769 0.538462 Consensus sequence: TGAMCTTTGMMCYT Reverse complement motif 0.538462 0.230769 0.230769 0.000000 0.230769 0.000000 0.461538 0.307692 0.076923 0.076923 0.769231 0.076923 0.076923 0.384615 0.076923 0.461538 0.000000 0.307692 0.230769 0.461538 0.153846 0.846154 0.000000 0.000000 0.923077 0.000000 0.000000 0.076923 0.846154 0.153846 0.000000 0.000000 0.769231 0.230769 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.461538 0.000000 0.538462 0.000000 0.000000 0.000000 0.076923 0.923077 0.076923 0.923077 0.000000 0.000000 0.846154 0.000000 0.153846 0.000000 Consensus sequence: AKGYYCAAAGRTCA Alignment: AKGYYCAAAGRTCA ------AAGGTCAC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 7 REST Reverse Complement Reverse Complement Forward 5 8 0.059465 Original motif 0.132621 0.109365 0.230044 0.527970 0.036318 0.168441 0.091421 0.703820 0.047589 0.855354 0.031309 0.065748 0.906367 0.018727 0.058677 0.016230 0.021197 0.027431 0.945137 0.006234 0.076012 0.609346 0.201246 0.113396 0.980697 0.004359 0.007472 0.007472 0.001868 0.987547 0.007472 0.003113 0.021793 0.922167 0.012453 0.043587 0.568847 0.125234 0.100935 0.204984 0.136534 0.233791 0.077307 0.552369 0.024314 0.004364 0.966958 0.004364 0.012469 0.003117 0.983167 0.001247 0.877105 0.069869 0.021210 0.031815 0.008125 0.800000 0.145625 0.046250 0.983750 0.005625 0.004375 0.006250 0.026349 0.008156 0.959849 0.005646 0.128688 0.632141 0.114878 0.124294 0.229899 0.019472 0.432161 0.318467 0.133962 0.586792 0.200629 0.078616 0.112579 0.700629 0.023270 0.163522 Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif 0.112579 0.023270 0.700629 0.163522 0.133962 0.200629 0.586792 0.078616 0.229899 0.432161 0.019472 0.318467 0.128688 0.114878 0.632141 0.124294 0.026349 0.959849 0.008156 0.005646 0.006250 0.005625 0.004375 0.983750 0.008125 0.145625 0.800000 0.046250 0.031815 0.069869 0.021210 0.877105 0.012469 0.983167 0.003117 0.001247 0.024314 0.966958 0.004364 0.004364 0.552369 0.233791 0.077307 0.136534 0.204984 0.125234 0.100935 0.568847 0.021793 0.012453 0.922167 0.043587 0.001868 0.007472 0.987547 0.003113 0.007472 0.004359 0.007472 0.980697 0.076012 0.201246 0.609346 0.113396 0.021197 0.945137 0.027431 0.006234 0.016230 0.018727 0.058677 0.906367 0.047589 0.031309 0.855354 0.065748 0.703820 0.168441 0.091421 0.036318 0.527970 0.109365 0.230044 0.132621 Consensus sequence: GGYGCTGTCCATGGTGCTGAA Alignment: GGYGCTGTCCATGGTGCTGAA ----GTGACCTT--------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 23 TGGAGCACTGTGACAcCACAGTGg Original Motif Reverse Complement Forward 8 8 0.060729 Original motif 0.054054 0.040541 0.054054 0.851351 0.040541 0.013514 0.824324 0.121622 0.094595 0.135135 0.756757 0.013514 0.891892 0.000000 0.000000 0.108108 0.040541 0.094595 0.810811 0.054054 0.081081 0.797297 0.054054 0.067568 0.932432 0.027027 0.000000 0.040541 0.054054 0.756757 0.135135 0.054054 0.108108 0.027027 0.013514 0.851351 0.108108 0.000000 0.851351 0.040541 0.013514 0.000000 0.027027 0.959459 0.000000 0.013514 0.945946 0.040541 0.905405 0.000000 0.067568 0.027027 0.054054 0.837838 0.000000 0.108108 0.945946 0.013514 0.040541 0.000000 0.162162 0.500000 0.189189 0.148649 0.108108 0.824324 0.000000 0.067568 0.945946 0.000000 0.040541 0.013514 0.081081 0.837838 0.027027 0.054054 0.945946 0.000000 0.013514 0.040541 0.054054 0.067568 0.783784 0.094595 0.054054 0.027027 0.000000 0.918919 0.040541 0.013514 0.864865 0.081081 0.148649 0.121622 0.675676 0.054054 Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif 0.148649 0.675676 0.121622 0.054054 0.040541 0.864865 0.013514 0.081081 0.918919 0.027027 0.000000 0.054054 0.054054 0.783784 0.067568 0.094595 0.040541 0.000000 0.013514 0.945946 0.081081 0.027027 0.837838 0.054054 0.013514 0.000000 0.040541 0.945946 0.108108 0.000000 0.824324 0.067568 0.162162 0.189189 0.500000 0.148649 0.000000 0.013514 0.040541 0.945946 0.054054 0.000000 0.837838 0.108108 0.027027 0.000000 0.067568 0.905405 0.000000 0.945946 0.013514 0.040541 0.959459 0.000000 0.027027 0.013514 0.108108 0.851351 0.000000 0.040541 0.851351 0.027027 0.013514 0.108108 0.054054 0.135135 0.756757 0.054054 0.040541 0.027027 0.000000 0.932432 0.081081 0.054054 0.797297 0.067568 0.040541 0.810811 0.094595 0.054054 0.108108 0.000000 0.000000 0.891892 0.094595 0.756757 0.135135 0.013514 0.040541 0.824324 0.013514 0.121622 0.851351 0.040541 0.054054 0.054054 Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA Alignment: CCACTGTGVTGTCACAGTGCTCCA -------AAGGTCAC--------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 21 AmTGTGACACCACAGT Original Motif Reverse Complement Backward 4 8 0.064515 Original motif 0.703125 0.187500 0.015625 0.093750 0.265625 0.500000 0.125000 0.109375 0.015625 0.046875 0.031250 0.906250 0.078125 0.015625 0.890625 0.015625 0.000000 0.000000 0.000000 1.000000 0.000000 0.031250 0.906250 0.062500 0.953125 0.000000 0.015625 0.031250 0.046875 0.890625 0.000000 0.062500 0.968750 0.000000 0.015625 0.015625 0.109375 0.781250 0.062500 0.046875 0.062500 0.890625 0.000000 0.046875 0.953125 0.000000 0.031250 0.015625 0.031250 0.781250 0.046875 0.140625 0.937500 0.015625 0.031250 0.015625 0.093750 0.078125 0.734375 0.093750 0.031250 0.078125 0.000000 0.890625 Consensus sequence: AMTGTGACACCACAGT Reverse complement motif 0.890625 0.078125 0.000000 0.031250 0.093750 0.734375 0.078125 0.093750 0.015625 0.015625 0.031250 0.937500 0.031250 0.046875 0.781250 0.140625 0.015625 0.000000 0.031250 0.953125 0.062500 0.000000 0.890625 0.046875 0.109375 0.062500 0.781250 0.046875 0.015625 0.000000 0.015625 0.968750 0.046875 0.000000 0.890625 0.062500 0.031250 0.000000 0.015625 0.953125 0.000000 0.906250 0.031250 0.062500 1.000000 0.000000 0.000000 0.000000 0.078125 0.890625 0.015625 0.015625 0.906250 0.046875 0.031250 0.015625 0.265625 0.125000 0.500000 0.109375 0.093750 0.187500 0.015625 0.703125 Consensus sequence: ACTGTGGTGTCACART Alignment: ACTGTGGTGTCACART -----AAGGTCAC--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 17 TgTGgTGTCACAGTGCTCC Original Motif Original Motif Forward 4 8 0.069551 Original motif 0.111111 0.083333 0.055556 0.750000 0.125000 0.097222 0.652778 0.125000 0.041667 0.097222 0.027778 0.833333 0.027778 0.027778 0.791667 0.152778 0.055556 0.166667 0.652778 0.125000 0.000000 0.041667 0.013889 0.944444 0.041667 0.000000 0.888889 0.069444 0.027778 0.027778 0.000000 0.944444 0.041667 0.944444 0.013889 0.000000 0.916667 0.027778 0.000000 0.055556 0.069444 0.875000 0.000000 0.055556 0.833333 0.013889 0.013889 0.138889 0.041667 0.069444 0.819444 0.069444 0.027778 0.027778 0.027778 0.916667 0.069444 0.013889 0.847222 0.069444 0.069444 0.777778 0.027778 0.125000 0.055556 0.041667 0.027778 0.875000 0.041667 0.708333 0.125000 0.125000 0.111111 0.819444 0.055556 0.013889 Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif 0.111111 0.055556 0.819444 0.013889 0.041667 0.125000 0.708333 0.125000 0.875000 0.041667 0.027778 0.055556 0.069444 0.027778 0.777778 0.125000 0.069444 0.847222 0.013889 0.069444 0.916667 0.027778 0.027778 0.027778 0.041667 0.819444 0.069444 0.069444 0.138889 0.013889 0.013889 0.833333 0.069444 0.000000 0.875000 0.055556 0.055556 0.027778 0.000000 0.916667 0.041667 0.013889 0.944444 0.000000 0.944444 0.027778 0.000000 0.027778 0.041667 0.888889 0.000000 0.069444 0.944444 0.041667 0.013889 0.000000 0.055556 0.652778 0.166667 0.125000 0.027778 0.791667 0.027778 0.152778 0.833333 0.097222 0.027778 0.041667 0.125000 0.652778 0.097222 0.125000 0.750000 0.083333 0.055556 0.111111 Consensus sequence: GGAGCACTGTGACACCACA Alignment: TGTGGTGTCACAGTGCTCC ---AAGGTCAC-------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 4 Motif name: Esrrb Original motif 0.290198 0.220264 0.271200 0.218337 0.184941 0.227810 0.376477 0.210772 0.115226 0.332236 0.331687 0.220850 0.070959 0.342466 0.122740 0.463836 0.084862 0.729264 0.171640 0.014235 0.909737 0.008753 0.067834 0.013676 0.975656 0.000547 0.016411 0.007385 0.008758 0.001368 0.981390 0.008484 0.005750 0.003286 0.986309 0.004655 0.049904 0.012613 0.066904 0.870579 0.002473 0.927473 0.046703 0.023352 0.951569 0.005504 0.035498 0.007430 Consensus sequence: VBBYCAAGGTCA Reverse complement motif 0.007430 0.005504 0.035498 0.951569 0.002473 0.046703 0.927473 0.023352 0.870579 0.012613 0.066904 0.049904 0.005750 0.986309 0.003286 0.004655 0.008758 0.981390 0.001368 0.008484 0.007385 0.000547 0.016411 0.975656 0.013676 0.008753 0.067834 0.909737 0.084862 0.171640 0.729264 0.014235 0.463836 0.342466 0.122740 0.070959 0.115226 0.331687 0.332236 0.220850 0.184941 0.376477 0.227810 0.210772 0.218337 0.220264 0.271200 0.290198 Consensus sequence: TGACCTTGMBBB ******************************************************************* Best Matches for Significant Motif ID 4 (Highest to Lowest) ******************************************************************* Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 2 NR2F1 Reverse Complement Original Motif Backward 1 12 0.044261 Original motif 0.000000 0.000000 0.153846 0.846154 0.076923 0.000000 0.923077 0.000000 0.923077 0.000000 0.076923 0.000000 0.461538 0.538462 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.230769 0.000000 0.769231 0.000000 0.153846 0.000000 0.846154 0.076923 0.000000 0.000000 0.923077 0.153846 0.000000 0.846154 0.000000 0.461538 0.307692 0.230769 0.000000 0.461538 0.384615 0.076923 0.076923 0.076923 0.769231 0.076923 0.076923 0.230769 0.461538 0.000000 0.307692 0.000000 0.230769 0.230769 0.538462 Consensus sequence: TGAMCTTTGMMCYT Reverse complement motif 0.538462 0.230769 0.230769 0.000000 0.230769 0.000000 0.461538 0.307692 0.076923 0.076923 0.769231 0.076923 0.076923 0.384615 0.076923 0.461538 0.000000 0.307692 0.230769 0.461538 0.153846 0.846154 0.000000 0.000000 0.923077 0.000000 0.000000 0.076923 0.846154 0.153846 0.000000 0.000000 0.769231 0.230769 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.461538 0.000000 0.538462 0.000000 0.000000 0.000000 0.076923 0.923077 0.076923 0.923077 0.000000 0.000000 0.846154 0.000000 0.153846 0.000000 Consensus sequence: AKGYYCAAAGRTCA Alignment: TGAMCTTTGMMCYT --TGACCTTGMBBB ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 14 PPARGRXRA Original Motif Original Motif Forward 4 12 0.046990 Original motif 0.109685 0.369895 0.373396 0.147025 0.117716 0.193473 0.148019 0.540793 0.453488 0.026744 0.427907 0.091860 0.116144 0.003484 0.779326 0.101045 0.161253 0.017401 0.781903 0.039443 0.168213 0.149652 0.458237 0.223898 0.082271 0.633835 0.207416 0.076477 0.949015 0.024334 0.017381 0.009270 0.604867 0.055620 0.312862 0.026651 0.825231 0.005787 0.158565 0.010417 0.095017 0.002317 0.888760 0.013905 0.047509 0.010429 0.803013 0.139050 0.025492 0.114716 0.304751 0.555041 0.062645 0.643852 0.167053 0.126450 0.784223 0.067285 0.054524 0.093968 Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif 0.093968 0.067285 0.054524 0.784223 0.062645 0.167053 0.643852 0.126450 0.555041 0.114716 0.304751 0.025492 0.047509 0.803013 0.010429 0.139050 0.095017 0.888760 0.002317 0.013905 0.010417 0.005787 0.158565 0.825231 0.026651 0.055620 0.312862 0.604867 0.009270 0.024334 0.017381 0.949015 0.082271 0.207416 0.633835 0.076477 0.168213 0.458237 0.149652 0.223898 0.161253 0.781903 0.017401 0.039443 0.116144 0.779326 0.003484 0.101045 0.091860 0.026744 0.427907 0.453488 0.540793 0.193473 0.148019 0.117716 0.109685 0.373396 0.369895 0.147025 Consensus sequence: TGRCCTKTGHCCKAB Alignment: BTRGGDCARAGGKCA ---VBBYCAAGGTCA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 1 HNF4A Original Motif Original Motif Backward 1 12 0.047081 Original motif 0.417910 0.104478 0.402985 0.074627 0.029851 0.029851 0.835821 0.104478 0.179104 0.059701 0.522388 0.238806 0.074627 0.343284 0.298507 0.283582 0.044776 0.761194 0.059701 0.134328 0.880597 0.014925 0.044776 0.059701 0.791045 0.029851 0.149254 0.029851 0.835821 0.014925 0.119403 0.029851 0.059701 0.059701 0.865672 0.014925 0.089552 0.029851 0.492537 0.388060 0.044776 0.328358 0.164179 0.462687 0.059701 0.731343 0.074627 0.134328 0.626866 0.104478 0.149254 0.119403 Consensus sequence: RGGBCAAAGKYCA Reverse complement motif 0.119403 0.104478 0.149254 0.626866 0.059701 0.074627 0.731343 0.134328 0.462687 0.328358 0.164179 0.044776 0.089552 0.492537 0.029851 0.388060 0.059701 0.865672 0.059701 0.014925 0.029851 0.014925 0.119403 0.835821 0.029851 0.029851 0.149254 0.791045 0.059701 0.014925 0.044776 0.880597 0.044776 0.059701 0.761194 0.134328 0.074627 0.298507 0.343284 0.283582 0.179104 0.522388 0.059701 0.238806 0.029851 0.835821 0.029851 0.104478 0.074627 0.104478 0.402985 0.417910 Consensus sequence: TGMYCTTTGBCCK Alignment: RGGBCAAAGKYCA -VBBYCAAGGTCA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 10 NR1H2RXRA Original Motif Original Motif Backward 3 12 0.050698 Original motif 0.680000 0.200000 0.000000 0.120000 0.680000 0.040000 0.200000 0.080000 0.800000 0.000000 0.200000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.040000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.000000 0.040000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.800000 0.040000 0.080000 0.080000 0.000000 0.600000 0.240000 0.160000 Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif 0.000000 0.240000 0.600000 0.160000 0.080000 0.040000 0.080000 0.800000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.040000 0.000000 0.000000 0.960000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.040000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.200000 0.800000 0.080000 0.040000 0.200000 0.680000 0.120000 0.200000 0.000000 0.680000 Consensus sequence: GTTGACCTTTGACCTTT Alignment: AAAGGTCAAAGGTCAAC ---VBBYCAAGGTCA-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 3 ESR1 Reverse Complement Original Motif Backward 9 12 0.062848 Original motif 0.261242 0.256959 0.329764 0.152034 0.228632 0.170940 0.350427 0.250000 0.136752 0.369658 0.318376 0.175214 0.176596 0.487234 0.138298 0.197872 0.285106 0.493617 0.100000 0.121277 0.651163 0.059197 0.188161 0.101480 0.075949 0.016878 0.816456 0.090717 0.040000 0.037895 0.884211 0.037895 0.069474 0.086316 0.191579 0.652632 0.008421 0.829474 0.111579 0.050526 0.837895 0.027368 0.056842 0.077895 0.122105 0.526316 0.225263 0.126316 0.132632 0.581053 0.111579 0.174737 0.134737 0.543158 0.204211 0.117895 0.067368 0.040000 0.016842 0.875789 0.044211 0.046316 0.896842 0.012632 0.642105 0.223158 0.065263 0.069474 0.021053 0.917895 0.025263 0.035789 0.124211 0.743158 0.004211 0.128421 0.054737 0.347368 0.046316 0.551579 Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif 0.551579 0.347368 0.046316 0.054737 0.124211 0.004211 0.743158 0.128421 0.021053 0.025263 0.917895 0.035789 0.069474 0.223158 0.065263 0.642105 0.044211 0.896842 0.046316 0.012632 0.875789 0.040000 0.016842 0.067368 0.134737 0.204211 0.543158 0.117895 0.132632 0.111579 0.581053 0.174737 0.122105 0.225263 0.526316 0.126316 0.077895 0.027368 0.056842 0.837895 0.008421 0.111579 0.829474 0.050526 0.652632 0.086316 0.191579 0.069474 0.040000 0.884211 0.037895 0.037895 0.075949 0.816456 0.016878 0.090717 0.101480 0.059197 0.188161 0.651163 0.285106 0.100000 0.493617 0.121277 0.176596 0.138298 0.487234 0.197872 0.136752 0.318376 0.369658 0.175214 0.228632 0.350427 0.170940 0.250000 0.261242 0.329764 0.256959 0.152034 Consensus sequence: MGGTCAGGGTGACCTRDBHV Alignment: VDBHMAGGTCACCCTGACCY TGACCTTGMBBB-------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 9 ESR2 Reverse Complement Original Motif Forward 6 12 0.069461 Original motif 0.218487 0.450980 0.176471 0.154062 0.442577 0.142857 0.114846 0.299720 0.521008 0.042017 0.431373 0.005602 0.075630 0.000000 0.770308 0.154062 0.050420 0.056022 0.893557 0.000000 0.036415 0.053221 0.092437 0.817927 0.000000 1.000000 0.000000 0.000000 0.943978 0.002801 0.000000 0.053221 0.137255 0.344538 0.316527 0.201681 0.179272 0.176471 0.417367 0.226891 0.145658 0.170868 0.411765 0.271709 0.058824 0.092437 0.067227 0.781513 0.176471 0.070028 0.742297 0.011204 0.498599 0.277311 0.053221 0.170868 0.095238 0.750700 0.005602 0.148459 0.128852 0.809524 0.000000 0.061625 0.075630 0.252101 0.000000 0.672269 0.168067 0.263305 0.380952 0.187675 Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif 0.168067 0.380952 0.263305 0.187675 0.672269 0.252101 0.000000 0.075630 0.128852 0.000000 0.809524 0.061625 0.095238 0.005602 0.750700 0.148459 0.170868 0.277311 0.053221 0.498599 0.176471 0.742297 0.070028 0.011204 0.781513 0.092437 0.067227 0.058824 0.145658 0.411765 0.170868 0.271709 0.179272 0.417367 0.176471 0.226891 0.137255 0.316527 0.344538 0.201681 0.053221 0.002801 0.000000 0.943978 0.000000 0.000000 1.000000 0.000000 0.817927 0.053221 0.092437 0.036415 0.050420 0.893557 0.056022 0.000000 0.075630 0.770308 0.000000 0.154062 0.005602 0.042017 0.431373 0.521008 0.299720 0.142857 0.114846 0.442577 0.218487 0.176471 0.450980 0.154062 Consensus sequence: BAGGYCABHBTGACCKHV Alignment: VHRGGTCABDBTGMCCTB -----TGACCTTGMBBB- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 7 REST Original Motif Original Motif Forward 5 12 0.071324 Original motif 0.132621 0.109365 0.230044 0.527970 0.036318 0.168441 0.091421 0.703820 0.047589 0.855354 0.031309 0.065748 0.906367 0.018727 0.058677 0.016230 0.021197 0.027431 0.945137 0.006234 0.076012 0.609346 0.201246 0.113396 0.980697 0.004359 0.007472 0.007472 0.001868 0.987547 0.007472 0.003113 0.021793 0.922167 0.012453 0.043587 0.568847 0.125234 0.100935 0.204984 0.136534 0.233791 0.077307 0.552369 0.024314 0.004364 0.966958 0.004364 0.012469 0.003117 0.983167 0.001247 0.877105 0.069869 0.021210 0.031815 0.008125 0.800000 0.145625 0.046250 0.983750 0.005625 0.004375 0.006250 0.026349 0.008156 0.959849 0.005646 0.128688 0.632141 0.114878 0.124294 0.229899 0.019472 0.432161 0.318467 0.133962 0.586792 0.200629 0.078616 0.112579 0.700629 0.023270 0.163522 Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif 0.112579 0.023270 0.700629 0.163522 0.133962 0.200629 0.586792 0.078616 0.229899 0.432161 0.019472 0.318467 0.128688 0.114878 0.632141 0.124294 0.026349 0.959849 0.008156 0.005646 0.006250 0.005625 0.004375 0.983750 0.008125 0.145625 0.800000 0.046250 0.031815 0.069869 0.021210 0.877105 0.012469 0.983167 0.003117 0.001247 0.024314 0.966958 0.004364 0.004364 0.552369 0.233791 0.077307 0.136534 0.204984 0.125234 0.100935 0.568847 0.021793 0.012453 0.922167 0.043587 0.001868 0.007472 0.987547 0.003113 0.007472 0.004359 0.007472 0.980697 0.076012 0.201246 0.609346 0.113396 0.021197 0.945137 0.027431 0.006234 0.016230 0.018727 0.058677 0.906367 0.047589 0.031309 0.855354 0.065748 0.703820 0.168441 0.091421 0.036318 0.527970 0.109365 0.230044 0.132621 Consensus sequence: GGYGCTGTCCATGGTGCTGAA Alignment: TTCAGCACCATGGACAGCKCC ----VBBYCAAGGTCA----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 17 TgTGgTGTCACAGTGCTCC Reverse Complement Original Motif Backward 1 12 0.077256 Original motif 0.111111 0.083333 0.055556 0.750000 0.125000 0.097222 0.652778 0.125000 0.041667 0.097222 0.027778 0.833333 0.027778 0.027778 0.791667 0.152778 0.055556 0.166667 0.652778 0.125000 0.000000 0.041667 0.013889 0.944444 0.041667 0.000000 0.888889 0.069444 0.027778 0.027778 0.000000 0.944444 0.041667 0.944444 0.013889 0.000000 0.916667 0.027778 0.000000 0.055556 0.069444 0.875000 0.000000 0.055556 0.833333 0.013889 0.013889 0.138889 0.041667 0.069444 0.819444 0.069444 0.027778 0.027778 0.027778 0.916667 0.069444 0.013889 0.847222 0.069444 0.069444 0.777778 0.027778 0.125000 0.055556 0.041667 0.027778 0.875000 0.041667 0.708333 0.125000 0.125000 0.111111 0.819444 0.055556 0.013889 Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif 0.111111 0.055556 0.819444 0.013889 0.041667 0.125000 0.708333 0.125000 0.875000 0.041667 0.027778 0.055556 0.069444 0.027778 0.777778 0.125000 0.069444 0.847222 0.013889 0.069444 0.916667 0.027778 0.027778 0.027778 0.041667 0.819444 0.069444 0.069444 0.138889 0.013889 0.013889 0.833333 0.069444 0.000000 0.875000 0.055556 0.055556 0.027778 0.000000 0.916667 0.041667 0.013889 0.944444 0.000000 0.944444 0.027778 0.000000 0.027778 0.041667 0.888889 0.000000 0.069444 0.944444 0.041667 0.013889 0.000000 0.055556 0.652778 0.166667 0.125000 0.027778 0.791667 0.027778 0.152778 0.833333 0.097222 0.027778 0.041667 0.125000 0.652778 0.097222 0.125000 0.750000 0.083333 0.055556 0.111111 Consensus sequence: GGAGCACTGTGACACCACA Alignment: TGTGGTGTCACAGTGCTCC -------TGACCTTGMBBB ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 23 TGGAGCACTGTGACAcCACAGTGg Reverse Complement Reverse Complement Forward 12 12 0.078539 Original motif 0.054054 0.040541 0.054054 0.851351 0.040541 0.013514 0.824324 0.121622 0.094595 0.135135 0.756757 0.013514 0.891892 0.000000 0.000000 0.108108 0.040541 0.094595 0.810811 0.054054 0.081081 0.797297 0.054054 0.067568 0.932432 0.027027 0.000000 0.040541 0.054054 0.756757 0.135135 0.054054 0.108108 0.027027 0.013514 0.851351 0.108108 0.000000 0.851351 0.040541 0.013514 0.000000 0.027027 0.959459 0.000000 0.013514 0.945946 0.040541 0.905405 0.000000 0.067568 0.027027 0.054054 0.837838 0.000000 0.108108 0.945946 0.013514 0.040541 0.000000 0.162162 0.500000 0.189189 0.148649 0.108108 0.824324 0.000000 0.067568 0.945946 0.000000 0.040541 0.013514 0.081081 0.837838 0.027027 0.054054 0.945946 0.000000 0.013514 0.040541 0.054054 0.067568 0.783784 0.094595 0.054054 0.027027 0.000000 0.918919 0.040541 0.013514 0.864865 0.081081 0.148649 0.121622 0.675676 0.054054 Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif 0.148649 0.675676 0.121622 0.054054 0.040541 0.864865 0.013514 0.081081 0.918919 0.027027 0.000000 0.054054 0.054054 0.783784 0.067568 0.094595 0.040541 0.000000 0.013514 0.945946 0.081081 0.027027 0.837838 0.054054 0.013514 0.000000 0.040541 0.945946 0.108108 0.000000 0.824324 0.067568 0.162162 0.189189 0.500000 0.148649 0.000000 0.013514 0.040541 0.945946 0.054054 0.000000 0.837838 0.108108 0.027027 0.000000 0.067568 0.905405 0.000000 0.945946 0.013514 0.040541 0.959459 0.000000 0.027027 0.013514 0.108108 0.851351 0.000000 0.040541 0.851351 0.027027 0.013514 0.108108 0.054054 0.135135 0.756757 0.054054 0.040541 0.027027 0.000000 0.932432 0.081081 0.054054 0.797297 0.067568 0.040541 0.810811 0.094595 0.054054 0.108108 0.000000 0.000000 0.891892 0.094595 0.756757 0.135135 0.013514 0.040541 0.824324 0.013514 0.121622 0.851351 0.040541 0.054054 0.054054 Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA Alignment: CCACTGTGVTGTCACAGTGCTCCA -----------TGACCTTGMBBB- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 22 CACTGTGrYrtCACAGTGswsCAcT Original Motif Reverse Complement Forward 4 12 0.083272 Original motif 0.111111 0.746032 0.063492 0.079365 0.857143 0.047619 0.047619 0.047619 0.047619 0.857143 0.079365 0.015873 0.031746 0.000000 0.000000 0.968254 0.031746 0.015873 0.904762 0.047619 0.000000 0.000000 0.000000 1.000000 0.031746 0.000000 0.857143 0.111111 0.396825 0.111111 0.412698 0.079365 0.031746 0.253968 0.015873 0.698413 0.365079 0.000000 0.634921 0.000000 0.079365 0.206349 0.047619 0.666667 0.047619 0.936508 0.015873 0.000000 0.952381 0.000000 0.015873 0.031746 0.015873 0.920635 0.000000 0.063492 0.920635 0.000000 0.000000 0.079365 0.063492 0.047619 0.841270 0.047619 0.000000 0.000000 0.015873 0.984127 0.047619 0.015873 0.904762 0.031746 0.015873 0.603175 0.317460 0.063492 0.396825 0.000000 0.015873 0.587302 0.015873 0.476190 0.428571 0.079365 0.063492 0.920635 0.000000 0.015873 0.920635 0.015873 0.047619 0.015873 0.095238 0.682540 0.095238 0.126984 0.047619 0.015873 0.095238 0.841270 Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif 0.841270 0.015873 0.095238 0.047619 0.095238 0.095238 0.682540 0.126984 0.015873 0.015873 0.047619 0.920635 0.063492 0.000000 0.920635 0.015873 0.015873 0.428571 0.476190 0.079365 0.587302 0.000000 0.015873 0.396825 0.015873 0.317460 0.603175 0.063492 0.047619 0.904762 0.015873 0.031746 0.984127 0.000000 0.015873 0.000000 0.063492 0.841270 0.047619 0.047619 0.079365 0.000000 0.000000 0.920635 0.015873 0.000000 0.920635 0.063492 0.031746 0.000000 0.015873 0.952381 0.047619 0.015873 0.936508 0.000000 0.666667 0.206349 0.047619 0.079365 0.365079 0.634921 0.000000 0.000000 0.698413 0.253968 0.015873 0.031746 0.396825 0.412698 0.111111 0.079365 0.031746 0.857143 0.000000 0.111111 1.000000 0.000000 0.000000 0.000000 0.031746 0.904762 0.015873 0.047619 0.968254 0.000000 0.000000 0.031746 0.047619 0.079365 0.857143 0.015873 0.047619 0.047619 0.047619 0.857143 0.111111 0.063492 0.746032 0.079365 Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG Alignment: AGTGSWSCACTGTGAMAMCACAGTG ---VBBYCAAGGTCA---------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 1 Motif name: HNF4A Original motif 0.417910 0.104478 0.402985 0.074627 0.029851 0.029851 0.835821 0.104478 0.179104 0.059701 0.522388 0.238806 0.074627 0.343284 0.298507 0.283582 0.044776 0.761194 0.059701 0.134328 0.880597 0.014925 0.044776 0.059701 0.791045 0.029851 0.149254 0.029851 0.835821 0.014925 0.119403 0.029851 0.059701 0.059701 0.865672 0.014925 0.089552 0.029851 0.492537 0.388060 0.044776 0.328358 0.164179 0.462687 0.059701 0.731343 0.074627 0.134328 0.626866 0.104478 0.149254 0.119403 Consensus sequence: RGGBCAAAGKYCA Reverse complement motif 0.119403 0.104478 0.149254 0.626866 0.059701 0.074627 0.731343 0.134328 0.462687 0.328358 0.164179 0.044776 0.089552 0.492537 0.029851 0.388060 0.059701 0.865672 0.059701 0.014925 0.029851 0.014925 0.119403 0.835821 0.029851 0.029851 0.149254 0.791045 0.059701 0.014925 0.044776 0.880597 0.044776 0.059701 0.761194 0.134328 0.074627 0.298507 0.343284 0.283582 0.179104 0.522388 0.059701 0.238806 0.029851 0.835821 0.029851 0.104478 0.074627 0.104478 0.402985 0.417910 Consensus sequence: TGMYCTTTGBCCK ******************************************************************* Best Matches for Significant Motif ID 1 (Highest to Lowest) ******************************************************************* Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 14 PPARGRXRA Reverse Complement Reverse Complement Backward 3 13 0.000000 Original motif 0.109685 0.369895 0.373396 0.147025 0.117716 0.193473 0.148019 0.540793 0.453488 0.026744 0.427907 0.091860 0.116144 0.003484 0.779326 0.101045 0.161253 0.017401 0.781903 0.039443 0.168213 0.149652 0.458237 0.223898 0.082271 0.633835 0.207416 0.076477 0.949015 0.024334 0.017381 0.009270 0.604867 0.055620 0.312862 0.026651 0.825231 0.005787 0.158565 0.010417 0.095017 0.002317 0.888760 0.013905 0.047509 0.010429 0.803013 0.139050 0.025492 0.114716 0.304751 0.555041 0.062645 0.643852 0.167053 0.126450 0.784223 0.067285 0.054524 0.093968 Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif 0.093968 0.067285 0.054524 0.784223 0.062645 0.167053 0.643852 0.126450 0.555041 0.114716 0.304751 0.025492 0.047509 0.803013 0.010429 0.139050 0.095017 0.888760 0.002317 0.013905 0.010417 0.005787 0.158565 0.825231 0.026651 0.055620 0.312862 0.604867 0.009270 0.024334 0.017381 0.949015 0.082271 0.207416 0.633835 0.076477 0.168213 0.458237 0.149652 0.223898 0.161253 0.781903 0.017401 0.039443 0.116144 0.779326 0.003484 0.101045 0.091860 0.026744 0.427907 0.453488 0.540793 0.193473 0.148019 0.117716 0.109685 0.373396 0.369895 0.147025 Consensus sequence: TGRCCTKTGHCCKAB Alignment: TGRCCTKTGHCCKAB TGMYCTTTGBCCK-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 2 NR2F1 Original Motif Reverse Complement Forward 2 13 0.022741 Original motif 0.000000 0.000000 0.153846 0.846154 0.076923 0.000000 0.923077 0.000000 0.923077 0.000000 0.076923 0.000000 0.461538 0.538462 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.230769 0.000000 0.769231 0.000000 0.153846 0.000000 0.846154 0.076923 0.000000 0.000000 0.923077 0.153846 0.000000 0.846154 0.000000 0.461538 0.307692 0.230769 0.000000 0.461538 0.384615 0.076923 0.076923 0.076923 0.769231 0.076923 0.076923 0.230769 0.461538 0.000000 0.307692 0.000000 0.230769 0.230769 0.538462 Consensus sequence: TGAMCTTTGMMCYT Reverse complement motif 0.538462 0.230769 0.230769 0.000000 0.230769 0.000000 0.461538 0.307692 0.076923 0.076923 0.769231 0.076923 0.076923 0.384615 0.076923 0.461538 0.000000 0.307692 0.230769 0.461538 0.153846 0.846154 0.000000 0.000000 0.923077 0.000000 0.000000 0.076923 0.846154 0.153846 0.000000 0.000000 0.769231 0.230769 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.461538 0.000000 0.538462 0.000000 0.000000 0.000000 0.076923 0.923077 0.076923 0.923077 0.000000 0.000000 0.846154 0.000000 0.153846 0.000000 Consensus sequence: AKGYYCAAAGRTCA Alignment: AKGYYCAAAGRTCA -RGGBCAAAGKYCA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 10 NR1H2RXRA Original Motif Original Motif Forward 3 13 0.042302 Original motif 0.680000 0.200000 0.000000 0.120000 0.680000 0.040000 0.200000 0.080000 0.800000 0.000000 0.200000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.040000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.000000 0.040000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.800000 0.040000 0.080000 0.080000 0.000000 0.600000 0.240000 0.160000 Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif 0.000000 0.240000 0.600000 0.160000 0.080000 0.040000 0.080000 0.800000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.040000 0.000000 0.000000 0.960000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.040000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.200000 0.800000 0.080000 0.040000 0.200000 0.680000 0.120000 0.200000 0.000000 0.680000 Consensus sequence: GTTGACCTTTGACCTTT Alignment: AAAGGTCAAAGGTCAAC --RGGBCAAAGKYCA-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 22 CACTGTGrYrtCACAGTGswsCAcT Original Motif Original Motif Backward 6 13 0.055765 Original motif 0.111111 0.746032 0.063492 0.079365 0.857143 0.047619 0.047619 0.047619 0.047619 0.857143 0.079365 0.015873 0.031746 0.000000 0.000000 0.968254 0.031746 0.015873 0.904762 0.047619 0.000000 0.000000 0.000000 1.000000 0.031746 0.000000 0.857143 0.111111 0.396825 0.111111 0.412698 0.079365 0.031746 0.253968 0.015873 0.698413 0.365079 0.000000 0.634921 0.000000 0.079365 0.206349 0.047619 0.666667 0.047619 0.936508 0.015873 0.000000 0.952381 0.000000 0.015873 0.031746 0.015873 0.920635 0.000000 0.063492 0.920635 0.000000 0.000000 0.079365 0.063492 0.047619 0.841270 0.047619 0.000000 0.000000 0.015873 0.984127 0.047619 0.015873 0.904762 0.031746 0.015873 0.603175 0.317460 0.063492 0.396825 0.000000 0.015873 0.587302 0.015873 0.476190 0.428571 0.079365 0.063492 0.920635 0.000000 0.015873 0.920635 0.015873 0.047619 0.015873 0.095238 0.682540 0.095238 0.126984 0.047619 0.015873 0.095238 0.841270 Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif 0.841270 0.015873 0.095238 0.047619 0.095238 0.095238 0.682540 0.126984 0.015873 0.015873 0.047619 0.920635 0.063492 0.000000 0.920635 0.015873 0.015873 0.428571 0.476190 0.079365 0.587302 0.000000 0.015873 0.396825 0.015873 0.317460 0.603175 0.063492 0.047619 0.904762 0.015873 0.031746 0.984127 0.000000 0.015873 0.000000 0.063492 0.841270 0.047619 0.047619 0.079365 0.000000 0.000000 0.920635 0.015873 0.000000 0.920635 0.063492 0.031746 0.000000 0.015873 0.952381 0.047619 0.015873 0.936508 0.000000 0.666667 0.206349 0.047619 0.079365 0.365079 0.634921 0.000000 0.000000 0.698413 0.253968 0.015873 0.031746 0.396825 0.412698 0.111111 0.079365 0.031746 0.857143 0.000000 0.111111 1.000000 0.000000 0.000000 0.000000 0.031746 0.904762 0.015873 0.047619 0.968254 0.000000 0.000000 0.031746 0.047619 0.079365 0.857143 0.015873 0.047619 0.047619 0.047619 0.857143 0.111111 0.063492 0.746032 0.079365 Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG Alignment: CACTGTGRTRTCACAGTGSWSCACT -------RGGBCAAAGKYCA----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 23 TGGAGCACTGTGACAcCACAGTGg Original Motif Reverse Complement Forward 9 13 0.065644 Original motif 0.054054 0.040541 0.054054 0.851351 0.040541 0.013514 0.824324 0.121622 0.094595 0.135135 0.756757 0.013514 0.891892 0.000000 0.000000 0.108108 0.040541 0.094595 0.810811 0.054054 0.081081 0.797297 0.054054 0.067568 0.932432 0.027027 0.000000 0.040541 0.054054 0.756757 0.135135 0.054054 0.108108 0.027027 0.013514 0.851351 0.108108 0.000000 0.851351 0.040541 0.013514 0.000000 0.027027 0.959459 0.000000 0.013514 0.945946 0.040541 0.905405 0.000000 0.067568 0.027027 0.054054 0.837838 0.000000 0.108108 0.945946 0.013514 0.040541 0.000000 0.162162 0.500000 0.189189 0.148649 0.108108 0.824324 0.000000 0.067568 0.945946 0.000000 0.040541 0.013514 0.081081 0.837838 0.027027 0.054054 0.945946 0.000000 0.013514 0.040541 0.054054 0.067568 0.783784 0.094595 0.054054 0.027027 0.000000 0.918919 0.040541 0.013514 0.864865 0.081081 0.148649 0.121622 0.675676 0.054054 Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif 0.148649 0.675676 0.121622 0.054054 0.040541 0.864865 0.013514 0.081081 0.918919 0.027027 0.000000 0.054054 0.054054 0.783784 0.067568 0.094595 0.040541 0.000000 0.013514 0.945946 0.081081 0.027027 0.837838 0.054054 0.013514 0.000000 0.040541 0.945946 0.108108 0.000000 0.824324 0.067568 0.162162 0.189189 0.500000 0.148649 0.000000 0.013514 0.040541 0.945946 0.054054 0.000000 0.837838 0.108108 0.027027 0.000000 0.067568 0.905405 0.000000 0.945946 0.013514 0.040541 0.959459 0.000000 0.027027 0.013514 0.108108 0.851351 0.000000 0.040541 0.851351 0.027027 0.013514 0.108108 0.054054 0.135135 0.756757 0.054054 0.040541 0.027027 0.000000 0.932432 0.081081 0.054054 0.797297 0.067568 0.040541 0.810811 0.094595 0.054054 0.108108 0.000000 0.000000 0.891892 0.094595 0.756757 0.135135 0.013514 0.040541 0.824324 0.013514 0.121622 0.851351 0.040541 0.054054 0.054054 Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA Alignment: CCACTGTGVTGTCACAGTGCTCCA --------RGGBCAAAGKYCA--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 9 ESR2 Original Motif Original Motif Forward 3 13 0.067162 Original motif 0.218487 0.450980 0.176471 0.154062 0.442577 0.142857 0.114846 0.299720 0.521008 0.042017 0.431373 0.005602 0.075630 0.000000 0.770308 0.154062 0.050420 0.056022 0.893557 0.000000 0.036415 0.053221 0.092437 0.817927 0.000000 1.000000 0.000000 0.000000 0.943978 0.002801 0.000000 0.053221 0.137255 0.344538 0.316527 0.201681 0.179272 0.176471 0.417367 0.226891 0.145658 0.170868 0.411765 0.271709 0.058824 0.092437 0.067227 0.781513 0.176471 0.070028 0.742297 0.011204 0.498599 0.277311 0.053221 0.170868 0.095238 0.750700 0.005602 0.148459 0.128852 0.809524 0.000000 0.061625 0.075630 0.252101 0.000000 0.672269 0.168067 0.263305 0.380952 0.187675 Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif 0.168067 0.380952 0.263305 0.187675 0.672269 0.252101 0.000000 0.075630 0.128852 0.000000 0.809524 0.061625 0.095238 0.005602 0.750700 0.148459 0.170868 0.277311 0.053221 0.498599 0.176471 0.742297 0.070028 0.011204 0.781513 0.092437 0.067227 0.058824 0.145658 0.411765 0.170868 0.271709 0.179272 0.417367 0.176471 0.226891 0.137255 0.316527 0.344538 0.201681 0.053221 0.002801 0.000000 0.943978 0.000000 0.000000 1.000000 0.000000 0.817927 0.053221 0.092437 0.036415 0.050420 0.893557 0.056022 0.000000 0.075630 0.770308 0.000000 0.154062 0.005602 0.042017 0.431373 0.521008 0.299720 0.142857 0.114846 0.442577 0.218487 0.176471 0.450980 0.154062 Consensus sequence: BAGGYCABHBTGACCKHV Alignment: VHRGGTCABDBTGMCCTB --RGGBCAAAGKYCA--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 17 TgTGgTGTCACAGTGCTCC Original Motif Original Motif Backward 3 13 0.068134 Original motif 0.111111 0.083333 0.055556 0.750000 0.125000 0.097222 0.652778 0.125000 0.041667 0.097222 0.027778 0.833333 0.027778 0.027778 0.791667 0.152778 0.055556 0.166667 0.652778 0.125000 0.000000 0.041667 0.013889 0.944444 0.041667 0.000000 0.888889 0.069444 0.027778 0.027778 0.000000 0.944444 0.041667 0.944444 0.013889 0.000000 0.916667 0.027778 0.000000 0.055556 0.069444 0.875000 0.000000 0.055556 0.833333 0.013889 0.013889 0.138889 0.041667 0.069444 0.819444 0.069444 0.027778 0.027778 0.027778 0.916667 0.069444 0.013889 0.847222 0.069444 0.069444 0.777778 0.027778 0.125000 0.055556 0.041667 0.027778 0.875000 0.041667 0.708333 0.125000 0.125000 0.111111 0.819444 0.055556 0.013889 Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif 0.111111 0.055556 0.819444 0.013889 0.041667 0.125000 0.708333 0.125000 0.875000 0.041667 0.027778 0.055556 0.069444 0.027778 0.777778 0.125000 0.069444 0.847222 0.013889 0.069444 0.916667 0.027778 0.027778 0.027778 0.041667 0.819444 0.069444 0.069444 0.138889 0.013889 0.013889 0.833333 0.069444 0.000000 0.875000 0.055556 0.055556 0.027778 0.000000 0.916667 0.041667 0.013889 0.944444 0.000000 0.944444 0.027778 0.000000 0.027778 0.041667 0.888889 0.000000 0.069444 0.944444 0.041667 0.013889 0.000000 0.055556 0.652778 0.166667 0.125000 0.027778 0.791667 0.027778 0.152778 0.833333 0.097222 0.027778 0.041667 0.125000 0.652778 0.097222 0.125000 0.750000 0.083333 0.055556 0.111111 Consensus sequence: GGAGCACTGTGACACCACA Alignment: TGTGGTGTCACAGTGCTCC ----RGGBCAAAGKYCA-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 3 ESR1 Original Motif Reverse Complement Forward 1 13 0.071114 Original motif 0.261242 0.256959 0.329764 0.152034 0.228632 0.170940 0.350427 0.250000 0.136752 0.369658 0.318376 0.175214 0.176596 0.487234 0.138298 0.197872 0.285106 0.493617 0.100000 0.121277 0.651163 0.059197 0.188161 0.101480 0.075949 0.016878 0.816456 0.090717 0.040000 0.037895 0.884211 0.037895 0.069474 0.086316 0.191579 0.652632 0.008421 0.829474 0.111579 0.050526 0.837895 0.027368 0.056842 0.077895 0.122105 0.526316 0.225263 0.126316 0.132632 0.581053 0.111579 0.174737 0.134737 0.543158 0.204211 0.117895 0.067368 0.040000 0.016842 0.875789 0.044211 0.046316 0.896842 0.012632 0.642105 0.223158 0.065263 0.069474 0.021053 0.917895 0.025263 0.035789 0.124211 0.743158 0.004211 0.128421 0.054737 0.347368 0.046316 0.551579 Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif 0.551579 0.347368 0.046316 0.054737 0.124211 0.004211 0.743158 0.128421 0.021053 0.025263 0.917895 0.035789 0.069474 0.223158 0.065263 0.642105 0.044211 0.896842 0.046316 0.012632 0.875789 0.040000 0.016842 0.067368 0.134737 0.204211 0.543158 0.117895 0.132632 0.111579 0.581053 0.174737 0.122105 0.225263 0.526316 0.126316 0.077895 0.027368 0.056842 0.837895 0.008421 0.111579 0.829474 0.050526 0.652632 0.086316 0.191579 0.069474 0.040000 0.884211 0.037895 0.037895 0.075949 0.816456 0.016878 0.090717 0.101480 0.059197 0.188161 0.651163 0.285106 0.100000 0.493617 0.121277 0.176596 0.138298 0.487234 0.197872 0.136752 0.318376 0.369658 0.175214 0.228632 0.350427 0.170940 0.250000 0.261242 0.329764 0.256959 0.152034 Consensus sequence: MGGTCAGGGTGACCTRDBHV Alignment: MGGTCAGGGTGACCTRDBHV RGGBCAAAGKYCA------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 7 REST Reverse Complement Reverse Complement Backward 4 13 0.074192 Original motif 0.132621 0.109365 0.230044 0.527970 0.036318 0.168441 0.091421 0.703820 0.047589 0.855354 0.031309 0.065748 0.906367 0.018727 0.058677 0.016230 0.021197 0.027431 0.945137 0.006234 0.076012 0.609346 0.201246 0.113396 0.980697 0.004359 0.007472 0.007472 0.001868 0.987547 0.007472 0.003113 0.021793 0.922167 0.012453 0.043587 0.568847 0.125234 0.100935 0.204984 0.136534 0.233791 0.077307 0.552369 0.024314 0.004364 0.966958 0.004364 0.012469 0.003117 0.983167 0.001247 0.877105 0.069869 0.021210 0.031815 0.008125 0.800000 0.145625 0.046250 0.983750 0.005625 0.004375 0.006250 0.026349 0.008156 0.959849 0.005646 0.128688 0.632141 0.114878 0.124294 0.229899 0.019472 0.432161 0.318467 0.133962 0.586792 0.200629 0.078616 0.112579 0.700629 0.023270 0.163522 Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif 0.112579 0.023270 0.700629 0.163522 0.133962 0.200629 0.586792 0.078616 0.229899 0.432161 0.019472 0.318467 0.128688 0.114878 0.632141 0.124294 0.026349 0.959849 0.008156 0.005646 0.006250 0.005625 0.004375 0.983750 0.008125 0.145625 0.800000 0.046250 0.031815 0.069869 0.021210 0.877105 0.012469 0.983167 0.003117 0.001247 0.024314 0.966958 0.004364 0.004364 0.552369 0.233791 0.077307 0.136534 0.204984 0.125234 0.100935 0.568847 0.021793 0.012453 0.922167 0.043587 0.001868 0.007472 0.987547 0.003113 0.007472 0.004359 0.007472 0.980697 0.076012 0.201246 0.609346 0.113396 0.021197 0.945137 0.027431 0.006234 0.016230 0.018727 0.058677 0.906367 0.047589 0.031309 0.855354 0.065748 0.703820 0.168441 0.091421 0.036318 0.527970 0.109365 0.230044 0.132621 Consensus sequence: GGYGCTGTCCATGGTGCTGAA Alignment: GGYGCTGTCCATGGTGCTGAA -----TGMYCTTTGBCCK--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 27 AgTGCTCCACTGTGgTGTCACAgT Original Motif Reverse Complement Backward 6 13 0.079910 Original motif 0.690141 0.126761 0.042254 0.140845 0.169014 0.098592 0.676056 0.056338 0.042254 0.028169 0.028169 0.901408 0.056338 0.000000 0.774648 0.169014 0.042254 0.887324 0.042254 0.028169 0.000000 0.014085 0.000000 0.985915 0.056338 0.830986 0.042254 0.070423 0.028169 0.957746 0.014085 0.000000 0.957746 0.000000 0.014085 0.028169 0.084507 0.845070 0.014085 0.056338 0.028169 0.014085 0.000000 0.957746 0.140845 0.028169 0.802817 0.028169 0.014085 0.014085 0.014085 0.957746 0.014085 0.000000 0.929577 0.056338 0.056338 0.154930 0.619718 0.169014 0.014085 0.028169 0.000000 0.957746 0.056338 0.014085 0.873239 0.056338 0.014085 0.000000 0.000000 0.985915 0.042254 0.929577 0.000000 0.028169 0.957746 0.028169 0.000000 0.014085 0.028169 0.845070 0.028169 0.098592 0.873239 0.014085 0.042254 0.070423 0.098592 0.154930 0.563380 0.183099 0.070423 0.014085 0.112676 0.802817 Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif 0.802817 0.014085 0.112676 0.070423 0.098592 0.563380 0.154930 0.183099 0.070423 0.014085 0.042254 0.873239 0.028169 0.028169 0.845070 0.098592 0.014085 0.028169 0.000000 0.957746 0.042254 0.000000 0.929577 0.028169 0.985915 0.000000 0.000000 0.014085 0.056338 0.873239 0.014085 0.056338 0.957746 0.028169 0.000000 0.014085 0.056338 0.619718 0.154930 0.169014 0.014085 0.929577 0.000000 0.056338 0.957746 0.014085 0.014085 0.014085 0.140845 0.802817 0.028169 0.028169 0.957746 0.014085 0.000000 0.028169 0.084507 0.014085 0.845070 0.056338 0.028169 0.000000 0.014085 0.957746 0.028169 0.014085 0.957746 0.000000 0.056338 0.042254 0.830986 0.070423 0.985915 0.014085 0.000000 0.000000 0.042254 0.042254 0.887324 0.028169 0.056338 0.774648 0.000000 0.169014 0.901408 0.028169 0.028169 0.042254 0.169014 0.676056 0.098592 0.056338 0.140845 0.126761 0.042254 0.690141 Consensus sequence: ACTGTGACACCACAGTGGAGCACT Alignment: ACTGTGACACCACAGTGGAGCACT ------RGGBCAAAGKYCA----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 16 CTCF Original Motif Original Motif Forward 4 13 0.085064 Original motif 0.095290 0.318729 0.083242 0.502738 0.182913 0.158817 0.453450 0.204819 0.307777 0.053669 0.491785 0.146769 0.061336 0.876232 0.023001 0.039430 0.008762 0.989047 0.000000 0.002191 0.814896 0.014239 0.071194 0.099671 0.043812 0.578313 0.365827 0.012048 0.117325 0.474781 0.052632 0.355263 0.933114 0.012061 0.035088 0.019737 0.005488 0.000000 0.991218 0.003293 0.365532 0.003293 0.621295 0.009879 0.059276 0.013172 0.553238 0.374314 0.013187 0.000000 0.978022 0.008791 0.061538 0.008791 0.851648 0.078022 0.114411 0.806381 0.005501 0.073707 0.409241 0.014301 0.557756 0.018702 0.090308 0.530837 0.338106 0.040749 0.128855 0.354626 0.080396 0.436123 0.442731 0.199339 0.292952 0.064978 Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif 0.064978 0.199339 0.292952 0.442731 0.436123 0.354626 0.080396 0.128855 0.090308 0.338106 0.530837 0.040749 0.409241 0.557756 0.014301 0.018702 0.114411 0.005501 0.806381 0.073707 0.061538 0.851648 0.008791 0.078022 0.013187 0.978022 0.000000 0.008791 0.059276 0.553238 0.013172 0.374314 0.365532 0.621295 0.003293 0.009879 0.005488 0.991218 0.000000 0.003293 0.019737 0.012061 0.035088 0.933114 0.117325 0.052632 0.474781 0.355263 0.043812 0.365827 0.578313 0.012048 0.099671 0.014239 0.071194 0.814896 0.008762 0.000000 0.989047 0.002191 0.061336 0.023001 0.876232 0.039430 0.307777 0.491785 0.053669 0.146769 0.182913 0.453450 0.158817 0.204819 0.502738 0.318729 0.083242 0.095290 Consensus sequence: BMSMGCCYMCTKSTGGMHM Alignment: YDRCCASYAGRKGGCRSYV ---RGGBCAAAGKYCA--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 12 Motif name: RORA_1 Original motif 0.600000 0.040000 0.080000 0.280000 0.360000 0.040000 0.000000 0.600000 0.240000 0.480000 0.160000 0.120000 0.440000 0.080000 0.200000 0.280000 0.840000 0.000000 0.160000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 Consensus sequence: AWVDAGGTCA Reverse complement motif 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.160000 0.840000 0.280000 0.080000 0.200000 0.440000 0.240000 0.160000 0.480000 0.120000 0.600000 0.040000 0.000000 0.360000 0.280000 0.040000 0.080000 0.600000 Consensus sequence: TGACCTDVWT ******************************************************************* Best Matches for Significant Motif ID 12 (Highest to Lowest) ******************************************************************* Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 4 Esrrb Original Motif Original Motif Backward 1 10 0.029401 Original motif 0.290198 0.220264 0.271200 0.218337 0.184941 0.227810 0.376477 0.210772 0.115226 0.332236 0.331687 0.220850 0.070959 0.342466 0.122740 0.463836 0.084862 0.729264 0.171640 0.014235 0.909737 0.008753 0.067834 0.013676 0.975656 0.000547 0.016411 0.007385 0.008758 0.001368 0.981390 0.008484 0.005750 0.003286 0.986309 0.004655 0.049904 0.012613 0.066904 0.870579 0.002473 0.927473 0.046703 0.023352 0.951569 0.005504 0.035498 0.007430 Consensus sequence: VBBYCAAGGTCA Reverse complement motif 0.007430 0.005504 0.035498 0.951569 0.002473 0.046703 0.927473 0.023352 0.870579 0.012613 0.066904 0.049904 0.005750 0.986309 0.003286 0.004655 0.008758 0.981390 0.001368 0.008484 0.007385 0.000547 0.016411 0.975656 0.013676 0.008753 0.067834 0.909737 0.084862 0.171640 0.729264 0.014235 0.463836 0.342466 0.122740 0.070959 0.115226 0.331687 0.332236 0.220850 0.184941 0.376477 0.227810 0.210772 0.218337 0.220264 0.271200 0.290198 Consensus sequence: TGACCTTGMBBB Alignment: VBBYCAAGGTCA --AWVDAGGTCA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 3 ESR1 Reverse Complement Reverse Complement Backward 2 10 0.041785 Original motif 0.261242 0.256959 0.329764 0.152034 0.228632 0.170940 0.350427 0.250000 0.136752 0.369658 0.318376 0.175214 0.176596 0.487234 0.138298 0.197872 0.285106 0.493617 0.100000 0.121277 0.651163 0.059197 0.188161 0.101480 0.075949 0.016878 0.816456 0.090717 0.040000 0.037895 0.884211 0.037895 0.069474 0.086316 0.191579 0.652632 0.008421 0.829474 0.111579 0.050526 0.837895 0.027368 0.056842 0.077895 0.122105 0.526316 0.225263 0.126316 0.132632 0.581053 0.111579 0.174737 0.134737 0.543158 0.204211 0.117895 0.067368 0.040000 0.016842 0.875789 0.044211 0.046316 0.896842 0.012632 0.642105 0.223158 0.065263 0.069474 0.021053 0.917895 0.025263 0.035789 0.124211 0.743158 0.004211 0.128421 0.054737 0.347368 0.046316 0.551579 Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif 0.551579 0.347368 0.046316 0.054737 0.124211 0.004211 0.743158 0.128421 0.021053 0.025263 0.917895 0.035789 0.069474 0.223158 0.065263 0.642105 0.044211 0.896842 0.046316 0.012632 0.875789 0.040000 0.016842 0.067368 0.134737 0.204211 0.543158 0.117895 0.132632 0.111579 0.581053 0.174737 0.122105 0.225263 0.526316 0.126316 0.077895 0.027368 0.056842 0.837895 0.008421 0.111579 0.829474 0.050526 0.652632 0.086316 0.191579 0.069474 0.040000 0.884211 0.037895 0.037895 0.075949 0.816456 0.016878 0.090717 0.101480 0.059197 0.188161 0.651163 0.285106 0.100000 0.493617 0.121277 0.176596 0.138298 0.487234 0.197872 0.136752 0.318376 0.369658 0.175214 0.228632 0.350427 0.170940 0.250000 0.261242 0.329764 0.256959 0.152034 Consensus sequence: MGGTCAGGGTGACCTRDBHV Alignment: MGGTCAGGGTGACCTRDBHV ---------TGACCTDVWT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 10 NR1H2RXRA Original Motif Original Motif Forward 6 10 0.054250 Original motif 0.680000 0.200000 0.000000 0.120000 0.680000 0.040000 0.200000 0.080000 0.800000 0.000000 0.200000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.040000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.000000 0.040000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.800000 0.040000 0.080000 0.080000 0.000000 0.600000 0.240000 0.160000 Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif 0.000000 0.240000 0.600000 0.160000 0.080000 0.040000 0.080000 0.800000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.040000 0.000000 0.000000 0.960000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.040000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.200000 0.800000 0.080000 0.040000 0.200000 0.680000 0.120000 0.200000 0.000000 0.680000 Consensus sequence: GTTGACCTTTGACCTTT Alignment: AAAGGTCAAAGGTCAAC -----AWVDAGGTCA-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 2 NR2F1 Reverse Complement Original Motif Forward 5 10 0.065481 Original motif 0.000000 0.000000 0.153846 0.846154 0.076923 0.000000 0.923077 0.000000 0.923077 0.000000 0.076923 0.000000 0.461538 0.538462 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.230769 0.000000 0.769231 0.000000 0.153846 0.000000 0.846154 0.076923 0.000000 0.000000 0.923077 0.153846 0.000000 0.846154 0.000000 0.461538 0.307692 0.230769 0.000000 0.461538 0.384615 0.076923 0.076923 0.076923 0.769231 0.076923 0.076923 0.230769 0.461538 0.000000 0.307692 0.000000 0.230769 0.230769 0.538462 Consensus sequence: TGAMCTTTGMMCYT Reverse complement motif 0.538462 0.230769 0.230769 0.000000 0.230769 0.000000 0.461538 0.307692 0.076923 0.076923 0.769231 0.076923 0.076923 0.384615 0.076923 0.461538 0.000000 0.307692 0.230769 0.461538 0.153846 0.846154 0.000000 0.000000 0.923077 0.000000 0.000000 0.076923 0.846154 0.153846 0.000000 0.000000 0.769231 0.230769 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.461538 0.000000 0.538462 0.000000 0.000000 0.000000 0.076923 0.923077 0.076923 0.923077 0.000000 0.000000 0.846154 0.000000 0.153846 0.000000 Consensus sequence: AKGYYCAAAGRTCA Alignment: TGAMCTTTGMMCYT ----TGACCTDVWT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 14 PPARGRXRA Original Motif Original Motif Backward 1 10 0.066680 Original motif 0.109685 0.369895 0.373396 0.147025 0.117716 0.193473 0.148019 0.540793 0.453488 0.026744 0.427907 0.091860 0.116144 0.003484 0.779326 0.101045 0.161253 0.017401 0.781903 0.039443 0.168213 0.149652 0.458237 0.223898 0.082271 0.633835 0.207416 0.076477 0.949015 0.024334 0.017381 0.009270 0.604867 0.055620 0.312862 0.026651 0.825231 0.005787 0.158565 0.010417 0.095017 0.002317 0.888760 0.013905 0.047509 0.010429 0.803013 0.139050 0.025492 0.114716 0.304751 0.555041 0.062645 0.643852 0.167053 0.126450 0.784223 0.067285 0.054524 0.093968 Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif 0.093968 0.067285 0.054524 0.784223 0.062645 0.167053 0.643852 0.126450 0.555041 0.114716 0.304751 0.025492 0.047509 0.803013 0.010429 0.139050 0.095017 0.888760 0.002317 0.013905 0.010417 0.005787 0.158565 0.825231 0.026651 0.055620 0.312862 0.604867 0.009270 0.024334 0.017381 0.949015 0.082271 0.207416 0.633835 0.076477 0.168213 0.458237 0.149652 0.223898 0.161253 0.781903 0.017401 0.039443 0.116144 0.779326 0.003484 0.101045 0.091860 0.026744 0.427907 0.453488 0.540793 0.193473 0.148019 0.117716 0.109685 0.373396 0.369895 0.147025 Consensus sequence: TGRCCTKTGHCCKAB Alignment: BTRGGDCARAGGKCA -----AWVDAGGTCA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 7 REST Original Motif Original Motif Forward 7 10 0.075561 Original motif 0.132621 0.109365 0.230044 0.527970 0.036318 0.168441 0.091421 0.703820 0.047589 0.855354 0.031309 0.065748 0.906367 0.018727 0.058677 0.016230 0.021197 0.027431 0.945137 0.006234 0.076012 0.609346 0.201246 0.113396 0.980697 0.004359 0.007472 0.007472 0.001868 0.987547 0.007472 0.003113 0.021793 0.922167 0.012453 0.043587 0.568847 0.125234 0.100935 0.204984 0.136534 0.233791 0.077307 0.552369 0.024314 0.004364 0.966958 0.004364 0.012469 0.003117 0.983167 0.001247 0.877105 0.069869 0.021210 0.031815 0.008125 0.800000 0.145625 0.046250 0.983750 0.005625 0.004375 0.006250 0.026349 0.008156 0.959849 0.005646 0.128688 0.632141 0.114878 0.124294 0.229899 0.019472 0.432161 0.318467 0.133962 0.586792 0.200629 0.078616 0.112579 0.700629 0.023270 0.163522 Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif 0.112579 0.023270 0.700629 0.163522 0.133962 0.200629 0.586792 0.078616 0.229899 0.432161 0.019472 0.318467 0.128688 0.114878 0.632141 0.124294 0.026349 0.959849 0.008156 0.005646 0.006250 0.005625 0.004375 0.983750 0.008125 0.145625 0.800000 0.046250 0.031815 0.069869 0.021210 0.877105 0.012469 0.983167 0.003117 0.001247 0.024314 0.966958 0.004364 0.004364 0.552369 0.233791 0.077307 0.136534 0.204984 0.125234 0.100935 0.568847 0.021793 0.012453 0.922167 0.043587 0.001868 0.007472 0.987547 0.003113 0.007472 0.004359 0.007472 0.980697 0.076012 0.201246 0.609346 0.113396 0.021197 0.945137 0.027431 0.006234 0.016230 0.018727 0.058677 0.906367 0.047589 0.031309 0.855354 0.065748 0.703820 0.168441 0.091421 0.036318 0.527970 0.109365 0.230044 0.132621 Consensus sequence: GGYGCTGTCCATGGTGCTGAA Alignment: TTCAGCACCATGGACAGCKCC ------AWVDAGGTCA----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 1 HNF4A Original Motif Original Motif Forward 4 10 0.080340 Original motif 0.417910 0.104478 0.402985 0.074627 0.029851 0.029851 0.835821 0.104478 0.179104 0.059701 0.522388 0.238806 0.074627 0.343284 0.298507 0.283582 0.044776 0.761194 0.059701 0.134328 0.880597 0.014925 0.044776 0.059701 0.791045 0.029851 0.149254 0.029851 0.835821 0.014925 0.119403 0.029851 0.059701 0.059701 0.865672 0.014925 0.089552 0.029851 0.492537 0.388060 0.044776 0.328358 0.164179 0.462687 0.059701 0.731343 0.074627 0.134328 0.626866 0.104478 0.149254 0.119403 Consensus sequence: RGGBCAAAGKYCA Reverse complement motif 0.119403 0.104478 0.149254 0.626866 0.059701 0.074627 0.731343 0.134328 0.462687 0.328358 0.164179 0.044776 0.089552 0.492537 0.029851 0.388060 0.059701 0.865672 0.059701 0.014925 0.029851 0.014925 0.119403 0.835821 0.029851 0.029851 0.149254 0.791045 0.059701 0.014925 0.044776 0.880597 0.044776 0.059701 0.761194 0.134328 0.074627 0.298507 0.343284 0.283582 0.179104 0.522388 0.059701 0.238806 0.029851 0.835821 0.029851 0.104478 0.074627 0.104478 0.402985 0.417910 Consensus sequence: TGMYCTTTGBCCK Alignment: RGGBCAAAGKYCA ---AWVDAGGTCA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 17 TgTGgTGTCACAGTGCTCC Reverse Complement Reverse Complement Forward 10 10 0.088931 Original motif 0.111111 0.083333 0.055556 0.750000 0.125000 0.097222 0.652778 0.125000 0.041667 0.097222 0.027778 0.833333 0.027778 0.027778 0.791667 0.152778 0.055556 0.166667 0.652778 0.125000 0.000000 0.041667 0.013889 0.944444 0.041667 0.000000 0.888889 0.069444 0.027778 0.027778 0.000000 0.944444 0.041667 0.944444 0.013889 0.000000 0.916667 0.027778 0.000000 0.055556 0.069444 0.875000 0.000000 0.055556 0.833333 0.013889 0.013889 0.138889 0.041667 0.069444 0.819444 0.069444 0.027778 0.027778 0.027778 0.916667 0.069444 0.013889 0.847222 0.069444 0.069444 0.777778 0.027778 0.125000 0.055556 0.041667 0.027778 0.875000 0.041667 0.708333 0.125000 0.125000 0.111111 0.819444 0.055556 0.013889 Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif 0.111111 0.055556 0.819444 0.013889 0.041667 0.125000 0.708333 0.125000 0.875000 0.041667 0.027778 0.055556 0.069444 0.027778 0.777778 0.125000 0.069444 0.847222 0.013889 0.069444 0.916667 0.027778 0.027778 0.027778 0.041667 0.819444 0.069444 0.069444 0.138889 0.013889 0.013889 0.833333 0.069444 0.000000 0.875000 0.055556 0.055556 0.027778 0.000000 0.916667 0.041667 0.013889 0.944444 0.000000 0.944444 0.027778 0.000000 0.027778 0.041667 0.888889 0.000000 0.069444 0.944444 0.041667 0.013889 0.000000 0.055556 0.652778 0.166667 0.125000 0.027778 0.791667 0.027778 0.152778 0.833333 0.097222 0.027778 0.041667 0.125000 0.652778 0.097222 0.125000 0.750000 0.083333 0.055556 0.111111 Consensus sequence: GGAGCACTGTGACACCACA Alignment: GGAGCACTGTGACACCACA ---------TGACCTDVWT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 25 wwCCAmAGTCmt Original Motif Original Motif Backward 2 10 0.092250 Original motif 0.454545 0.045455 0.227273 0.272727 0.363636 0.136364 0.136364 0.363636 0.000000 1.000000 0.000000 0.000000 0.000000 0.954545 0.045455 0.000000 1.000000 0.000000 0.000000 0.000000 0.409091 0.590909 0.000000 0.000000 0.909091 0.045455 0.045455 0.000000 0.000000 0.000000 1.000000 0.000000 0.045455 0.000000 0.000000 0.954545 0.045455 0.909091 0.000000 0.045455 0.272727 0.318182 0.181818 0.227273 0.181818 0.227273 0.227273 0.363636 Consensus sequence: DDCCAMAGTCHB Reverse complement motif 0.363636 0.227273 0.227273 0.181818 0.272727 0.181818 0.318182 0.227273 0.045455 0.000000 0.909091 0.045455 0.954545 0.000000 0.000000 0.045455 0.000000 1.000000 0.000000 0.000000 0.000000 0.045455 0.045455 0.909091 0.409091 0.000000 0.590909 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.045455 0.954545 0.000000 0.000000 0.000000 1.000000 0.000000 0.363636 0.136364 0.136364 0.363636 0.272727 0.045455 0.227273 0.454545 Consensus sequence: VDGACTRTGGDD Alignment: DDCCAMAGTCHB -AWVDAGGTCA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 9 ESR2 Original Motif Reverse Complement Backward 4 10 0.098821 Original motif 0.218487 0.450980 0.176471 0.154062 0.442577 0.142857 0.114846 0.299720 0.521008 0.042017 0.431373 0.005602 0.075630 0.000000 0.770308 0.154062 0.050420 0.056022 0.893557 0.000000 0.036415 0.053221 0.092437 0.817927 0.000000 1.000000 0.000000 0.000000 0.943978 0.002801 0.000000 0.053221 0.137255 0.344538 0.316527 0.201681 0.179272 0.176471 0.417367 0.226891 0.145658 0.170868 0.411765 0.271709 0.058824 0.092437 0.067227 0.781513 0.176471 0.070028 0.742297 0.011204 0.498599 0.277311 0.053221 0.170868 0.095238 0.750700 0.005602 0.148459 0.128852 0.809524 0.000000 0.061625 0.075630 0.252101 0.000000 0.672269 0.168067 0.263305 0.380952 0.187675 Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif 0.168067 0.380952 0.263305 0.187675 0.672269 0.252101 0.000000 0.075630 0.128852 0.000000 0.809524 0.061625 0.095238 0.005602 0.750700 0.148459 0.170868 0.277311 0.053221 0.498599 0.176471 0.742297 0.070028 0.011204 0.781513 0.092437 0.067227 0.058824 0.145658 0.411765 0.170868 0.271709 0.179272 0.417367 0.176471 0.226891 0.137255 0.316527 0.344538 0.201681 0.053221 0.002801 0.000000 0.943978 0.000000 0.000000 1.000000 0.000000 0.817927 0.053221 0.092437 0.036415 0.050420 0.893557 0.056022 0.000000 0.075630 0.770308 0.000000 0.154062 0.005602 0.042017 0.431373 0.521008 0.299720 0.142857 0.114846 0.442577 0.218487 0.176471 0.450980 0.154062 Consensus sequence: BAGGYCABHBTGACCKHV Alignment: BAGGYCABHBTGACCKHV -----AWVDAGGTCA--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 6 Motif name: Mycn Original motif 0.349315 0.363014 0.143836 0.143836 0.089041 0.388128 0.447489 0.075342 0.015982 0.984018 0.000000 0.000000 0.945205 0.000000 0.041096 0.013699 0.000000 0.961187 0.018265 0.020548 0.070776 0.002283 0.924658 0.002283 0.054795 0.221461 0.004566 0.719178 0.000000 0.000000 0.938356 0.061644 0.061644 0.111872 0.739726 0.086758 0.139269 0.605023 0.091324 0.164384 Consensus sequence: HSCACGTGGC Reverse complement motif 0.139269 0.091324 0.605023 0.164384 0.061644 0.739726 0.111872 0.086758 0.000000 0.938356 0.000000 0.061644 0.719178 0.221461 0.004566 0.054795 0.070776 0.924658 0.002283 0.002283 0.000000 0.018265 0.961187 0.020548 0.013699 0.000000 0.041096 0.945205 0.015982 0.000000 0.984018 0.000000 0.089041 0.447489 0.388128 0.075342 0.349315 0.143836 0.363014 0.143836 Consensus sequence: GCCACGTGSD ******************************************************************* Best Matches for Significant Motif ID 6 (Highest to Lowest) ******************************************************************* Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 8 Myc Reverse Complement Reverse Complement Forward 1 10 0.000000 Original motif 0.295154 0.422907 0.158590 0.123348 0.149780 0.233480 0.572687 0.044053 0.035242 0.964758 0.000000 0.000000 0.955947 0.017621 0.022026 0.004405 0.000000 0.933921 0.013216 0.052863 0.083700 0.008811 0.898678 0.008811 0.039648 0.193833 0.000000 0.766520 0.000000 0.008811 0.951542 0.039648 0.000000 0.074890 0.806167 0.118943 0.198238 0.471366 0.105727 0.224670 Consensus sequence: VGCACGTGGH Reverse complement motif 0.198238 0.105727 0.471366 0.224670 0.000000 0.806167 0.074890 0.118943 0.000000 0.951542 0.008811 0.039648 0.766520 0.193833 0.000000 0.039648 0.083700 0.898678 0.008811 0.008811 0.000000 0.013216 0.933921 0.052863 0.004405 0.017621 0.022026 0.955947 0.035242 0.000000 0.964758 0.000000 0.149780 0.572687 0.233480 0.044053 0.295154 0.158590 0.422907 0.123348 Consensus sequence: DCCACGTGCV Alignment: DCCACGTGCV GCCACGTGSD ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 18 sscCCCGCGcs Reverse Complement Original Motif Backward 1 10 0.065482 Original motif 0.147059 0.441176 0.264706 0.147059 0.117647 0.529412 0.294118 0.058824 0.000000 0.676471 0.235294 0.088235 0.029412 0.852941 0.117647 0.000000 0.000000 0.823529 0.176471 0.000000 0.000000 0.794118 0.205882 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.058824 0.941176 0.000000 0.117647 0.470588 0.235294 0.176471 0.000000 0.323529 0.529412 0.147059 Consensus sequence: BSCCCCGCGBS Reverse complement motif 0.000000 0.529412 0.323529 0.147059 0.117647 0.235294 0.470588 0.176471 0.000000 0.941176 0.058824 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.205882 0.794118 0.000000 0.000000 0.176471 0.823529 0.000000 0.029412 0.117647 0.852941 0.000000 0.000000 0.235294 0.676471 0.088235 0.117647 0.294118 0.529412 0.058824 0.147059 0.264706 0.441176 0.147059 Consensus sequence: SBCGCGGGGSB Alignment: BSCCCCGCGBS -GCCACGTGSD ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 16 CTCF Original Motif Original Motif Forward 6 10 0.067902 Original motif 0.095290 0.318729 0.083242 0.502738 0.182913 0.158817 0.453450 0.204819 0.307777 0.053669 0.491785 0.146769 0.061336 0.876232 0.023001 0.039430 0.008762 0.989047 0.000000 0.002191 0.814896 0.014239 0.071194 0.099671 0.043812 0.578313 0.365827 0.012048 0.117325 0.474781 0.052632 0.355263 0.933114 0.012061 0.035088 0.019737 0.005488 0.000000 0.991218 0.003293 0.365532 0.003293 0.621295 0.009879 0.059276 0.013172 0.553238 0.374314 0.013187 0.000000 0.978022 0.008791 0.061538 0.008791 0.851648 0.078022 0.114411 0.806381 0.005501 0.073707 0.409241 0.014301 0.557756 0.018702 0.090308 0.530837 0.338106 0.040749 0.128855 0.354626 0.080396 0.436123 0.442731 0.199339 0.292952 0.064978 Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif 0.064978 0.199339 0.292952 0.442731 0.436123 0.354626 0.080396 0.128855 0.090308 0.338106 0.530837 0.040749 0.409241 0.557756 0.014301 0.018702 0.114411 0.005501 0.806381 0.073707 0.061538 0.851648 0.008791 0.078022 0.013187 0.978022 0.000000 0.008791 0.059276 0.553238 0.013172 0.374314 0.365532 0.621295 0.003293 0.009879 0.005488 0.991218 0.000000 0.003293 0.019737 0.012061 0.035088 0.933114 0.117325 0.052632 0.474781 0.355263 0.043812 0.365827 0.578313 0.012048 0.099671 0.014239 0.071194 0.814896 0.008762 0.000000 0.989047 0.002191 0.061336 0.023001 0.876232 0.039430 0.307777 0.491785 0.053669 0.146769 0.182913 0.453450 0.158817 0.204819 0.502738 0.318729 0.083242 0.095290 Consensus sequence: BMSMGCCYMCTKSTGGMHM Alignment: YDRCCASYAGRKGGCRSYV -----HSCACGTGGC---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 24 ssCCCCGCSssk Original Motif Reverse Complement Forward 2 10 0.070499 Original motif 0.000000 0.444444 0.370370 0.185185 0.111111 0.407407 0.333333 0.148148 0.000000 0.888889 0.037037 0.074074 0.000000 0.888889 0.074074 0.037037 0.000000 0.777778 0.222222 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.037037 0.888889 0.000000 0.074074 0.000000 0.703704 0.296296 0.000000 0.000000 0.518519 0.370370 0.111111 0.111111 0.407407 0.259259 0.222222 0.074074 0.222222 0.407407 0.296296 Consensus sequence: SBCCCCGCCSBB Reverse complement motif 0.074074 0.407407 0.222222 0.296296 0.111111 0.259259 0.407407 0.222222 0.000000 0.370370 0.518519 0.111111 0.000000 0.296296 0.703704 0.000000 0.037037 0.000000 0.888889 0.074074 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.222222 0.777778 0.000000 0.000000 0.074074 0.888889 0.037037 0.000000 0.037037 0.888889 0.074074 0.111111 0.333333 0.407407 0.148148 0.000000 0.370370 0.444444 0.185185 Consensus sequence: BBSGGCGGGGBS Alignment: BBSGGCGGGGBS -HSCACGTGGC- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 22 CACTGTGrYrtCACAGTGswsCAcT Reverse Complement Reverse Complement Backward 10 10 0.088322 Original motif 0.111111 0.746032 0.063492 0.079365 0.857143 0.047619 0.047619 0.047619 0.047619 0.857143 0.079365 0.015873 0.031746 0.000000 0.000000 0.968254 0.031746 0.015873 0.904762 0.047619 0.000000 0.000000 0.000000 1.000000 0.031746 0.000000 0.857143 0.111111 0.396825 0.111111 0.412698 0.079365 0.031746 0.253968 0.015873 0.698413 0.365079 0.000000 0.634921 0.000000 0.079365 0.206349 0.047619 0.666667 0.047619 0.936508 0.015873 0.000000 0.952381 0.000000 0.015873 0.031746 0.015873 0.920635 0.000000 0.063492 0.920635 0.000000 0.000000 0.079365 0.063492 0.047619 0.841270 0.047619 0.000000 0.000000 0.015873 0.984127 0.047619 0.015873 0.904762 0.031746 0.015873 0.603175 0.317460 0.063492 0.396825 0.000000 0.015873 0.587302 0.015873 0.476190 0.428571 0.079365 0.063492 0.920635 0.000000 0.015873 0.920635 0.015873 0.047619 0.015873 0.095238 0.682540 0.095238 0.126984 0.047619 0.015873 0.095238 0.841270 Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif 0.841270 0.015873 0.095238 0.047619 0.095238 0.095238 0.682540 0.126984 0.015873 0.015873 0.047619 0.920635 0.063492 0.000000 0.920635 0.015873 0.015873 0.428571 0.476190 0.079365 0.587302 0.000000 0.015873 0.396825 0.015873 0.317460 0.603175 0.063492 0.047619 0.904762 0.015873 0.031746 0.984127 0.000000 0.015873 0.000000 0.063492 0.841270 0.047619 0.047619 0.079365 0.000000 0.000000 0.920635 0.015873 0.000000 0.920635 0.063492 0.031746 0.000000 0.015873 0.952381 0.047619 0.015873 0.936508 0.000000 0.666667 0.206349 0.047619 0.079365 0.365079 0.634921 0.000000 0.000000 0.698413 0.253968 0.015873 0.031746 0.396825 0.412698 0.111111 0.079365 0.031746 0.857143 0.000000 0.111111 1.000000 0.000000 0.000000 0.000000 0.031746 0.904762 0.015873 0.047619 0.968254 0.000000 0.000000 0.031746 0.047619 0.079365 0.857143 0.015873 0.047619 0.047619 0.047619 0.857143 0.111111 0.063492 0.746032 0.079365 Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG Alignment: AGTGSWSCACTGTGAMAMCACAGTG ------GCCACGTGSD--------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 3 ESR1 Reverse Complement Reverse Complement Backward 3 10 0.089863 Original motif 0.261242 0.256959 0.329764 0.152034 0.228632 0.170940 0.350427 0.250000 0.136752 0.369658 0.318376 0.175214 0.176596 0.487234 0.138298 0.197872 0.285106 0.493617 0.100000 0.121277 0.651163 0.059197 0.188161 0.101480 0.075949 0.016878 0.816456 0.090717 0.040000 0.037895 0.884211 0.037895 0.069474 0.086316 0.191579 0.652632 0.008421 0.829474 0.111579 0.050526 0.837895 0.027368 0.056842 0.077895 0.122105 0.526316 0.225263 0.126316 0.132632 0.581053 0.111579 0.174737 0.134737 0.543158 0.204211 0.117895 0.067368 0.040000 0.016842 0.875789 0.044211 0.046316 0.896842 0.012632 0.642105 0.223158 0.065263 0.069474 0.021053 0.917895 0.025263 0.035789 0.124211 0.743158 0.004211 0.128421 0.054737 0.347368 0.046316 0.551579 Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif 0.551579 0.347368 0.046316 0.054737 0.124211 0.004211 0.743158 0.128421 0.021053 0.025263 0.917895 0.035789 0.069474 0.223158 0.065263 0.642105 0.044211 0.896842 0.046316 0.012632 0.875789 0.040000 0.016842 0.067368 0.134737 0.204211 0.543158 0.117895 0.132632 0.111579 0.581053 0.174737 0.122105 0.225263 0.526316 0.126316 0.077895 0.027368 0.056842 0.837895 0.008421 0.111579 0.829474 0.050526 0.652632 0.086316 0.191579 0.069474 0.040000 0.884211 0.037895 0.037895 0.075949 0.816456 0.016878 0.090717 0.101480 0.059197 0.188161 0.651163 0.285106 0.100000 0.493617 0.121277 0.176596 0.138298 0.487234 0.197872 0.136752 0.318376 0.369658 0.175214 0.228632 0.350427 0.170940 0.250000 0.261242 0.329764 0.256959 0.152034 Consensus sequence: MGGTCAGGGTGACCTRDBHV Alignment: MGGTCAGGGTGACCTRDBHV --------GCCACGTGSD-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 20 CagTGCTCCACTGTGgT Reverse Complement Reverse Complement Backward 7 10 0.094301 Original motif 0.150000 0.700000 0.016667 0.133333 0.650000 0.150000 0.050000 0.150000 0.166667 0.116667 0.633333 0.083333 0.050000 0.033333 0.066667 0.850000 0.050000 0.000000 0.833333 0.116667 0.016667 0.966667 0.000000 0.016667 0.050000 0.016667 0.000000 0.933333 0.066667 0.833333 0.066667 0.033333 0.033333 0.966667 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.050000 0.916667 0.016667 0.016667 0.166667 0.000000 0.000000 0.833333 0.083333 0.016667 0.900000 0.000000 0.000000 0.016667 0.016667 0.966667 0.000000 0.016667 0.966667 0.016667 0.116667 0.166667 0.483333 0.233333 0.066667 0.083333 0.050000 0.800000 Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif 0.800000 0.083333 0.050000 0.066667 0.116667 0.483333 0.166667 0.233333 0.000000 0.966667 0.016667 0.016667 0.966667 0.016667 0.016667 0.000000 0.083333 0.900000 0.016667 0.000000 0.833333 0.000000 0.000000 0.166667 0.050000 0.016667 0.916667 0.016667 0.000000 0.000000 0.000000 1.000000 0.033333 0.000000 0.966667 0.000000 0.066667 0.066667 0.833333 0.033333 0.933333 0.016667 0.000000 0.050000 0.016667 0.000000 0.966667 0.016667 0.050000 0.833333 0.000000 0.116667 0.850000 0.033333 0.066667 0.050000 0.166667 0.633333 0.116667 0.083333 0.150000 0.150000 0.050000 0.650000 0.150000 0.016667 0.700000 0.133333 Consensus sequence: ABCACAGTGGAGCACTG Alignment: ABCACAGTGGAGCACTG -GCCACGTGSD------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 1 HNF4A Reverse Complement Reverse Complement Forward 2 10 0.094712 Original motif 0.417910 0.104478 0.402985 0.074627 0.029851 0.029851 0.835821 0.104478 0.179104 0.059701 0.522388 0.238806 0.074627 0.343284 0.298507 0.283582 0.044776 0.761194 0.059701 0.134328 0.880597 0.014925 0.044776 0.059701 0.791045 0.029851 0.149254 0.029851 0.835821 0.014925 0.119403 0.029851 0.059701 0.059701 0.865672 0.014925 0.089552 0.029851 0.492537 0.388060 0.044776 0.328358 0.164179 0.462687 0.059701 0.731343 0.074627 0.134328 0.626866 0.104478 0.149254 0.119403 Consensus sequence: RGGBCAAAGKYCA Reverse complement motif 0.119403 0.104478 0.149254 0.626866 0.059701 0.074627 0.731343 0.134328 0.462687 0.328358 0.164179 0.044776 0.089552 0.492537 0.029851 0.388060 0.059701 0.865672 0.059701 0.014925 0.029851 0.014925 0.119403 0.835821 0.029851 0.029851 0.149254 0.791045 0.059701 0.014925 0.044776 0.880597 0.044776 0.059701 0.761194 0.134328 0.074627 0.298507 0.343284 0.283582 0.179104 0.522388 0.059701 0.238806 0.029851 0.835821 0.029851 0.104478 0.074627 0.104478 0.402985 0.417910 Consensus sequence: TGMYCTTTGBCCK Alignment: TGMYCTTTGBCCK -GCCACGTGSD-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 27 AgTGCTCCACTGTGgTGTCACAgT Reverse Complement Reverse Complement Backward 6 10 0.094936 Original motif 0.690141 0.126761 0.042254 0.140845 0.169014 0.098592 0.676056 0.056338 0.042254 0.028169 0.028169 0.901408 0.056338 0.000000 0.774648 0.169014 0.042254 0.887324 0.042254 0.028169 0.000000 0.014085 0.000000 0.985915 0.056338 0.830986 0.042254 0.070423 0.028169 0.957746 0.014085 0.000000 0.957746 0.000000 0.014085 0.028169 0.084507 0.845070 0.014085 0.056338 0.028169 0.014085 0.000000 0.957746 0.140845 0.028169 0.802817 0.028169 0.014085 0.014085 0.014085 0.957746 0.014085 0.000000 0.929577 0.056338 0.056338 0.154930 0.619718 0.169014 0.014085 0.028169 0.000000 0.957746 0.056338 0.014085 0.873239 0.056338 0.014085 0.000000 0.000000 0.985915 0.042254 0.929577 0.000000 0.028169 0.957746 0.028169 0.000000 0.014085 0.028169 0.845070 0.028169 0.098592 0.873239 0.014085 0.042254 0.070423 0.098592 0.154930 0.563380 0.183099 0.070423 0.014085 0.112676 0.802817 Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif 0.802817 0.014085 0.112676 0.070423 0.098592 0.563380 0.154930 0.183099 0.070423 0.014085 0.042254 0.873239 0.028169 0.028169 0.845070 0.098592 0.014085 0.028169 0.000000 0.957746 0.042254 0.000000 0.929577 0.028169 0.985915 0.000000 0.000000 0.014085 0.056338 0.873239 0.014085 0.056338 0.957746 0.028169 0.000000 0.014085 0.056338 0.619718 0.154930 0.169014 0.014085 0.929577 0.000000 0.056338 0.957746 0.014085 0.014085 0.014085 0.140845 0.802817 0.028169 0.028169 0.957746 0.014085 0.000000 0.028169 0.084507 0.014085 0.845070 0.056338 0.028169 0.000000 0.014085 0.957746 0.028169 0.014085 0.957746 0.000000 0.056338 0.042254 0.830986 0.070423 0.985915 0.014085 0.000000 0.000000 0.042254 0.042254 0.887324 0.028169 0.056338 0.774648 0.000000 0.169014 0.901408 0.028169 0.028169 0.042254 0.169014 0.676056 0.098592 0.056338 0.140845 0.126761 0.042254 0.690141 Consensus sequence: ACTGTGACACCACAGTGGAGCACT Alignment: ACTGTGACACCACAGTGGAGCACT ---------GCCACGTGSD----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 14 PPARGRXRA Reverse Complement Reverse Complement Backward 5 10 0.095444 Original motif 0.109685 0.369895 0.373396 0.147025 0.117716 0.193473 0.148019 0.540793 0.453488 0.026744 0.427907 0.091860 0.116144 0.003484 0.779326 0.101045 0.161253 0.017401 0.781903 0.039443 0.168213 0.149652 0.458237 0.223898 0.082271 0.633835 0.207416 0.076477 0.949015 0.024334 0.017381 0.009270 0.604867 0.055620 0.312862 0.026651 0.825231 0.005787 0.158565 0.010417 0.095017 0.002317 0.888760 0.013905 0.047509 0.010429 0.803013 0.139050 0.025492 0.114716 0.304751 0.555041 0.062645 0.643852 0.167053 0.126450 0.784223 0.067285 0.054524 0.093968 Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif 0.093968 0.067285 0.054524 0.784223 0.062645 0.167053 0.643852 0.126450 0.555041 0.114716 0.304751 0.025492 0.047509 0.803013 0.010429 0.139050 0.095017 0.888760 0.002317 0.013905 0.010417 0.005787 0.158565 0.825231 0.026651 0.055620 0.312862 0.604867 0.009270 0.024334 0.017381 0.949015 0.082271 0.207416 0.633835 0.076477 0.168213 0.458237 0.149652 0.223898 0.161253 0.781903 0.017401 0.039443 0.116144 0.779326 0.003484 0.101045 0.091860 0.026744 0.427907 0.453488 0.540793 0.193473 0.148019 0.117716 0.109685 0.373396 0.369895 0.147025 Consensus sequence: TGRCCTKTGHCCKAB Alignment: TGRCCTKTGHCCKAB -GCCACGTGSD---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 8 Motif name: Myc Original motif 0.295154 0.422907 0.158590 0.123348 0.149780 0.233480 0.572687 0.044053 0.035242 0.964758 0.000000 0.000000 0.955947 0.017621 0.022026 0.004405 0.000000 0.933921 0.013216 0.052863 0.083700 0.008811 0.898678 0.008811 0.039648 0.193833 0.000000 0.766520 0.000000 0.008811 0.951542 0.039648 0.000000 0.074890 0.806167 0.118943 0.198238 0.471366 0.105727 0.224670 Consensus sequence: VGCACGTGGH Reverse complement motif 0.198238 0.105727 0.471366 0.224670 0.000000 0.806167 0.074890 0.118943 0.000000 0.951542 0.008811 0.039648 0.766520 0.193833 0.000000 0.039648 0.083700 0.898678 0.008811 0.008811 0.000000 0.013216 0.933921 0.052863 0.004405 0.017621 0.022026 0.955947 0.035242 0.000000 0.964758 0.000000 0.149780 0.572687 0.233480 0.044053 0.295154 0.158590 0.422907 0.123348 Consensus sequence: DCCACGTGCV ******************************************************************* Best Matches for Significant Motif ID 8 (Highest to Lowest) ******************************************************************* Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 6 Mycn Original Motif Original Motif Backward 1 10 0.000000 Original motif 0.349315 0.363014 0.143836 0.143836 0.089041 0.388128 0.447489 0.075342 0.015982 0.984018 0.000000 0.000000 0.945205 0.000000 0.041096 0.013699 0.000000 0.961187 0.018265 0.020548 0.070776 0.002283 0.924658 0.002283 0.054795 0.221461 0.004566 0.719178 0.000000 0.000000 0.938356 0.061644 0.061644 0.111872 0.739726 0.086758 0.139269 0.605023 0.091324 0.164384 Consensus sequence: HSCACGTGGC Reverse complement motif 0.139269 0.091324 0.605023 0.164384 0.061644 0.739726 0.111872 0.086758 0.000000 0.938356 0.000000 0.061644 0.719178 0.221461 0.004566 0.054795 0.070776 0.924658 0.002283 0.002283 0.000000 0.018265 0.961187 0.020548 0.013699 0.000000 0.041096 0.945205 0.015982 0.000000 0.984018 0.000000 0.089041 0.447489 0.388128 0.075342 0.349315 0.143836 0.363014 0.143836 Consensus sequence: GCCACGTGSD Alignment: HSCACGTGGC VGCACGTGGH ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 18 sscCCCGCGcs Reverse Complement Original Motif Forward 2 10 0.064853 Original motif 0.147059 0.441176 0.264706 0.147059 0.117647 0.529412 0.294118 0.058824 0.000000 0.676471 0.235294 0.088235 0.029412 0.852941 0.117647 0.000000 0.000000 0.823529 0.176471 0.000000 0.000000 0.794118 0.205882 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.058824 0.941176 0.000000 0.117647 0.470588 0.235294 0.176471 0.000000 0.323529 0.529412 0.147059 Consensus sequence: BSCCCCGCGBS Reverse complement motif 0.000000 0.529412 0.323529 0.147059 0.117647 0.235294 0.470588 0.176471 0.000000 0.941176 0.058824 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.205882 0.794118 0.000000 0.000000 0.176471 0.823529 0.000000 0.029412 0.117647 0.852941 0.000000 0.000000 0.235294 0.676471 0.088235 0.117647 0.294118 0.529412 0.058824 0.147059 0.264706 0.441176 0.147059 Consensus sequence: SBCGCGGGGSB Alignment: BSCCCCGCGBS -DCCACGTGCV ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 24 ssCCCCGCSssk Reverse Complement Original Motif Backward 2 10 0.072859 Original motif 0.000000 0.444444 0.370370 0.185185 0.111111 0.407407 0.333333 0.148148 0.000000 0.888889 0.037037 0.074074 0.000000 0.888889 0.074074 0.037037 0.000000 0.777778 0.222222 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.037037 0.888889 0.000000 0.074074 0.000000 0.703704 0.296296 0.000000 0.000000 0.518519 0.370370 0.111111 0.111111 0.407407 0.259259 0.222222 0.074074 0.222222 0.407407 0.296296 Consensus sequence: SBCCCCGCCSBB Reverse complement motif 0.074074 0.407407 0.222222 0.296296 0.111111 0.259259 0.407407 0.222222 0.000000 0.370370 0.518519 0.111111 0.000000 0.296296 0.703704 0.000000 0.037037 0.000000 0.888889 0.074074 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.222222 0.777778 0.000000 0.000000 0.074074 0.888889 0.037037 0.000000 0.037037 0.888889 0.074074 0.111111 0.333333 0.407407 0.148148 0.000000 0.370370 0.444444 0.185185 Consensus sequence: BBSGGCGGGGBS Alignment: SBCCCCGCCSBB -DCCACGTGCV- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 16 CTCF Reverse Complement Original Motif Backward 8 10 0.075426 Original motif 0.095290 0.318729 0.083242 0.502738 0.182913 0.158817 0.453450 0.204819 0.307777 0.053669 0.491785 0.146769 0.061336 0.876232 0.023001 0.039430 0.008762 0.989047 0.000000 0.002191 0.814896 0.014239 0.071194 0.099671 0.043812 0.578313 0.365827 0.012048 0.117325 0.474781 0.052632 0.355263 0.933114 0.012061 0.035088 0.019737 0.005488 0.000000 0.991218 0.003293 0.365532 0.003293 0.621295 0.009879 0.059276 0.013172 0.553238 0.374314 0.013187 0.000000 0.978022 0.008791 0.061538 0.008791 0.851648 0.078022 0.114411 0.806381 0.005501 0.073707 0.409241 0.014301 0.557756 0.018702 0.090308 0.530837 0.338106 0.040749 0.128855 0.354626 0.080396 0.436123 0.442731 0.199339 0.292952 0.064978 Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif 0.064978 0.199339 0.292952 0.442731 0.436123 0.354626 0.080396 0.128855 0.090308 0.338106 0.530837 0.040749 0.409241 0.557756 0.014301 0.018702 0.114411 0.005501 0.806381 0.073707 0.061538 0.851648 0.008791 0.078022 0.013187 0.978022 0.000000 0.008791 0.059276 0.553238 0.013172 0.374314 0.365532 0.621295 0.003293 0.009879 0.005488 0.991218 0.000000 0.003293 0.019737 0.012061 0.035088 0.933114 0.117325 0.052632 0.474781 0.355263 0.043812 0.365827 0.578313 0.012048 0.099671 0.014239 0.071194 0.814896 0.008762 0.000000 0.989047 0.002191 0.061336 0.023001 0.876232 0.039430 0.307777 0.491785 0.053669 0.146769 0.182913 0.453450 0.158817 0.204819 0.502738 0.318729 0.083242 0.095290 Consensus sequence: BMSMGCCYMCTKSTGGMHM Alignment: YDRCCASYAGRKGGCRSYV --DCCACGTGCV------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 22 CACTGTGrYrtCACAGTGswsCAcT Reverse Complement Original Motif Backward 6 10 0.088891 Original motif 0.111111 0.746032 0.063492 0.079365 0.857143 0.047619 0.047619 0.047619 0.047619 0.857143 0.079365 0.015873 0.031746 0.000000 0.000000 0.968254 0.031746 0.015873 0.904762 0.047619 0.000000 0.000000 0.000000 1.000000 0.031746 0.000000 0.857143 0.111111 0.396825 0.111111 0.412698 0.079365 0.031746 0.253968 0.015873 0.698413 0.365079 0.000000 0.634921 0.000000 0.079365 0.206349 0.047619 0.666667 0.047619 0.936508 0.015873 0.000000 0.952381 0.000000 0.015873 0.031746 0.015873 0.920635 0.000000 0.063492 0.920635 0.000000 0.000000 0.079365 0.063492 0.047619 0.841270 0.047619 0.000000 0.000000 0.015873 0.984127 0.047619 0.015873 0.904762 0.031746 0.015873 0.603175 0.317460 0.063492 0.396825 0.000000 0.015873 0.587302 0.015873 0.476190 0.428571 0.079365 0.063492 0.920635 0.000000 0.015873 0.920635 0.015873 0.047619 0.015873 0.095238 0.682540 0.095238 0.126984 0.047619 0.015873 0.095238 0.841270 Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif 0.841270 0.015873 0.095238 0.047619 0.095238 0.095238 0.682540 0.126984 0.015873 0.015873 0.047619 0.920635 0.063492 0.000000 0.920635 0.015873 0.015873 0.428571 0.476190 0.079365 0.587302 0.000000 0.015873 0.396825 0.015873 0.317460 0.603175 0.063492 0.047619 0.904762 0.015873 0.031746 0.984127 0.000000 0.015873 0.000000 0.063492 0.841270 0.047619 0.047619 0.079365 0.000000 0.000000 0.920635 0.015873 0.000000 0.920635 0.063492 0.031746 0.000000 0.015873 0.952381 0.047619 0.015873 0.936508 0.000000 0.666667 0.206349 0.047619 0.079365 0.365079 0.634921 0.000000 0.000000 0.698413 0.253968 0.015873 0.031746 0.396825 0.412698 0.111111 0.079365 0.031746 0.857143 0.000000 0.111111 1.000000 0.000000 0.000000 0.000000 0.031746 0.904762 0.015873 0.047619 0.968254 0.000000 0.000000 0.031746 0.047619 0.079365 0.857143 0.015873 0.047619 0.047619 0.047619 0.857143 0.111111 0.063492 0.746032 0.079365 Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG Alignment: CACTGTGRTRTCACAGTGSWSCACT ----------DCCACGTGCV----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 1 HNF4A Original Motif Reverse Complement Backward 1 10 0.093449 Original motif 0.417910 0.104478 0.402985 0.074627 0.029851 0.029851 0.835821 0.104478 0.179104 0.059701 0.522388 0.238806 0.074627 0.343284 0.298507 0.283582 0.044776 0.761194 0.059701 0.134328 0.880597 0.014925 0.044776 0.059701 0.791045 0.029851 0.149254 0.029851 0.835821 0.014925 0.119403 0.029851 0.059701 0.059701 0.865672 0.014925 0.089552 0.029851 0.492537 0.388060 0.044776 0.328358 0.164179 0.462687 0.059701 0.731343 0.074627 0.134328 0.626866 0.104478 0.149254 0.119403 Consensus sequence: RGGBCAAAGKYCA Reverse complement motif 0.119403 0.104478 0.149254 0.626866 0.059701 0.074627 0.731343 0.134328 0.462687 0.328358 0.164179 0.044776 0.089552 0.492537 0.029851 0.388060 0.059701 0.865672 0.059701 0.014925 0.029851 0.014925 0.119403 0.835821 0.029851 0.029851 0.149254 0.791045 0.059701 0.014925 0.044776 0.880597 0.044776 0.059701 0.761194 0.134328 0.074627 0.298507 0.343284 0.283582 0.179104 0.522388 0.059701 0.238806 0.029851 0.835821 0.029851 0.104478 0.074627 0.104478 0.402985 0.417910 Consensus sequence: TGMYCTTTGBCCK Alignment: TGMYCTTTGBCCK ---VGCACGTGGH ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 3 ESR1 Reverse Complement Reverse Complement Forward 9 10 0.094044 Original motif 0.261242 0.256959 0.329764 0.152034 0.228632 0.170940 0.350427 0.250000 0.136752 0.369658 0.318376 0.175214 0.176596 0.487234 0.138298 0.197872 0.285106 0.493617 0.100000 0.121277 0.651163 0.059197 0.188161 0.101480 0.075949 0.016878 0.816456 0.090717 0.040000 0.037895 0.884211 0.037895 0.069474 0.086316 0.191579 0.652632 0.008421 0.829474 0.111579 0.050526 0.837895 0.027368 0.056842 0.077895 0.122105 0.526316 0.225263 0.126316 0.132632 0.581053 0.111579 0.174737 0.134737 0.543158 0.204211 0.117895 0.067368 0.040000 0.016842 0.875789 0.044211 0.046316 0.896842 0.012632 0.642105 0.223158 0.065263 0.069474 0.021053 0.917895 0.025263 0.035789 0.124211 0.743158 0.004211 0.128421 0.054737 0.347368 0.046316 0.551579 Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif 0.551579 0.347368 0.046316 0.054737 0.124211 0.004211 0.743158 0.128421 0.021053 0.025263 0.917895 0.035789 0.069474 0.223158 0.065263 0.642105 0.044211 0.896842 0.046316 0.012632 0.875789 0.040000 0.016842 0.067368 0.134737 0.204211 0.543158 0.117895 0.132632 0.111579 0.581053 0.174737 0.122105 0.225263 0.526316 0.126316 0.077895 0.027368 0.056842 0.837895 0.008421 0.111579 0.829474 0.050526 0.652632 0.086316 0.191579 0.069474 0.040000 0.884211 0.037895 0.037895 0.075949 0.816456 0.016878 0.090717 0.101480 0.059197 0.188161 0.651163 0.285106 0.100000 0.493617 0.121277 0.176596 0.138298 0.487234 0.197872 0.136752 0.318376 0.369658 0.175214 0.228632 0.350427 0.170940 0.250000 0.261242 0.329764 0.256959 0.152034 Consensus sequence: MGGTCAGGGTGACCTRDBHV Alignment: MGGTCAGGGTGACCTRDBHV --------DCCACGTGCV-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 20 CagTGCTCCACTGTGgT Reverse Complement Reverse Complement Backward 7 10 0.095523 Original motif 0.150000 0.700000 0.016667 0.133333 0.650000 0.150000 0.050000 0.150000 0.166667 0.116667 0.633333 0.083333 0.050000 0.033333 0.066667 0.850000 0.050000 0.000000 0.833333 0.116667 0.016667 0.966667 0.000000 0.016667 0.050000 0.016667 0.000000 0.933333 0.066667 0.833333 0.066667 0.033333 0.033333 0.966667 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.050000 0.916667 0.016667 0.016667 0.166667 0.000000 0.000000 0.833333 0.083333 0.016667 0.900000 0.000000 0.000000 0.016667 0.016667 0.966667 0.000000 0.016667 0.966667 0.016667 0.116667 0.166667 0.483333 0.233333 0.066667 0.083333 0.050000 0.800000 Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif 0.800000 0.083333 0.050000 0.066667 0.116667 0.483333 0.166667 0.233333 0.000000 0.966667 0.016667 0.016667 0.966667 0.016667 0.016667 0.000000 0.083333 0.900000 0.016667 0.000000 0.833333 0.000000 0.000000 0.166667 0.050000 0.016667 0.916667 0.016667 0.000000 0.000000 0.000000 1.000000 0.033333 0.000000 0.966667 0.000000 0.066667 0.066667 0.833333 0.033333 0.933333 0.016667 0.000000 0.050000 0.016667 0.000000 0.966667 0.016667 0.050000 0.833333 0.000000 0.116667 0.850000 0.033333 0.066667 0.050000 0.166667 0.633333 0.116667 0.083333 0.150000 0.150000 0.050000 0.650000 0.150000 0.016667 0.700000 0.133333 Consensus sequence: ABCACAGTGGAGCACTG Alignment: ABCACAGTGGAGCACTG -DCCACGTGCV------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 9 ESR2 Original Motif Original Motif Forward 5 10 0.096860 Original motif 0.218487 0.450980 0.176471 0.154062 0.442577 0.142857 0.114846 0.299720 0.521008 0.042017 0.431373 0.005602 0.075630 0.000000 0.770308 0.154062 0.050420 0.056022 0.893557 0.000000 0.036415 0.053221 0.092437 0.817927 0.000000 1.000000 0.000000 0.000000 0.943978 0.002801 0.000000 0.053221 0.137255 0.344538 0.316527 0.201681 0.179272 0.176471 0.417367 0.226891 0.145658 0.170868 0.411765 0.271709 0.058824 0.092437 0.067227 0.781513 0.176471 0.070028 0.742297 0.011204 0.498599 0.277311 0.053221 0.170868 0.095238 0.750700 0.005602 0.148459 0.128852 0.809524 0.000000 0.061625 0.075630 0.252101 0.000000 0.672269 0.168067 0.263305 0.380952 0.187675 Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif 0.168067 0.380952 0.263305 0.187675 0.672269 0.252101 0.000000 0.075630 0.128852 0.000000 0.809524 0.061625 0.095238 0.005602 0.750700 0.148459 0.170868 0.277311 0.053221 0.498599 0.176471 0.742297 0.070028 0.011204 0.781513 0.092437 0.067227 0.058824 0.145658 0.411765 0.170868 0.271709 0.179272 0.417367 0.176471 0.226891 0.137255 0.316527 0.344538 0.201681 0.053221 0.002801 0.000000 0.943978 0.000000 0.000000 1.000000 0.000000 0.817927 0.053221 0.092437 0.036415 0.050420 0.893557 0.056022 0.000000 0.075630 0.770308 0.000000 0.154062 0.005602 0.042017 0.431373 0.521008 0.299720 0.142857 0.114846 0.442577 0.218487 0.176471 0.450980 0.154062 Consensus sequence: BAGGYCABHBTGACCKHV Alignment: VHRGGTCABDBTGMCCTB ----VGCACGTGGH---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 23 TGGAGCACTGTGACAcCACAGTGg Reverse Complement Original Motif Backward 11 10 0.097113 Original motif 0.054054 0.040541 0.054054 0.851351 0.040541 0.013514 0.824324 0.121622 0.094595 0.135135 0.756757 0.013514 0.891892 0.000000 0.000000 0.108108 0.040541 0.094595 0.810811 0.054054 0.081081 0.797297 0.054054 0.067568 0.932432 0.027027 0.000000 0.040541 0.054054 0.756757 0.135135 0.054054 0.108108 0.027027 0.013514 0.851351 0.108108 0.000000 0.851351 0.040541 0.013514 0.000000 0.027027 0.959459 0.000000 0.013514 0.945946 0.040541 0.905405 0.000000 0.067568 0.027027 0.054054 0.837838 0.000000 0.108108 0.945946 0.013514 0.040541 0.000000 0.162162 0.500000 0.189189 0.148649 0.108108 0.824324 0.000000 0.067568 0.945946 0.000000 0.040541 0.013514 0.081081 0.837838 0.027027 0.054054 0.945946 0.000000 0.013514 0.040541 0.054054 0.067568 0.783784 0.094595 0.054054 0.027027 0.000000 0.918919 0.040541 0.013514 0.864865 0.081081 0.148649 0.121622 0.675676 0.054054 Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif 0.148649 0.675676 0.121622 0.054054 0.040541 0.864865 0.013514 0.081081 0.918919 0.027027 0.000000 0.054054 0.054054 0.783784 0.067568 0.094595 0.040541 0.000000 0.013514 0.945946 0.081081 0.027027 0.837838 0.054054 0.013514 0.000000 0.040541 0.945946 0.108108 0.000000 0.824324 0.067568 0.162162 0.189189 0.500000 0.148649 0.000000 0.013514 0.040541 0.945946 0.054054 0.000000 0.837838 0.108108 0.027027 0.000000 0.067568 0.905405 0.000000 0.945946 0.013514 0.040541 0.959459 0.000000 0.027027 0.013514 0.108108 0.851351 0.000000 0.040541 0.851351 0.027027 0.013514 0.108108 0.054054 0.135135 0.756757 0.054054 0.040541 0.027027 0.000000 0.932432 0.081081 0.054054 0.797297 0.067568 0.040541 0.810811 0.094595 0.054054 0.108108 0.000000 0.000000 0.891892 0.094595 0.756757 0.135135 0.013514 0.040541 0.824324 0.013514 0.121622 0.851351 0.040541 0.054054 0.054054 Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA Alignment: TGGAGCACTGTGACAVCACAGTGG ----DCCACGTGCV---------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- **************************************************************************************************************************************************************************************************** ********************************************************************** Best Matches for Each Motif (Highest to Lowest) ***************************************************************************** Dataset #: 1 Motif ID: 1 Motif name: HNF4A Original motif 0.417910 0.104478 0.402985 0.074627 0.029851 0.029851 0.835821 0.104478 0.179104 0.059701 0.522388 0.238806 0.074627 0.343284 0.298507 0.283582 0.044776 0.761194 0.059701 0.134328 0.880597 0.014925 0.044776 0.059701 0.791045 0.029851 0.149254 0.029851 0.835821 0.014925 0.119403 0.029851 0.059701 0.059701 0.865672 0.014925 0.089552 0.029851 0.492537 0.388060 0.044776 0.328358 0.164179 0.462687 0.059701 0.731343 0.074627 0.134328 0.626866 0.104478 0.149254 0.119403 Consensus sequence: RGGBCAAAGKYCA Reserve complement motif 0.119403 0.104478 0.149254 0.626866 0.059701 0.074627 0.731343 0.134328 0.462687 0.328358 0.164179 0.044776 0.089552 0.492537 0.029851 0.388060 0.059701 0.865672 0.059701 0.014925 0.029851 0.014925 0.119403 0.835821 0.029851 0.029851 0.149254 0.791045 0.059701 0.014925 0.044776 0.880597 0.044776 0.059701 0.761194 0.134328 0.074627 0.298507 0.343284 0.283582 0.179104 0.522388 0.059701 0.238806 0.029851 0.835821 0.029851 0.104478 0.074627 0.104478 0.402985 0.417910 Consensus sequence: TGMYCTTTGBCCK ************************************************************************ Best Matches for Motif ID 1 (Highest to Lowest) ************************************************************************ Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 14 PPARGRXRA Reverse Complement Reverse Complement Backward 3 13 0.000000 Original motif 0.109685 0.369895 0.373396 0.147025 0.117716 0.193473 0.148019 0.540793 0.453488 0.026744 0.427907 0.091860 0.116144 0.003484 0.779326 0.101045 0.161253 0.017401 0.781903 0.039443 0.168213 0.149652 0.458237 0.223898 0.082271 0.633835 0.207416 0.076477 0.949015 0.024334 0.017381 0.009270 0.604867 0.055620 0.312862 0.026651 0.825231 0.005787 0.158565 0.010417 0.095017 0.002317 0.888760 0.013905 0.047509 0.010429 0.803013 0.139050 0.025492 0.114716 0.304751 0.555041 0.062645 0.643852 0.167053 0.126450 0.784223 0.067285 0.054524 0.093968 Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif 0.093968 0.067285 0.054524 0.784223 0.062645 0.167053 0.643852 0.126450 0.555041 0.114716 0.304751 0.025492 0.047509 0.803013 0.010429 0.139050 0.095017 0.888760 0.002317 0.013905 0.010417 0.005787 0.158565 0.825231 0.026651 0.055620 0.312862 0.604867 0.009270 0.024334 0.017381 0.949015 0.082271 0.207416 0.633835 0.076477 0.168213 0.458237 0.149652 0.223898 0.161253 0.781903 0.017401 0.039443 0.116144 0.779326 0.003484 0.101045 0.091860 0.026744 0.427907 0.453488 0.540793 0.193473 0.148019 0.117716 0.109685 0.373396 0.369895 0.147025 Consensus sequence: TGRCCTKTGHCCKAB Alignment: TGRCCTKTGHCCKAB TGMYCTTTGBCCK-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 2 NR2F1 Original Motif Reverse Complement Forward 2 13 0.022741 Original motif 0.000000 0.000000 0.153846 0.846154 0.076923 0.000000 0.923077 0.000000 0.923077 0.000000 0.076923 0.000000 0.461538 0.538462 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.230769 0.000000 0.769231 0.000000 0.153846 0.000000 0.846154 0.076923 0.000000 0.000000 0.923077 0.153846 0.000000 0.846154 0.000000 0.461538 0.307692 0.230769 0.000000 0.461538 0.384615 0.076923 0.076923 0.076923 0.769231 0.076923 0.076923 0.230769 0.461538 0.000000 0.307692 0.000000 0.230769 0.230769 0.538462 Consensus sequence: TGAMCTTTGMMCYT Reverse complement motif 0.538462 0.230769 0.230769 0.000000 0.230769 0.000000 0.461538 0.307692 0.076923 0.076923 0.769231 0.076923 0.076923 0.384615 0.076923 0.461538 0.000000 0.307692 0.230769 0.461538 0.153846 0.846154 0.000000 0.000000 0.923077 0.000000 0.000000 0.076923 0.846154 0.153846 0.000000 0.000000 0.769231 0.230769 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.461538 0.000000 0.538462 0.000000 0.000000 0.000000 0.076923 0.923077 0.076923 0.923077 0.000000 0.000000 0.846154 0.000000 0.153846 0.000000 Consensus sequence: AKGYYCAAAGRTCA Alignment: AKGYYCAAAGRTCA -RGGBCAAAGKYCA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 10 NR1H2RXRA Original Motif Original Motif Forward 3 13 0.042302 Original motif 0.680000 0.200000 0.000000 0.120000 0.680000 0.040000 0.200000 0.080000 0.800000 0.000000 0.200000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.040000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.000000 0.040000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.800000 0.040000 0.080000 0.080000 0.000000 0.600000 0.240000 0.160000 Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif 0.000000 0.240000 0.600000 0.160000 0.080000 0.040000 0.080000 0.800000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.040000 0.000000 0.000000 0.960000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.040000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.200000 0.800000 0.080000 0.040000 0.200000 0.680000 0.120000 0.200000 0.000000 0.680000 Consensus sequence: GTTGACCTTTGACCTTT Alignment: AAAGGTCAAAGGTCAAC --RGGBCAAAGKYCA-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 22 CACTGTGrYrtCACAGTGswsCAcT Original Motif Original Motif Backward 6 13 0.055765 Original motif 0.111111 0.746032 0.063492 0.079365 0.857143 0.047619 0.047619 0.047619 0.047619 0.857143 0.079365 0.015873 0.031746 0.000000 0.000000 0.968254 0.031746 0.015873 0.904762 0.047619 0.000000 0.000000 0.000000 1.000000 0.031746 0.000000 0.857143 0.111111 0.396825 0.111111 0.412698 0.079365 0.031746 0.253968 0.015873 0.698413 0.365079 0.000000 0.634921 0.000000 0.079365 0.206349 0.047619 0.666667 0.047619 0.936508 0.015873 0.000000 0.952381 0.000000 0.015873 0.031746 0.015873 0.920635 0.000000 0.063492 0.920635 0.000000 0.000000 0.079365 0.063492 0.047619 0.841270 0.047619 0.000000 0.000000 0.015873 0.984127 0.047619 0.015873 0.904762 0.031746 0.015873 0.603175 0.317460 0.063492 0.396825 0.000000 0.015873 0.587302 0.015873 0.476190 0.428571 0.079365 0.063492 0.920635 0.000000 0.015873 0.920635 0.015873 0.047619 0.015873 0.095238 0.682540 0.095238 0.126984 0.047619 0.015873 0.095238 0.841270 Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif 0.841270 0.015873 0.095238 0.047619 0.095238 0.095238 0.682540 0.126984 0.015873 0.015873 0.047619 0.920635 0.063492 0.000000 0.920635 0.015873 0.015873 0.428571 0.476190 0.079365 0.587302 0.000000 0.015873 0.396825 0.015873 0.317460 0.603175 0.063492 0.047619 0.904762 0.015873 0.031746 0.984127 0.000000 0.015873 0.000000 0.063492 0.841270 0.047619 0.047619 0.079365 0.000000 0.000000 0.920635 0.015873 0.000000 0.920635 0.063492 0.031746 0.000000 0.015873 0.952381 0.047619 0.015873 0.936508 0.000000 0.666667 0.206349 0.047619 0.079365 0.365079 0.634921 0.000000 0.000000 0.698413 0.253968 0.015873 0.031746 0.396825 0.412698 0.111111 0.079365 0.031746 0.857143 0.000000 0.111111 1.000000 0.000000 0.000000 0.000000 0.031746 0.904762 0.015873 0.047619 0.968254 0.000000 0.000000 0.031746 0.047619 0.079365 0.857143 0.015873 0.047619 0.047619 0.047619 0.857143 0.111111 0.063492 0.746032 0.079365 Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG Alignment: CACTGTGRTRTCACAGTGSWSCACT -------RGGBCAAAGKYCA----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 23 TGGAGCACTGTGACAcCACAGTGg Original Motif Reverse Complement Forward 9 13 0.065644 Original motif 0.054054 0.040541 0.054054 0.851351 0.040541 0.013514 0.824324 0.121622 0.094595 0.135135 0.756757 0.013514 0.891892 0.000000 0.000000 0.108108 0.040541 0.094595 0.810811 0.054054 0.081081 0.797297 0.054054 0.067568 0.932432 0.027027 0.000000 0.040541 0.054054 0.756757 0.135135 0.054054 0.108108 0.027027 0.013514 0.851351 0.108108 0.000000 0.851351 0.040541 0.013514 0.000000 0.027027 0.959459 0.000000 0.013514 0.945946 0.040541 0.905405 0.000000 0.067568 0.027027 0.054054 0.837838 0.000000 0.108108 0.945946 0.013514 0.040541 0.000000 0.162162 0.500000 0.189189 0.148649 0.108108 0.824324 0.000000 0.067568 0.945946 0.000000 0.040541 0.013514 0.081081 0.837838 0.027027 0.054054 0.945946 0.000000 0.013514 0.040541 0.054054 0.067568 0.783784 0.094595 0.054054 0.027027 0.000000 0.918919 0.040541 0.013514 0.864865 0.081081 0.148649 0.121622 0.675676 0.054054 Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif 0.148649 0.675676 0.121622 0.054054 0.040541 0.864865 0.013514 0.081081 0.918919 0.027027 0.000000 0.054054 0.054054 0.783784 0.067568 0.094595 0.040541 0.000000 0.013514 0.945946 0.081081 0.027027 0.837838 0.054054 0.013514 0.000000 0.040541 0.945946 0.108108 0.000000 0.824324 0.067568 0.162162 0.189189 0.500000 0.148649 0.000000 0.013514 0.040541 0.945946 0.054054 0.000000 0.837838 0.108108 0.027027 0.000000 0.067568 0.905405 0.000000 0.945946 0.013514 0.040541 0.959459 0.000000 0.027027 0.013514 0.108108 0.851351 0.000000 0.040541 0.851351 0.027027 0.013514 0.108108 0.054054 0.135135 0.756757 0.054054 0.040541 0.027027 0.000000 0.932432 0.081081 0.054054 0.797297 0.067568 0.040541 0.810811 0.094595 0.054054 0.108108 0.000000 0.000000 0.891892 0.094595 0.756757 0.135135 0.013514 0.040541 0.824324 0.013514 0.121622 0.851351 0.040541 0.054054 0.054054 Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA Alignment: CCACTGTGVTGTCACAGTGCTCCA --------RGGBCAAAGKYCA--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 9 ESR2 Original Motif Original Motif Forward 3 13 0.067162 Original motif 0.218487 0.450980 0.176471 0.154062 0.442577 0.142857 0.114846 0.299720 0.521008 0.042017 0.431373 0.005602 0.075630 0.000000 0.770308 0.154062 0.050420 0.056022 0.893557 0.000000 0.036415 0.053221 0.092437 0.817927 0.000000 1.000000 0.000000 0.000000 0.943978 0.002801 0.000000 0.053221 0.137255 0.344538 0.316527 0.201681 0.179272 0.176471 0.417367 0.226891 0.145658 0.170868 0.411765 0.271709 0.058824 0.092437 0.067227 0.781513 0.176471 0.070028 0.742297 0.011204 0.498599 0.277311 0.053221 0.170868 0.095238 0.750700 0.005602 0.148459 0.128852 0.809524 0.000000 0.061625 0.075630 0.252101 0.000000 0.672269 0.168067 0.263305 0.380952 0.187675 Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif 0.168067 0.380952 0.263305 0.187675 0.672269 0.252101 0.000000 0.075630 0.128852 0.000000 0.809524 0.061625 0.095238 0.005602 0.750700 0.148459 0.170868 0.277311 0.053221 0.498599 0.176471 0.742297 0.070028 0.011204 0.781513 0.092437 0.067227 0.058824 0.145658 0.411765 0.170868 0.271709 0.179272 0.417367 0.176471 0.226891 0.137255 0.316527 0.344538 0.201681 0.053221 0.002801 0.000000 0.943978 0.000000 0.000000 1.000000 0.000000 0.817927 0.053221 0.092437 0.036415 0.050420 0.893557 0.056022 0.000000 0.075630 0.770308 0.000000 0.154062 0.005602 0.042017 0.431373 0.521008 0.299720 0.142857 0.114846 0.442577 0.218487 0.176471 0.450980 0.154062 Consensus sequence: BAGGYCABHBTGACCKHV Alignment: VHRGGTCABDBTGMCCTB --RGGBCAAAGKYCA--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 17 TgTGgTGTCACAGTGCTCC Original Motif Original Motif Backward 3 13 0.068134 Original motif 0.111111 0.083333 0.055556 0.750000 0.125000 0.097222 0.652778 0.125000 0.041667 0.097222 0.027778 0.833333 0.027778 0.027778 0.791667 0.152778 0.055556 0.166667 0.652778 0.125000 0.000000 0.041667 0.013889 0.944444 0.041667 0.000000 0.888889 0.069444 0.027778 0.027778 0.000000 0.944444 0.041667 0.944444 0.013889 0.000000 0.916667 0.027778 0.000000 0.055556 0.069444 0.875000 0.000000 0.055556 0.833333 0.013889 0.013889 0.138889 0.041667 0.069444 0.819444 0.069444 0.027778 0.027778 0.027778 0.916667 0.069444 0.013889 0.847222 0.069444 0.069444 0.777778 0.027778 0.125000 0.055556 0.041667 0.027778 0.875000 0.041667 0.708333 0.125000 0.125000 0.111111 0.819444 0.055556 0.013889 Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif 0.111111 0.055556 0.819444 0.013889 0.041667 0.125000 0.708333 0.125000 0.875000 0.041667 0.027778 0.055556 0.069444 0.027778 0.777778 0.125000 0.069444 0.847222 0.013889 0.069444 0.916667 0.027778 0.027778 0.027778 0.041667 0.819444 0.069444 0.069444 0.138889 0.013889 0.013889 0.833333 0.069444 0.000000 0.875000 0.055556 0.055556 0.027778 0.000000 0.916667 0.041667 0.013889 0.944444 0.000000 0.944444 0.027778 0.000000 0.027778 0.041667 0.888889 0.000000 0.069444 0.944444 0.041667 0.013889 0.000000 0.055556 0.652778 0.166667 0.125000 0.027778 0.791667 0.027778 0.152778 0.833333 0.097222 0.027778 0.041667 0.125000 0.652778 0.097222 0.125000 0.750000 0.083333 0.055556 0.111111 Consensus sequence: GGAGCACTGTGACACCACA Alignment: TGTGGTGTCACAGTGCTCC ----RGGBCAAAGKYCA-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 3 ESR1 Original Motif Reverse Complement Forward 1 13 0.071114 Original motif 0.261242 0.256959 0.329764 0.152034 0.228632 0.170940 0.350427 0.250000 0.136752 0.369658 0.318376 0.175214 0.176596 0.487234 0.138298 0.197872 0.285106 0.493617 0.100000 0.121277 0.651163 0.059197 0.188161 0.101480 0.075949 0.016878 0.816456 0.090717 0.040000 0.037895 0.884211 0.037895 0.069474 0.086316 0.191579 0.652632 0.008421 0.829474 0.111579 0.050526 0.837895 0.027368 0.056842 0.077895 0.122105 0.526316 0.225263 0.126316 0.132632 0.581053 0.111579 0.174737 0.134737 0.543158 0.204211 0.117895 0.067368 0.040000 0.016842 0.875789 0.044211 0.046316 0.896842 0.012632 0.642105 0.223158 0.065263 0.069474 0.021053 0.917895 0.025263 0.035789 0.124211 0.743158 0.004211 0.128421 0.054737 0.347368 0.046316 0.551579 Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif 0.551579 0.347368 0.046316 0.054737 0.124211 0.004211 0.743158 0.128421 0.021053 0.025263 0.917895 0.035789 0.069474 0.223158 0.065263 0.642105 0.044211 0.896842 0.046316 0.012632 0.875789 0.040000 0.016842 0.067368 0.134737 0.204211 0.543158 0.117895 0.132632 0.111579 0.581053 0.174737 0.122105 0.225263 0.526316 0.126316 0.077895 0.027368 0.056842 0.837895 0.008421 0.111579 0.829474 0.050526 0.652632 0.086316 0.191579 0.069474 0.040000 0.884211 0.037895 0.037895 0.075949 0.816456 0.016878 0.090717 0.101480 0.059197 0.188161 0.651163 0.285106 0.100000 0.493617 0.121277 0.176596 0.138298 0.487234 0.197872 0.136752 0.318376 0.369658 0.175214 0.228632 0.350427 0.170940 0.250000 0.261242 0.329764 0.256959 0.152034 Consensus sequence: MGGTCAGGGTGACCTRDBHV Alignment: MGGTCAGGGTGACCTRDBHV RGGBCAAAGKYCA------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 7 REST Reverse Complement Reverse Complement Backward 4 13 0.074192 Original motif 0.132621 0.109365 0.230044 0.527970 0.036318 0.168441 0.091421 0.703820 0.047589 0.855354 0.031309 0.065748 0.906367 0.018727 0.058677 0.016230 0.021197 0.027431 0.945137 0.006234 0.076012 0.609346 0.201246 0.113396 0.980697 0.004359 0.007472 0.007472 0.001868 0.987547 0.007472 0.003113 0.021793 0.922167 0.012453 0.043587 0.568847 0.125234 0.100935 0.204984 0.136534 0.233791 0.077307 0.552369 0.024314 0.004364 0.966958 0.004364 0.012469 0.003117 0.983167 0.001247 0.877105 0.069869 0.021210 0.031815 0.008125 0.800000 0.145625 0.046250 0.983750 0.005625 0.004375 0.006250 0.026349 0.008156 0.959849 0.005646 0.128688 0.632141 0.114878 0.124294 0.229899 0.019472 0.432161 0.318467 0.133962 0.586792 0.200629 0.078616 0.112579 0.700629 0.023270 0.163522 Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif 0.112579 0.023270 0.700629 0.163522 0.133962 0.200629 0.586792 0.078616 0.229899 0.432161 0.019472 0.318467 0.128688 0.114878 0.632141 0.124294 0.026349 0.959849 0.008156 0.005646 0.006250 0.005625 0.004375 0.983750 0.008125 0.145625 0.800000 0.046250 0.031815 0.069869 0.021210 0.877105 0.012469 0.983167 0.003117 0.001247 0.024314 0.966958 0.004364 0.004364 0.552369 0.233791 0.077307 0.136534 0.204984 0.125234 0.100935 0.568847 0.021793 0.012453 0.922167 0.043587 0.001868 0.007472 0.987547 0.003113 0.007472 0.004359 0.007472 0.980697 0.076012 0.201246 0.609346 0.113396 0.021197 0.945137 0.027431 0.006234 0.016230 0.018727 0.058677 0.906367 0.047589 0.031309 0.855354 0.065748 0.703820 0.168441 0.091421 0.036318 0.527970 0.109365 0.230044 0.132621 Consensus sequence: GGYGCTGTCCATGGTGCTGAA Alignment: GGYGCTGTCCATGGTGCTGAA -----TGMYCTTTGBCCK--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 27 AgTGCTCCACTGTGgTGTCACAgT Original Motif Reverse Complement Backward 6 13 0.079910 Original motif 0.690141 0.126761 0.042254 0.140845 0.169014 0.098592 0.676056 0.056338 0.042254 0.028169 0.028169 0.901408 0.056338 0.000000 0.774648 0.169014 0.042254 0.887324 0.042254 0.028169 0.000000 0.014085 0.000000 0.985915 0.056338 0.830986 0.042254 0.070423 0.028169 0.957746 0.014085 0.000000 0.957746 0.000000 0.014085 0.028169 0.084507 0.845070 0.014085 0.056338 0.028169 0.014085 0.000000 0.957746 0.140845 0.028169 0.802817 0.028169 0.014085 0.014085 0.014085 0.957746 0.014085 0.000000 0.929577 0.056338 0.056338 0.154930 0.619718 0.169014 0.014085 0.028169 0.000000 0.957746 0.056338 0.014085 0.873239 0.056338 0.014085 0.000000 0.000000 0.985915 0.042254 0.929577 0.000000 0.028169 0.957746 0.028169 0.000000 0.014085 0.028169 0.845070 0.028169 0.098592 0.873239 0.014085 0.042254 0.070423 0.098592 0.154930 0.563380 0.183099 0.070423 0.014085 0.112676 0.802817 Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif 0.802817 0.014085 0.112676 0.070423 0.098592 0.563380 0.154930 0.183099 0.070423 0.014085 0.042254 0.873239 0.028169 0.028169 0.845070 0.098592 0.014085 0.028169 0.000000 0.957746 0.042254 0.000000 0.929577 0.028169 0.985915 0.000000 0.000000 0.014085 0.056338 0.873239 0.014085 0.056338 0.957746 0.028169 0.000000 0.014085 0.056338 0.619718 0.154930 0.169014 0.014085 0.929577 0.000000 0.056338 0.957746 0.014085 0.014085 0.014085 0.140845 0.802817 0.028169 0.028169 0.957746 0.014085 0.000000 0.028169 0.084507 0.014085 0.845070 0.056338 0.028169 0.000000 0.014085 0.957746 0.028169 0.014085 0.957746 0.000000 0.056338 0.042254 0.830986 0.070423 0.985915 0.014085 0.000000 0.000000 0.042254 0.042254 0.887324 0.028169 0.056338 0.774648 0.000000 0.169014 0.901408 0.028169 0.028169 0.042254 0.169014 0.676056 0.098592 0.056338 0.140845 0.126761 0.042254 0.690141 Consensus sequence: ACTGTGACACCACAGTGGAGCACT Alignment: ACTGTGACACCACAGTGGAGCACT ------RGGBCAAAGKYCA----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 16 CTCF Original Motif Original Motif Forward 4 13 0.085064 Original motif 0.095290 0.318729 0.083242 0.502738 0.182913 0.158817 0.453450 0.204819 0.307777 0.053669 0.491785 0.146769 0.061336 0.876232 0.023001 0.039430 0.008762 0.989047 0.000000 0.002191 0.814896 0.014239 0.071194 0.099671 0.043812 0.578313 0.365827 0.012048 0.117325 0.474781 0.052632 0.355263 0.933114 0.012061 0.035088 0.019737 0.005488 0.000000 0.991218 0.003293 0.365532 0.003293 0.621295 0.009879 0.059276 0.013172 0.553238 0.374314 0.013187 0.000000 0.978022 0.008791 0.061538 0.008791 0.851648 0.078022 0.114411 0.806381 0.005501 0.073707 0.409241 0.014301 0.557756 0.018702 0.090308 0.530837 0.338106 0.040749 0.128855 0.354626 0.080396 0.436123 0.442731 0.199339 0.292952 0.064978 Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif 0.064978 0.199339 0.292952 0.442731 0.436123 0.354626 0.080396 0.128855 0.090308 0.338106 0.530837 0.040749 0.409241 0.557756 0.014301 0.018702 0.114411 0.005501 0.806381 0.073707 0.061538 0.851648 0.008791 0.078022 0.013187 0.978022 0.000000 0.008791 0.059276 0.553238 0.013172 0.374314 0.365532 0.621295 0.003293 0.009879 0.005488 0.991218 0.000000 0.003293 0.019737 0.012061 0.035088 0.933114 0.117325 0.052632 0.474781 0.355263 0.043812 0.365827 0.578313 0.012048 0.099671 0.014239 0.071194 0.814896 0.008762 0.000000 0.989047 0.002191 0.061336 0.023001 0.876232 0.039430 0.307777 0.491785 0.053669 0.146769 0.182913 0.453450 0.158817 0.204819 0.502738 0.318729 0.083242 0.095290 Consensus sequence: BMSMGCCYMCTKSTGGMHM Alignment: YDRCCASYAGRKGGCRSYV ---RGGBCAAAGKYCA--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 2 Motif name: NR2F1 Original motif 0.000000 0.000000 0.153846 0.846154 0.076923 0.000000 0.923077 0.000000 0.923077 0.000000 0.076923 0.000000 0.461538 0.538462 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.230769 0.000000 0.769231 0.000000 0.153846 0.000000 0.846154 0.076923 0.000000 0.000000 0.923077 0.153846 0.000000 0.846154 0.000000 0.461538 0.307692 0.230769 0.000000 0.461538 0.384615 0.076923 0.076923 0.076923 0.769231 0.076923 0.076923 0.230769 0.461538 0.000000 0.307692 0.000000 0.230769 0.230769 0.538462 Consensus sequence: TGAMCTTTGMMCYT Reserve complement motif 0.538462 0.230769 0.230769 0.000000 0.230769 0.000000 0.461538 0.307692 0.076923 0.076923 0.769231 0.076923 0.076923 0.384615 0.076923 0.461538 0.000000 0.307692 0.230769 0.461538 0.153846 0.846154 0.000000 0.000000 0.923077 0.000000 0.000000 0.076923 0.846154 0.153846 0.000000 0.000000 0.769231 0.230769 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.461538 0.000000 0.538462 0.000000 0.000000 0.000000 0.076923 0.923077 0.076923 0.923077 0.000000 0.000000 0.846154 0.000000 0.153846 0.000000 Consensus sequence: AKGYYCAAAGRTCA ************************************************************************ Best Matches for Motif ID 2 (Highest to Lowest) ************************************************************************ Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 10 NR1H2RXRA Original Motif Reverse Complement Backward 2 14 0.017459 Original motif 0.680000 0.200000 0.000000 0.120000 0.680000 0.040000 0.200000 0.080000 0.800000 0.000000 0.200000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.040000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.000000 0.040000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.800000 0.040000 0.080000 0.080000 0.000000 0.600000 0.240000 0.160000 Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif 0.000000 0.240000 0.600000 0.160000 0.080000 0.040000 0.080000 0.800000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.040000 0.000000 0.000000 0.960000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.040000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.200000 0.800000 0.080000 0.040000 0.200000 0.680000 0.120000 0.200000 0.000000 0.680000 Consensus sequence: GTTGACCTTTGACCTTT Alignment: GTTGACCTTTGACCTTT --TGAMCTTTGMMCYT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 14 PPARGRXRA Original Motif Reverse Complement Backward 2 14 0.027828 Original motif 0.109685 0.369895 0.373396 0.147025 0.117716 0.193473 0.148019 0.540793 0.453488 0.026744 0.427907 0.091860 0.116144 0.003484 0.779326 0.101045 0.161253 0.017401 0.781903 0.039443 0.168213 0.149652 0.458237 0.223898 0.082271 0.633835 0.207416 0.076477 0.949015 0.024334 0.017381 0.009270 0.604867 0.055620 0.312862 0.026651 0.825231 0.005787 0.158565 0.010417 0.095017 0.002317 0.888760 0.013905 0.047509 0.010429 0.803013 0.139050 0.025492 0.114716 0.304751 0.555041 0.062645 0.643852 0.167053 0.126450 0.784223 0.067285 0.054524 0.093968 Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif 0.093968 0.067285 0.054524 0.784223 0.062645 0.167053 0.643852 0.126450 0.555041 0.114716 0.304751 0.025492 0.047509 0.803013 0.010429 0.139050 0.095017 0.888760 0.002317 0.013905 0.010417 0.005787 0.158565 0.825231 0.026651 0.055620 0.312862 0.604867 0.009270 0.024334 0.017381 0.949015 0.082271 0.207416 0.633835 0.076477 0.168213 0.458237 0.149652 0.223898 0.161253 0.781903 0.017401 0.039443 0.116144 0.779326 0.003484 0.101045 0.091860 0.026744 0.427907 0.453488 0.540793 0.193473 0.148019 0.117716 0.109685 0.373396 0.369895 0.147025 Consensus sequence: TGRCCTKTGHCCKAB Alignment: TGRCCTKTGHCCKAB TGAMCTTTGMMCYT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 22 CACTGTGrYrtCACAGTGswsCAcT Original Motif Reverse Complement Backward 7 14 0.059765 Original motif 0.111111 0.746032 0.063492 0.079365 0.857143 0.047619 0.047619 0.047619 0.047619 0.857143 0.079365 0.015873 0.031746 0.000000 0.000000 0.968254 0.031746 0.015873 0.904762 0.047619 0.000000 0.000000 0.000000 1.000000 0.031746 0.000000 0.857143 0.111111 0.396825 0.111111 0.412698 0.079365 0.031746 0.253968 0.015873 0.698413 0.365079 0.000000 0.634921 0.000000 0.079365 0.206349 0.047619 0.666667 0.047619 0.936508 0.015873 0.000000 0.952381 0.000000 0.015873 0.031746 0.015873 0.920635 0.000000 0.063492 0.920635 0.000000 0.000000 0.079365 0.063492 0.047619 0.841270 0.047619 0.000000 0.000000 0.015873 0.984127 0.047619 0.015873 0.904762 0.031746 0.015873 0.603175 0.317460 0.063492 0.396825 0.000000 0.015873 0.587302 0.015873 0.476190 0.428571 0.079365 0.063492 0.920635 0.000000 0.015873 0.920635 0.015873 0.047619 0.015873 0.095238 0.682540 0.095238 0.126984 0.047619 0.015873 0.095238 0.841270 Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif 0.841270 0.015873 0.095238 0.047619 0.095238 0.095238 0.682540 0.126984 0.015873 0.015873 0.047619 0.920635 0.063492 0.000000 0.920635 0.015873 0.015873 0.428571 0.476190 0.079365 0.587302 0.000000 0.015873 0.396825 0.015873 0.317460 0.603175 0.063492 0.047619 0.904762 0.015873 0.031746 0.984127 0.000000 0.015873 0.000000 0.063492 0.841270 0.047619 0.047619 0.079365 0.000000 0.000000 0.920635 0.015873 0.000000 0.920635 0.063492 0.031746 0.000000 0.015873 0.952381 0.047619 0.015873 0.936508 0.000000 0.666667 0.206349 0.047619 0.079365 0.365079 0.634921 0.000000 0.000000 0.698413 0.253968 0.015873 0.031746 0.396825 0.412698 0.111111 0.079365 0.031746 0.857143 0.000000 0.111111 1.000000 0.000000 0.000000 0.000000 0.031746 0.904762 0.015873 0.047619 0.968254 0.000000 0.000000 0.031746 0.047619 0.079365 0.857143 0.015873 0.047619 0.047619 0.047619 0.857143 0.111111 0.063492 0.746032 0.079365 Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG Alignment: AGTGSWSCACTGTGAMAMCACAGTG -----TGAMCTTTGMMCYT------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 9 ESR2 Original Motif Reverse Complement Backward 2 14 0.071047 Original motif 0.218487 0.450980 0.176471 0.154062 0.442577 0.142857 0.114846 0.299720 0.521008 0.042017 0.431373 0.005602 0.075630 0.000000 0.770308 0.154062 0.050420 0.056022 0.893557 0.000000 0.036415 0.053221 0.092437 0.817927 0.000000 1.000000 0.000000 0.000000 0.943978 0.002801 0.000000 0.053221 0.137255 0.344538 0.316527 0.201681 0.179272 0.176471 0.417367 0.226891 0.145658 0.170868 0.411765 0.271709 0.058824 0.092437 0.067227 0.781513 0.176471 0.070028 0.742297 0.011204 0.498599 0.277311 0.053221 0.170868 0.095238 0.750700 0.005602 0.148459 0.128852 0.809524 0.000000 0.061625 0.075630 0.252101 0.000000 0.672269 0.168067 0.263305 0.380952 0.187675 Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif 0.168067 0.380952 0.263305 0.187675 0.672269 0.252101 0.000000 0.075630 0.128852 0.000000 0.809524 0.061625 0.095238 0.005602 0.750700 0.148459 0.170868 0.277311 0.053221 0.498599 0.176471 0.742297 0.070028 0.011204 0.781513 0.092437 0.067227 0.058824 0.145658 0.411765 0.170868 0.271709 0.179272 0.417367 0.176471 0.226891 0.137255 0.316527 0.344538 0.201681 0.053221 0.002801 0.000000 0.943978 0.000000 0.000000 1.000000 0.000000 0.817927 0.053221 0.092437 0.036415 0.050420 0.893557 0.056022 0.000000 0.075630 0.770308 0.000000 0.154062 0.005602 0.042017 0.431373 0.521008 0.299720 0.142857 0.114846 0.442577 0.218487 0.176471 0.450980 0.154062 Consensus sequence: BAGGYCABHBTGACCKHV Alignment: BAGGYCABHBTGACCKHV ---TGAMCTTTGMMCYT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 7 REST Reverse Complement Original Motif Backward 6 14 0.071796 Original motif 0.132621 0.109365 0.230044 0.527970 0.036318 0.168441 0.091421 0.703820 0.047589 0.855354 0.031309 0.065748 0.906367 0.018727 0.058677 0.016230 0.021197 0.027431 0.945137 0.006234 0.076012 0.609346 0.201246 0.113396 0.980697 0.004359 0.007472 0.007472 0.001868 0.987547 0.007472 0.003113 0.021793 0.922167 0.012453 0.043587 0.568847 0.125234 0.100935 0.204984 0.136534 0.233791 0.077307 0.552369 0.024314 0.004364 0.966958 0.004364 0.012469 0.003117 0.983167 0.001247 0.877105 0.069869 0.021210 0.031815 0.008125 0.800000 0.145625 0.046250 0.983750 0.005625 0.004375 0.006250 0.026349 0.008156 0.959849 0.005646 0.128688 0.632141 0.114878 0.124294 0.229899 0.019472 0.432161 0.318467 0.133962 0.586792 0.200629 0.078616 0.112579 0.700629 0.023270 0.163522 Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif 0.112579 0.023270 0.700629 0.163522 0.133962 0.200629 0.586792 0.078616 0.229899 0.432161 0.019472 0.318467 0.128688 0.114878 0.632141 0.124294 0.026349 0.959849 0.008156 0.005646 0.006250 0.005625 0.004375 0.983750 0.008125 0.145625 0.800000 0.046250 0.031815 0.069869 0.021210 0.877105 0.012469 0.983167 0.003117 0.001247 0.024314 0.966958 0.004364 0.004364 0.552369 0.233791 0.077307 0.136534 0.204984 0.125234 0.100935 0.568847 0.021793 0.012453 0.922167 0.043587 0.001868 0.007472 0.987547 0.003113 0.007472 0.004359 0.007472 0.980697 0.076012 0.201246 0.609346 0.113396 0.021197 0.945137 0.027431 0.006234 0.016230 0.018727 0.058677 0.906367 0.047589 0.031309 0.855354 0.065748 0.703820 0.168441 0.091421 0.036318 0.527970 0.109365 0.230044 0.132621 Consensus sequence: GGYGCTGTCCATGGTGCTGAA Alignment: TTCAGCACCATGGACAGCKCC --AKGYYCAAAGRTCA----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 23 TGGAGCACTGTGACAcCACAGTGg Original Motif Original Motif Backward 8 14 0.073728 Original motif 0.054054 0.040541 0.054054 0.851351 0.040541 0.013514 0.824324 0.121622 0.094595 0.135135 0.756757 0.013514 0.891892 0.000000 0.000000 0.108108 0.040541 0.094595 0.810811 0.054054 0.081081 0.797297 0.054054 0.067568 0.932432 0.027027 0.000000 0.040541 0.054054 0.756757 0.135135 0.054054 0.108108 0.027027 0.013514 0.851351 0.108108 0.000000 0.851351 0.040541 0.013514 0.000000 0.027027 0.959459 0.000000 0.013514 0.945946 0.040541 0.905405 0.000000 0.067568 0.027027 0.054054 0.837838 0.000000 0.108108 0.945946 0.013514 0.040541 0.000000 0.162162 0.500000 0.189189 0.148649 0.108108 0.824324 0.000000 0.067568 0.945946 0.000000 0.040541 0.013514 0.081081 0.837838 0.027027 0.054054 0.945946 0.000000 0.013514 0.040541 0.054054 0.067568 0.783784 0.094595 0.054054 0.027027 0.000000 0.918919 0.040541 0.013514 0.864865 0.081081 0.148649 0.121622 0.675676 0.054054 Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif 0.148649 0.675676 0.121622 0.054054 0.040541 0.864865 0.013514 0.081081 0.918919 0.027027 0.000000 0.054054 0.054054 0.783784 0.067568 0.094595 0.040541 0.000000 0.013514 0.945946 0.081081 0.027027 0.837838 0.054054 0.013514 0.000000 0.040541 0.945946 0.108108 0.000000 0.824324 0.067568 0.162162 0.189189 0.500000 0.148649 0.000000 0.013514 0.040541 0.945946 0.054054 0.000000 0.837838 0.108108 0.027027 0.000000 0.067568 0.905405 0.000000 0.945946 0.013514 0.040541 0.959459 0.000000 0.027027 0.013514 0.108108 0.851351 0.000000 0.040541 0.851351 0.027027 0.013514 0.108108 0.054054 0.135135 0.756757 0.054054 0.040541 0.027027 0.000000 0.932432 0.081081 0.054054 0.797297 0.067568 0.040541 0.810811 0.094595 0.054054 0.108108 0.000000 0.000000 0.891892 0.094595 0.756757 0.135135 0.013514 0.040541 0.824324 0.013514 0.121622 0.851351 0.040541 0.054054 0.054054 Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA Alignment: TGGAGCACTGTGACAVCACAGTGG ---TGAMCTTTGMMCYT------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 17 TgTGgTGTCACAGTGCTCC Original Motif Reverse Complement Backward 4 14 0.073970 Original motif 0.111111 0.083333 0.055556 0.750000 0.125000 0.097222 0.652778 0.125000 0.041667 0.097222 0.027778 0.833333 0.027778 0.027778 0.791667 0.152778 0.055556 0.166667 0.652778 0.125000 0.000000 0.041667 0.013889 0.944444 0.041667 0.000000 0.888889 0.069444 0.027778 0.027778 0.000000 0.944444 0.041667 0.944444 0.013889 0.000000 0.916667 0.027778 0.000000 0.055556 0.069444 0.875000 0.000000 0.055556 0.833333 0.013889 0.013889 0.138889 0.041667 0.069444 0.819444 0.069444 0.027778 0.027778 0.027778 0.916667 0.069444 0.013889 0.847222 0.069444 0.069444 0.777778 0.027778 0.125000 0.055556 0.041667 0.027778 0.875000 0.041667 0.708333 0.125000 0.125000 0.111111 0.819444 0.055556 0.013889 Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif 0.111111 0.055556 0.819444 0.013889 0.041667 0.125000 0.708333 0.125000 0.875000 0.041667 0.027778 0.055556 0.069444 0.027778 0.777778 0.125000 0.069444 0.847222 0.013889 0.069444 0.916667 0.027778 0.027778 0.027778 0.041667 0.819444 0.069444 0.069444 0.138889 0.013889 0.013889 0.833333 0.069444 0.000000 0.875000 0.055556 0.055556 0.027778 0.000000 0.916667 0.041667 0.013889 0.944444 0.000000 0.944444 0.027778 0.000000 0.027778 0.041667 0.888889 0.000000 0.069444 0.944444 0.041667 0.013889 0.000000 0.055556 0.652778 0.166667 0.125000 0.027778 0.791667 0.027778 0.152778 0.833333 0.097222 0.027778 0.041667 0.125000 0.652778 0.097222 0.125000 0.750000 0.083333 0.055556 0.111111 Consensus sequence: GGAGCACTGTGACACCACA Alignment: GGAGCACTGTGACACCACA --TGAMCTTTGMMCYT--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 1 HNF4A Original Motif Reverse Complement Backward 1 13 0.514048 Original motif 0.417910 0.104478 0.402985 0.074627 0.029851 0.029851 0.835821 0.104478 0.179104 0.059701 0.522388 0.238806 0.074627 0.343284 0.298507 0.283582 0.044776 0.761194 0.059701 0.134328 0.880597 0.014925 0.044776 0.059701 0.791045 0.029851 0.149254 0.029851 0.835821 0.014925 0.119403 0.029851 0.059701 0.059701 0.865672 0.014925 0.089552 0.029851 0.492537 0.388060 0.044776 0.328358 0.164179 0.462687 0.059701 0.731343 0.074627 0.134328 0.626866 0.104478 0.149254 0.119403 Consensus sequence: RGGBCAAAGKYCA Reverse complement motif 0.119403 0.104478 0.149254 0.626866 0.059701 0.074627 0.731343 0.134328 0.462687 0.328358 0.164179 0.044776 0.089552 0.492537 0.029851 0.388060 0.059701 0.865672 0.059701 0.014925 0.029851 0.014925 0.119403 0.835821 0.029851 0.029851 0.149254 0.791045 0.059701 0.014925 0.044776 0.880597 0.044776 0.059701 0.761194 0.134328 0.074627 0.298507 0.343284 0.283582 0.179104 0.522388 0.059701 0.238806 0.029851 0.835821 0.029851 0.104478 0.074627 0.104478 0.402985 0.417910 Consensus sequence: TGMYCTTTGBCCK Alignment: -TGMYCTTTGBCCK TGAMCTTTGMMCYT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 3 ESR1 Original Motif Original Motif Forward 8 13 0.569869 Original motif 0.261242 0.256959 0.329764 0.152034 0.228632 0.170940 0.350427 0.250000 0.136752 0.369658 0.318376 0.175214 0.176596 0.487234 0.138298 0.197872 0.285106 0.493617 0.100000 0.121277 0.651163 0.059197 0.188161 0.101480 0.075949 0.016878 0.816456 0.090717 0.040000 0.037895 0.884211 0.037895 0.069474 0.086316 0.191579 0.652632 0.008421 0.829474 0.111579 0.050526 0.837895 0.027368 0.056842 0.077895 0.122105 0.526316 0.225263 0.126316 0.132632 0.581053 0.111579 0.174737 0.134737 0.543158 0.204211 0.117895 0.067368 0.040000 0.016842 0.875789 0.044211 0.046316 0.896842 0.012632 0.642105 0.223158 0.065263 0.069474 0.021053 0.917895 0.025263 0.035789 0.124211 0.743158 0.004211 0.128421 0.054737 0.347368 0.046316 0.551579 Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif 0.551579 0.347368 0.046316 0.054737 0.124211 0.004211 0.743158 0.128421 0.021053 0.025263 0.917895 0.035789 0.069474 0.223158 0.065263 0.642105 0.044211 0.896842 0.046316 0.012632 0.875789 0.040000 0.016842 0.067368 0.134737 0.204211 0.543158 0.117895 0.132632 0.111579 0.581053 0.174737 0.122105 0.225263 0.526316 0.126316 0.077895 0.027368 0.056842 0.837895 0.008421 0.111579 0.829474 0.050526 0.652632 0.086316 0.191579 0.069474 0.040000 0.884211 0.037895 0.037895 0.075949 0.816456 0.016878 0.090717 0.101480 0.059197 0.188161 0.651163 0.285106 0.100000 0.493617 0.121277 0.176596 0.138298 0.487234 0.197872 0.136752 0.318376 0.369658 0.175214 0.228632 0.350427 0.170940 0.250000 0.261242 0.329764 0.256959 0.152034 Consensus sequence: MGGTCAGGGTGACCTRDBHV Alignment: VDBHMAGGTCACCCTGACCY- -------TGAMCTTTGMMCYT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 4 Esrrb Reverse Complement Original Motif Backward 1 12 1.030295 Original motif 0.290198 0.220264 0.271200 0.218337 0.184941 0.227810 0.376477 0.210772 0.115226 0.332236 0.331687 0.220850 0.070959 0.342466 0.122740 0.463836 0.084862 0.729264 0.171640 0.014235 0.909737 0.008753 0.067834 0.013676 0.975656 0.000547 0.016411 0.007385 0.008758 0.001368 0.981390 0.008484 0.005750 0.003286 0.986309 0.004655 0.049904 0.012613 0.066904 0.870579 0.002473 0.927473 0.046703 0.023352 0.951569 0.005504 0.035498 0.007430 Consensus sequence: VBBYCAAGGTCA Reverse complement motif 0.007430 0.005504 0.035498 0.951569 0.002473 0.046703 0.927473 0.023352 0.870579 0.012613 0.066904 0.049904 0.005750 0.986309 0.003286 0.004655 0.008758 0.981390 0.001368 0.008484 0.007385 0.000547 0.016411 0.975656 0.013676 0.008753 0.067834 0.909737 0.084862 0.171640 0.729264 0.014235 0.463836 0.342466 0.122740 0.070959 0.115226 0.331687 0.332236 0.220850 0.184941 0.376477 0.227810 0.210772 0.218337 0.220264 0.271200 0.290198 Consensus sequence: TGACCTTGMBBB Alignment: --VBBYCAAGGTCA AKGYYCAAAGRTCA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 3 Motif name: ESR1 Original motif 0.261242 0.256959 0.329764 0.152034 0.228632 0.170940 0.350427 0.250000 0.136752 0.369658 0.318376 0.175214 0.176596 0.487234 0.138298 0.197872 0.285106 0.493617 0.100000 0.121277 0.651163 0.059197 0.188161 0.101480 0.075949 0.016878 0.816456 0.090717 0.040000 0.037895 0.884211 0.037895 0.069474 0.086316 0.191579 0.652632 0.008421 0.829474 0.111579 0.050526 0.837895 0.027368 0.056842 0.077895 0.122105 0.526316 0.225263 0.126316 0.132632 0.581053 0.111579 0.174737 0.134737 0.543158 0.204211 0.117895 0.067368 0.040000 0.016842 0.875789 0.044211 0.046316 0.896842 0.012632 0.642105 0.223158 0.065263 0.069474 0.021053 0.917895 0.025263 0.035789 0.124211 0.743158 0.004211 0.128421 0.054737 0.347368 0.046316 0.551579 Consensus sequence: VDBHMAGGTCACCCTGACCY Reserve complement motif 0.551579 0.347368 0.046316 0.054737 0.124211 0.004211 0.743158 0.128421 0.021053 0.025263 0.917895 0.035789 0.069474 0.223158 0.065263 0.642105 0.044211 0.896842 0.046316 0.012632 0.875789 0.040000 0.016842 0.067368 0.134737 0.204211 0.543158 0.117895 0.132632 0.111579 0.581053 0.174737 0.122105 0.225263 0.526316 0.126316 0.077895 0.027368 0.056842 0.837895 0.008421 0.111579 0.829474 0.050526 0.652632 0.086316 0.191579 0.069474 0.040000 0.884211 0.037895 0.037895 0.075949 0.816456 0.016878 0.090717 0.101480 0.059197 0.188161 0.651163 0.285106 0.100000 0.493617 0.121277 0.176596 0.138298 0.487234 0.197872 0.136752 0.318376 0.369658 0.175214 0.228632 0.350427 0.170940 0.250000 0.261242 0.329764 0.256959 0.152034 Consensus sequence: MGGTCAGGGTGACCTRDBHV ************************************************************************ Best Matches for Motif ID 3 (Highest to Lowest) ************************************************************************ Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 23 TGGAGCACTGTGACAcCACAGTGg Original Motif Reverse Complement Backward 2 20 0.072259 Original motif 0.054054 0.040541 0.054054 0.851351 0.040541 0.013514 0.824324 0.121622 0.094595 0.135135 0.756757 0.013514 0.891892 0.000000 0.000000 0.108108 0.040541 0.094595 0.810811 0.054054 0.081081 0.797297 0.054054 0.067568 0.932432 0.027027 0.000000 0.040541 0.054054 0.756757 0.135135 0.054054 0.108108 0.027027 0.013514 0.851351 0.108108 0.000000 0.851351 0.040541 0.013514 0.000000 0.027027 0.959459 0.000000 0.013514 0.945946 0.040541 0.905405 0.000000 0.067568 0.027027 0.054054 0.837838 0.000000 0.108108 0.945946 0.013514 0.040541 0.000000 0.162162 0.500000 0.189189 0.148649 0.108108 0.824324 0.000000 0.067568 0.945946 0.000000 0.040541 0.013514 0.081081 0.837838 0.027027 0.054054 0.945946 0.000000 0.013514 0.040541 0.054054 0.067568 0.783784 0.094595 0.054054 0.027027 0.000000 0.918919 0.040541 0.013514 0.864865 0.081081 0.148649 0.121622 0.675676 0.054054 Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif 0.148649 0.675676 0.121622 0.054054 0.040541 0.864865 0.013514 0.081081 0.918919 0.027027 0.000000 0.054054 0.054054 0.783784 0.067568 0.094595 0.040541 0.000000 0.013514 0.945946 0.081081 0.027027 0.837838 0.054054 0.013514 0.000000 0.040541 0.945946 0.108108 0.000000 0.824324 0.067568 0.162162 0.189189 0.500000 0.148649 0.000000 0.013514 0.040541 0.945946 0.054054 0.000000 0.837838 0.108108 0.027027 0.000000 0.067568 0.905405 0.000000 0.945946 0.013514 0.040541 0.959459 0.000000 0.027027 0.013514 0.108108 0.851351 0.000000 0.040541 0.851351 0.027027 0.013514 0.108108 0.054054 0.135135 0.756757 0.054054 0.040541 0.027027 0.000000 0.932432 0.081081 0.054054 0.797297 0.067568 0.040541 0.810811 0.094595 0.054054 0.108108 0.000000 0.000000 0.891892 0.094595 0.756757 0.135135 0.013514 0.040541 0.824324 0.013514 0.121622 0.851351 0.040541 0.054054 0.054054 Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA Alignment: CCACTGTGVTGTCACAGTGCTCCA ---VDBHMAGGTCACCCTGACCY- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 22 CACTGTGrYrtCACAGTGswsCAcT Original Motif Original Motif Forward 3 20 0.081897 Original motif 0.111111 0.746032 0.063492 0.079365 0.857143 0.047619 0.047619 0.047619 0.047619 0.857143 0.079365 0.015873 0.031746 0.000000 0.000000 0.968254 0.031746 0.015873 0.904762 0.047619 0.000000 0.000000 0.000000 1.000000 0.031746 0.000000 0.857143 0.111111 0.396825 0.111111 0.412698 0.079365 0.031746 0.253968 0.015873 0.698413 0.365079 0.000000 0.634921 0.000000 0.079365 0.206349 0.047619 0.666667 0.047619 0.936508 0.015873 0.000000 0.952381 0.000000 0.015873 0.031746 0.015873 0.920635 0.000000 0.063492 0.920635 0.000000 0.000000 0.079365 0.063492 0.047619 0.841270 0.047619 0.000000 0.000000 0.015873 0.984127 0.047619 0.015873 0.904762 0.031746 0.015873 0.603175 0.317460 0.063492 0.396825 0.000000 0.015873 0.587302 0.015873 0.476190 0.428571 0.079365 0.063492 0.920635 0.000000 0.015873 0.920635 0.015873 0.047619 0.015873 0.095238 0.682540 0.095238 0.126984 0.047619 0.015873 0.095238 0.841270 Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif 0.841270 0.015873 0.095238 0.047619 0.095238 0.095238 0.682540 0.126984 0.015873 0.015873 0.047619 0.920635 0.063492 0.000000 0.920635 0.015873 0.015873 0.428571 0.476190 0.079365 0.587302 0.000000 0.015873 0.396825 0.015873 0.317460 0.603175 0.063492 0.047619 0.904762 0.015873 0.031746 0.984127 0.000000 0.015873 0.000000 0.063492 0.841270 0.047619 0.047619 0.079365 0.000000 0.000000 0.920635 0.015873 0.000000 0.920635 0.063492 0.031746 0.000000 0.015873 0.952381 0.047619 0.015873 0.936508 0.000000 0.666667 0.206349 0.047619 0.079365 0.365079 0.634921 0.000000 0.000000 0.698413 0.253968 0.015873 0.031746 0.396825 0.412698 0.111111 0.079365 0.031746 0.857143 0.000000 0.111111 1.000000 0.000000 0.000000 0.000000 0.031746 0.904762 0.015873 0.047619 0.968254 0.000000 0.000000 0.031746 0.047619 0.079365 0.857143 0.015873 0.047619 0.047619 0.047619 0.857143 0.111111 0.063492 0.746032 0.079365 Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG Alignment: CACTGTGRTRTCACAGTGSWSCACT --VDBHMAGGTCACCCTGACCY--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 17 TgTGgTGTCACAGTGCTCC Original Motif Original Motif Backward 1 19 0.566376 Original motif 0.111111 0.083333 0.055556 0.750000 0.125000 0.097222 0.652778 0.125000 0.041667 0.097222 0.027778 0.833333 0.027778 0.027778 0.791667 0.152778 0.055556 0.166667 0.652778 0.125000 0.000000 0.041667 0.013889 0.944444 0.041667 0.000000 0.888889 0.069444 0.027778 0.027778 0.000000 0.944444 0.041667 0.944444 0.013889 0.000000 0.916667 0.027778 0.000000 0.055556 0.069444 0.875000 0.000000 0.055556 0.833333 0.013889 0.013889 0.138889 0.041667 0.069444 0.819444 0.069444 0.027778 0.027778 0.027778 0.916667 0.069444 0.013889 0.847222 0.069444 0.069444 0.777778 0.027778 0.125000 0.055556 0.041667 0.027778 0.875000 0.041667 0.708333 0.125000 0.125000 0.111111 0.819444 0.055556 0.013889 Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif 0.111111 0.055556 0.819444 0.013889 0.041667 0.125000 0.708333 0.125000 0.875000 0.041667 0.027778 0.055556 0.069444 0.027778 0.777778 0.125000 0.069444 0.847222 0.013889 0.069444 0.916667 0.027778 0.027778 0.027778 0.041667 0.819444 0.069444 0.069444 0.138889 0.013889 0.013889 0.833333 0.069444 0.000000 0.875000 0.055556 0.055556 0.027778 0.000000 0.916667 0.041667 0.013889 0.944444 0.000000 0.944444 0.027778 0.000000 0.027778 0.041667 0.888889 0.000000 0.069444 0.944444 0.041667 0.013889 0.000000 0.055556 0.652778 0.166667 0.125000 0.027778 0.791667 0.027778 0.152778 0.833333 0.097222 0.027778 0.041667 0.125000 0.652778 0.097222 0.125000 0.750000 0.083333 0.055556 0.111111 Consensus sequence: GGAGCACTGTGACACCACA Alignment: -TGTGGTGTCACAGTGCTCC VDBHMAGGTCACCCTGACCY ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 16 CTCF Original Motif Reverse Complement Backward 1 19 0.579928 Original motif 0.095290 0.318729 0.083242 0.502738 0.182913 0.158817 0.453450 0.204819 0.307777 0.053669 0.491785 0.146769 0.061336 0.876232 0.023001 0.039430 0.008762 0.989047 0.000000 0.002191 0.814896 0.014239 0.071194 0.099671 0.043812 0.578313 0.365827 0.012048 0.117325 0.474781 0.052632 0.355263 0.933114 0.012061 0.035088 0.019737 0.005488 0.000000 0.991218 0.003293 0.365532 0.003293 0.621295 0.009879 0.059276 0.013172 0.553238 0.374314 0.013187 0.000000 0.978022 0.008791 0.061538 0.008791 0.851648 0.078022 0.114411 0.806381 0.005501 0.073707 0.409241 0.014301 0.557756 0.018702 0.090308 0.530837 0.338106 0.040749 0.128855 0.354626 0.080396 0.436123 0.442731 0.199339 0.292952 0.064978 Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif 0.064978 0.199339 0.292952 0.442731 0.436123 0.354626 0.080396 0.128855 0.090308 0.338106 0.530837 0.040749 0.409241 0.557756 0.014301 0.018702 0.114411 0.005501 0.806381 0.073707 0.061538 0.851648 0.008791 0.078022 0.013187 0.978022 0.000000 0.008791 0.059276 0.553238 0.013172 0.374314 0.365532 0.621295 0.003293 0.009879 0.005488 0.991218 0.000000 0.003293 0.019737 0.012061 0.035088 0.933114 0.117325 0.052632 0.474781 0.355263 0.043812 0.365827 0.578313 0.012048 0.099671 0.014239 0.071194 0.814896 0.008762 0.000000 0.989047 0.002191 0.061336 0.023001 0.876232 0.039430 0.307777 0.491785 0.053669 0.146769 0.182913 0.453450 0.158817 0.204819 0.502738 0.318729 0.083242 0.095290 Consensus sequence: BMSMGCCYMCTKSTGGMHM Alignment: -BMSMGCCYMCTKSTGGMHM VDBHMAGGTCACCCTGACCY ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 9 ESR2 Original Motif Original Motif Backward 2 17 1.502873 Original motif 0.218487 0.450980 0.176471 0.154062 0.442577 0.142857 0.114846 0.299720 0.521008 0.042017 0.431373 0.005602 0.075630 0.000000 0.770308 0.154062 0.050420 0.056022 0.893557 0.000000 0.036415 0.053221 0.092437 0.817927 0.000000 1.000000 0.000000 0.000000 0.943978 0.002801 0.000000 0.053221 0.137255 0.344538 0.316527 0.201681 0.179272 0.176471 0.417367 0.226891 0.145658 0.170868 0.411765 0.271709 0.058824 0.092437 0.067227 0.781513 0.176471 0.070028 0.742297 0.011204 0.498599 0.277311 0.053221 0.170868 0.095238 0.750700 0.005602 0.148459 0.128852 0.809524 0.000000 0.061625 0.075630 0.252101 0.000000 0.672269 0.168067 0.263305 0.380952 0.187675 Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif 0.168067 0.380952 0.263305 0.187675 0.672269 0.252101 0.000000 0.075630 0.128852 0.000000 0.809524 0.061625 0.095238 0.005602 0.750700 0.148459 0.170868 0.277311 0.053221 0.498599 0.176471 0.742297 0.070028 0.011204 0.781513 0.092437 0.067227 0.058824 0.145658 0.411765 0.170868 0.271709 0.179272 0.417367 0.176471 0.226891 0.137255 0.316527 0.344538 0.201681 0.053221 0.002801 0.000000 0.943978 0.000000 0.000000 1.000000 0.000000 0.817927 0.053221 0.092437 0.036415 0.050420 0.893557 0.056022 0.000000 0.075630 0.770308 0.000000 0.154062 0.005602 0.042017 0.431373 0.521008 0.299720 0.142857 0.114846 0.442577 0.218487 0.176471 0.450980 0.154062 Consensus sequence: BAGGYCABHBTGACCKHV Alignment: ---VHRGGTCABDBTGMCCTB VDBHMAGGTCACCCTGACCY- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 7 REST Original Motif Original Motif Forward 6 16 2.074088 Original motif 0.132621 0.109365 0.230044 0.527970 0.036318 0.168441 0.091421 0.703820 0.047589 0.855354 0.031309 0.065748 0.906367 0.018727 0.058677 0.016230 0.021197 0.027431 0.945137 0.006234 0.076012 0.609346 0.201246 0.113396 0.980697 0.004359 0.007472 0.007472 0.001868 0.987547 0.007472 0.003113 0.021793 0.922167 0.012453 0.043587 0.568847 0.125234 0.100935 0.204984 0.136534 0.233791 0.077307 0.552369 0.024314 0.004364 0.966958 0.004364 0.012469 0.003117 0.983167 0.001247 0.877105 0.069869 0.021210 0.031815 0.008125 0.800000 0.145625 0.046250 0.983750 0.005625 0.004375 0.006250 0.026349 0.008156 0.959849 0.005646 0.128688 0.632141 0.114878 0.124294 0.229899 0.019472 0.432161 0.318467 0.133962 0.586792 0.200629 0.078616 0.112579 0.700629 0.023270 0.163522 Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif 0.112579 0.023270 0.700629 0.163522 0.133962 0.200629 0.586792 0.078616 0.229899 0.432161 0.019472 0.318467 0.128688 0.114878 0.632141 0.124294 0.026349 0.959849 0.008156 0.005646 0.006250 0.005625 0.004375 0.983750 0.008125 0.145625 0.800000 0.046250 0.031815 0.069869 0.021210 0.877105 0.012469 0.983167 0.003117 0.001247 0.024314 0.966958 0.004364 0.004364 0.552369 0.233791 0.077307 0.136534 0.204984 0.125234 0.100935 0.568847 0.021793 0.012453 0.922167 0.043587 0.001868 0.007472 0.987547 0.003113 0.007472 0.004359 0.007472 0.980697 0.076012 0.201246 0.609346 0.113396 0.021197 0.945137 0.027431 0.006234 0.016230 0.018727 0.058677 0.906367 0.047589 0.031309 0.855354 0.065748 0.703820 0.168441 0.091421 0.036318 0.527970 0.109365 0.230044 0.132621 Consensus sequence: GGYGCTGTCCATGGTGCTGAA Alignment: TTCAGCACCATGGACAGCKCC---- -----VDBHMAGGTCACCCTGACCY ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 21 AmTGTGACACCACAGT Original Motif Reverse Complement Forward 2 15 2.575172 Original motif 0.703125 0.187500 0.015625 0.093750 0.265625 0.500000 0.125000 0.109375 0.015625 0.046875 0.031250 0.906250 0.078125 0.015625 0.890625 0.015625 0.000000 0.000000 0.000000 1.000000 0.000000 0.031250 0.906250 0.062500 0.953125 0.000000 0.015625 0.031250 0.046875 0.890625 0.000000 0.062500 0.968750 0.000000 0.015625 0.015625 0.109375 0.781250 0.062500 0.046875 0.062500 0.890625 0.000000 0.046875 0.953125 0.000000 0.031250 0.015625 0.031250 0.781250 0.046875 0.140625 0.937500 0.015625 0.031250 0.015625 0.093750 0.078125 0.734375 0.093750 0.031250 0.078125 0.000000 0.890625 Consensus sequence: AMTGTGACACCACAGT Reverse complement motif 0.890625 0.078125 0.000000 0.031250 0.093750 0.734375 0.078125 0.093750 0.015625 0.015625 0.031250 0.937500 0.031250 0.046875 0.781250 0.140625 0.015625 0.000000 0.031250 0.953125 0.062500 0.000000 0.890625 0.046875 0.109375 0.062500 0.781250 0.046875 0.015625 0.000000 0.015625 0.968750 0.046875 0.000000 0.890625 0.062500 0.031250 0.000000 0.015625 0.953125 0.000000 0.906250 0.031250 0.062500 1.000000 0.000000 0.000000 0.000000 0.078125 0.890625 0.015625 0.015625 0.906250 0.046875 0.031250 0.015625 0.265625 0.125000 0.500000 0.109375 0.093750 0.187500 0.015625 0.703125 Consensus sequence: ACTGTGGTGTCACART Alignment: ACTGTGGTGTCACART----- -VDBHMAGGTCACCCTGACCY ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 27 AgTGCTCCACTGTGgTGTCACAgT Reverse Complement Reverse Complement Backward 10 15 2.575941 Original motif 0.690141 0.126761 0.042254 0.140845 0.169014 0.098592 0.676056 0.056338 0.042254 0.028169 0.028169 0.901408 0.056338 0.000000 0.774648 0.169014 0.042254 0.887324 0.042254 0.028169 0.000000 0.014085 0.000000 0.985915 0.056338 0.830986 0.042254 0.070423 0.028169 0.957746 0.014085 0.000000 0.957746 0.000000 0.014085 0.028169 0.084507 0.845070 0.014085 0.056338 0.028169 0.014085 0.000000 0.957746 0.140845 0.028169 0.802817 0.028169 0.014085 0.014085 0.014085 0.957746 0.014085 0.000000 0.929577 0.056338 0.056338 0.154930 0.619718 0.169014 0.014085 0.028169 0.000000 0.957746 0.056338 0.014085 0.873239 0.056338 0.014085 0.000000 0.000000 0.985915 0.042254 0.929577 0.000000 0.028169 0.957746 0.028169 0.000000 0.014085 0.028169 0.845070 0.028169 0.098592 0.873239 0.014085 0.042254 0.070423 0.098592 0.154930 0.563380 0.183099 0.070423 0.014085 0.112676 0.802817 Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif 0.802817 0.014085 0.112676 0.070423 0.098592 0.563380 0.154930 0.183099 0.070423 0.014085 0.042254 0.873239 0.028169 0.028169 0.845070 0.098592 0.014085 0.028169 0.000000 0.957746 0.042254 0.000000 0.929577 0.028169 0.985915 0.000000 0.000000 0.014085 0.056338 0.873239 0.014085 0.056338 0.957746 0.028169 0.000000 0.014085 0.056338 0.619718 0.154930 0.169014 0.014085 0.929577 0.000000 0.056338 0.957746 0.014085 0.014085 0.014085 0.140845 0.802817 0.028169 0.028169 0.957746 0.014085 0.000000 0.028169 0.084507 0.014085 0.845070 0.056338 0.028169 0.000000 0.014085 0.957746 0.028169 0.014085 0.957746 0.000000 0.056338 0.042254 0.830986 0.070423 0.985915 0.014085 0.000000 0.000000 0.042254 0.042254 0.887324 0.028169 0.056338 0.774648 0.000000 0.169014 0.901408 0.028169 0.028169 0.042254 0.169014 0.676056 0.098592 0.056338 0.140845 0.126761 0.042254 0.690141 Consensus sequence: ACTGTGACACCACAGTGGAGCACT Alignment: -----ACTGTGACACCACAGTGGAGCACT MGGTCAGGGTGACCTRDBHV--------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 14 PPARGRXRA Reverse Complement Original Motif Backward 2 14 3.070553 Original motif 0.109685 0.369895 0.373396 0.147025 0.117716 0.193473 0.148019 0.540793 0.453488 0.026744 0.427907 0.091860 0.116144 0.003484 0.779326 0.101045 0.161253 0.017401 0.781903 0.039443 0.168213 0.149652 0.458237 0.223898 0.082271 0.633835 0.207416 0.076477 0.949015 0.024334 0.017381 0.009270 0.604867 0.055620 0.312862 0.026651 0.825231 0.005787 0.158565 0.010417 0.095017 0.002317 0.888760 0.013905 0.047509 0.010429 0.803013 0.139050 0.025492 0.114716 0.304751 0.555041 0.062645 0.643852 0.167053 0.126450 0.784223 0.067285 0.054524 0.093968 Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif 0.093968 0.067285 0.054524 0.784223 0.062645 0.167053 0.643852 0.126450 0.555041 0.114716 0.304751 0.025492 0.047509 0.803013 0.010429 0.139050 0.095017 0.888760 0.002317 0.013905 0.010417 0.005787 0.158565 0.825231 0.026651 0.055620 0.312862 0.604867 0.009270 0.024334 0.017381 0.949015 0.082271 0.207416 0.633835 0.076477 0.168213 0.458237 0.149652 0.223898 0.161253 0.781903 0.017401 0.039443 0.116144 0.779326 0.003484 0.101045 0.091860 0.026744 0.427907 0.453488 0.540793 0.193473 0.148019 0.117716 0.109685 0.373396 0.369895 0.147025 Consensus sequence: TGRCCTKTGHCCKAB Alignment: ------BTRGGDCARAGGKCA MGGTCAGGGTGACCTRDBHV- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 10 NR1H2RXRA Original Motif Original Motif Forward 5 13 3.567799 Original motif 0.680000 0.200000 0.000000 0.120000 0.680000 0.040000 0.200000 0.080000 0.800000 0.000000 0.200000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.040000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.000000 0.040000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.800000 0.040000 0.080000 0.080000 0.000000 0.600000 0.240000 0.160000 Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif 0.000000 0.240000 0.600000 0.160000 0.080000 0.040000 0.080000 0.800000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.040000 0.000000 0.000000 0.960000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.040000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.200000 0.800000 0.080000 0.040000 0.200000 0.680000 0.120000 0.200000 0.000000 0.680000 Consensus sequence: GTTGACCTTTGACCTTT Alignment: AAAGGTCAAAGGTCAAC------- ----VDBHMAGGTCACCCTGACCY ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 4 Motif name: Esrrb Original motif 0.290198 0.220264 0.271200 0.218337 0.184941 0.227810 0.376477 0.210772 0.115226 0.332236 0.331687 0.220850 0.070959 0.342466 0.122740 0.463836 0.084862 0.729264 0.171640 0.014235 0.909737 0.008753 0.067834 0.013676 0.975656 0.000547 0.016411 0.007385 0.008758 0.001368 0.981390 0.008484 0.005750 0.003286 0.986309 0.004655 0.049904 0.012613 0.066904 0.870579 0.002473 0.927473 0.046703 0.023352 0.951569 0.005504 0.035498 0.007430 Consensus sequence: VBBYCAAGGTCA Reserve complement motif 0.007430 0.005504 0.035498 0.951569 0.002473 0.046703 0.927473 0.023352 0.870579 0.012613 0.066904 0.049904 0.005750 0.986309 0.003286 0.004655 0.008758 0.981390 0.001368 0.008484 0.007385 0.000547 0.016411 0.975656 0.013676 0.008753 0.067834 0.909737 0.084862 0.171640 0.729264 0.014235 0.463836 0.342466 0.122740 0.070959 0.115226 0.331687 0.332236 0.220850 0.184941 0.376477 0.227810 0.210772 0.218337 0.220264 0.271200 0.290198 Consensus sequence: TGACCTTGMBBB ************************************************************************ Best Matches for Motif ID 4 (Highest to Lowest) ************************************************************************ Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 2 NR2F1 Reverse Complement Original Motif Backward 1 12 0.044261 Original motif 0.000000 0.000000 0.153846 0.846154 0.076923 0.000000 0.923077 0.000000 0.923077 0.000000 0.076923 0.000000 0.461538 0.538462 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.230769 0.000000 0.769231 0.000000 0.153846 0.000000 0.846154 0.076923 0.000000 0.000000 0.923077 0.153846 0.000000 0.846154 0.000000 0.461538 0.307692 0.230769 0.000000 0.461538 0.384615 0.076923 0.076923 0.076923 0.769231 0.076923 0.076923 0.230769 0.461538 0.000000 0.307692 0.000000 0.230769 0.230769 0.538462 Consensus sequence: TGAMCTTTGMMCYT Reverse complement motif 0.538462 0.230769 0.230769 0.000000 0.230769 0.000000 0.461538 0.307692 0.076923 0.076923 0.769231 0.076923 0.076923 0.384615 0.076923 0.461538 0.000000 0.307692 0.230769 0.461538 0.153846 0.846154 0.000000 0.000000 0.923077 0.000000 0.000000 0.076923 0.846154 0.153846 0.000000 0.000000 0.769231 0.230769 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.461538 0.000000 0.538462 0.000000 0.000000 0.000000 0.076923 0.923077 0.076923 0.923077 0.000000 0.000000 0.846154 0.000000 0.153846 0.000000 Consensus sequence: AKGYYCAAAGRTCA Alignment: TGAMCTTTGMMCYT --TGACCTTGMBBB ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 14 PPARGRXRA Original Motif Original Motif Forward 4 12 0.046990 Original motif 0.109685 0.369895 0.373396 0.147025 0.117716 0.193473 0.148019 0.540793 0.453488 0.026744 0.427907 0.091860 0.116144 0.003484 0.779326 0.101045 0.161253 0.017401 0.781903 0.039443 0.168213 0.149652 0.458237 0.223898 0.082271 0.633835 0.207416 0.076477 0.949015 0.024334 0.017381 0.009270 0.604867 0.055620 0.312862 0.026651 0.825231 0.005787 0.158565 0.010417 0.095017 0.002317 0.888760 0.013905 0.047509 0.010429 0.803013 0.139050 0.025492 0.114716 0.304751 0.555041 0.062645 0.643852 0.167053 0.126450 0.784223 0.067285 0.054524 0.093968 Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif 0.093968 0.067285 0.054524 0.784223 0.062645 0.167053 0.643852 0.126450 0.555041 0.114716 0.304751 0.025492 0.047509 0.803013 0.010429 0.139050 0.095017 0.888760 0.002317 0.013905 0.010417 0.005787 0.158565 0.825231 0.026651 0.055620 0.312862 0.604867 0.009270 0.024334 0.017381 0.949015 0.082271 0.207416 0.633835 0.076477 0.168213 0.458237 0.149652 0.223898 0.161253 0.781903 0.017401 0.039443 0.116144 0.779326 0.003484 0.101045 0.091860 0.026744 0.427907 0.453488 0.540793 0.193473 0.148019 0.117716 0.109685 0.373396 0.369895 0.147025 Consensus sequence: TGRCCTKTGHCCKAB Alignment: BTRGGDCARAGGKCA ---VBBYCAAGGTCA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 1 HNF4A Original Motif Original Motif Backward 1 12 0.047081 Original motif 0.417910 0.104478 0.402985 0.074627 0.029851 0.029851 0.835821 0.104478 0.179104 0.059701 0.522388 0.238806 0.074627 0.343284 0.298507 0.283582 0.044776 0.761194 0.059701 0.134328 0.880597 0.014925 0.044776 0.059701 0.791045 0.029851 0.149254 0.029851 0.835821 0.014925 0.119403 0.029851 0.059701 0.059701 0.865672 0.014925 0.089552 0.029851 0.492537 0.388060 0.044776 0.328358 0.164179 0.462687 0.059701 0.731343 0.074627 0.134328 0.626866 0.104478 0.149254 0.119403 Consensus sequence: RGGBCAAAGKYCA Reverse complement motif 0.119403 0.104478 0.149254 0.626866 0.059701 0.074627 0.731343 0.134328 0.462687 0.328358 0.164179 0.044776 0.089552 0.492537 0.029851 0.388060 0.059701 0.865672 0.059701 0.014925 0.029851 0.014925 0.119403 0.835821 0.029851 0.029851 0.149254 0.791045 0.059701 0.014925 0.044776 0.880597 0.044776 0.059701 0.761194 0.134328 0.074627 0.298507 0.343284 0.283582 0.179104 0.522388 0.059701 0.238806 0.029851 0.835821 0.029851 0.104478 0.074627 0.104478 0.402985 0.417910 Consensus sequence: TGMYCTTTGBCCK Alignment: RGGBCAAAGKYCA -VBBYCAAGGTCA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 10 NR1H2RXRA Original Motif Original Motif Backward 3 12 0.050698 Original motif 0.680000 0.200000 0.000000 0.120000 0.680000 0.040000 0.200000 0.080000 0.800000 0.000000 0.200000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.040000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.000000 0.040000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.800000 0.040000 0.080000 0.080000 0.000000 0.600000 0.240000 0.160000 Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif 0.000000 0.240000 0.600000 0.160000 0.080000 0.040000 0.080000 0.800000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.040000 0.000000 0.000000 0.960000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.040000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.200000 0.800000 0.080000 0.040000 0.200000 0.680000 0.120000 0.200000 0.000000 0.680000 Consensus sequence: GTTGACCTTTGACCTTT Alignment: AAAGGTCAAAGGTCAAC ---VBBYCAAGGTCA-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 3 ESR1 Reverse Complement Original Motif Backward 9 12 0.062848 Original motif 0.261242 0.256959 0.329764 0.152034 0.228632 0.170940 0.350427 0.250000 0.136752 0.369658 0.318376 0.175214 0.176596 0.487234 0.138298 0.197872 0.285106 0.493617 0.100000 0.121277 0.651163 0.059197 0.188161 0.101480 0.075949 0.016878 0.816456 0.090717 0.040000 0.037895 0.884211 0.037895 0.069474 0.086316 0.191579 0.652632 0.008421 0.829474 0.111579 0.050526 0.837895 0.027368 0.056842 0.077895 0.122105 0.526316 0.225263 0.126316 0.132632 0.581053 0.111579 0.174737 0.134737 0.543158 0.204211 0.117895 0.067368 0.040000 0.016842 0.875789 0.044211 0.046316 0.896842 0.012632 0.642105 0.223158 0.065263 0.069474 0.021053 0.917895 0.025263 0.035789 0.124211 0.743158 0.004211 0.128421 0.054737 0.347368 0.046316 0.551579 Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif 0.551579 0.347368 0.046316 0.054737 0.124211 0.004211 0.743158 0.128421 0.021053 0.025263 0.917895 0.035789 0.069474 0.223158 0.065263 0.642105 0.044211 0.896842 0.046316 0.012632 0.875789 0.040000 0.016842 0.067368 0.134737 0.204211 0.543158 0.117895 0.132632 0.111579 0.581053 0.174737 0.122105 0.225263 0.526316 0.126316 0.077895 0.027368 0.056842 0.837895 0.008421 0.111579 0.829474 0.050526 0.652632 0.086316 0.191579 0.069474 0.040000 0.884211 0.037895 0.037895 0.075949 0.816456 0.016878 0.090717 0.101480 0.059197 0.188161 0.651163 0.285106 0.100000 0.493617 0.121277 0.176596 0.138298 0.487234 0.197872 0.136752 0.318376 0.369658 0.175214 0.228632 0.350427 0.170940 0.250000 0.261242 0.329764 0.256959 0.152034 Consensus sequence: MGGTCAGGGTGACCTRDBHV Alignment: VDBHMAGGTCACCCTGACCY TGACCTTGMBBB-------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 9 ESR2 Reverse Complement Original Motif Forward 6 12 0.069461 Original motif 0.218487 0.450980 0.176471 0.154062 0.442577 0.142857 0.114846 0.299720 0.521008 0.042017 0.431373 0.005602 0.075630 0.000000 0.770308 0.154062 0.050420 0.056022 0.893557 0.000000 0.036415 0.053221 0.092437 0.817927 0.000000 1.000000 0.000000 0.000000 0.943978 0.002801 0.000000 0.053221 0.137255 0.344538 0.316527 0.201681 0.179272 0.176471 0.417367 0.226891 0.145658 0.170868 0.411765 0.271709 0.058824 0.092437 0.067227 0.781513 0.176471 0.070028 0.742297 0.011204 0.498599 0.277311 0.053221 0.170868 0.095238 0.750700 0.005602 0.148459 0.128852 0.809524 0.000000 0.061625 0.075630 0.252101 0.000000 0.672269 0.168067 0.263305 0.380952 0.187675 Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif 0.168067 0.380952 0.263305 0.187675 0.672269 0.252101 0.000000 0.075630 0.128852 0.000000 0.809524 0.061625 0.095238 0.005602 0.750700 0.148459 0.170868 0.277311 0.053221 0.498599 0.176471 0.742297 0.070028 0.011204 0.781513 0.092437 0.067227 0.058824 0.145658 0.411765 0.170868 0.271709 0.179272 0.417367 0.176471 0.226891 0.137255 0.316527 0.344538 0.201681 0.053221 0.002801 0.000000 0.943978 0.000000 0.000000 1.000000 0.000000 0.817927 0.053221 0.092437 0.036415 0.050420 0.893557 0.056022 0.000000 0.075630 0.770308 0.000000 0.154062 0.005602 0.042017 0.431373 0.521008 0.299720 0.142857 0.114846 0.442577 0.218487 0.176471 0.450980 0.154062 Consensus sequence: BAGGYCABHBTGACCKHV Alignment: VHRGGTCABDBTGMCCTB -----TGACCTTGMBBB- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 7 REST Original Motif Original Motif Forward 5 12 0.071324 Original motif 0.132621 0.109365 0.230044 0.527970 0.036318 0.168441 0.091421 0.703820 0.047589 0.855354 0.031309 0.065748 0.906367 0.018727 0.058677 0.016230 0.021197 0.027431 0.945137 0.006234 0.076012 0.609346 0.201246 0.113396 0.980697 0.004359 0.007472 0.007472 0.001868 0.987547 0.007472 0.003113 0.021793 0.922167 0.012453 0.043587 0.568847 0.125234 0.100935 0.204984 0.136534 0.233791 0.077307 0.552369 0.024314 0.004364 0.966958 0.004364 0.012469 0.003117 0.983167 0.001247 0.877105 0.069869 0.021210 0.031815 0.008125 0.800000 0.145625 0.046250 0.983750 0.005625 0.004375 0.006250 0.026349 0.008156 0.959849 0.005646 0.128688 0.632141 0.114878 0.124294 0.229899 0.019472 0.432161 0.318467 0.133962 0.586792 0.200629 0.078616 0.112579 0.700629 0.023270 0.163522 Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif 0.112579 0.023270 0.700629 0.163522 0.133962 0.200629 0.586792 0.078616 0.229899 0.432161 0.019472 0.318467 0.128688 0.114878 0.632141 0.124294 0.026349 0.959849 0.008156 0.005646 0.006250 0.005625 0.004375 0.983750 0.008125 0.145625 0.800000 0.046250 0.031815 0.069869 0.021210 0.877105 0.012469 0.983167 0.003117 0.001247 0.024314 0.966958 0.004364 0.004364 0.552369 0.233791 0.077307 0.136534 0.204984 0.125234 0.100935 0.568847 0.021793 0.012453 0.922167 0.043587 0.001868 0.007472 0.987547 0.003113 0.007472 0.004359 0.007472 0.980697 0.076012 0.201246 0.609346 0.113396 0.021197 0.945137 0.027431 0.006234 0.016230 0.018727 0.058677 0.906367 0.047589 0.031309 0.855354 0.065748 0.703820 0.168441 0.091421 0.036318 0.527970 0.109365 0.230044 0.132621 Consensus sequence: GGYGCTGTCCATGGTGCTGAA Alignment: TTCAGCACCATGGACAGCKCC ----VBBYCAAGGTCA----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 17 TgTGgTGTCACAGTGCTCC Reverse Complement Original Motif Backward 1 12 0.077256 Original motif 0.111111 0.083333 0.055556 0.750000 0.125000 0.097222 0.652778 0.125000 0.041667 0.097222 0.027778 0.833333 0.027778 0.027778 0.791667 0.152778 0.055556 0.166667 0.652778 0.125000 0.000000 0.041667 0.013889 0.944444 0.041667 0.000000 0.888889 0.069444 0.027778 0.027778 0.000000 0.944444 0.041667 0.944444 0.013889 0.000000 0.916667 0.027778 0.000000 0.055556 0.069444 0.875000 0.000000 0.055556 0.833333 0.013889 0.013889 0.138889 0.041667 0.069444 0.819444 0.069444 0.027778 0.027778 0.027778 0.916667 0.069444 0.013889 0.847222 0.069444 0.069444 0.777778 0.027778 0.125000 0.055556 0.041667 0.027778 0.875000 0.041667 0.708333 0.125000 0.125000 0.111111 0.819444 0.055556 0.013889 Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif 0.111111 0.055556 0.819444 0.013889 0.041667 0.125000 0.708333 0.125000 0.875000 0.041667 0.027778 0.055556 0.069444 0.027778 0.777778 0.125000 0.069444 0.847222 0.013889 0.069444 0.916667 0.027778 0.027778 0.027778 0.041667 0.819444 0.069444 0.069444 0.138889 0.013889 0.013889 0.833333 0.069444 0.000000 0.875000 0.055556 0.055556 0.027778 0.000000 0.916667 0.041667 0.013889 0.944444 0.000000 0.944444 0.027778 0.000000 0.027778 0.041667 0.888889 0.000000 0.069444 0.944444 0.041667 0.013889 0.000000 0.055556 0.652778 0.166667 0.125000 0.027778 0.791667 0.027778 0.152778 0.833333 0.097222 0.027778 0.041667 0.125000 0.652778 0.097222 0.125000 0.750000 0.083333 0.055556 0.111111 Consensus sequence: GGAGCACTGTGACACCACA Alignment: TGTGGTGTCACAGTGCTCC -------TGACCTTGMBBB ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 23 TGGAGCACTGTGACAcCACAGTGg Reverse Complement Reverse Complement Forward 12 12 0.078539 Original motif 0.054054 0.040541 0.054054 0.851351 0.040541 0.013514 0.824324 0.121622 0.094595 0.135135 0.756757 0.013514 0.891892 0.000000 0.000000 0.108108 0.040541 0.094595 0.810811 0.054054 0.081081 0.797297 0.054054 0.067568 0.932432 0.027027 0.000000 0.040541 0.054054 0.756757 0.135135 0.054054 0.108108 0.027027 0.013514 0.851351 0.108108 0.000000 0.851351 0.040541 0.013514 0.000000 0.027027 0.959459 0.000000 0.013514 0.945946 0.040541 0.905405 0.000000 0.067568 0.027027 0.054054 0.837838 0.000000 0.108108 0.945946 0.013514 0.040541 0.000000 0.162162 0.500000 0.189189 0.148649 0.108108 0.824324 0.000000 0.067568 0.945946 0.000000 0.040541 0.013514 0.081081 0.837838 0.027027 0.054054 0.945946 0.000000 0.013514 0.040541 0.054054 0.067568 0.783784 0.094595 0.054054 0.027027 0.000000 0.918919 0.040541 0.013514 0.864865 0.081081 0.148649 0.121622 0.675676 0.054054 Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif 0.148649 0.675676 0.121622 0.054054 0.040541 0.864865 0.013514 0.081081 0.918919 0.027027 0.000000 0.054054 0.054054 0.783784 0.067568 0.094595 0.040541 0.000000 0.013514 0.945946 0.081081 0.027027 0.837838 0.054054 0.013514 0.000000 0.040541 0.945946 0.108108 0.000000 0.824324 0.067568 0.162162 0.189189 0.500000 0.148649 0.000000 0.013514 0.040541 0.945946 0.054054 0.000000 0.837838 0.108108 0.027027 0.000000 0.067568 0.905405 0.000000 0.945946 0.013514 0.040541 0.959459 0.000000 0.027027 0.013514 0.108108 0.851351 0.000000 0.040541 0.851351 0.027027 0.013514 0.108108 0.054054 0.135135 0.756757 0.054054 0.040541 0.027027 0.000000 0.932432 0.081081 0.054054 0.797297 0.067568 0.040541 0.810811 0.094595 0.054054 0.108108 0.000000 0.000000 0.891892 0.094595 0.756757 0.135135 0.013514 0.040541 0.824324 0.013514 0.121622 0.851351 0.040541 0.054054 0.054054 Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA Alignment: CCACTGTGVTGTCACAGTGCTCCA -----------TGACCTTGMBBB- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 22 CACTGTGrYrtCACAGTGswsCAcT Original Motif Reverse Complement Forward 4 12 0.083272 Original motif 0.111111 0.746032 0.063492 0.079365 0.857143 0.047619 0.047619 0.047619 0.047619 0.857143 0.079365 0.015873 0.031746 0.000000 0.000000 0.968254 0.031746 0.015873 0.904762 0.047619 0.000000 0.000000 0.000000 1.000000 0.031746 0.000000 0.857143 0.111111 0.396825 0.111111 0.412698 0.079365 0.031746 0.253968 0.015873 0.698413 0.365079 0.000000 0.634921 0.000000 0.079365 0.206349 0.047619 0.666667 0.047619 0.936508 0.015873 0.000000 0.952381 0.000000 0.015873 0.031746 0.015873 0.920635 0.000000 0.063492 0.920635 0.000000 0.000000 0.079365 0.063492 0.047619 0.841270 0.047619 0.000000 0.000000 0.015873 0.984127 0.047619 0.015873 0.904762 0.031746 0.015873 0.603175 0.317460 0.063492 0.396825 0.000000 0.015873 0.587302 0.015873 0.476190 0.428571 0.079365 0.063492 0.920635 0.000000 0.015873 0.920635 0.015873 0.047619 0.015873 0.095238 0.682540 0.095238 0.126984 0.047619 0.015873 0.095238 0.841270 Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif 0.841270 0.015873 0.095238 0.047619 0.095238 0.095238 0.682540 0.126984 0.015873 0.015873 0.047619 0.920635 0.063492 0.000000 0.920635 0.015873 0.015873 0.428571 0.476190 0.079365 0.587302 0.000000 0.015873 0.396825 0.015873 0.317460 0.603175 0.063492 0.047619 0.904762 0.015873 0.031746 0.984127 0.000000 0.015873 0.000000 0.063492 0.841270 0.047619 0.047619 0.079365 0.000000 0.000000 0.920635 0.015873 0.000000 0.920635 0.063492 0.031746 0.000000 0.015873 0.952381 0.047619 0.015873 0.936508 0.000000 0.666667 0.206349 0.047619 0.079365 0.365079 0.634921 0.000000 0.000000 0.698413 0.253968 0.015873 0.031746 0.396825 0.412698 0.111111 0.079365 0.031746 0.857143 0.000000 0.111111 1.000000 0.000000 0.000000 0.000000 0.031746 0.904762 0.015873 0.047619 0.968254 0.000000 0.000000 0.031746 0.047619 0.079365 0.857143 0.015873 0.047619 0.047619 0.047619 0.857143 0.111111 0.063492 0.746032 0.079365 Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG Alignment: AGTGSWSCACTGTGAMAMCACAGTG ---VBBYCAAGGTCA---------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 5 Motif name: ZEB1 Original motif 0.024390 0.829268 0.024390 0.121951 0.926829 0.000000 0.048780 0.024390 0.000000 0.975610 0.024390 0.000000 0.000000 0.926829 0.073171 0.000000 0.000000 0.024390 0.000000 0.975610 0.243902 0.024390 0.390244 0.341463 Consensus sequence: CACCTD Reserve complement motif 0.243902 0.390244 0.024390 0.341463 0.975610 0.024390 0.000000 0.000000 0.000000 0.073171 0.926829 0.000000 0.000000 0.024390 0.975610 0.000000 0.024390 0.000000 0.048780 0.926829 0.024390 0.024390 0.829268 0.121951 Consensus sequence: HAGGTG ************************************************************************ Best Matches for Motif ID 5 (Highest to Lowest) ************************************************************************ Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 16 CTCF Reverse Complement Original Motif Forward 8 6 0.000000 Original motif 0.095290 0.318729 0.083242 0.502738 0.182913 0.158817 0.453450 0.204819 0.307777 0.053669 0.491785 0.146769 0.061336 0.876232 0.023001 0.039430 0.008762 0.989047 0.000000 0.002191 0.814896 0.014239 0.071194 0.099671 0.043812 0.578313 0.365827 0.012048 0.117325 0.474781 0.052632 0.355263 0.933114 0.012061 0.035088 0.019737 0.005488 0.000000 0.991218 0.003293 0.365532 0.003293 0.621295 0.009879 0.059276 0.013172 0.553238 0.374314 0.013187 0.000000 0.978022 0.008791 0.061538 0.008791 0.851648 0.078022 0.114411 0.806381 0.005501 0.073707 0.409241 0.014301 0.557756 0.018702 0.090308 0.530837 0.338106 0.040749 0.128855 0.354626 0.080396 0.436123 0.442731 0.199339 0.292952 0.064978 Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif 0.064978 0.199339 0.292952 0.442731 0.436123 0.354626 0.080396 0.128855 0.090308 0.338106 0.530837 0.040749 0.409241 0.557756 0.014301 0.018702 0.114411 0.005501 0.806381 0.073707 0.061538 0.851648 0.008791 0.078022 0.013187 0.978022 0.000000 0.008791 0.059276 0.553238 0.013172 0.374314 0.365532 0.621295 0.003293 0.009879 0.005488 0.991218 0.000000 0.003293 0.019737 0.012061 0.035088 0.933114 0.117325 0.052632 0.474781 0.355263 0.043812 0.365827 0.578313 0.012048 0.099671 0.014239 0.071194 0.814896 0.008762 0.000000 0.989047 0.002191 0.061336 0.023001 0.876232 0.039430 0.307777 0.491785 0.053669 0.146769 0.182913 0.453450 0.158817 0.204819 0.502738 0.318729 0.083242 0.095290 Consensus sequence: BMSMGCCYMCTKSTGGMHM Alignment: YDRCCASYAGRKGGCRSYV -------HAGGTG------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 12 RORA_1 Original Motif Reverse Complement Backward 4 6 0.006889 Original motif 0.600000 0.040000 0.080000 0.280000 0.360000 0.040000 0.000000 0.600000 0.240000 0.480000 0.160000 0.120000 0.440000 0.080000 0.200000 0.280000 0.840000 0.000000 0.160000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 Consensus sequence: AWVDAGGTCA Reverse complement motif 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.160000 0.840000 0.280000 0.080000 0.200000 0.440000 0.240000 0.160000 0.480000 0.120000 0.600000 0.040000 0.000000 0.360000 0.280000 0.040000 0.080000 0.600000 Consensus sequence: TGACCTDVWT Alignment: TGACCTDVWT -CACCTD--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 7 REST Reverse Complement Reverse Complement Backward 6 6 0.007073 Original motif 0.132621 0.109365 0.230044 0.527970 0.036318 0.168441 0.091421 0.703820 0.047589 0.855354 0.031309 0.065748 0.906367 0.018727 0.058677 0.016230 0.021197 0.027431 0.945137 0.006234 0.076012 0.609346 0.201246 0.113396 0.980697 0.004359 0.007472 0.007472 0.001868 0.987547 0.007472 0.003113 0.021793 0.922167 0.012453 0.043587 0.568847 0.125234 0.100935 0.204984 0.136534 0.233791 0.077307 0.552369 0.024314 0.004364 0.966958 0.004364 0.012469 0.003117 0.983167 0.001247 0.877105 0.069869 0.021210 0.031815 0.008125 0.800000 0.145625 0.046250 0.983750 0.005625 0.004375 0.006250 0.026349 0.008156 0.959849 0.005646 0.128688 0.632141 0.114878 0.124294 0.229899 0.019472 0.432161 0.318467 0.133962 0.586792 0.200629 0.078616 0.112579 0.700629 0.023270 0.163522 Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif 0.112579 0.023270 0.700629 0.163522 0.133962 0.200629 0.586792 0.078616 0.229899 0.432161 0.019472 0.318467 0.128688 0.114878 0.632141 0.124294 0.026349 0.959849 0.008156 0.005646 0.006250 0.005625 0.004375 0.983750 0.008125 0.145625 0.800000 0.046250 0.031815 0.069869 0.021210 0.877105 0.012469 0.983167 0.003117 0.001247 0.024314 0.966958 0.004364 0.004364 0.552369 0.233791 0.077307 0.136534 0.204984 0.125234 0.100935 0.568847 0.021793 0.012453 0.922167 0.043587 0.001868 0.007472 0.987547 0.003113 0.007472 0.004359 0.007472 0.980697 0.076012 0.201246 0.609346 0.113396 0.021197 0.945137 0.027431 0.006234 0.016230 0.018727 0.058677 0.906367 0.047589 0.031309 0.855354 0.065748 0.703820 0.168441 0.091421 0.036318 0.527970 0.109365 0.230044 0.132621 Consensus sequence: GGYGCTGTCCATGGTGCTGAA Alignment: GGYGCTGTCCATGGTGCTGAA ----------HAGGTG----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 4 Esrrb Reverse Complement Original Motif Forward 2 6 0.013046 Original motif 0.290198 0.220264 0.271200 0.218337 0.184941 0.227810 0.376477 0.210772 0.115226 0.332236 0.331687 0.220850 0.070959 0.342466 0.122740 0.463836 0.084862 0.729264 0.171640 0.014235 0.909737 0.008753 0.067834 0.013676 0.975656 0.000547 0.016411 0.007385 0.008758 0.001368 0.981390 0.008484 0.005750 0.003286 0.986309 0.004655 0.049904 0.012613 0.066904 0.870579 0.002473 0.927473 0.046703 0.023352 0.951569 0.005504 0.035498 0.007430 Consensus sequence: VBBYCAAGGTCA Reverse complement motif 0.007430 0.005504 0.035498 0.951569 0.002473 0.046703 0.927473 0.023352 0.870579 0.012613 0.066904 0.049904 0.005750 0.986309 0.003286 0.004655 0.008758 0.981390 0.001368 0.008484 0.007385 0.000547 0.016411 0.975656 0.013676 0.008753 0.067834 0.909737 0.084862 0.171640 0.729264 0.014235 0.463836 0.342466 0.122740 0.070959 0.115226 0.331687 0.332236 0.220850 0.184941 0.376477 0.227810 0.210772 0.218337 0.220264 0.271200 0.290198 Consensus sequence: TGACCTTGMBBB Alignment: VBBYCAAGGTCA -HAGGTG----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 10 NR1H2RXRA Original Motif Reverse Complement Backward 2 6 0.016035 Original motif 0.680000 0.200000 0.000000 0.120000 0.680000 0.040000 0.200000 0.080000 0.800000 0.000000 0.200000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.040000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.000000 0.040000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.800000 0.040000 0.080000 0.080000 0.000000 0.600000 0.240000 0.160000 Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif 0.000000 0.240000 0.600000 0.160000 0.080000 0.040000 0.080000 0.800000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.040000 0.000000 0.000000 0.960000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.040000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.200000 0.800000 0.080000 0.040000 0.200000 0.680000 0.120000 0.200000 0.000000 0.680000 Consensus sequence: GTTGACCTTTGACCTTT Alignment: GTTGACCTTTGACCTTT ----------CACCTD- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 14 PPARGRXRA Original Motif Reverse Complement Backward 9 6 0.019244 Original motif 0.109685 0.369895 0.373396 0.147025 0.117716 0.193473 0.148019 0.540793 0.453488 0.026744 0.427907 0.091860 0.116144 0.003484 0.779326 0.101045 0.161253 0.017401 0.781903 0.039443 0.168213 0.149652 0.458237 0.223898 0.082271 0.633835 0.207416 0.076477 0.949015 0.024334 0.017381 0.009270 0.604867 0.055620 0.312862 0.026651 0.825231 0.005787 0.158565 0.010417 0.095017 0.002317 0.888760 0.013905 0.047509 0.010429 0.803013 0.139050 0.025492 0.114716 0.304751 0.555041 0.062645 0.643852 0.167053 0.126450 0.784223 0.067285 0.054524 0.093968 Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif 0.093968 0.067285 0.054524 0.784223 0.062645 0.167053 0.643852 0.126450 0.555041 0.114716 0.304751 0.025492 0.047509 0.803013 0.010429 0.139050 0.095017 0.888760 0.002317 0.013905 0.010417 0.005787 0.158565 0.825231 0.026651 0.055620 0.312862 0.604867 0.009270 0.024334 0.017381 0.949015 0.082271 0.207416 0.633835 0.076477 0.168213 0.458237 0.149652 0.223898 0.161253 0.781903 0.017401 0.039443 0.116144 0.779326 0.003484 0.101045 0.091860 0.026744 0.427907 0.453488 0.540793 0.193473 0.148019 0.117716 0.109685 0.373396 0.369895 0.147025 Consensus sequence: TGRCCTKTGHCCKAB Alignment: TGRCCTKTGHCCKAB -CACCTD-------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 11 NR4A2 Original Motif Reverse Complement Backward 1 6 0.021650 Original motif 0.615385 0.076923 0.230769 0.076923 0.928571 0.000000 0.071429 0.000000 0.000000 0.000000 0.928571 0.071429 0.214286 0.000000 0.785714 0.000000 0.142857 0.142857 0.000000 0.714286 0.000000 0.928571 0.000000 0.071429 1.000000 0.000000 0.000000 0.000000 0.230769 0.615385 0.153846 0.000000 Consensus sequence: AAGGTCAC Reverse complement motif 0.230769 0.153846 0.615385 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.928571 0.071429 0.714286 0.142857 0.000000 0.142857 0.214286 0.785714 0.000000 0.000000 0.000000 0.928571 0.000000 0.071429 0.000000 0.000000 0.071429 0.928571 0.076923 0.076923 0.230769 0.615385 Consensus sequence: GTGACCTT Alignment: GTGACCTT --CACCTD ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 3 ESR1 Original Motif Reverse Complement Backward 11 6 0.022947 Original motif 0.261242 0.256959 0.329764 0.152034 0.228632 0.170940 0.350427 0.250000 0.136752 0.369658 0.318376 0.175214 0.176596 0.487234 0.138298 0.197872 0.285106 0.493617 0.100000 0.121277 0.651163 0.059197 0.188161 0.101480 0.075949 0.016878 0.816456 0.090717 0.040000 0.037895 0.884211 0.037895 0.069474 0.086316 0.191579 0.652632 0.008421 0.829474 0.111579 0.050526 0.837895 0.027368 0.056842 0.077895 0.122105 0.526316 0.225263 0.126316 0.132632 0.581053 0.111579 0.174737 0.134737 0.543158 0.204211 0.117895 0.067368 0.040000 0.016842 0.875789 0.044211 0.046316 0.896842 0.012632 0.642105 0.223158 0.065263 0.069474 0.021053 0.917895 0.025263 0.035789 0.124211 0.743158 0.004211 0.128421 0.054737 0.347368 0.046316 0.551579 Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif 0.551579 0.347368 0.046316 0.054737 0.124211 0.004211 0.743158 0.128421 0.021053 0.025263 0.917895 0.035789 0.069474 0.223158 0.065263 0.642105 0.044211 0.896842 0.046316 0.012632 0.875789 0.040000 0.016842 0.067368 0.134737 0.204211 0.543158 0.117895 0.132632 0.111579 0.581053 0.174737 0.122105 0.225263 0.526316 0.126316 0.077895 0.027368 0.056842 0.837895 0.008421 0.111579 0.829474 0.050526 0.652632 0.086316 0.191579 0.069474 0.040000 0.884211 0.037895 0.037895 0.075949 0.816456 0.016878 0.090717 0.101480 0.059197 0.188161 0.651163 0.285106 0.100000 0.493617 0.121277 0.176596 0.138298 0.487234 0.197872 0.136752 0.318376 0.369658 0.175214 0.228632 0.350427 0.170940 0.250000 0.261242 0.329764 0.256959 0.152034 Consensus sequence: MGGTCAGGGTGACCTRDBHV Alignment: MGGTCAGGGTGACCTRDBHV ----CACCTD---------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 6 Mycn Original Motif Original Motif Forward 3 6 0.024646 Original motif 0.349315 0.363014 0.143836 0.143836 0.089041 0.388128 0.447489 0.075342 0.015982 0.984018 0.000000 0.000000 0.945205 0.000000 0.041096 0.013699 0.000000 0.961187 0.018265 0.020548 0.070776 0.002283 0.924658 0.002283 0.054795 0.221461 0.004566 0.719178 0.000000 0.000000 0.938356 0.061644 0.061644 0.111872 0.739726 0.086758 0.139269 0.605023 0.091324 0.164384 Consensus sequence: HSCACGTGGC Reverse complement motif 0.139269 0.091324 0.605023 0.164384 0.061644 0.739726 0.111872 0.086758 0.000000 0.938356 0.000000 0.061644 0.719178 0.221461 0.004566 0.054795 0.070776 0.924658 0.002283 0.002283 0.000000 0.018265 0.961187 0.020548 0.013699 0.000000 0.041096 0.945205 0.015982 0.000000 0.984018 0.000000 0.089041 0.447489 0.388128 0.075342 0.349315 0.143836 0.363014 0.143836 Consensus sequence: GCCACGTGSD Alignment: HSCACGTGGC --CACCTD-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 8 Myc Reverse Complement Reverse Complement Forward 3 6 0.025129 Original motif 0.295154 0.422907 0.158590 0.123348 0.149780 0.233480 0.572687 0.044053 0.035242 0.964758 0.000000 0.000000 0.955947 0.017621 0.022026 0.004405 0.000000 0.933921 0.013216 0.052863 0.083700 0.008811 0.898678 0.008811 0.039648 0.193833 0.000000 0.766520 0.000000 0.008811 0.951542 0.039648 0.000000 0.074890 0.806167 0.118943 0.198238 0.471366 0.105727 0.224670 Consensus sequence: VGCACGTGGH Reverse complement motif 0.198238 0.105727 0.471366 0.224670 0.000000 0.806167 0.074890 0.118943 0.000000 0.951542 0.008811 0.039648 0.766520 0.193833 0.000000 0.039648 0.083700 0.898678 0.008811 0.008811 0.000000 0.013216 0.933921 0.052863 0.004405 0.017621 0.022026 0.955947 0.035242 0.000000 0.964758 0.000000 0.149780 0.572687 0.233480 0.044053 0.295154 0.158590 0.422907 0.123348 Consensus sequence: DCCACGTGCV Alignment: DCCACGTGCV --HAGGTG-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 6 Motif name: Mycn Original motif 0.349315 0.363014 0.143836 0.143836 0.089041 0.388128 0.447489 0.075342 0.015982 0.984018 0.000000 0.000000 0.945205 0.000000 0.041096 0.013699 0.000000 0.961187 0.018265 0.020548 0.070776 0.002283 0.924658 0.002283 0.054795 0.221461 0.004566 0.719178 0.000000 0.000000 0.938356 0.061644 0.061644 0.111872 0.739726 0.086758 0.139269 0.605023 0.091324 0.164384 Consensus sequence: HSCACGTGGC Reserve complement motif 0.139269 0.091324 0.605023 0.164384 0.061644 0.739726 0.111872 0.086758 0.000000 0.938356 0.000000 0.061644 0.719178 0.221461 0.004566 0.054795 0.070776 0.924658 0.002283 0.002283 0.000000 0.018265 0.961187 0.020548 0.013699 0.000000 0.041096 0.945205 0.015982 0.000000 0.984018 0.000000 0.089041 0.447489 0.388128 0.075342 0.349315 0.143836 0.363014 0.143836 Consensus sequence: GCCACGTGSD ************************************************************************ Best Matches for Motif ID 6 (Highest to Lowest) ************************************************************************ Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 8 Myc Reverse Complement Reverse Complement Forward 1 10 0.000000 Original motif 0.295154 0.422907 0.158590 0.123348 0.149780 0.233480 0.572687 0.044053 0.035242 0.964758 0.000000 0.000000 0.955947 0.017621 0.022026 0.004405 0.000000 0.933921 0.013216 0.052863 0.083700 0.008811 0.898678 0.008811 0.039648 0.193833 0.000000 0.766520 0.000000 0.008811 0.951542 0.039648 0.000000 0.074890 0.806167 0.118943 0.198238 0.471366 0.105727 0.224670 Consensus sequence: VGCACGTGGH Reverse complement motif 0.198238 0.105727 0.471366 0.224670 0.000000 0.806167 0.074890 0.118943 0.000000 0.951542 0.008811 0.039648 0.766520 0.193833 0.000000 0.039648 0.083700 0.898678 0.008811 0.008811 0.000000 0.013216 0.933921 0.052863 0.004405 0.017621 0.022026 0.955947 0.035242 0.000000 0.964758 0.000000 0.149780 0.572687 0.233480 0.044053 0.295154 0.158590 0.422907 0.123348 Consensus sequence: DCCACGTGCV Alignment: DCCACGTGCV GCCACGTGSD ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 18 sscCCCGCGcs Reverse Complement Original Motif Backward 1 10 0.065482 Original motif 0.147059 0.441176 0.264706 0.147059 0.117647 0.529412 0.294118 0.058824 0.000000 0.676471 0.235294 0.088235 0.029412 0.852941 0.117647 0.000000 0.000000 0.823529 0.176471 0.000000 0.000000 0.794118 0.205882 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.058824 0.941176 0.000000 0.117647 0.470588 0.235294 0.176471 0.000000 0.323529 0.529412 0.147059 Consensus sequence: BSCCCCGCGBS Reverse complement motif 0.000000 0.529412 0.323529 0.147059 0.117647 0.235294 0.470588 0.176471 0.000000 0.941176 0.058824 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.205882 0.794118 0.000000 0.000000 0.176471 0.823529 0.000000 0.029412 0.117647 0.852941 0.000000 0.000000 0.235294 0.676471 0.088235 0.117647 0.294118 0.529412 0.058824 0.147059 0.264706 0.441176 0.147059 Consensus sequence: SBCGCGGGGSB Alignment: BSCCCCGCGBS -GCCACGTGSD ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 16 CTCF Original Motif Original Motif Forward 6 10 0.067902 Original motif 0.095290 0.318729 0.083242 0.502738 0.182913 0.158817 0.453450 0.204819 0.307777 0.053669 0.491785 0.146769 0.061336 0.876232 0.023001 0.039430 0.008762 0.989047 0.000000 0.002191 0.814896 0.014239 0.071194 0.099671 0.043812 0.578313 0.365827 0.012048 0.117325 0.474781 0.052632 0.355263 0.933114 0.012061 0.035088 0.019737 0.005488 0.000000 0.991218 0.003293 0.365532 0.003293 0.621295 0.009879 0.059276 0.013172 0.553238 0.374314 0.013187 0.000000 0.978022 0.008791 0.061538 0.008791 0.851648 0.078022 0.114411 0.806381 0.005501 0.073707 0.409241 0.014301 0.557756 0.018702 0.090308 0.530837 0.338106 0.040749 0.128855 0.354626 0.080396 0.436123 0.442731 0.199339 0.292952 0.064978 Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif 0.064978 0.199339 0.292952 0.442731 0.436123 0.354626 0.080396 0.128855 0.090308 0.338106 0.530837 0.040749 0.409241 0.557756 0.014301 0.018702 0.114411 0.005501 0.806381 0.073707 0.061538 0.851648 0.008791 0.078022 0.013187 0.978022 0.000000 0.008791 0.059276 0.553238 0.013172 0.374314 0.365532 0.621295 0.003293 0.009879 0.005488 0.991218 0.000000 0.003293 0.019737 0.012061 0.035088 0.933114 0.117325 0.052632 0.474781 0.355263 0.043812 0.365827 0.578313 0.012048 0.099671 0.014239 0.071194 0.814896 0.008762 0.000000 0.989047 0.002191 0.061336 0.023001 0.876232 0.039430 0.307777 0.491785 0.053669 0.146769 0.182913 0.453450 0.158817 0.204819 0.502738 0.318729 0.083242 0.095290 Consensus sequence: BMSMGCCYMCTKSTGGMHM Alignment: YDRCCASYAGRKGGCRSYV -----HSCACGTGGC---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 24 ssCCCCGCSssk Original Motif Reverse Complement Forward 2 10 0.070499 Original motif 0.000000 0.444444 0.370370 0.185185 0.111111 0.407407 0.333333 0.148148 0.000000 0.888889 0.037037 0.074074 0.000000 0.888889 0.074074 0.037037 0.000000 0.777778 0.222222 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.037037 0.888889 0.000000 0.074074 0.000000 0.703704 0.296296 0.000000 0.000000 0.518519 0.370370 0.111111 0.111111 0.407407 0.259259 0.222222 0.074074 0.222222 0.407407 0.296296 Consensus sequence: SBCCCCGCCSBB Reverse complement motif 0.074074 0.407407 0.222222 0.296296 0.111111 0.259259 0.407407 0.222222 0.000000 0.370370 0.518519 0.111111 0.000000 0.296296 0.703704 0.000000 0.037037 0.000000 0.888889 0.074074 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.222222 0.777778 0.000000 0.000000 0.074074 0.888889 0.037037 0.000000 0.037037 0.888889 0.074074 0.111111 0.333333 0.407407 0.148148 0.000000 0.370370 0.444444 0.185185 Consensus sequence: BBSGGCGGGGBS Alignment: BBSGGCGGGGBS -HSCACGTGGC- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 22 CACTGTGrYrtCACAGTGswsCAcT Reverse Complement Reverse Complement Backward 10 10 0.088322 Original motif 0.111111 0.746032 0.063492 0.079365 0.857143 0.047619 0.047619 0.047619 0.047619 0.857143 0.079365 0.015873 0.031746 0.000000 0.000000 0.968254 0.031746 0.015873 0.904762 0.047619 0.000000 0.000000 0.000000 1.000000 0.031746 0.000000 0.857143 0.111111 0.396825 0.111111 0.412698 0.079365 0.031746 0.253968 0.015873 0.698413 0.365079 0.000000 0.634921 0.000000 0.079365 0.206349 0.047619 0.666667 0.047619 0.936508 0.015873 0.000000 0.952381 0.000000 0.015873 0.031746 0.015873 0.920635 0.000000 0.063492 0.920635 0.000000 0.000000 0.079365 0.063492 0.047619 0.841270 0.047619 0.000000 0.000000 0.015873 0.984127 0.047619 0.015873 0.904762 0.031746 0.015873 0.603175 0.317460 0.063492 0.396825 0.000000 0.015873 0.587302 0.015873 0.476190 0.428571 0.079365 0.063492 0.920635 0.000000 0.015873 0.920635 0.015873 0.047619 0.015873 0.095238 0.682540 0.095238 0.126984 0.047619 0.015873 0.095238 0.841270 Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif 0.841270 0.015873 0.095238 0.047619 0.095238 0.095238 0.682540 0.126984 0.015873 0.015873 0.047619 0.920635 0.063492 0.000000 0.920635 0.015873 0.015873 0.428571 0.476190 0.079365 0.587302 0.000000 0.015873 0.396825 0.015873 0.317460 0.603175 0.063492 0.047619 0.904762 0.015873 0.031746 0.984127 0.000000 0.015873 0.000000 0.063492 0.841270 0.047619 0.047619 0.079365 0.000000 0.000000 0.920635 0.015873 0.000000 0.920635 0.063492 0.031746 0.000000 0.015873 0.952381 0.047619 0.015873 0.936508 0.000000 0.666667 0.206349 0.047619 0.079365 0.365079 0.634921 0.000000 0.000000 0.698413 0.253968 0.015873 0.031746 0.396825 0.412698 0.111111 0.079365 0.031746 0.857143 0.000000 0.111111 1.000000 0.000000 0.000000 0.000000 0.031746 0.904762 0.015873 0.047619 0.968254 0.000000 0.000000 0.031746 0.047619 0.079365 0.857143 0.015873 0.047619 0.047619 0.047619 0.857143 0.111111 0.063492 0.746032 0.079365 Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG Alignment: AGTGSWSCACTGTGAMAMCACAGTG ------GCCACGTGSD--------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 3 ESR1 Reverse Complement Reverse Complement Backward 3 10 0.089863 Original motif 0.261242 0.256959 0.329764 0.152034 0.228632 0.170940 0.350427 0.250000 0.136752 0.369658 0.318376 0.175214 0.176596 0.487234 0.138298 0.197872 0.285106 0.493617 0.100000 0.121277 0.651163 0.059197 0.188161 0.101480 0.075949 0.016878 0.816456 0.090717 0.040000 0.037895 0.884211 0.037895 0.069474 0.086316 0.191579 0.652632 0.008421 0.829474 0.111579 0.050526 0.837895 0.027368 0.056842 0.077895 0.122105 0.526316 0.225263 0.126316 0.132632 0.581053 0.111579 0.174737 0.134737 0.543158 0.204211 0.117895 0.067368 0.040000 0.016842 0.875789 0.044211 0.046316 0.896842 0.012632 0.642105 0.223158 0.065263 0.069474 0.021053 0.917895 0.025263 0.035789 0.124211 0.743158 0.004211 0.128421 0.054737 0.347368 0.046316 0.551579 Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif 0.551579 0.347368 0.046316 0.054737 0.124211 0.004211 0.743158 0.128421 0.021053 0.025263 0.917895 0.035789 0.069474 0.223158 0.065263 0.642105 0.044211 0.896842 0.046316 0.012632 0.875789 0.040000 0.016842 0.067368 0.134737 0.204211 0.543158 0.117895 0.132632 0.111579 0.581053 0.174737 0.122105 0.225263 0.526316 0.126316 0.077895 0.027368 0.056842 0.837895 0.008421 0.111579 0.829474 0.050526 0.652632 0.086316 0.191579 0.069474 0.040000 0.884211 0.037895 0.037895 0.075949 0.816456 0.016878 0.090717 0.101480 0.059197 0.188161 0.651163 0.285106 0.100000 0.493617 0.121277 0.176596 0.138298 0.487234 0.197872 0.136752 0.318376 0.369658 0.175214 0.228632 0.350427 0.170940 0.250000 0.261242 0.329764 0.256959 0.152034 Consensus sequence: MGGTCAGGGTGACCTRDBHV Alignment: MGGTCAGGGTGACCTRDBHV --------GCCACGTGSD-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 20 CagTGCTCCACTGTGgT Reverse Complement Reverse Complement Backward 7 10 0.094301 Original motif 0.150000 0.700000 0.016667 0.133333 0.650000 0.150000 0.050000 0.150000 0.166667 0.116667 0.633333 0.083333 0.050000 0.033333 0.066667 0.850000 0.050000 0.000000 0.833333 0.116667 0.016667 0.966667 0.000000 0.016667 0.050000 0.016667 0.000000 0.933333 0.066667 0.833333 0.066667 0.033333 0.033333 0.966667 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.050000 0.916667 0.016667 0.016667 0.166667 0.000000 0.000000 0.833333 0.083333 0.016667 0.900000 0.000000 0.000000 0.016667 0.016667 0.966667 0.000000 0.016667 0.966667 0.016667 0.116667 0.166667 0.483333 0.233333 0.066667 0.083333 0.050000 0.800000 Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif 0.800000 0.083333 0.050000 0.066667 0.116667 0.483333 0.166667 0.233333 0.000000 0.966667 0.016667 0.016667 0.966667 0.016667 0.016667 0.000000 0.083333 0.900000 0.016667 0.000000 0.833333 0.000000 0.000000 0.166667 0.050000 0.016667 0.916667 0.016667 0.000000 0.000000 0.000000 1.000000 0.033333 0.000000 0.966667 0.000000 0.066667 0.066667 0.833333 0.033333 0.933333 0.016667 0.000000 0.050000 0.016667 0.000000 0.966667 0.016667 0.050000 0.833333 0.000000 0.116667 0.850000 0.033333 0.066667 0.050000 0.166667 0.633333 0.116667 0.083333 0.150000 0.150000 0.050000 0.650000 0.150000 0.016667 0.700000 0.133333 Consensus sequence: ABCACAGTGGAGCACTG Alignment: ABCACAGTGGAGCACTG -GCCACGTGSD------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 1 HNF4A Reverse Complement Reverse Complement Forward 2 10 0.094712 Original motif 0.417910 0.104478 0.402985 0.074627 0.029851 0.029851 0.835821 0.104478 0.179104 0.059701 0.522388 0.238806 0.074627 0.343284 0.298507 0.283582 0.044776 0.761194 0.059701 0.134328 0.880597 0.014925 0.044776 0.059701 0.791045 0.029851 0.149254 0.029851 0.835821 0.014925 0.119403 0.029851 0.059701 0.059701 0.865672 0.014925 0.089552 0.029851 0.492537 0.388060 0.044776 0.328358 0.164179 0.462687 0.059701 0.731343 0.074627 0.134328 0.626866 0.104478 0.149254 0.119403 Consensus sequence: RGGBCAAAGKYCA Reverse complement motif 0.119403 0.104478 0.149254 0.626866 0.059701 0.074627 0.731343 0.134328 0.462687 0.328358 0.164179 0.044776 0.089552 0.492537 0.029851 0.388060 0.059701 0.865672 0.059701 0.014925 0.029851 0.014925 0.119403 0.835821 0.029851 0.029851 0.149254 0.791045 0.059701 0.014925 0.044776 0.880597 0.044776 0.059701 0.761194 0.134328 0.074627 0.298507 0.343284 0.283582 0.179104 0.522388 0.059701 0.238806 0.029851 0.835821 0.029851 0.104478 0.074627 0.104478 0.402985 0.417910 Consensus sequence: TGMYCTTTGBCCK Alignment: TGMYCTTTGBCCK -GCCACGTGSD-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 27 AgTGCTCCACTGTGgTGTCACAgT Reverse Complement Reverse Complement Backward 6 10 0.094936 Original motif 0.690141 0.126761 0.042254 0.140845 0.169014 0.098592 0.676056 0.056338 0.042254 0.028169 0.028169 0.901408 0.056338 0.000000 0.774648 0.169014 0.042254 0.887324 0.042254 0.028169 0.000000 0.014085 0.000000 0.985915 0.056338 0.830986 0.042254 0.070423 0.028169 0.957746 0.014085 0.000000 0.957746 0.000000 0.014085 0.028169 0.084507 0.845070 0.014085 0.056338 0.028169 0.014085 0.000000 0.957746 0.140845 0.028169 0.802817 0.028169 0.014085 0.014085 0.014085 0.957746 0.014085 0.000000 0.929577 0.056338 0.056338 0.154930 0.619718 0.169014 0.014085 0.028169 0.000000 0.957746 0.056338 0.014085 0.873239 0.056338 0.014085 0.000000 0.000000 0.985915 0.042254 0.929577 0.000000 0.028169 0.957746 0.028169 0.000000 0.014085 0.028169 0.845070 0.028169 0.098592 0.873239 0.014085 0.042254 0.070423 0.098592 0.154930 0.563380 0.183099 0.070423 0.014085 0.112676 0.802817 Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif 0.802817 0.014085 0.112676 0.070423 0.098592 0.563380 0.154930 0.183099 0.070423 0.014085 0.042254 0.873239 0.028169 0.028169 0.845070 0.098592 0.014085 0.028169 0.000000 0.957746 0.042254 0.000000 0.929577 0.028169 0.985915 0.000000 0.000000 0.014085 0.056338 0.873239 0.014085 0.056338 0.957746 0.028169 0.000000 0.014085 0.056338 0.619718 0.154930 0.169014 0.014085 0.929577 0.000000 0.056338 0.957746 0.014085 0.014085 0.014085 0.140845 0.802817 0.028169 0.028169 0.957746 0.014085 0.000000 0.028169 0.084507 0.014085 0.845070 0.056338 0.028169 0.000000 0.014085 0.957746 0.028169 0.014085 0.957746 0.000000 0.056338 0.042254 0.830986 0.070423 0.985915 0.014085 0.000000 0.000000 0.042254 0.042254 0.887324 0.028169 0.056338 0.774648 0.000000 0.169014 0.901408 0.028169 0.028169 0.042254 0.169014 0.676056 0.098592 0.056338 0.140845 0.126761 0.042254 0.690141 Consensus sequence: ACTGTGACACCACAGTGGAGCACT Alignment: ACTGTGACACCACAGTGGAGCACT ---------GCCACGTGSD----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 14 PPARGRXRA Reverse Complement Reverse Complement Backward 5 10 0.095444 Original motif 0.109685 0.369895 0.373396 0.147025 0.117716 0.193473 0.148019 0.540793 0.453488 0.026744 0.427907 0.091860 0.116144 0.003484 0.779326 0.101045 0.161253 0.017401 0.781903 0.039443 0.168213 0.149652 0.458237 0.223898 0.082271 0.633835 0.207416 0.076477 0.949015 0.024334 0.017381 0.009270 0.604867 0.055620 0.312862 0.026651 0.825231 0.005787 0.158565 0.010417 0.095017 0.002317 0.888760 0.013905 0.047509 0.010429 0.803013 0.139050 0.025492 0.114716 0.304751 0.555041 0.062645 0.643852 0.167053 0.126450 0.784223 0.067285 0.054524 0.093968 Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif 0.093968 0.067285 0.054524 0.784223 0.062645 0.167053 0.643852 0.126450 0.555041 0.114716 0.304751 0.025492 0.047509 0.803013 0.010429 0.139050 0.095017 0.888760 0.002317 0.013905 0.010417 0.005787 0.158565 0.825231 0.026651 0.055620 0.312862 0.604867 0.009270 0.024334 0.017381 0.949015 0.082271 0.207416 0.633835 0.076477 0.168213 0.458237 0.149652 0.223898 0.161253 0.781903 0.017401 0.039443 0.116144 0.779326 0.003484 0.101045 0.091860 0.026744 0.427907 0.453488 0.540793 0.193473 0.148019 0.117716 0.109685 0.373396 0.369895 0.147025 Consensus sequence: TGRCCTKTGHCCKAB Alignment: TGRCCTKTGHCCKAB -GCCACGTGSD---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 7 Motif name: REST Original motif 0.132621 0.109365 0.230044 0.527970 0.036318 0.168441 0.091421 0.703820 0.047589 0.855354 0.031309 0.065748 0.906367 0.018727 0.058677 0.016230 0.021197 0.027431 0.945137 0.006234 0.076012 0.609346 0.201246 0.113396 0.980697 0.004359 0.007472 0.007472 0.001868 0.987547 0.007472 0.003113 0.021793 0.922167 0.012453 0.043587 0.568847 0.125234 0.100935 0.204984 0.136534 0.233791 0.077307 0.552369 0.024314 0.004364 0.966958 0.004364 0.012469 0.003117 0.983167 0.001247 0.877105 0.069869 0.021210 0.031815 0.008125 0.800000 0.145625 0.046250 0.983750 0.005625 0.004375 0.006250 0.026349 0.008156 0.959849 0.005646 0.128688 0.632141 0.114878 0.124294 0.229899 0.019472 0.432161 0.318467 0.133962 0.586792 0.200629 0.078616 0.112579 0.700629 0.023270 0.163522 Consensus sequence: TTCAGCACCATGGACAGCKCC Reserve complement motif 0.112579 0.023270 0.700629 0.163522 0.133962 0.200629 0.586792 0.078616 0.229899 0.432161 0.019472 0.318467 0.128688 0.114878 0.632141 0.124294 0.026349 0.959849 0.008156 0.005646 0.006250 0.005625 0.004375 0.983750 0.008125 0.145625 0.800000 0.046250 0.031815 0.069869 0.021210 0.877105 0.012469 0.983167 0.003117 0.001247 0.024314 0.966958 0.004364 0.004364 0.552369 0.233791 0.077307 0.136534 0.204984 0.125234 0.100935 0.568847 0.021793 0.012453 0.922167 0.043587 0.001868 0.007472 0.987547 0.003113 0.007472 0.004359 0.007472 0.980697 0.076012 0.201246 0.609346 0.113396 0.021197 0.945137 0.027431 0.006234 0.016230 0.018727 0.058677 0.906367 0.047589 0.031309 0.855354 0.065748 0.703820 0.168441 0.091421 0.036318 0.527970 0.109365 0.230044 0.132621 Consensus sequence: GGYGCTGTCCATGGTGCTGAA ************************************************************************ Best Matches for Motif ID 7 (Highest to Lowest) ************************************************************************ Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 27 AgTGCTCCACTGTGgTGTCACAgT Reverse Complement Original Motif Backward 6 19 0.060523 Original motif 0.690141 0.126761 0.042254 0.140845 0.169014 0.098592 0.676056 0.056338 0.042254 0.028169 0.028169 0.901408 0.056338 0.000000 0.774648 0.169014 0.042254 0.887324 0.042254 0.028169 0.000000 0.014085 0.000000 0.985915 0.056338 0.830986 0.042254 0.070423 0.028169 0.957746 0.014085 0.000000 0.957746 0.000000 0.014085 0.028169 0.084507 0.845070 0.014085 0.056338 0.028169 0.014085 0.000000 0.957746 0.140845 0.028169 0.802817 0.028169 0.014085 0.014085 0.014085 0.957746 0.014085 0.000000 0.929577 0.056338 0.056338 0.154930 0.619718 0.169014 0.014085 0.028169 0.000000 0.957746 0.056338 0.014085 0.873239 0.056338 0.014085 0.000000 0.000000 0.985915 0.042254 0.929577 0.000000 0.028169 0.957746 0.028169 0.000000 0.014085 0.028169 0.845070 0.028169 0.098592 0.873239 0.014085 0.042254 0.070423 0.098592 0.154930 0.563380 0.183099 0.070423 0.014085 0.112676 0.802817 Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif 0.802817 0.014085 0.112676 0.070423 0.098592 0.563380 0.154930 0.183099 0.070423 0.014085 0.042254 0.873239 0.028169 0.028169 0.845070 0.098592 0.014085 0.028169 0.000000 0.957746 0.042254 0.000000 0.929577 0.028169 0.985915 0.000000 0.000000 0.014085 0.056338 0.873239 0.014085 0.056338 0.957746 0.028169 0.000000 0.014085 0.056338 0.619718 0.154930 0.169014 0.014085 0.929577 0.000000 0.056338 0.957746 0.014085 0.014085 0.014085 0.140845 0.802817 0.028169 0.028169 0.957746 0.014085 0.000000 0.028169 0.084507 0.014085 0.845070 0.056338 0.028169 0.000000 0.014085 0.957746 0.028169 0.014085 0.957746 0.000000 0.056338 0.042254 0.830986 0.070423 0.985915 0.014085 0.000000 0.000000 0.042254 0.042254 0.887324 0.028169 0.056338 0.774648 0.000000 0.169014 0.901408 0.028169 0.028169 0.042254 0.169014 0.676056 0.098592 0.056338 0.140845 0.126761 0.042254 0.690141 Consensus sequence: ACTGTGACACCACAGTGGAGCACT Alignment: --AGTGCTCCACTGTGGTGTCACAGT GGYGCTGTCCATGGTGCTGAA----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 3 ESR1 Original Motif Original Motif Backward 5 16 1.562644 Original motif 0.261242 0.256959 0.329764 0.152034 0.228632 0.170940 0.350427 0.250000 0.136752 0.369658 0.318376 0.175214 0.176596 0.487234 0.138298 0.197872 0.285106 0.493617 0.100000 0.121277 0.651163 0.059197 0.188161 0.101480 0.075949 0.016878 0.816456 0.090717 0.040000 0.037895 0.884211 0.037895 0.069474 0.086316 0.191579 0.652632 0.008421 0.829474 0.111579 0.050526 0.837895 0.027368 0.056842 0.077895 0.122105 0.526316 0.225263 0.126316 0.132632 0.581053 0.111579 0.174737 0.134737 0.543158 0.204211 0.117895 0.067368 0.040000 0.016842 0.875789 0.044211 0.046316 0.896842 0.012632 0.642105 0.223158 0.065263 0.069474 0.021053 0.917895 0.025263 0.035789 0.124211 0.743158 0.004211 0.128421 0.054737 0.347368 0.046316 0.551579 Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif 0.551579 0.347368 0.046316 0.054737 0.124211 0.004211 0.743158 0.128421 0.021053 0.025263 0.917895 0.035789 0.069474 0.223158 0.065263 0.642105 0.044211 0.896842 0.046316 0.012632 0.875789 0.040000 0.016842 0.067368 0.134737 0.204211 0.543158 0.117895 0.132632 0.111579 0.581053 0.174737 0.122105 0.225263 0.526316 0.126316 0.077895 0.027368 0.056842 0.837895 0.008421 0.111579 0.829474 0.050526 0.652632 0.086316 0.191579 0.069474 0.040000 0.884211 0.037895 0.037895 0.075949 0.816456 0.016878 0.090717 0.101480 0.059197 0.188161 0.651163 0.285106 0.100000 0.493617 0.121277 0.176596 0.138298 0.487234 0.197872 0.136752 0.318376 0.369658 0.175214 0.228632 0.350427 0.170940 0.250000 0.261242 0.329764 0.256959 0.152034 Consensus sequence: MGGTCAGGGTGACCTRDBHV Alignment: -----VDBHMAGGTCACCCTGACCY TTCAGCACCATGGACAGCKCC---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 20 CagTGCTCCACTGTGgT Reverse Complement Reverse Complement Backward 4 14 2.570325 Original motif 0.150000 0.700000 0.016667 0.133333 0.650000 0.150000 0.050000 0.150000 0.166667 0.116667 0.633333 0.083333 0.050000 0.033333 0.066667 0.850000 0.050000 0.000000 0.833333 0.116667 0.016667 0.966667 0.000000 0.016667 0.050000 0.016667 0.000000 0.933333 0.066667 0.833333 0.066667 0.033333 0.033333 0.966667 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.050000 0.916667 0.016667 0.016667 0.166667 0.000000 0.000000 0.833333 0.083333 0.016667 0.900000 0.000000 0.000000 0.016667 0.016667 0.966667 0.000000 0.016667 0.966667 0.016667 0.116667 0.166667 0.483333 0.233333 0.066667 0.083333 0.050000 0.800000 Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif 0.800000 0.083333 0.050000 0.066667 0.116667 0.483333 0.166667 0.233333 0.000000 0.966667 0.016667 0.016667 0.966667 0.016667 0.016667 0.000000 0.083333 0.900000 0.016667 0.000000 0.833333 0.000000 0.000000 0.166667 0.050000 0.016667 0.916667 0.016667 0.000000 0.000000 0.000000 1.000000 0.033333 0.000000 0.966667 0.000000 0.066667 0.066667 0.833333 0.033333 0.933333 0.016667 0.000000 0.050000 0.016667 0.000000 0.966667 0.016667 0.050000 0.833333 0.000000 0.116667 0.850000 0.033333 0.066667 0.050000 0.166667 0.633333 0.116667 0.083333 0.150000 0.150000 0.050000 0.650000 0.150000 0.016667 0.700000 0.133333 Consensus sequence: ABCACAGTGGAGCACTG Alignment: -------ABCACAGTGGAGCACTG GGYGCTGTCCATGGTGCTGAA--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 21 AmTGTGACACCACAGT Reverse Complement Reverse Complement Forward 3 14 2.570540 Original motif 0.703125 0.187500 0.015625 0.093750 0.265625 0.500000 0.125000 0.109375 0.015625 0.046875 0.031250 0.906250 0.078125 0.015625 0.890625 0.015625 0.000000 0.000000 0.000000 1.000000 0.000000 0.031250 0.906250 0.062500 0.953125 0.000000 0.015625 0.031250 0.046875 0.890625 0.000000 0.062500 0.968750 0.000000 0.015625 0.015625 0.109375 0.781250 0.062500 0.046875 0.062500 0.890625 0.000000 0.046875 0.953125 0.000000 0.031250 0.015625 0.031250 0.781250 0.046875 0.140625 0.937500 0.015625 0.031250 0.015625 0.093750 0.078125 0.734375 0.093750 0.031250 0.078125 0.000000 0.890625 Consensus sequence: AMTGTGACACCACAGT Reverse complement motif 0.890625 0.078125 0.000000 0.031250 0.093750 0.734375 0.078125 0.093750 0.015625 0.015625 0.031250 0.937500 0.031250 0.046875 0.781250 0.140625 0.015625 0.000000 0.031250 0.953125 0.062500 0.000000 0.890625 0.046875 0.109375 0.062500 0.781250 0.046875 0.015625 0.000000 0.015625 0.968750 0.046875 0.000000 0.890625 0.062500 0.031250 0.000000 0.015625 0.953125 0.000000 0.906250 0.031250 0.062500 1.000000 0.000000 0.000000 0.000000 0.078125 0.890625 0.015625 0.015625 0.906250 0.046875 0.031250 0.015625 0.265625 0.125000 0.500000 0.109375 0.093750 0.187500 0.015625 0.703125 Consensus sequence: ACTGTGGTGTCACART Alignment: ACTGTGGTGTCACART------- --GGYGCTGTCCATGGTGCTGAA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 23 TGGAGCACTGTGACAcCACAGTGg Original Motif Original Motif Forward 12 13 3.048414 Original motif 0.054054 0.040541 0.054054 0.851351 0.040541 0.013514 0.824324 0.121622 0.094595 0.135135 0.756757 0.013514 0.891892 0.000000 0.000000 0.108108 0.040541 0.094595 0.810811 0.054054 0.081081 0.797297 0.054054 0.067568 0.932432 0.027027 0.000000 0.040541 0.054054 0.756757 0.135135 0.054054 0.108108 0.027027 0.013514 0.851351 0.108108 0.000000 0.851351 0.040541 0.013514 0.000000 0.027027 0.959459 0.000000 0.013514 0.945946 0.040541 0.905405 0.000000 0.067568 0.027027 0.054054 0.837838 0.000000 0.108108 0.945946 0.013514 0.040541 0.000000 0.162162 0.500000 0.189189 0.148649 0.108108 0.824324 0.000000 0.067568 0.945946 0.000000 0.040541 0.013514 0.081081 0.837838 0.027027 0.054054 0.945946 0.000000 0.013514 0.040541 0.054054 0.067568 0.783784 0.094595 0.054054 0.027027 0.000000 0.918919 0.040541 0.013514 0.864865 0.081081 0.148649 0.121622 0.675676 0.054054 Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif 0.148649 0.675676 0.121622 0.054054 0.040541 0.864865 0.013514 0.081081 0.918919 0.027027 0.000000 0.054054 0.054054 0.783784 0.067568 0.094595 0.040541 0.000000 0.013514 0.945946 0.081081 0.027027 0.837838 0.054054 0.013514 0.000000 0.040541 0.945946 0.108108 0.000000 0.824324 0.067568 0.162162 0.189189 0.500000 0.148649 0.000000 0.013514 0.040541 0.945946 0.054054 0.000000 0.837838 0.108108 0.027027 0.000000 0.067568 0.905405 0.000000 0.945946 0.013514 0.040541 0.959459 0.000000 0.027027 0.013514 0.108108 0.851351 0.000000 0.040541 0.851351 0.027027 0.013514 0.108108 0.054054 0.135135 0.756757 0.054054 0.040541 0.027027 0.000000 0.932432 0.081081 0.054054 0.797297 0.067568 0.040541 0.810811 0.094595 0.054054 0.108108 0.000000 0.000000 0.891892 0.094595 0.756757 0.135135 0.013514 0.040541 0.824324 0.013514 0.121622 0.851351 0.040541 0.054054 0.054054 Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA Alignment: TGGAGCACTGTGACAVCACAGTGG-------- -----------TTCAGCACCATGGACAGCKCC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 9 ESR2 Reverse Complement Reverse Complement Forward 6 13 3.051561 Original motif 0.218487 0.450980 0.176471 0.154062 0.442577 0.142857 0.114846 0.299720 0.521008 0.042017 0.431373 0.005602 0.075630 0.000000 0.770308 0.154062 0.050420 0.056022 0.893557 0.000000 0.036415 0.053221 0.092437 0.817927 0.000000 1.000000 0.000000 0.000000 0.943978 0.002801 0.000000 0.053221 0.137255 0.344538 0.316527 0.201681 0.179272 0.176471 0.417367 0.226891 0.145658 0.170868 0.411765 0.271709 0.058824 0.092437 0.067227 0.781513 0.176471 0.070028 0.742297 0.011204 0.498599 0.277311 0.053221 0.170868 0.095238 0.750700 0.005602 0.148459 0.128852 0.809524 0.000000 0.061625 0.075630 0.252101 0.000000 0.672269 0.168067 0.263305 0.380952 0.187675 Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif 0.168067 0.380952 0.263305 0.187675 0.672269 0.252101 0.000000 0.075630 0.128852 0.000000 0.809524 0.061625 0.095238 0.005602 0.750700 0.148459 0.170868 0.277311 0.053221 0.498599 0.176471 0.742297 0.070028 0.011204 0.781513 0.092437 0.067227 0.058824 0.145658 0.411765 0.170868 0.271709 0.179272 0.417367 0.176471 0.226891 0.137255 0.316527 0.344538 0.201681 0.053221 0.002801 0.000000 0.943978 0.000000 0.000000 1.000000 0.000000 0.817927 0.053221 0.092437 0.036415 0.050420 0.893557 0.056022 0.000000 0.075630 0.770308 0.000000 0.154062 0.005602 0.042017 0.431373 0.521008 0.299720 0.142857 0.114846 0.442577 0.218487 0.176471 0.450980 0.154062 Consensus sequence: BAGGYCABHBTGACCKHV Alignment: BAGGYCABHBTGACCKHV-------- -----GGYGCTGTCCATGGTGCTGAA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 1 HNF4A Reverse Complement Reverse Complement Forward 1 13 3.063746 Original motif 0.417910 0.104478 0.402985 0.074627 0.029851 0.029851 0.835821 0.104478 0.179104 0.059701 0.522388 0.238806 0.074627 0.343284 0.298507 0.283582 0.044776 0.761194 0.059701 0.134328 0.880597 0.014925 0.044776 0.059701 0.791045 0.029851 0.149254 0.029851 0.835821 0.014925 0.119403 0.029851 0.059701 0.059701 0.865672 0.014925 0.089552 0.029851 0.492537 0.388060 0.044776 0.328358 0.164179 0.462687 0.059701 0.731343 0.074627 0.134328 0.626866 0.104478 0.149254 0.119403 Consensus sequence: RGGBCAAAGKYCA Reverse complement motif 0.119403 0.104478 0.149254 0.626866 0.059701 0.074627 0.731343 0.134328 0.462687 0.328358 0.164179 0.044776 0.089552 0.492537 0.029851 0.388060 0.059701 0.865672 0.059701 0.014925 0.029851 0.014925 0.119403 0.835821 0.029851 0.029851 0.149254 0.791045 0.059701 0.014925 0.044776 0.880597 0.044776 0.059701 0.761194 0.134328 0.074627 0.298507 0.343284 0.283582 0.179104 0.522388 0.059701 0.238806 0.029851 0.835821 0.029851 0.104478 0.074627 0.104478 0.402985 0.417910 Consensus sequence: TGMYCTTTGBCCK Alignment: TGMYCTTTGBCCK-------- GGYGCTGTCCATGGTGCTGAA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 14 PPARGRXRA Original Motif Original Motif Backward 3 13 3.065736 Original motif 0.109685 0.369895 0.373396 0.147025 0.117716 0.193473 0.148019 0.540793 0.453488 0.026744 0.427907 0.091860 0.116144 0.003484 0.779326 0.101045 0.161253 0.017401 0.781903 0.039443 0.168213 0.149652 0.458237 0.223898 0.082271 0.633835 0.207416 0.076477 0.949015 0.024334 0.017381 0.009270 0.604867 0.055620 0.312862 0.026651 0.825231 0.005787 0.158565 0.010417 0.095017 0.002317 0.888760 0.013905 0.047509 0.010429 0.803013 0.139050 0.025492 0.114716 0.304751 0.555041 0.062645 0.643852 0.167053 0.126450 0.784223 0.067285 0.054524 0.093968 Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif 0.093968 0.067285 0.054524 0.784223 0.062645 0.167053 0.643852 0.126450 0.555041 0.114716 0.304751 0.025492 0.047509 0.803013 0.010429 0.139050 0.095017 0.888760 0.002317 0.013905 0.010417 0.005787 0.158565 0.825231 0.026651 0.055620 0.312862 0.604867 0.009270 0.024334 0.017381 0.949015 0.082271 0.207416 0.633835 0.076477 0.168213 0.458237 0.149652 0.223898 0.161253 0.781903 0.017401 0.039443 0.116144 0.779326 0.003484 0.101045 0.091860 0.026744 0.427907 0.453488 0.540793 0.193473 0.148019 0.117716 0.109685 0.373396 0.369895 0.147025 Consensus sequence: TGRCCTKTGHCCKAB Alignment: --------BTRGGDCARAGGKCA TTCAGCACCATGGACAGCKCC-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 22 CACTGTGrYrtCACAGTGswsCAcT Original Motif Reverse Complement Forward 14 12 3.559031 Original motif 0.111111 0.746032 0.063492 0.079365 0.857143 0.047619 0.047619 0.047619 0.047619 0.857143 0.079365 0.015873 0.031746 0.000000 0.000000 0.968254 0.031746 0.015873 0.904762 0.047619 0.000000 0.000000 0.000000 1.000000 0.031746 0.000000 0.857143 0.111111 0.396825 0.111111 0.412698 0.079365 0.031746 0.253968 0.015873 0.698413 0.365079 0.000000 0.634921 0.000000 0.079365 0.206349 0.047619 0.666667 0.047619 0.936508 0.015873 0.000000 0.952381 0.000000 0.015873 0.031746 0.015873 0.920635 0.000000 0.063492 0.920635 0.000000 0.000000 0.079365 0.063492 0.047619 0.841270 0.047619 0.000000 0.000000 0.015873 0.984127 0.047619 0.015873 0.904762 0.031746 0.015873 0.603175 0.317460 0.063492 0.396825 0.000000 0.015873 0.587302 0.015873 0.476190 0.428571 0.079365 0.063492 0.920635 0.000000 0.015873 0.920635 0.015873 0.047619 0.015873 0.095238 0.682540 0.095238 0.126984 0.047619 0.015873 0.095238 0.841270 Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif 0.841270 0.015873 0.095238 0.047619 0.095238 0.095238 0.682540 0.126984 0.015873 0.015873 0.047619 0.920635 0.063492 0.000000 0.920635 0.015873 0.015873 0.428571 0.476190 0.079365 0.587302 0.000000 0.015873 0.396825 0.015873 0.317460 0.603175 0.063492 0.047619 0.904762 0.015873 0.031746 0.984127 0.000000 0.015873 0.000000 0.063492 0.841270 0.047619 0.047619 0.079365 0.000000 0.000000 0.920635 0.015873 0.000000 0.920635 0.063492 0.031746 0.000000 0.015873 0.952381 0.047619 0.015873 0.936508 0.000000 0.666667 0.206349 0.047619 0.079365 0.365079 0.634921 0.000000 0.000000 0.698413 0.253968 0.015873 0.031746 0.396825 0.412698 0.111111 0.079365 0.031746 0.857143 0.000000 0.111111 1.000000 0.000000 0.000000 0.000000 0.031746 0.904762 0.015873 0.047619 0.968254 0.000000 0.000000 0.031746 0.047619 0.079365 0.857143 0.015873 0.047619 0.047619 0.047619 0.857143 0.111111 0.063492 0.746032 0.079365 Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG Alignment: AGTGSWSCACTGTGAMAMCACAGTG--------- -------------TTCAGCACCATGGACAGCKCC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 25 wwCCAmAGTCmt Reverse Complement Reverse Complement Forward 1 12 3.563057 Original motif 0.454545 0.045455 0.227273 0.272727 0.363636 0.136364 0.136364 0.363636 0.000000 1.000000 0.000000 0.000000 0.000000 0.954545 0.045455 0.000000 1.000000 0.000000 0.000000 0.000000 0.409091 0.590909 0.000000 0.000000 0.909091 0.045455 0.045455 0.000000 0.000000 0.000000 1.000000 0.000000 0.045455 0.000000 0.000000 0.954545 0.045455 0.909091 0.000000 0.045455 0.272727 0.318182 0.181818 0.227273 0.181818 0.227273 0.227273 0.363636 Consensus sequence: DDCCAMAGTCHB Reverse complement motif 0.363636 0.227273 0.227273 0.181818 0.272727 0.181818 0.318182 0.227273 0.045455 0.000000 0.909091 0.045455 0.954545 0.000000 0.000000 0.045455 0.000000 1.000000 0.000000 0.000000 0.000000 0.045455 0.045455 0.909091 0.409091 0.000000 0.590909 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.045455 0.954545 0.000000 0.000000 0.000000 1.000000 0.000000 0.363636 0.136364 0.136364 0.363636 0.272727 0.045455 0.227273 0.454545 Consensus sequence: VDGACTRTGGDD Alignment: VDGACTRTGGDD--------- GGYGCTGTCCATGGTGCTGAA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 8 Motif name: Myc Original motif 0.295154 0.422907 0.158590 0.123348 0.149780 0.233480 0.572687 0.044053 0.035242 0.964758 0.000000 0.000000 0.955947 0.017621 0.022026 0.004405 0.000000 0.933921 0.013216 0.052863 0.083700 0.008811 0.898678 0.008811 0.039648 0.193833 0.000000 0.766520 0.000000 0.008811 0.951542 0.039648 0.000000 0.074890 0.806167 0.118943 0.198238 0.471366 0.105727 0.224670 Consensus sequence: VGCACGTGGH Reserve complement motif 0.198238 0.105727 0.471366 0.224670 0.000000 0.806167 0.074890 0.118943 0.000000 0.951542 0.008811 0.039648 0.766520 0.193833 0.000000 0.039648 0.083700 0.898678 0.008811 0.008811 0.000000 0.013216 0.933921 0.052863 0.004405 0.017621 0.022026 0.955947 0.035242 0.000000 0.964758 0.000000 0.149780 0.572687 0.233480 0.044053 0.295154 0.158590 0.422907 0.123348 Consensus sequence: DCCACGTGCV ************************************************************************ Best Matches for Motif ID 8 (Highest to Lowest) ************************************************************************ Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 6 Mycn Original Motif Original Motif Backward 1 10 0.000000 Original motif 0.349315 0.363014 0.143836 0.143836 0.089041 0.388128 0.447489 0.075342 0.015982 0.984018 0.000000 0.000000 0.945205 0.000000 0.041096 0.013699 0.000000 0.961187 0.018265 0.020548 0.070776 0.002283 0.924658 0.002283 0.054795 0.221461 0.004566 0.719178 0.000000 0.000000 0.938356 0.061644 0.061644 0.111872 0.739726 0.086758 0.139269 0.605023 0.091324 0.164384 Consensus sequence: HSCACGTGGC Reverse complement motif 0.139269 0.091324 0.605023 0.164384 0.061644 0.739726 0.111872 0.086758 0.000000 0.938356 0.000000 0.061644 0.719178 0.221461 0.004566 0.054795 0.070776 0.924658 0.002283 0.002283 0.000000 0.018265 0.961187 0.020548 0.013699 0.000000 0.041096 0.945205 0.015982 0.000000 0.984018 0.000000 0.089041 0.447489 0.388128 0.075342 0.349315 0.143836 0.363014 0.143836 Consensus sequence: GCCACGTGSD Alignment: HSCACGTGGC VGCACGTGGH ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 18 sscCCCGCGcs Reverse Complement Original Motif Forward 2 10 0.064853 Original motif 0.147059 0.441176 0.264706 0.147059 0.117647 0.529412 0.294118 0.058824 0.000000 0.676471 0.235294 0.088235 0.029412 0.852941 0.117647 0.000000 0.000000 0.823529 0.176471 0.000000 0.000000 0.794118 0.205882 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.058824 0.941176 0.000000 0.117647 0.470588 0.235294 0.176471 0.000000 0.323529 0.529412 0.147059 Consensus sequence: BSCCCCGCGBS Reverse complement motif 0.000000 0.529412 0.323529 0.147059 0.117647 0.235294 0.470588 0.176471 0.000000 0.941176 0.058824 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.205882 0.794118 0.000000 0.000000 0.176471 0.823529 0.000000 0.029412 0.117647 0.852941 0.000000 0.000000 0.235294 0.676471 0.088235 0.117647 0.294118 0.529412 0.058824 0.147059 0.264706 0.441176 0.147059 Consensus sequence: SBCGCGGGGSB Alignment: BSCCCCGCGBS -DCCACGTGCV ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 24 ssCCCCGCSssk Reverse Complement Original Motif Backward 2 10 0.072859 Original motif 0.000000 0.444444 0.370370 0.185185 0.111111 0.407407 0.333333 0.148148 0.000000 0.888889 0.037037 0.074074 0.000000 0.888889 0.074074 0.037037 0.000000 0.777778 0.222222 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.037037 0.888889 0.000000 0.074074 0.000000 0.703704 0.296296 0.000000 0.000000 0.518519 0.370370 0.111111 0.111111 0.407407 0.259259 0.222222 0.074074 0.222222 0.407407 0.296296 Consensus sequence: SBCCCCGCCSBB Reverse complement motif 0.074074 0.407407 0.222222 0.296296 0.111111 0.259259 0.407407 0.222222 0.000000 0.370370 0.518519 0.111111 0.000000 0.296296 0.703704 0.000000 0.037037 0.000000 0.888889 0.074074 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.222222 0.777778 0.000000 0.000000 0.074074 0.888889 0.037037 0.000000 0.037037 0.888889 0.074074 0.111111 0.333333 0.407407 0.148148 0.000000 0.370370 0.444444 0.185185 Consensus sequence: BBSGGCGGGGBS Alignment: SBCCCCGCCSBB -DCCACGTGCV- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 16 CTCF Reverse Complement Original Motif Backward 8 10 0.075426 Original motif 0.095290 0.318729 0.083242 0.502738 0.182913 0.158817 0.453450 0.204819 0.307777 0.053669 0.491785 0.146769 0.061336 0.876232 0.023001 0.039430 0.008762 0.989047 0.000000 0.002191 0.814896 0.014239 0.071194 0.099671 0.043812 0.578313 0.365827 0.012048 0.117325 0.474781 0.052632 0.355263 0.933114 0.012061 0.035088 0.019737 0.005488 0.000000 0.991218 0.003293 0.365532 0.003293 0.621295 0.009879 0.059276 0.013172 0.553238 0.374314 0.013187 0.000000 0.978022 0.008791 0.061538 0.008791 0.851648 0.078022 0.114411 0.806381 0.005501 0.073707 0.409241 0.014301 0.557756 0.018702 0.090308 0.530837 0.338106 0.040749 0.128855 0.354626 0.080396 0.436123 0.442731 0.199339 0.292952 0.064978 Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif 0.064978 0.199339 0.292952 0.442731 0.436123 0.354626 0.080396 0.128855 0.090308 0.338106 0.530837 0.040749 0.409241 0.557756 0.014301 0.018702 0.114411 0.005501 0.806381 0.073707 0.061538 0.851648 0.008791 0.078022 0.013187 0.978022 0.000000 0.008791 0.059276 0.553238 0.013172 0.374314 0.365532 0.621295 0.003293 0.009879 0.005488 0.991218 0.000000 0.003293 0.019737 0.012061 0.035088 0.933114 0.117325 0.052632 0.474781 0.355263 0.043812 0.365827 0.578313 0.012048 0.099671 0.014239 0.071194 0.814896 0.008762 0.000000 0.989047 0.002191 0.061336 0.023001 0.876232 0.039430 0.307777 0.491785 0.053669 0.146769 0.182913 0.453450 0.158817 0.204819 0.502738 0.318729 0.083242 0.095290 Consensus sequence: BMSMGCCYMCTKSTGGMHM Alignment: YDRCCASYAGRKGGCRSYV --DCCACGTGCV------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 22 CACTGTGrYrtCACAGTGswsCAcT Reverse Complement Original Motif Backward 6 10 0.088891 Original motif 0.111111 0.746032 0.063492 0.079365 0.857143 0.047619 0.047619 0.047619 0.047619 0.857143 0.079365 0.015873 0.031746 0.000000 0.000000 0.968254 0.031746 0.015873 0.904762 0.047619 0.000000 0.000000 0.000000 1.000000 0.031746 0.000000 0.857143 0.111111 0.396825 0.111111 0.412698 0.079365 0.031746 0.253968 0.015873 0.698413 0.365079 0.000000 0.634921 0.000000 0.079365 0.206349 0.047619 0.666667 0.047619 0.936508 0.015873 0.000000 0.952381 0.000000 0.015873 0.031746 0.015873 0.920635 0.000000 0.063492 0.920635 0.000000 0.000000 0.079365 0.063492 0.047619 0.841270 0.047619 0.000000 0.000000 0.015873 0.984127 0.047619 0.015873 0.904762 0.031746 0.015873 0.603175 0.317460 0.063492 0.396825 0.000000 0.015873 0.587302 0.015873 0.476190 0.428571 0.079365 0.063492 0.920635 0.000000 0.015873 0.920635 0.015873 0.047619 0.015873 0.095238 0.682540 0.095238 0.126984 0.047619 0.015873 0.095238 0.841270 Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif 0.841270 0.015873 0.095238 0.047619 0.095238 0.095238 0.682540 0.126984 0.015873 0.015873 0.047619 0.920635 0.063492 0.000000 0.920635 0.015873 0.015873 0.428571 0.476190 0.079365 0.587302 0.000000 0.015873 0.396825 0.015873 0.317460 0.603175 0.063492 0.047619 0.904762 0.015873 0.031746 0.984127 0.000000 0.015873 0.000000 0.063492 0.841270 0.047619 0.047619 0.079365 0.000000 0.000000 0.920635 0.015873 0.000000 0.920635 0.063492 0.031746 0.000000 0.015873 0.952381 0.047619 0.015873 0.936508 0.000000 0.666667 0.206349 0.047619 0.079365 0.365079 0.634921 0.000000 0.000000 0.698413 0.253968 0.015873 0.031746 0.396825 0.412698 0.111111 0.079365 0.031746 0.857143 0.000000 0.111111 1.000000 0.000000 0.000000 0.000000 0.031746 0.904762 0.015873 0.047619 0.968254 0.000000 0.000000 0.031746 0.047619 0.079365 0.857143 0.015873 0.047619 0.047619 0.047619 0.857143 0.111111 0.063492 0.746032 0.079365 Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG Alignment: CACTGTGRTRTCACAGTGSWSCACT ----------DCCACGTGCV----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 1 HNF4A Original Motif Reverse Complement Backward 1 10 0.093449 Original motif 0.417910 0.104478 0.402985 0.074627 0.029851 0.029851 0.835821 0.104478 0.179104 0.059701 0.522388 0.238806 0.074627 0.343284 0.298507 0.283582 0.044776 0.761194 0.059701 0.134328 0.880597 0.014925 0.044776 0.059701 0.791045 0.029851 0.149254 0.029851 0.835821 0.014925 0.119403 0.029851 0.059701 0.059701 0.865672 0.014925 0.089552 0.029851 0.492537 0.388060 0.044776 0.328358 0.164179 0.462687 0.059701 0.731343 0.074627 0.134328 0.626866 0.104478 0.149254 0.119403 Consensus sequence: RGGBCAAAGKYCA Reverse complement motif 0.119403 0.104478 0.149254 0.626866 0.059701 0.074627 0.731343 0.134328 0.462687 0.328358 0.164179 0.044776 0.089552 0.492537 0.029851 0.388060 0.059701 0.865672 0.059701 0.014925 0.029851 0.014925 0.119403 0.835821 0.029851 0.029851 0.149254 0.791045 0.059701 0.014925 0.044776 0.880597 0.044776 0.059701 0.761194 0.134328 0.074627 0.298507 0.343284 0.283582 0.179104 0.522388 0.059701 0.238806 0.029851 0.835821 0.029851 0.104478 0.074627 0.104478 0.402985 0.417910 Consensus sequence: TGMYCTTTGBCCK Alignment: TGMYCTTTGBCCK ---VGCACGTGGH ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 3 ESR1 Reverse Complement Reverse Complement Forward 9 10 0.094044 Original motif 0.261242 0.256959 0.329764 0.152034 0.228632 0.170940 0.350427 0.250000 0.136752 0.369658 0.318376 0.175214 0.176596 0.487234 0.138298 0.197872 0.285106 0.493617 0.100000 0.121277 0.651163 0.059197 0.188161 0.101480 0.075949 0.016878 0.816456 0.090717 0.040000 0.037895 0.884211 0.037895 0.069474 0.086316 0.191579 0.652632 0.008421 0.829474 0.111579 0.050526 0.837895 0.027368 0.056842 0.077895 0.122105 0.526316 0.225263 0.126316 0.132632 0.581053 0.111579 0.174737 0.134737 0.543158 0.204211 0.117895 0.067368 0.040000 0.016842 0.875789 0.044211 0.046316 0.896842 0.012632 0.642105 0.223158 0.065263 0.069474 0.021053 0.917895 0.025263 0.035789 0.124211 0.743158 0.004211 0.128421 0.054737 0.347368 0.046316 0.551579 Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif 0.551579 0.347368 0.046316 0.054737 0.124211 0.004211 0.743158 0.128421 0.021053 0.025263 0.917895 0.035789 0.069474 0.223158 0.065263 0.642105 0.044211 0.896842 0.046316 0.012632 0.875789 0.040000 0.016842 0.067368 0.134737 0.204211 0.543158 0.117895 0.132632 0.111579 0.581053 0.174737 0.122105 0.225263 0.526316 0.126316 0.077895 0.027368 0.056842 0.837895 0.008421 0.111579 0.829474 0.050526 0.652632 0.086316 0.191579 0.069474 0.040000 0.884211 0.037895 0.037895 0.075949 0.816456 0.016878 0.090717 0.101480 0.059197 0.188161 0.651163 0.285106 0.100000 0.493617 0.121277 0.176596 0.138298 0.487234 0.197872 0.136752 0.318376 0.369658 0.175214 0.228632 0.350427 0.170940 0.250000 0.261242 0.329764 0.256959 0.152034 Consensus sequence: MGGTCAGGGTGACCTRDBHV Alignment: MGGTCAGGGTGACCTRDBHV --------DCCACGTGCV-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 20 CagTGCTCCACTGTGgT Reverse Complement Reverse Complement Backward 7 10 0.095523 Original motif 0.150000 0.700000 0.016667 0.133333 0.650000 0.150000 0.050000 0.150000 0.166667 0.116667 0.633333 0.083333 0.050000 0.033333 0.066667 0.850000 0.050000 0.000000 0.833333 0.116667 0.016667 0.966667 0.000000 0.016667 0.050000 0.016667 0.000000 0.933333 0.066667 0.833333 0.066667 0.033333 0.033333 0.966667 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.050000 0.916667 0.016667 0.016667 0.166667 0.000000 0.000000 0.833333 0.083333 0.016667 0.900000 0.000000 0.000000 0.016667 0.016667 0.966667 0.000000 0.016667 0.966667 0.016667 0.116667 0.166667 0.483333 0.233333 0.066667 0.083333 0.050000 0.800000 Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif 0.800000 0.083333 0.050000 0.066667 0.116667 0.483333 0.166667 0.233333 0.000000 0.966667 0.016667 0.016667 0.966667 0.016667 0.016667 0.000000 0.083333 0.900000 0.016667 0.000000 0.833333 0.000000 0.000000 0.166667 0.050000 0.016667 0.916667 0.016667 0.000000 0.000000 0.000000 1.000000 0.033333 0.000000 0.966667 0.000000 0.066667 0.066667 0.833333 0.033333 0.933333 0.016667 0.000000 0.050000 0.016667 0.000000 0.966667 0.016667 0.050000 0.833333 0.000000 0.116667 0.850000 0.033333 0.066667 0.050000 0.166667 0.633333 0.116667 0.083333 0.150000 0.150000 0.050000 0.650000 0.150000 0.016667 0.700000 0.133333 Consensus sequence: ABCACAGTGGAGCACTG Alignment: ABCACAGTGGAGCACTG -DCCACGTGCV------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 9 ESR2 Original Motif Original Motif Forward 5 10 0.096860 Original motif 0.218487 0.450980 0.176471 0.154062 0.442577 0.142857 0.114846 0.299720 0.521008 0.042017 0.431373 0.005602 0.075630 0.000000 0.770308 0.154062 0.050420 0.056022 0.893557 0.000000 0.036415 0.053221 0.092437 0.817927 0.000000 1.000000 0.000000 0.000000 0.943978 0.002801 0.000000 0.053221 0.137255 0.344538 0.316527 0.201681 0.179272 0.176471 0.417367 0.226891 0.145658 0.170868 0.411765 0.271709 0.058824 0.092437 0.067227 0.781513 0.176471 0.070028 0.742297 0.011204 0.498599 0.277311 0.053221 0.170868 0.095238 0.750700 0.005602 0.148459 0.128852 0.809524 0.000000 0.061625 0.075630 0.252101 0.000000 0.672269 0.168067 0.263305 0.380952 0.187675 Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif 0.168067 0.380952 0.263305 0.187675 0.672269 0.252101 0.000000 0.075630 0.128852 0.000000 0.809524 0.061625 0.095238 0.005602 0.750700 0.148459 0.170868 0.277311 0.053221 0.498599 0.176471 0.742297 0.070028 0.011204 0.781513 0.092437 0.067227 0.058824 0.145658 0.411765 0.170868 0.271709 0.179272 0.417367 0.176471 0.226891 0.137255 0.316527 0.344538 0.201681 0.053221 0.002801 0.000000 0.943978 0.000000 0.000000 1.000000 0.000000 0.817927 0.053221 0.092437 0.036415 0.050420 0.893557 0.056022 0.000000 0.075630 0.770308 0.000000 0.154062 0.005602 0.042017 0.431373 0.521008 0.299720 0.142857 0.114846 0.442577 0.218487 0.176471 0.450980 0.154062 Consensus sequence: BAGGYCABHBTGACCKHV Alignment: VHRGGTCABDBTGMCCTB ----VGCACGTGGH---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 23 TGGAGCACTGTGACAcCACAGTGg Reverse Complement Original Motif Backward 11 10 0.097113 Original motif 0.054054 0.040541 0.054054 0.851351 0.040541 0.013514 0.824324 0.121622 0.094595 0.135135 0.756757 0.013514 0.891892 0.000000 0.000000 0.108108 0.040541 0.094595 0.810811 0.054054 0.081081 0.797297 0.054054 0.067568 0.932432 0.027027 0.000000 0.040541 0.054054 0.756757 0.135135 0.054054 0.108108 0.027027 0.013514 0.851351 0.108108 0.000000 0.851351 0.040541 0.013514 0.000000 0.027027 0.959459 0.000000 0.013514 0.945946 0.040541 0.905405 0.000000 0.067568 0.027027 0.054054 0.837838 0.000000 0.108108 0.945946 0.013514 0.040541 0.000000 0.162162 0.500000 0.189189 0.148649 0.108108 0.824324 0.000000 0.067568 0.945946 0.000000 0.040541 0.013514 0.081081 0.837838 0.027027 0.054054 0.945946 0.000000 0.013514 0.040541 0.054054 0.067568 0.783784 0.094595 0.054054 0.027027 0.000000 0.918919 0.040541 0.013514 0.864865 0.081081 0.148649 0.121622 0.675676 0.054054 Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif 0.148649 0.675676 0.121622 0.054054 0.040541 0.864865 0.013514 0.081081 0.918919 0.027027 0.000000 0.054054 0.054054 0.783784 0.067568 0.094595 0.040541 0.000000 0.013514 0.945946 0.081081 0.027027 0.837838 0.054054 0.013514 0.000000 0.040541 0.945946 0.108108 0.000000 0.824324 0.067568 0.162162 0.189189 0.500000 0.148649 0.000000 0.013514 0.040541 0.945946 0.054054 0.000000 0.837838 0.108108 0.027027 0.000000 0.067568 0.905405 0.000000 0.945946 0.013514 0.040541 0.959459 0.000000 0.027027 0.013514 0.108108 0.851351 0.000000 0.040541 0.851351 0.027027 0.013514 0.108108 0.054054 0.135135 0.756757 0.054054 0.040541 0.027027 0.000000 0.932432 0.081081 0.054054 0.797297 0.067568 0.040541 0.810811 0.094595 0.054054 0.108108 0.000000 0.000000 0.891892 0.094595 0.756757 0.135135 0.013514 0.040541 0.824324 0.013514 0.121622 0.851351 0.040541 0.054054 0.054054 Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA Alignment: TGGAGCACTGTGACAVCACAGTGG ----DCCACGTGCV---------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 9 Motif name: ESR2 Original motif 0.218487 0.450980 0.176471 0.154062 0.442577 0.142857 0.114846 0.299720 0.521008 0.042017 0.431373 0.005602 0.075630 0.000000 0.770308 0.154062 0.050420 0.056022 0.893557 0.000000 0.036415 0.053221 0.092437 0.817927 0.000000 1.000000 0.000000 0.000000 0.943978 0.002801 0.000000 0.053221 0.137255 0.344538 0.316527 0.201681 0.179272 0.176471 0.417367 0.226891 0.145658 0.170868 0.411765 0.271709 0.058824 0.092437 0.067227 0.781513 0.176471 0.070028 0.742297 0.011204 0.498599 0.277311 0.053221 0.170868 0.095238 0.750700 0.005602 0.148459 0.128852 0.809524 0.000000 0.061625 0.075630 0.252101 0.000000 0.672269 0.168067 0.263305 0.380952 0.187675 Consensus sequence: VHRGGTCABDBTGMCCTB Reserve complement motif 0.168067 0.380952 0.263305 0.187675 0.672269 0.252101 0.000000 0.075630 0.128852 0.000000 0.809524 0.061625 0.095238 0.005602 0.750700 0.148459 0.170868 0.277311 0.053221 0.498599 0.176471 0.742297 0.070028 0.011204 0.781513 0.092437 0.067227 0.058824 0.145658 0.411765 0.170868 0.271709 0.179272 0.417367 0.176471 0.226891 0.137255 0.316527 0.344538 0.201681 0.053221 0.002801 0.000000 0.943978 0.000000 0.000000 1.000000 0.000000 0.817927 0.053221 0.092437 0.036415 0.050420 0.893557 0.056022 0.000000 0.075630 0.770308 0.000000 0.154062 0.005602 0.042017 0.431373 0.521008 0.299720 0.142857 0.114846 0.442577 0.218487 0.176471 0.450980 0.154062 Consensus sequence: BAGGYCABHBTGACCKHV ************************************************************************ Best Matches for Motif ID 9 (Highest to Lowest) ************************************************************************ Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 23 TGGAGCACTGTGACAcCACAGTGg Original Motif Reverse Complement Forward 7 18 0.071776 Original motif 0.054054 0.040541 0.054054 0.851351 0.040541 0.013514 0.824324 0.121622 0.094595 0.135135 0.756757 0.013514 0.891892 0.000000 0.000000 0.108108 0.040541 0.094595 0.810811 0.054054 0.081081 0.797297 0.054054 0.067568 0.932432 0.027027 0.000000 0.040541 0.054054 0.756757 0.135135 0.054054 0.108108 0.027027 0.013514 0.851351 0.108108 0.000000 0.851351 0.040541 0.013514 0.000000 0.027027 0.959459 0.000000 0.013514 0.945946 0.040541 0.905405 0.000000 0.067568 0.027027 0.054054 0.837838 0.000000 0.108108 0.945946 0.013514 0.040541 0.000000 0.162162 0.500000 0.189189 0.148649 0.108108 0.824324 0.000000 0.067568 0.945946 0.000000 0.040541 0.013514 0.081081 0.837838 0.027027 0.054054 0.945946 0.000000 0.013514 0.040541 0.054054 0.067568 0.783784 0.094595 0.054054 0.027027 0.000000 0.918919 0.040541 0.013514 0.864865 0.081081 0.148649 0.121622 0.675676 0.054054 Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif 0.148649 0.675676 0.121622 0.054054 0.040541 0.864865 0.013514 0.081081 0.918919 0.027027 0.000000 0.054054 0.054054 0.783784 0.067568 0.094595 0.040541 0.000000 0.013514 0.945946 0.081081 0.027027 0.837838 0.054054 0.013514 0.000000 0.040541 0.945946 0.108108 0.000000 0.824324 0.067568 0.162162 0.189189 0.500000 0.148649 0.000000 0.013514 0.040541 0.945946 0.054054 0.000000 0.837838 0.108108 0.027027 0.000000 0.067568 0.905405 0.000000 0.945946 0.013514 0.040541 0.959459 0.000000 0.027027 0.013514 0.108108 0.851351 0.000000 0.040541 0.851351 0.027027 0.013514 0.108108 0.054054 0.135135 0.756757 0.054054 0.040541 0.027027 0.000000 0.932432 0.081081 0.054054 0.797297 0.067568 0.040541 0.810811 0.094595 0.054054 0.108108 0.000000 0.000000 0.891892 0.094595 0.756757 0.135135 0.013514 0.040541 0.824324 0.013514 0.121622 0.851351 0.040541 0.054054 0.054054 Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA Alignment: CCACTGTGVTGTCACAGTGCTCCA ------VHRGGTCABDBTGMCCTB ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 22 CACTGTGrYrtCACAGTGswsCAcT Original Motif Reverse Complement Backward 7 18 0.081590 Original motif 0.111111 0.746032 0.063492 0.079365 0.857143 0.047619 0.047619 0.047619 0.047619 0.857143 0.079365 0.015873 0.031746 0.000000 0.000000 0.968254 0.031746 0.015873 0.904762 0.047619 0.000000 0.000000 0.000000 1.000000 0.031746 0.000000 0.857143 0.111111 0.396825 0.111111 0.412698 0.079365 0.031746 0.253968 0.015873 0.698413 0.365079 0.000000 0.634921 0.000000 0.079365 0.206349 0.047619 0.666667 0.047619 0.936508 0.015873 0.000000 0.952381 0.000000 0.015873 0.031746 0.015873 0.920635 0.000000 0.063492 0.920635 0.000000 0.000000 0.079365 0.063492 0.047619 0.841270 0.047619 0.000000 0.000000 0.015873 0.984127 0.047619 0.015873 0.904762 0.031746 0.015873 0.603175 0.317460 0.063492 0.396825 0.000000 0.015873 0.587302 0.015873 0.476190 0.428571 0.079365 0.063492 0.920635 0.000000 0.015873 0.920635 0.015873 0.047619 0.015873 0.095238 0.682540 0.095238 0.126984 0.047619 0.015873 0.095238 0.841270 Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif 0.841270 0.015873 0.095238 0.047619 0.095238 0.095238 0.682540 0.126984 0.015873 0.015873 0.047619 0.920635 0.063492 0.000000 0.920635 0.015873 0.015873 0.428571 0.476190 0.079365 0.587302 0.000000 0.015873 0.396825 0.015873 0.317460 0.603175 0.063492 0.047619 0.904762 0.015873 0.031746 0.984127 0.000000 0.015873 0.000000 0.063492 0.841270 0.047619 0.047619 0.079365 0.000000 0.000000 0.920635 0.015873 0.000000 0.920635 0.063492 0.031746 0.000000 0.015873 0.952381 0.047619 0.015873 0.936508 0.000000 0.666667 0.206349 0.047619 0.079365 0.365079 0.634921 0.000000 0.000000 0.698413 0.253968 0.015873 0.031746 0.396825 0.412698 0.111111 0.079365 0.031746 0.857143 0.000000 0.111111 1.000000 0.000000 0.000000 0.000000 0.031746 0.904762 0.015873 0.047619 0.968254 0.000000 0.000000 0.031746 0.047619 0.079365 0.857143 0.015873 0.047619 0.047619 0.047619 0.857143 0.111111 0.063492 0.746032 0.079365 Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG Alignment: AGTGSWSCACTGTGAMAMCACAGTG -VHRGGTCABDBTGMCCTB------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 7 REST Original Motif Reverse Complement Backward 3 18 0.091696 Original motif 0.132621 0.109365 0.230044 0.527970 0.036318 0.168441 0.091421 0.703820 0.047589 0.855354 0.031309 0.065748 0.906367 0.018727 0.058677 0.016230 0.021197 0.027431 0.945137 0.006234 0.076012 0.609346 0.201246 0.113396 0.980697 0.004359 0.007472 0.007472 0.001868 0.987547 0.007472 0.003113 0.021793 0.922167 0.012453 0.043587 0.568847 0.125234 0.100935 0.204984 0.136534 0.233791 0.077307 0.552369 0.024314 0.004364 0.966958 0.004364 0.012469 0.003117 0.983167 0.001247 0.877105 0.069869 0.021210 0.031815 0.008125 0.800000 0.145625 0.046250 0.983750 0.005625 0.004375 0.006250 0.026349 0.008156 0.959849 0.005646 0.128688 0.632141 0.114878 0.124294 0.229899 0.019472 0.432161 0.318467 0.133962 0.586792 0.200629 0.078616 0.112579 0.700629 0.023270 0.163522 Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif 0.112579 0.023270 0.700629 0.163522 0.133962 0.200629 0.586792 0.078616 0.229899 0.432161 0.019472 0.318467 0.128688 0.114878 0.632141 0.124294 0.026349 0.959849 0.008156 0.005646 0.006250 0.005625 0.004375 0.983750 0.008125 0.145625 0.800000 0.046250 0.031815 0.069869 0.021210 0.877105 0.012469 0.983167 0.003117 0.001247 0.024314 0.966958 0.004364 0.004364 0.552369 0.233791 0.077307 0.136534 0.204984 0.125234 0.100935 0.568847 0.021793 0.012453 0.922167 0.043587 0.001868 0.007472 0.987547 0.003113 0.007472 0.004359 0.007472 0.980697 0.076012 0.201246 0.609346 0.113396 0.021197 0.945137 0.027431 0.006234 0.016230 0.018727 0.058677 0.906367 0.047589 0.031309 0.855354 0.065748 0.703820 0.168441 0.091421 0.036318 0.527970 0.109365 0.230044 0.132621 Consensus sequence: GGYGCTGTCCATGGTGCTGAA Alignment: GGYGCTGTCCATGGTGCTGAA -VHRGGTCABDBTGMCCTB-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 3 ESR1 Original Motif Original Motif Forward 4 17 0.511812 Original motif 0.261242 0.256959 0.329764 0.152034 0.228632 0.170940 0.350427 0.250000 0.136752 0.369658 0.318376 0.175214 0.176596 0.487234 0.138298 0.197872 0.285106 0.493617 0.100000 0.121277 0.651163 0.059197 0.188161 0.101480 0.075949 0.016878 0.816456 0.090717 0.040000 0.037895 0.884211 0.037895 0.069474 0.086316 0.191579 0.652632 0.008421 0.829474 0.111579 0.050526 0.837895 0.027368 0.056842 0.077895 0.122105 0.526316 0.225263 0.126316 0.132632 0.581053 0.111579 0.174737 0.134737 0.543158 0.204211 0.117895 0.067368 0.040000 0.016842 0.875789 0.044211 0.046316 0.896842 0.012632 0.642105 0.223158 0.065263 0.069474 0.021053 0.917895 0.025263 0.035789 0.124211 0.743158 0.004211 0.128421 0.054737 0.347368 0.046316 0.551579 Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif 0.551579 0.347368 0.046316 0.054737 0.124211 0.004211 0.743158 0.128421 0.021053 0.025263 0.917895 0.035789 0.069474 0.223158 0.065263 0.642105 0.044211 0.896842 0.046316 0.012632 0.875789 0.040000 0.016842 0.067368 0.134737 0.204211 0.543158 0.117895 0.132632 0.111579 0.581053 0.174737 0.122105 0.225263 0.526316 0.126316 0.077895 0.027368 0.056842 0.837895 0.008421 0.111579 0.829474 0.050526 0.652632 0.086316 0.191579 0.069474 0.040000 0.884211 0.037895 0.037895 0.075949 0.816456 0.016878 0.090717 0.101480 0.059197 0.188161 0.651163 0.285106 0.100000 0.493617 0.121277 0.176596 0.138298 0.487234 0.197872 0.136752 0.318376 0.369658 0.175214 0.228632 0.350427 0.170940 0.250000 0.261242 0.329764 0.256959 0.152034 Consensus sequence: MGGTCAGGGTGACCTRDBHV Alignment: VDBHMAGGTCACCCTGACCY- ---VHRGGTCABDBTGMCCTB ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 17 TgTGgTGTCACAGTGCTCC Original Motif Original Motif Forward 3 17 0.569595 Original motif 0.111111 0.083333 0.055556 0.750000 0.125000 0.097222 0.652778 0.125000 0.041667 0.097222 0.027778 0.833333 0.027778 0.027778 0.791667 0.152778 0.055556 0.166667 0.652778 0.125000 0.000000 0.041667 0.013889 0.944444 0.041667 0.000000 0.888889 0.069444 0.027778 0.027778 0.000000 0.944444 0.041667 0.944444 0.013889 0.000000 0.916667 0.027778 0.000000 0.055556 0.069444 0.875000 0.000000 0.055556 0.833333 0.013889 0.013889 0.138889 0.041667 0.069444 0.819444 0.069444 0.027778 0.027778 0.027778 0.916667 0.069444 0.013889 0.847222 0.069444 0.069444 0.777778 0.027778 0.125000 0.055556 0.041667 0.027778 0.875000 0.041667 0.708333 0.125000 0.125000 0.111111 0.819444 0.055556 0.013889 Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif 0.111111 0.055556 0.819444 0.013889 0.041667 0.125000 0.708333 0.125000 0.875000 0.041667 0.027778 0.055556 0.069444 0.027778 0.777778 0.125000 0.069444 0.847222 0.013889 0.069444 0.916667 0.027778 0.027778 0.027778 0.041667 0.819444 0.069444 0.069444 0.138889 0.013889 0.013889 0.833333 0.069444 0.000000 0.875000 0.055556 0.055556 0.027778 0.000000 0.916667 0.041667 0.013889 0.944444 0.000000 0.944444 0.027778 0.000000 0.027778 0.041667 0.888889 0.000000 0.069444 0.944444 0.041667 0.013889 0.000000 0.055556 0.652778 0.166667 0.125000 0.027778 0.791667 0.027778 0.152778 0.833333 0.097222 0.027778 0.041667 0.125000 0.652778 0.097222 0.125000 0.750000 0.083333 0.055556 0.111111 Consensus sequence: GGAGCACTGTGACACCACA Alignment: TGTGGTGTCACAGTGCTCC- --VHRGGTCABDBTGMCCTB ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 14 PPARGRXRA Original Motif Original Motif Forward 1 15 1.566991 Original motif 0.109685 0.369895 0.373396 0.147025 0.117716 0.193473 0.148019 0.540793 0.453488 0.026744 0.427907 0.091860 0.116144 0.003484 0.779326 0.101045 0.161253 0.017401 0.781903 0.039443 0.168213 0.149652 0.458237 0.223898 0.082271 0.633835 0.207416 0.076477 0.949015 0.024334 0.017381 0.009270 0.604867 0.055620 0.312862 0.026651 0.825231 0.005787 0.158565 0.010417 0.095017 0.002317 0.888760 0.013905 0.047509 0.010429 0.803013 0.139050 0.025492 0.114716 0.304751 0.555041 0.062645 0.643852 0.167053 0.126450 0.784223 0.067285 0.054524 0.093968 Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif 0.093968 0.067285 0.054524 0.784223 0.062645 0.167053 0.643852 0.126450 0.555041 0.114716 0.304751 0.025492 0.047509 0.803013 0.010429 0.139050 0.095017 0.888760 0.002317 0.013905 0.010417 0.005787 0.158565 0.825231 0.026651 0.055620 0.312862 0.604867 0.009270 0.024334 0.017381 0.949015 0.082271 0.207416 0.633835 0.076477 0.168213 0.458237 0.149652 0.223898 0.161253 0.781903 0.017401 0.039443 0.116144 0.779326 0.003484 0.101045 0.091860 0.026744 0.427907 0.453488 0.540793 0.193473 0.148019 0.117716 0.109685 0.373396 0.369895 0.147025 Consensus sequence: TGRCCTKTGHCCKAB Alignment: BTRGGDCARAGGKCA--- VHRGGTCABDBTGMCCTB ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 2 NR2F1 Original Motif Original Motif Backward 1 14 2.089207 Original motif 0.000000 0.000000 0.153846 0.846154 0.076923 0.000000 0.923077 0.000000 0.923077 0.000000 0.076923 0.000000 0.461538 0.538462 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.230769 0.000000 0.769231 0.000000 0.153846 0.000000 0.846154 0.076923 0.000000 0.000000 0.923077 0.153846 0.000000 0.846154 0.000000 0.461538 0.307692 0.230769 0.000000 0.461538 0.384615 0.076923 0.076923 0.076923 0.769231 0.076923 0.076923 0.230769 0.461538 0.000000 0.307692 0.000000 0.230769 0.230769 0.538462 Consensus sequence: TGAMCTTTGMMCYT Reverse complement motif 0.538462 0.230769 0.230769 0.000000 0.230769 0.000000 0.461538 0.307692 0.076923 0.076923 0.769231 0.076923 0.076923 0.384615 0.076923 0.461538 0.000000 0.307692 0.230769 0.461538 0.153846 0.846154 0.000000 0.000000 0.923077 0.000000 0.000000 0.076923 0.846154 0.153846 0.000000 0.000000 0.769231 0.230769 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.461538 0.000000 0.538462 0.000000 0.000000 0.000000 0.076923 0.923077 0.076923 0.923077 0.000000 0.000000 0.846154 0.000000 0.153846 0.000000 Consensus sequence: AKGYYCAAAGRTCA Alignment: ----TGAMCTTTGMMCYT VHRGGTCABDBTGMCCTB ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 15 Tcfcp2l1 Reverse Complement Original Motif Backward 1 14 2.091093 Original motif 0.001968 0.925480 0.062715 0.009838 0.069973 0.807513 0.005401 0.117113 0.594508 0.005148 0.275803 0.124540 0.005884 0.023780 0.967149 0.003187 0.175477 0.336270 0.025698 0.462555 0.098385 0.289280 0.062163 0.550171 0.173924 0.397260 0.151174 0.277642 0.357213 0.224939 0.252323 0.165526 0.631540 0.069682 0.190954 0.107824 0.394421 0.051382 0.310497 0.243700 0.003669 0.933219 0.054795 0.008317 0.061719 0.812148 0.002939 0.123194 0.536555 0.007360 0.305937 0.150147 0.012039 0.028993 0.954791 0.004177 Consensus sequence: CCAGYYHVADCCRG Reverse complement motif 0.012039 0.954791 0.028993 0.004177 0.150147 0.007360 0.305937 0.536555 0.061719 0.002939 0.812148 0.123194 0.003669 0.054795 0.933219 0.008317 0.243700 0.051382 0.310497 0.394421 0.107824 0.069682 0.190954 0.631540 0.165526 0.224939 0.252323 0.357213 0.173924 0.151174 0.397260 0.277642 0.550171 0.289280 0.062163 0.098385 0.462555 0.336270 0.025698 0.175477 0.005884 0.967149 0.023780 0.003187 0.124540 0.005148 0.275803 0.594508 0.069973 0.005401 0.807513 0.117113 0.001968 0.062715 0.925480 0.009838 Consensus sequence: CKGGDTBDMMCTGG Alignment: ----CCAGYYHVADCCRG BAGGYCABHBTGACCKHV ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 16 CTCF Original Motif Original Motif Forward 7 13 2.583795 Original motif 0.095290 0.318729 0.083242 0.502738 0.182913 0.158817 0.453450 0.204819 0.307777 0.053669 0.491785 0.146769 0.061336 0.876232 0.023001 0.039430 0.008762 0.989047 0.000000 0.002191 0.814896 0.014239 0.071194 0.099671 0.043812 0.578313 0.365827 0.012048 0.117325 0.474781 0.052632 0.355263 0.933114 0.012061 0.035088 0.019737 0.005488 0.000000 0.991218 0.003293 0.365532 0.003293 0.621295 0.009879 0.059276 0.013172 0.553238 0.374314 0.013187 0.000000 0.978022 0.008791 0.061538 0.008791 0.851648 0.078022 0.114411 0.806381 0.005501 0.073707 0.409241 0.014301 0.557756 0.018702 0.090308 0.530837 0.338106 0.040749 0.128855 0.354626 0.080396 0.436123 0.442731 0.199339 0.292952 0.064978 Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif 0.064978 0.199339 0.292952 0.442731 0.436123 0.354626 0.080396 0.128855 0.090308 0.338106 0.530837 0.040749 0.409241 0.557756 0.014301 0.018702 0.114411 0.005501 0.806381 0.073707 0.061538 0.851648 0.008791 0.078022 0.013187 0.978022 0.000000 0.008791 0.059276 0.553238 0.013172 0.374314 0.365532 0.621295 0.003293 0.009879 0.005488 0.991218 0.000000 0.003293 0.019737 0.012061 0.035088 0.933114 0.117325 0.052632 0.474781 0.355263 0.043812 0.365827 0.578313 0.012048 0.099671 0.014239 0.071194 0.814896 0.008762 0.000000 0.989047 0.002191 0.061336 0.023001 0.876232 0.039430 0.307777 0.491785 0.053669 0.146769 0.182913 0.453450 0.158817 0.204819 0.502738 0.318729 0.083242 0.095290 Consensus sequence: BMSMGCCYMCTKSTGGMHM Alignment: YDRCCASYAGRKGGCRSYV----- ------VHRGGTCABDBTGMCCTB ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 1 HNF4A Reverse Complement Original Motif Backward 1 13 2.592627 Original motif 0.417910 0.104478 0.402985 0.074627 0.029851 0.029851 0.835821 0.104478 0.179104 0.059701 0.522388 0.238806 0.074627 0.343284 0.298507 0.283582 0.044776 0.761194 0.059701 0.134328 0.880597 0.014925 0.044776 0.059701 0.791045 0.029851 0.149254 0.029851 0.835821 0.014925 0.119403 0.029851 0.059701 0.059701 0.865672 0.014925 0.089552 0.029851 0.492537 0.388060 0.044776 0.328358 0.164179 0.462687 0.059701 0.731343 0.074627 0.134328 0.626866 0.104478 0.149254 0.119403 Consensus sequence: RGGBCAAAGKYCA Reverse complement motif 0.119403 0.104478 0.149254 0.626866 0.059701 0.074627 0.731343 0.134328 0.462687 0.328358 0.164179 0.044776 0.089552 0.492537 0.029851 0.388060 0.059701 0.865672 0.059701 0.014925 0.029851 0.014925 0.119403 0.835821 0.029851 0.029851 0.149254 0.791045 0.059701 0.014925 0.044776 0.880597 0.044776 0.059701 0.761194 0.134328 0.074627 0.298507 0.343284 0.283582 0.179104 0.522388 0.059701 0.238806 0.029851 0.835821 0.029851 0.104478 0.074627 0.104478 0.402985 0.417910 Consensus sequence: TGMYCTTTGBCCK Alignment: -----RGGBCAAAGKYCA BAGGYCABHBTGACCKHV ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 10 Motif name: NR1H2RXRA Original motif 0.680000 0.200000 0.000000 0.120000 0.680000 0.040000 0.200000 0.080000 0.800000 0.000000 0.200000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.040000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.000000 0.040000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.800000 0.040000 0.080000 0.080000 0.000000 0.600000 0.240000 0.160000 Consensus sequence: AAAGGTCAAAGGTCAAC Reserve complement motif 0.000000 0.240000 0.600000 0.160000 0.080000 0.040000 0.080000 0.800000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.040000 0.000000 0.000000 0.960000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.040000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.200000 0.800000 0.080000 0.040000 0.200000 0.680000 0.120000 0.200000 0.000000 0.680000 Consensus sequence: GTTGACCTTTGACCTTT ************************************************************************ Best Matches for Motif ID 10 (Highest to Lowest) ************************************************************************ Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 7 REST Reverse Complement Reverse Complement Forward 4 17 0.091199 Original motif 0.132621 0.109365 0.230044 0.527970 0.036318 0.168441 0.091421 0.703820 0.047589 0.855354 0.031309 0.065748 0.906367 0.018727 0.058677 0.016230 0.021197 0.027431 0.945137 0.006234 0.076012 0.609346 0.201246 0.113396 0.980697 0.004359 0.007472 0.007472 0.001868 0.987547 0.007472 0.003113 0.021793 0.922167 0.012453 0.043587 0.568847 0.125234 0.100935 0.204984 0.136534 0.233791 0.077307 0.552369 0.024314 0.004364 0.966958 0.004364 0.012469 0.003117 0.983167 0.001247 0.877105 0.069869 0.021210 0.031815 0.008125 0.800000 0.145625 0.046250 0.983750 0.005625 0.004375 0.006250 0.026349 0.008156 0.959849 0.005646 0.128688 0.632141 0.114878 0.124294 0.229899 0.019472 0.432161 0.318467 0.133962 0.586792 0.200629 0.078616 0.112579 0.700629 0.023270 0.163522 Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif 0.112579 0.023270 0.700629 0.163522 0.133962 0.200629 0.586792 0.078616 0.229899 0.432161 0.019472 0.318467 0.128688 0.114878 0.632141 0.124294 0.026349 0.959849 0.008156 0.005646 0.006250 0.005625 0.004375 0.983750 0.008125 0.145625 0.800000 0.046250 0.031815 0.069869 0.021210 0.877105 0.012469 0.983167 0.003117 0.001247 0.024314 0.966958 0.004364 0.004364 0.552369 0.233791 0.077307 0.136534 0.204984 0.125234 0.100935 0.568847 0.021793 0.012453 0.922167 0.043587 0.001868 0.007472 0.987547 0.003113 0.007472 0.004359 0.007472 0.980697 0.076012 0.201246 0.609346 0.113396 0.021197 0.945137 0.027431 0.006234 0.016230 0.018727 0.058677 0.906367 0.047589 0.031309 0.855354 0.065748 0.703820 0.168441 0.091421 0.036318 0.527970 0.109365 0.230044 0.132621 Consensus sequence: GGYGCTGTCCATGGTGCTGAA Alignment: GGYGCTGTCCATGGTGCTGAA ---GTTGACCTTTGACCTTT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 14 PPARGRXRA Original Motif Original Motif Forward 1 15 1.059451 Original motif 0.109685 0.369895 0.373396 0.147025 0.117716 0.193473 0.148019 0.540793 0.453488 0.026744 0.427907 0.091860 0.116144 0.003484 0.779326 0.101045 0.161253 0.017401 0.781903 0.039443 0.168213 0.149652 0.458237 0.223898 0.082271 0.633835 0.207416 0.076477 0.949015 0.024334 0.017381 0.009270 0.604867 0.055620 0.312862 0.026651 0.825231 0.005787 0.158565 0.010417 0.095017 0.002317 0.888760 0.013905 0.047509 0.010429 0.803013 0.139050 0.025492 0.114716 0.304751 0.555041 0.062645 0.643852 0.167053 0.126450 0.784223 0.067285 0.054524 0.093968 Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif 0.093968 0.067285 0.054524 0.784223 0.062645 0.167053 0.643852 0.126450 0.555041 0.114716 0.304751 0.025492 0.047509 0.803013 0.010429 0.139050 0.095017 0.888760 0.002317 0.013905 0.010417 0.005787 0.158565 0.825231 0.026651 0.055620 0.312862 0.604867 0.009270 0.024334 0.017381 0.949015 0.082271 0.207416 0.633835 0.076477 0.168213 0.458237 0.149652 0.223898 0.161253 0.781903 0.017401 0.039443 0.116144 0.779326 0.003484 0.101045 0.091860 0.026744 0.427907 0.453488 0.540793 0.193473 0.148019 0.117716 0.109685 0.373396 0.369895 0.147025 Consensus sequence: TGRCCTKTGHCCKAB Alignment: BTRGGDCARAGGKCA-- AAAGGTCAAAGGTCAAC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 3 ESR1 Original Motif Original Motif Backward 8 13 2.085141 Original motif 0.261242 0.256959 0.329764 0.152034 0.228632 0.170940 0.350427 0.250000 0.136752 0.369658 0.318376 0.175214 0.176596 0.487234 0.138298 0.197872 0.285106 0.493617 0.100000 0.121277 0.651163 0.059197 0.188161 0.101480 0.075949 0.016878 0.816456 0.090717 0.040000 0.037895 0.884211 0.037895 0.069474 0.086316 0.191579 0.652632 0.008421 0.829474 0.111579 0.050526 0.837895 0.027368 0.056842 0.077895 0.122105 0.526316 0.225263 0.126316 0.132632 0.581053 0.111579 0.174737 0.134737 0.543158 0.204211 0.117895 0.067368 0.040000 0.016842 0.875789 0.044211 0.046316 0.896842 0.012632 0.642105 0.223158 0.065263 0.069474 0.021053 0.917895 0.025263 0.035789 0.124211 0.743158 0.004211 0.128421 0.054737 0.347368 0.046316 0.551579 Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif 0.551579 0.347368 0.046316 0.054737 0.124211 0.004211 0.743158 0.128421 0.021053 0.025263 0.917895 0.035789 0.069474 0.223158 0.065263 0.642105 0.044211 0.896842 0.046316 0.012632 0.875789 0.040000 0.016842 0.067368 0.134737 0.204211 0.543158 0.117895 0.132632 0.111579 0.581053 0.174737 0.122105 0.225263 0.526316 0.126316 0.077895 0.027368 0.056842 0.837895 0.008421 0.111579 0.829474 0.050526 0.652632 0.086316 0.191579 0.069474 0.040000 0.884211 0.037895 0.037895 0.075949 0.816456 0.016878 0.090717 0.101480 0.059197 0.188161 0.651163 0.285106 0.100000 0.493617 0.121277 0.176596 0.138298 0.487234 0.197872 0.136752 0.318376 0.369658 0.175214 0.228632 0.350427 0.170940 0.250000 0.261242 0.329764 0.256959 0.152034 Consensus sequence: MGGTCAGGGTGACCTRDBHV Alignment: ----VDBHMAGGTCACCCTGACCY AAAGGTCAAAGGTCAAC------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 27 AgTGCTCCACTGTGgTGTCACAgT Original Motif Original Motif Forward 13 12 2.599607 Original motif 0.690141 0.126761 0.042254 0.140845 0.169014 0.098592 0.676056 0.056338 0.042254 0.028169 0.028169 0.901408 0.056338 0.000000 0.774648 0.169014 0.042254 0.887324 0.042254 0.028169 0.000000 0.014085 0.000000 0.985915 0.056338 0.830986 0.042254 0.070423 0.028169 0.957746 0.014085 0.000000 0.957746 0.000000 0.014085 0.028169 0.084507 0.845070 0.014085 0.056338 0.028169 0.014085 0.000000 0.957746 0.140845 0.028169 0.802817 0.028169 0.014085 0.014085 0.014085 0.957746 0.014085 0.000000 0.929577 0.056338 0.056338 0.154930 0.619718 0.169014 0.014085 0.028169 0.000000 0.957746 0.056338 0.014085 0.873239 0.056338 0.014085 0.000000 0.000000 0.985915 0.042254 0.929577 0.000000 0.028169 0.957746 0.028169 0.000000 0.014085 0.028169 0.845070 0.028169 0.098592 0.873239 0.014085 0.042254 0.070423 0.098592 0.154930 0.563380 0.183099 0.070423 0.014085 0.112676 0.802817 Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif 0.802817 0.014085 0.112676 0.070423 0.098592 0.563380 0.154930 0.183099 0.070423 0.014085 0.042254 0.873239 0.028169 0.028169 0.845070 0.098592 0.014085 0.028169 0.000000 0.957746 0.042254 0.000000 0.929577 0.028169 0.985915 0.000000 0.000000 0.014085 0.056338 0.873239 0.014085 0.056338 0.957746 0.028169 0.000000 0.014085 0.056338 0.619718 0.154930 0.169014 0.014085 0.929577 0.000000 0.056338 0.957746 0.014085 0.014085 0.014085 0.140845 0.802817 0.028169 0.028169 0.957746 0.014085 0.000000 0.028169 0.084507 0.014085 0.845070 0.056338 0.028169 0.000000 0.014085 0.957746 0.028169 0.014085 0.957746 0.000000 0.056338 0.042254 0.830986 0.070423 0.985915 0.014085 0.000000 0.000000 0.042254 0.042254 0.887324 0.028169 0.056338 0.774648 0.000000 0.169014 0.901408 0.028169 0.028169 0.042254 0.169014 0.676056 0.098592 0.056338 0.140845 0.126761 0.042254 0.690141 Consensus sequence: ACTGTGACACCACAGTGGAGCACT Alignment: AGTGCTCCACTGTGGTGTCACAGT----- ------------AAAGGTCAAAGGTCAAC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 21 AmTGTGACACCACAGT Original Motif Reverse Complement Forward 5 12 2.599674 Original motif 0.703125 0.187500 0.015625 0.093750 0.265625 0.500000 0.125000 0.109375 0.015625 0.046875 0.031250 0.906250 0.078125 0.015625 0.890625 0.015625 0.000000 0.000000 0.000000 1.000000 0.000000 0.031250 0.906250 0.062500 0.953125 0.000000 0.015625 0.031250 0.046875 0.890625 0.000000 0.062500 0.968750 0.000000 0.015625 0.015625 0.109375 0.781250 0.062500 0.046875 0.062500 0.890625 0.000000 0.046875 0.953125 0.000000 0.031250 0.015625 0.031250 0.781250 0.046875 0.140625 0.937500 0.015625 0.031250 0.015625 0.093750 0.078125 0.734375 0.093750 0.031250 0.078125 0.000000 0.890625 Consensus sequence: AMTGTGACACCACAGT Reverse complement motif 0.890625 0.078125 0.000000 0.031250 0.093750 0.734375 0.078125 0.093750 0.015625 0.015625 0.031250 0.937500 0.031250 0.046875 0.781250 0.140625 0.015625 0.000000 0.031250 0.953125 0.062500 0.000000 0.890625 0.046875 0.109375 0.062500 0.781250 0.046875 0.015625 0.000000 0.015625 0.968750 0.046875 0.000000 0.890625 0.062500 0.031250 0.000000 0.015625 0.953125 0.000000 0.906250 0.031250 0.062500 1.000000 0.000000 0.000000 0.000000 0.078125 0.890625 0.015625 0.015625 0.906250 0.046875 0.031250 0.015625 0.265625 0.125000 0.500000 0.109375 0.093750 0.187500 0.015625 0.703125 Consensus sequence: ACTGTGGTGTCACART Alignment: ACTGTGGTGTCACART----- ----AAAGGTCAAAGGTCAAC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 20 CagTGCTCCACTGTGgT Original Motif Original Motif Backward 7 11 3.097311 Original motif 0.150000 0.700000 0.016667 0.133333 0.650000 0.150000 0.050000 0.150000 0.166667 0.116667 0.633333 0.083333 0.050000 0.033333 0.066667 0.850000 0.050000 0.000000 0.833333 0.116667 0.016667 0.966667 0.000000 0.016667 0.050000 0.016667 0.000000 0.933333 0.066667 0.833333 0.066667 0.033333 0.033333 0.966667 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.050000 0.916667 0.016667 0.016667 0.166667 0.000000 0.000000 0.833333 0.083333 0.016667 0.900000 0.000000 0.000000 0.016667 0.016667 0.966667 0.000000 0.016667 0.966667 0.016667 0.116667 0.166667 0.483333 0.233333 0.066667 0.083333 0.050000 0.800000 Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif 0.800000 0.083333 0.050000 0.066667 0.116667 0.483333 0.166667 0.233333 0.000000 0.966667 0.016667 0.016667 0.966667 0.016667 0.016667 0.000000 0.083333 0.900000 0.016667 0.000000 0.833333 0.000000 0.000000 0.166667 0.050000 0.016667 0.916667 0.016667 0.000000 0.000000 0.000000 1.000000 0.033333 0.000000 0.966667 0.000000 0.066667 0.066667 0.833333 0.033333 0.933333 0.016667 0.000000 0.050000 0.016667 0.000000 0.966667 0.016667 0.050000 0.833333 0.000000 0.116667 0.850000 0.033333 0.066667 0.050000 0.166667 0.633333 0.116667 0.083333 0.150000 0.150000 0.050000 0.650000 0.150000 0.016667 0.700000 0.133333 Consensus sequence: ABCACAGTGGAGCACTG Alignment: ------CAGTGCTCCACTGTGBT AAAGGTCAAAGGTCAAC------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 9 ESR2 Reverse Complement Reverse Complement Forward 9 10 3.562211 Original motif 0.218487 0.450980 0.176471 0.154062 0.442577 0.142857 0.114846 0.299720 0.521008 0.042017 0.431373 0.005602 0.075630 0.000000 0.770308 0.154062 0.050420 0.056022 0.893557 0.000000 0.036415 0.053221 0.092437 0.817927 0.000000 1.000000 0.000000 0.000000 0.943978 0.002801 0.000000 0.053221 0.137255 0.344538 0.316527 0.201681 0.179272 0.176471 0.417367 0.226891 0.145658 0.170868 0.411765 0.271709 0.058824 0.092437 0.067227 0.781513 0.176471 0.070028 0.742297 0.011204 0.498599 0.277311 0.053221 0.170868 0.095238 0.750700 0.005602 0.148459 0.128852 0.809524 0.000000 0.061625 0.075630 0.252101 0.000000 0.672269 0.168067 0.263305 0.380952 0.187675 Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif 0.168067 0.380952 0.263305 0.187675 0.672269 0.252101 0.000000 0.075630 0.128852 0.000000 0.809524 0.061625 0.095238 0.005602 0.750700 0.148459 0.170868 0.277311 0.053221 0.498599 0.176471 0.742297 0.070028 0.011204 0.781513 0.092437 0.067227 0.058824 0.145658 0.411765 0.170868 0.271709 0.179272 0.417367 0.176471 0.226891 0.137255 0.316527 0.344538 0.201681 0.053221 0.002801 0.000000 0.943978 0.000000 0.000000 1.000000 0.000000 0.817927 0.053221 0.092437 0.036415 0.050420 0.893557 0.056022 0.000000 0.075630 0.770308 0.000000 0.154062 0.005602 0.042017 0.431373 0.521008 0.299720 0.142857 0.114846 0.442577 0.218487 0.176471 0.450980 0.154062 Consensus sequence: BAGGYCABHBTGACCKHV Alignment: BAGGYCABHBTGACCKHV------- --------GTTGACCTTTGACCTTT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 13 MIZF Original Motif Original Motif Backward 1 10 3.585500 Original motif 0.100000 0.300000 0.250000 0.350000 0.650000 0.050000 0.000000 0.300000 1.000000 0.000000 0.000000 0.000000 0.100000 0.850000 0.050000 0.000000 0.000000 0.000000 0.950000 0.050000 0.000000 0.050000 0.000000 0.950000 0.000000 0.950000 0.000000 0.050000 0.000000 0.900000 0.100000 0.000000 0.000000 0.000000 0.950000 0.050000 0.100000 0.650000 0.050000 0.200000 Consensus sequence: BAACGTCCGC Reverse complement motif 0.100000 0.050000 0.650000 0.200000 0.000000 0.950000 0.000000 0.050000 0.000000 0.100000 0.900000 0.000000 0.000000 0.000000 0.950000 0.050000 0.950000 0.050000 0.000000 0.000000 0.000000 0.950000 0.000000 0.050000 0.100000 0.050000 0.850000 0.000000 0.000000 0.000000 0.000000 1.000000 0.300000 0.050000 0.000000 0.650000 0.350000 0.300000 0.250000 0.100000 Consensus sequence: GCGGACGTTV Alignment: -------BAACGTCCGC AAAGGTCAAAGGTCAAC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 2 NR2F1 Original Motif Reverse Complement Forward 6 9 4.074541 Original motif 0.000000 0.000000 0.153846 0.846154 0.076923 0.000000 0.923077 0.000000 0.923077 0.000000 0.076923 0.000000 0.461538 0.538462 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.230769 0.000000 0.769231 0.000000 0.153846 0.000000 0.846154 0.076923 0.000000 0.000000 0.923077 0.153846 0.000000 0.846154 0.000000 0.461538 0.307692 0.230769 0.000000 0.461538 0.384615 0.076923 0.076923 0.076923 0.769231 0.076923 0.076923 0.230769 0.461538 0.000000 0.307692 0.000000 0.230769 0.230769 0.538462 Consensus sequence: TGAMCTTTGMMCYT Reverse complement motif 0.538462 0.230769 0.230769 0.000000 0.230769 0.000000 0.461538 0.307692 0.076923 0.076923 0.769231 0.076923 0.076923 0.384615 0.076923 0.461538 0.000000 0.307692 0.230769 0.461538 0.153846 0.846154 0.000000 0.000000 0.923077 0.000000 0.000000 0.076923 0.846154 0.153846 0.000000 0.000000 0.769231 0.230769 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.461538 0.000000 0.538462 0.000000 0.000000 0.000000 0.076923 0.923077 0.076923 0.923077 0.000000 0.000000 0.846154 0.000000 0.153846 0.000000 Consensus sequence: AKGYYCAAAGRTCA Alignment: AKGYYCAAAGRTCA-------- -----AAAGGTCAAAGGTCAAC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 23 TGGAGCACTGTGACAcCACAGTGg Reverse Complement Original Motif Backward 16 9 4.094794 Original motif 0.054054 0.040541 0.054054 0.851351 0.040541 0.013514 0.824324 0.121622 0.094595 0.135135 0.756757 0.013514 0.891892 0.000000 0.000000 0.108108 0.040541 0.094595 0.810811 0.054054 0.081081 0.797297 0.054054 0.067568 0.932432 0.027027 0.000000 0.040541 0.054054 0.756757 0.135135 0.054054 0.108108 0.027027 0.013514 0.851351 0.108108 0.000000 0.851351 0.040541 0.013514 0.000000 0.027027 0.959459 0.000000 0.013514 0.945946 0.040541 0.905405 0.000000 0.067568 0.027027 0.054054 0.837838 0.000000 0.108108 0.945946 0.013514 0.040541 0.000000 0.162162 0.500000 0.189189 0.148649 0.108108 0.824324 0.000000 0.067568 0.945946 0.000000 0.040541 0.013514 0.081081 0.837838 0.027027 0.054054 0.945946 0.000000 0.013514 0.040541 0.054054 0.067568 0.783784 0.094595 0.054054 0.027027 0.000000 0.918919 0.040541 0.013514 0.864865 0.081081 0.148649 0.121622 0.675676 0.054054 Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif 0.148649 0.675676 0.121622 0.054054 0.040541 0.864865 0.013514 0.081081 0.918919 0.027027 0.000000 0.054054 0.054054 0.783784 0.067568 0.094595 0.040541 0.000000 0.013514 0.945946 0.081081 0.027027 0.837838 0.054054 0.013514 0.000000 0.040541 0.945946 0.108108 0.000000 0.824324 0.067568 0.162162 0.189189 0.500000 0.148649 0.000000 0.013514 0.040541 0.945946 0.054054 0.000000 0.837838 0.108108 0.027027 0.000000 0.067568 0.905405 0.000000 0.945946 0.013514 0.040541 0.959459 0.000000 0.027027 0.013514 0.108108 0.851351 0.000000 0.040541 0.851351 0.027027 0.013514 0.108108 0.054054 0.135135 0.756757 0.054054 0.040541 0.027027 0.000000 0.932432 0.081081 0.054054 0.797297 0.067568 0.040541 0.810811 0.094595 0.054054 0.108108 0.000000 0.000000 0.891892 0.094595 0.756757 0.135135 0.013514 0.040541 0.824324 0.013514 0.121622 0.851351 0.040541 0.054054 0.054054 Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA Alignment: --------TGGAGCACTGTGACAVCACAGTGG GTTGACCTTTGACCTTT--------------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 11 Motif name: NR4A2 Original motif 0.615385 0.076923 0.230769 0.076923 0.928571 0.000000 0.071429 0.000000 0.000000 0.000000 0.928571 0.071429 0.214286 0.000000 0.785714 0.000000 0.142857 0.142857 0.000000 0.714286 0.000000 0.928571 0.000000 0.071429 1.000000 0.000000 0.000000 0.000000 0.230769 0.615385 0.153846 0.000000 Consensus sequence: AAGGTCAC Reserve complement motif 0.230769 0.153846 0.615385 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.928571 0.071429 0.714286 0.142857 0.000000 0.142857 0.214286 0.785714 0.000000 0.000000 0.000000 0.928571 0.000000 0.071429 0.000000 0.000000 0.071429 0.928571 0.076923 0.076923 0.230769 0.615385 Consensus sequence: GTGACCTT ************************************************************************ Best Matches for Motif ID 11 (Highest to Lowest) ************************************************************************ Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 10 NR1H2RXRA Original Motif Original Motif Backward 9 8 0.016776 Original motif 0.680000 0.200000 0.000000 0.120000 0.680000 0.040000 0.200000 0.080000 0.800000 0.000000 0.200000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.040000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.000000 0.040000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.800000 0.040000 0.080000 0.080000 0.000000 0.600000 0.240000 0.160000 Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif 0.000000 0.240000 0.600000 0.160000 0.080000 0.040000 0.080000 0.800000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.040000 0.000000 0.000000 0.960000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.040000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.200000 0.800000 0.080000 0.040000 0.200000 0.680000 0.120000 0.200000 0.000000 0.680000 Consensus sequence: GTTGACCTTTGACCTTT Alignment: AAAGGTCAAAGGTCAAC -AAGGTCAC-------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 3 ESR1 Original Motif Original Motif Forward 5 8 0.019523 Original motif 0.261242 0.256959 0.329764 0.152034 0.228632 0.170940 0.350427 0.250000 0.136752 0.369658 0.318376 0.175214 0.176596 0.487234 0.138298 0.197872 0.285106 0.493617 0.100000 0.121277 0.651163 0.059197 0.188161 0.101480 0.075949 0.016878 0.816456 0.090717 0.040000 0.037895 0.884211 0.037895 0.069474 0.086316 0.191579 0.652632 0.008421 0.829474 0.111579 0.050526 0.837895 0.027368 0.056842 0.077895 0.122105 0.526316 0.225263 0.126316 0.132632 0.581053 0.111579 0.174737 0.134737 0.543158 0.204211 0.117895 0.067368 0.040000 0.016842 0.875789 0.044211 0.046316 0.896842 0.012632 0.642105 0.223158 0.065263 0.069474 0.021053 0.917895 0.025263 0.035789 0.124211 0.743158 0.004211 0.128421 0.054737 0.347368 0.046316 0.551579 Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif 0.551579 0.347368 0.046316 0.054737 0.124211 0.004211 0.743158 0.128421 0.021053 0.025263 0.917895 0.035789 0.069474 0.223158 0.065263 0.642105 0.044211 0.896842 0.046316 0.012632 0.875789 0.040000 0.016842 0.067368 0.134737 0.204211 0.543158 0.117895 0.132632 0.111579 0.581053 0.174737 0.122105 0.225263 0.526316 0.126316 0.077895 0.027368 0.056842 0.837895 0.008421 0.111579 0.829474 0.050526 0.652632 0.086316 0.191579 0.069474 0.040000 0.884211 0.037895 0.037895 0.075949 0.816456 0.016878 0.090717 0.101480 0.059197 0.188161 0.651163 0.285106 0.100000 0.493617 0.121277 0.176596 0.138298 0.487234 0.197872 0.136752 0.318376 0.369658 0.175214 0.228632 0.350427 0.170940 0.250000 0.261242 0.329764 0.256959 0.152034 Consensus sequence: MGGTCAGGGTGACCTRDBHV Alignment: VDBHMAGGTCACCCTGACCY ----AAGGTCAC-------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 9 ESR2 Reverse Complement Reverse Complement Backward 2 8 0.019837 Original motif 0.218487 0.450980 0.176471 0.154062 0.442577 0.142857 0.114846 0.299720 0.521008 0.042017 0.431373 0.005602 0.075630 0.000000 0.770308 0.154062 0.050420 0.056022 0.893557 0.000000 0.036415 0.053221 0.092437 0.817927 0.000000 1.000000 0.000000 0.000000 0.943978 0.002801 0.000000 0.053221 0.137255 0.344538 0.316527 0.201681 0.179272 0.176471 0.417367 0.226891 0.145658 0.170868 0.411765 0.271709 0.058824 0.092437 0.067227 0.781513 0.176471 0.070028 0.742297 0.011204 0.498599 0.277311 0.053221 0.170868 0.095238 0.750700 0.005602 0.148459 0.128852 0.809524 0.000000 0.061625 0.075630 0.252101 0.000000 0.672269 0.168067 0.263305 0.380952 0.187675 Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif 0.168067 0.380952 0.263305 0.187675 0.672269 0.252101 0.000000 0.075630 0.128852 0.000000 0.809524 0.061625 0.095238 0.005602 0.750700 0.148459 0.170868 0.277311 0.053221 0.498599 0.176471 0.742297 0.070028 0.011204 0.781513 0.092437 0.067227 0.058824 0.145658 0.411765 0.170868 0.271709 0.179272 0.417367 0.176471 0.226891 0.137255 0.316527 0.344538 0.201681 0.053221 0.002801 0.000000 0.943978 0.000000 0.000000 1.000000 0.000000 0.817927 0.053221 0.092437 0.036415 0.050420 0.893557 0.056022 0.000000 0.075630 0.770308 0.000000 0.154062 0.005602 0.042017 0.431373 0.521008 0.299720 0.142857 0.114846 0.442577 0.218487 0.176471 0.450980 0.154062 Consensus sequence: BAGGYCABHBTGACCKHV Alignment: BAGGYCABHBTGACCKHV ---------GTGACCTT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 14 PPARGRXRA Original Motif Original Motif Backward 7 8 0.049561 Original motif 0.109685 0.369895 0.373396 0.147025 0.117716 0.193473 0.148019 0.540793 0.453488 0.026744 0.427907 0.091860 0.116144 0.003484 0.779326 0.101045 0.161253 0.017401 0.781903 0.039443 0.168213 0.149652 0.458237 0.223898 0.082271 0.633835 0.207416 0.076477 0.949015 0.024334 0.017381 0.009270 0.604867 0.055620 0.312862 0.026651 0.825231 0.005787 0.158565 0.010417 0.095017 0.002317 0.888760 0.013905 0.047509 0.010429 0.803013 0.139050 0.025492 0.114716 0.304751 0.555041 0.062645 0.643852 0.167053 0.126450 0.784223 0.067285 0.054524 0.093968 Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif 0.093968 0.067285 0.054524 0.784223 0.062645 0.167053 0.643852 0.126450 0.555041 0.114716 0.304751 0.025492 0.047509 0.803013 0.010429 0.139050 0.095017 0.888760 0.002317 0.013905 0.010417 0.005787 0.158565 0.825231 0.026651 0.055620 0.312862 0.604867 0.009270 0.024334 0.017381 0.949015 0.082271 0.207416 0.633835 0.076477 0.168213 0.458237 0.149652 0.223898 0.161253 0.781903 0.017401 0.039443 0.116144 0.779326 0.003484 0.101045 0.091860 0.026744 0.427907 0.453488 0.540793 0.193473 0.148019 0.117716 0.109685 0.373396 0.369895 0.147025 Consensus sequence: TGRCCTKTGHCCKAB Alignment: BTRGGDCARAGGKCA -AAGGTCAC------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 22 CACTGTGrYrtCACAGTGswsCAcT Original Motif Original Motif Forward 7 8 0.055724 Original motif 0.111111 0.746032 0.063492 0.079365 0.857143 0.047619 0.047619 0.047619 0.047619 0.857143 0.079365 0.015873 0.031746 0.000000 0.000000 0.968254 0.031746 0.015873 0.904762 0.047619 0.000000 0.000000 0.000000 1.000000 0.031746 0.000000 0.857143 0.111111 0.396825 0.111111 0.412698 0.079365 0.031746 0.253968 0.015873 0.698413 0.365079 0.000000 0.634921 0.000000 0.079365 0.206349 0.047619 0.666667 0.047619 0.936508 0.015873 0.000000 0.952381 0.000000 0.015873 0.031746 0.015873 0.920635 0.000000 0.063492 0.920635 0.000000 0.000000 0.079365 0.063492 0.047619 0.841270 0.047619 0.000000 0.000000 0.015873 0.984127 0.047619 0.015873 0.904762 0.031746 0.015873 0.603175 0.317460 0.063492 0.396825 0.000000 0.015873 0.587302 0.015873 0.476190 0.428571 0.079365 0.063492 0.920635 0.000000 0.015873 0.920635 0.015873 0.047619 0.015873 0.095238 0.682540 0.095238 0.126984 0.047619 0.015873 0.095238 0.841270 Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif 0.841270 0.015873 0.095238 0.047619 0.095238 0.095238 0.682540 0.126984 0.015873 0.015873 0.047619 0.920635 0.063492 0.000000 0.920635 0.015873 0.015873 0.428571 0.476190 0.079365 0.587302 0.000000 0.015873 0.396825 0.015873 0.317460 0.603175 0.063492 0.047619 0.904762 0.015873 0.031746 0.984127 0.000000 0.015873 0.000000 0.063492 0.841270 0.047619 0.047619 0.079365 0.000000 0.000000 0.920635 0.015873 0.000000 0.920635 0.063492 0.031746 0.000000 0.015873 0.952381 0.047619 0.015873 0.936508 0.000000 0.666667 0.206349 0.047619 0.079365 0.365079 0.634921 0.000000 0.000000 0.698413 0.253968 0.015873 0.031746 0.396825 0.412698 0.111111 0.079365 0.031746 0.857143 0.000000 0.111111 1.000000 0.000000 0.000000 0.000000 0.031746 0.904762 0.015873 0.047619 0.968254 0.000000 0.000000 0.031746 0.047619 0.079365 0.857143 0.015873 0.047619 0.047619 0.047619 0.857143 0.111111 0.063492 0.746032 0.079365 Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG Alignment: CACTGTGRTRTCACAGTGSWSCACT ------AAGGTCAC----------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 2 NR2F1 Original Motif Reverse Complement Forward 7 8 0.056487 Original motif 0.000000 0.000000 0.153846 0.846154 0.076923 0.000000 0.923077 0.000000 0.923077 0.000000 0.076923 0.000000 0.461538 0.538462 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.230769 0.000000 0.769231 0.000000 0.153846 0.000000 0.846154 0.076923 0.000000 0.000000 0.923077 0.153846 0.000000 0.846154 0.000000 0.461538 0.307692 0.230769 0.000000 0.461538 0.384615 0.076923 0.076923 0.076923 0.769231 0.076923 0.076923 0.230769 0.461538 0.000000 0.307692 0.000000 0.230769 0.230769 0.538462 Consensus sequence: TGAMCTTTGMMCYT Reverse complement motif 0.538462 0.230769 0.230769 0.000000 0.230769 0.000000 0.461538 0.307692 0.076923 0.076923 0.769231 0.076923 0.076923 0.384615 0.076923 0.461538 0.000000 0.307692 0.230769 0.461538 0.153846 0.846154 0.000000 0.000000 0.923077 0.000000 0.000000 0.076923 0.846154 0.153846 0.000000 0.000000 0.769231 0.230769 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.461538 0.000000 0.538462 0.000000 0.000000 0.000000 0.076923 0.923077 0.076923 0.923077 0.000000 0.000000 0.846154 0.000000 0.153846 0.000000 Consensus sequence: AKGYYCAAAGRTCA Alignment: AKGYYCAAAGRTCA ------AAGGTCAC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 7 REST Reverse Complement Reverse Complement Forward 5 8 0.059465 Original motif 0.132621 0.109365 0.230044 0.527970 0.036318 0.168441 0.091421 0.703820 0.047589 0.855354 0.031309 0.065748 0.906367 0.018727 0.058677 0.016230 0.021197 0.027431 0.945137 0.006234 0.076012 0.609346 0.201246 0.113396 0.980697 0.004359 0.007472 0.007472 0.001868 0.987547 0.007472 0.003113 0.021793 0.922167 0.012453 0.043587 0.568847 0.125234 0.100935 0.204984 0.136534 0.233791 0.077307 0.552369 0.024314 0.004364 0.966958 0.004364 0.012469 0.003117 0.983167 0.001247 0.877105 0.069869 0.021210 0.031815 0.008125 0.800000 0.145625 0.046250 0.983750 0.005625 0.004375 0.006250 0.026349 0.008156 0.959849 0.005646 0.128688 0.632141 0.114878 0.124294 0.229899 0.019472 0.432161 0.318467 0.133962 0.586792 0.200629 0.078616 0.112579 0.700629 0.023270 0.163522 Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif 0.112579 0.023270 0.700629 0.163522 0.133962 0.200629 0.586792 0.078616 0.229899 0.432161 0.019472 0.318467 0.128688 0.114878 0.632141 0.124294 0.026349 0.959849 0.008156 0.005646 0.006250 0.005625 0.004375 0.983750 0.008125 0.145625 0.800000 0.046250 0.031815 0.069869 0.021210 0.877105 0.012469 0.983167 0.003117 0.001247 0.024314 0.966958 0.004364 0.004364 0.552369 0.233791 0.077307 0.136534 0.204984 0.125234 0.100935 0.568847 0.021793 0.012453 0.922167 0.043587 0.001868 0.007472 0.987547 0.003113 0.007472 0.004359 0.007472 0.980697 0.076012 0.201246 0.609346 0.113396 0.021197 0.945137 0.027431 0.006234 0.016230 0.018727 0.058677 0.906367 0.047589 0.031309 0.855354 0.065748 0.703820 0.168441 0.091421 0.036318 0.527970 0.109365 0.230044 0.132621 Consensus sequence: GGYGCTGTCCATGGTGCTGAA Alignment: GGYGCTGTCCATGGTGCTGAA ----GTGACCTT--------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 23 TGGAGCACTGTGACAcCACAGTGg Original Motif Reverse Complement Forward 8 8 0.060729 Original motif 0.054054 0.040541 0.054054 0.851351 0.040541 0.013514 0.824324 0.121622 0.094595 0.135135 0.756757 0.013514 0.891892 0.000000 0.000000 0.108108 0.040541 0.094595 0.810811 0.054054 0.081081 0.797297 0.054054 0.067568 0.932432 0.027027 0.000000 0.040541 0.054054 0.756757 0.135135 0.054054 0.108108 0.027027 0.013514 0.851351 0.108108 0.000000 0.851351 0.040541 0.013514 0.000000 0.027027 0.959459 0.000000 0.013514 0.945946 0.040541 0.905405 0.000000 0.067568 0.027027 0.054054 0.837838 0.000000 0.108108 0.945946 0.013514 0.040541 0.000000 0.162162 0.500000 0.189189 0.148649 0.108108 0.824324 0.000000 0.067568 0.945946 0.000000 0.040541 0.013514 0.081081 0.837838 0.027027 0.054054 0.945946 0.000000 0.013514 0.040541 0.054054 0.067568 0.783784 0.094595 0.054054 0.027027 0.000000 0.918919 0.040541 0.013514 0.864865 0.081081 0.148649 0.121622 0.675676 0.054054 Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif 0.148649 0.675676 0.121622 0.054054 0.040541 0.864865 0.013514 0.081081 0.918919 0.027027 0.000000 0.054054 0.054054 0.783784 0.067568 0.094595 0.040541 0.000000 0.013514 0.945946 0.081081 0.027027 0.837838 0.054054 0.013514 0.000000 0.040541 0.945946 0.108108 0.000000 0.824324 0.067568 0.162162 0.189189 0.500000 0.148649 0.000000 0.013514 0.040541 0.945946 0.054054 0.000000 0.837838 0.108108 0.027027 0.000000 0.067568 0.905405 0.000000 0.945946 0.013514 0.040541 0.959459 0.000000 0.027027 0.013514 0.108108 0.851351 0.000000 0.040541 0.851351 0.027027 0.013514 0.108108 0.054054 0.135135 0.756757 0.054054 0.040541 0.027027 0.000000 0.932432 0.081081 0.054054 0.797297 0.067568 0.040541 0.810811 0.094595 0.054054 0.108108 0.000000 0.000000 0.891892 0.094595 0.756757 0.135135 0.013514 0.040541 0.824324 0.013514 0.121622 0.851351 0.040541 0.054054 0.054054 Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA Alignment: CCACTGTGVTGTCACAGTGCTCCA -------AAGGTCAC--------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 21 AmTGTGACACCACAGT Original Motif Reverse Complement Backward 4 8 0.064515 Original motif 0.703125 0.187500 0.015625 0.093750 0.265625 0.500000 0.125000 0.109375 0.015625 0.046875 0.031250 0.906250 0.078125 0.015625 0.890625 0.015625 0.000000 0.000000 0.000000 1.000000 0.000000 0.031250 0.906250 0.062500 0.953125 0.000000 0.015625 0.031250 0.046875 0.890625 0.000000 0.062500 0.968750 0.000000 0.015625 0.015625 0.109375 0.781250 0.062500 0.046875 0.062500 0.890625 0.000000 0.046875 0.953125 0.000000 0.031250 0.015625 0.031250 0.781250 0.046875 0.140625 0.937500 0.015625 0.031250 0.015625 0.093750 0.078125 0.734375 0.093750 0.031250 0.078125 0.000000 0.890625 Consensus sequence: AMTGTGACACCACAGT Reverse complement motif 0.890625 0.078125 0.000000 0.031250 0.093750 0.734375 0.078125 0.093750 0.015625 0.015625 0.031250 0.937500 0.031250 0.046875 0.781250 0.140625 0.015625 0.000000 0.031250 0.953125 0.062500 0.000000 0.890625 0.046875 0.109375 0.062500 0.781250 0.046875 0.015625 0.000000 0.015625 0.968750 0.046875 0.000000 0.890625 0.062500 0.031250 0.000000 0.015625 0.953125 0.000000 0.906250 0.031250 0.062500 1.000000 0.000000 0.000000 0.000000 0.078125 0.890625 0.015625 0.015625 0.906250 0.046875 0.031250 0.015625 0.265625 0.125000 0.500000 0.109375 0.093750 0.187500 0.015625 0.703125 Consensus sequence: ACTGTGGTGTCACART Alignment: ACTGTGGTGTCACART -----AAGGTCAC--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 17 TgTGgTGTCACAGTGCTCC Original Motif Original Motif Forward 4 8 0.069551 Original motif 0.111111 0.083333 0.055556 0.750000 0.125000 0.097222 0.652778 0.125000 0.041667 0.097222 0.027778 0.833333 0.027778 0.027778 0.791667 0.152778 0.055556 0.166667 0.652778 0.125000 0.000000 0.041667 0.013889 0.944444 0.041667 0.000000 0.888889 0.069444 0.027778 0.027778 0.000000 0.944444 0.041667 0.944444 0.013889 0.000000 0.916667 0.027778 0.000000 0.055556 0.069444 0.875000 0.000000 0.055556 0.833333 0.013889 0.013889 0.138889 0.041667 0.069444 0.819444 0.069444 0.027778 0.027778 0.027778 0.916667 0.069444 0.013889 0.847222 0.069444 0.069444 0.777778 0.027778 0.125000 0.055556 0.041667 0.027778 0.875000 0.041667 0.708333 0.125000 0.125000 0.111111 0.819444 0.055556 0.013889 Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif 0.111111 0.055556 0.819444 0.013889 0.041667 0.125000 0.708333 0.125000 0.875000 0.041667 0.027778 0.055556 0.069444 0.027778 0.777778 0.125000 0.069444 0.847222 0.013889 0.069444 0.916667 0.027778 0.027778 0.027778 0.041667 0.819444 0.069444 0.069444 0.138889 0.013889 0.013889 0.833333 0.069444 0.000000 0.875000 0.055556 0.055556 0.027778 0.000000 0.916667 0.041667 0.013889 0.944444 0.000000 0.944444 0.027778 0.000000 0.027778 0.041667 0.888889 0.000000 0.069444 0.944444 0.041667 0.013889 0.000000 0.055556 0.652778 0.166667 0.125000 0.027778 0.791667 0.027778 0.152778 0.833333 0.097222 0.027778 0.041667 0.125000 0.652778 0.097222 0.125000 0.750000 0.083333 0.055556 0.111111 Consensus sequence: GGAGCACTGTGACACCACA Alignment: TGTGGTGTCACAGTGCTCC ---AAGGTCAC-------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 12 Motif name: RORA_1 Original motif 0.600000 0.040000 0.080000 0.280000 0.360000 0.040000 0.000000 0.600000 0.240000 0.480000 0.160000 0.120000 0.440000 0.080000 0.200000 0.280000 0.840000 0.000000 0.160000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 Consensus sequence: AWVDAGGTCA Reserve complement motif 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.160000 0.840000 0.280000 0.080000 0.200000 0.440000 0.240000 0.160000 0.480000 0.120000 0.600000 0.040000 0.000000 0.360000 0.280000 0.040000 0.080000 0.600000 Consensus sequence: TGACCTDVWT ************************************************************************ Best Matches for Motif ID 12 (Highest to Lowest) ************************************************************************ Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 4 Esrrb Original Motif Original Motif Backward 1 10 0.029401 Original motif 0.290198 0.220264 0.271200 0.218337 0.184941 0.227810 0.376477 0.210772 0.115226 0.332236 0.331687 0.220850 0.070959 0.342466 0.122740 0.463836 0.084862 0.729264 0.171640 0.014235 0.909737 0.008753 0.067834 0.013676 0.975656 0.000547 0.016411 0.007385 0.008758 0.001368 0.981390 0.008484 0.005750 0.003286 0.986309 0.004655 0.049904 0.012613 0.066904 0.870579 0.002473 0.927473 0.046703 0.023352 0.951569 0.005504 0.035498 0.007430 Consensus sequence: VBBYCAAGGTCA Reverse complement motif 0.007430 0.005504 0.035498 0.951569 0.002473 0.046703 0.927473 0.023352 0.870579 0.012613 0.066904 0.049904 0.005750 0.986309 0.003286 0.004655 0.008758 0.981390 0.001368 0.008484 0.007385 0.000547 0.016411 0.975656 0.013676 0.008753 0.067834 0.909737 0.084862 0.171640 0.729264 0.014235 0.463836 0.342466 0.122740 0.070959 0.115226 0.331687 0.332236 0.220850 0.184941 0.376477 0.227810 0.210772 0.218337 0.220264 0.271200 0.290198 Consensus sequence: TGACCTTGMBBB Alignment: VBBYCAAGGTCA --AWVDAGGTCA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 3 ESR1 Reverse Complement Reverse Complement Backward 2 10 0.041785 Original motif 0.261242 0.256959 0.329764 0.152034 0.228632 0.170940 0.350427 0.250000 0.136752 0.369658 0.318376 0.175214 0.176596 0.487234 0.138298 0.197872 0.285106 0.493617 0.100000 0.121277 0.651163 0.059197 0.188161 0.101480 0.075949 0.016878 0.816456 0.090717 0.040000 0.037895 0.884211 0.037895 0.069474 0.086316 0.191579 0.652632 0.008421 0.829474 0.111579 0.050526 0.837895 0.027368 0.056842 0.077895 0.122105 0.526316 0.225263 0.126316 0.132632 0.581053 0.111579 0.174737 0.134737 0.543158 0.204211 0.117895 0.067368 0.040000 0.016842 0.875789 0.044211 0.046316 0.896842 0.012632 0.642105 0.223158 0.065263 0.069474 0.021053 0.917895 0.025263 0.035789 0.124211 0.743158 0.004211 0.128421 0.054737 0.347368 0.046316 0.551579 Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif 0.551579 0.347368 0.046316 0.054737 0.124211 0.004211 0.743158 0.128421 0.021053 0.025263 0.917895 0.035789 0.069474 0.223158 0.065263 0.642105 0.044211 0.896842 0.046316 0.012632 0.875789 0.040000 0.016842 0.067368 0.134737 0.204211 0.543158 0.117895 0.132632 0.111579 0.581053 0.174737 0.122105 0.225263 0.526316 0.126316 0.077895 0.027368 0.056842 0.837895 0.008421 0.111579 0.829474 0.050526 0.652632 0.086316 0.191579 0.069474 0.040000 0.884211 0.037895 0.037895 0.075949 0.816456 0.016878 0.090717 0.101480 0.059197 0.188161 0.651163 0.285106 0.100000 0.493617 0.121277 0.176596 0.138298 0.487234 0.197872 0.136752 0.318376 0.369658 0.175214 0.228632 0.350427 0.170940 0.250000 0.261242 0.329764 0.256959 0.152034 Consensus sequence: MGGTCAGGGTGACCTRDBHV Alignment: MGGTCAGGGTGACCTRDBHV ---------TGACCTDVWT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 10 NR1H2RXRA Original Motif Original Motif Forward 6 10 0.054250 Original motif 0.680000 0.200000 0.000000 0.120000 0.680000 0.040000 0.200000 0.080000 0.800000 0.000000 0.200000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.040000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.000000 0.040000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.800000 0.040000 0.080000 0.080000 0.000000 0.600000 0.240000 0.160000 Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif 0.000000 0.240000 0.600000 0.160000 0.080000 0.040000 0.080000 0.800000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.040000 0.000000 0.000000 0.960000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.040000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.200000 0.800000 0.080000 0.040000 0.200000 0.680000 0.120000 0.200000 0.000000 0.680000 Consensus sequence: GTTGACCTTTGACCTTT Alignment: AAAGGTCAAAGGTCAAC -----AWVDAGGTCA-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 2 NR2F1 Reverse Complement Original Motif Forward 5 10 0.065481 Original motif 0.000000 0.000000 0.153846 0.846154 0.076923 0.000000 0.923077 0.000000 0.923077 0.000000 0.076923 0.000000 0.461538 0.538462 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.230769 0.000000 0.769231 0.000000 0.153846 0.000000 0.846154 0.076923 0.000000 0.000000 0.923077 0.153846 0.000000 0.846154 0.000000 0.461538 0.307692 0.230769 0.000000 0.461538 0.384615 0.076923 0.076923 0.076923 0.769231 0.076923 0.076923 0.230769 0.461538 0.000000 0.307692 0.000000 0.230769 0.230769 0.538462 Consensus sequence: TGAMCTTTGMMCYT Reverse complement motif 0.538462 0.230769 0.230769 0.000000 0.230769 0.000000 0.461538 0.307692 0.076923 0.076923 0.769231 0.076923 0.076923 0.384615 0.076923 0.461538 0.000000 0.307692 0.230769 0.461538 0.153846 0.846154 0.000000 0.000000 0.923077 0.000000 0.000000 0.076923 0.846154 0.153846 0.000000 0.000000 0.769231 0.230769 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.461538 0.000000 0.538462 0.000000 0.000000 0.000000 0.076923 0.923077 0.076923 0.923077 0.000000 0.000000 0.846154 0.000000 0.153846 0.000000 Consensus sequence: AKGYYCAAAGRTCA Alignment: TGAMCTTTGMMCYT ----TGACCTDVWT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 14 PPARGRXRA Original Motif Original Motif Backward 1 10 0.066680 Original motif 0.109685 0.369895 0.373396 0.147025 0.117716 0.193473 0.148019 0.540793 0.453488 0.026744 0.427907 0.091860 0.116144 0.003484 0.779326 0.101045 0.161253 0.017401 0.781903 0.039443 0.168213 0.149652 0.458237 0.223898 0.082271 0.633835 0.207416 0.076477 0.949015 0.024334 0.017381 0.009270 0.604867 0.055620 0.312862 0.026651 0.825231 0.005787 0.158565 0.010417 0.095017 0.002317 0.888760 0.013905 0.047509 0.010429 0.803013 0.139050 0.025492 0.114716 0.304751 0.555041 0.062645 0.643852 0.167053 0.126450 0.784223 0.067285 0.054524 0.093968 Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif 0.093968 0.067285 0.054524 0.784223 0.062645 0.167053 0.643852 0.126450 0.555041 0.114716 0.304751 0.025492 0.047509 0.803013 0.010429 0.139050 0.095017 0.888760 0.002317 0.013905 0.010417 0.005787 0.158565 0.825231 0.026651 0.055620 0.312862 0.604867 0.009270 0.024334 0.017381 0.949015 0.082271 0.207416 0.633835 0.076477 0.168213 0.458237 0.149652 0.223898 0.161253 0.781903 0.017401 0.039443 0.116144 0.779326 0.003484 0.101045 0.091860 0.026744 0.427907 0.453488 0.540793 0.193473 0.148019 0.117716 0.109685 0.373396 0.369895 0.147025 Consensus sequence: TGRCCTKTGHCCKAB Alignment: BTRGGDCARAGGKCA -----AWVDAGGTCA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 7 REST Original Motif Original Motif Forward 7 10 0.075561 Original motif 0.132621 0.109365 0.230044 0.527970 0.036318 0.168441 0.091421 0.703820 0.047589 0.855354 0.031309 0.065748 0.906367 0.018727 0.058677 0.016230 0.021197 0.027431 0.945137 0.006234 0.076012 0.609346 0.201246 0.113396 0.980697 0.004359 0.007472 0.007472 0.001868 0.987547 0.007472 0.003113 0.021793 0.922167 0.012453 0.043587 0.568847 0.125234 0.100935 0.204984 0.136534 0.233791 0.077307 0.552369 0.024314 0.004364 0.966958 0.004364 0.012469 0.003117 0.983167 0.001247 0.877105 0.069869 0.021210 0.031815 0.008125 0.800000 0.145625 0.046250 0.983750 0.005625 0.004375 0.006250 0.026349 0.008156 0.959849 0.005646 0.128688 0.632141 0.114878 0.124294 0.229899 0.019472 0.432161 0.318467 0.133962 0.586792 0.200629 0.078616 0.112579 0.700629 0.023270 0.163522 Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif 0.112579 0.023270 0.700629 0.163522 0.133962 0.200629 0.586792 0.078616 0.229899 0.432161 0.019472 0.318467 0.128688 0.114878 0.632141 0.124294 0.026349 0.959849 0.008156 0.005646 0.006250 0.005625 0.004375 0.983750 0.008125 0.145625 0.800000 0.046250 0.031815 0.069869 0.021210 0.877105 0.012469 0.983167 0.003117 0.001247 0.024314 0.966958 0.004364 0.004364 0.552369 0.233791 0.077307 0.136534 0.204984 0.125234 0.100935 0.568847 0.021793 0.012453 0.922167 0.043587 0.001868 0.007472 0.987547 0.003113 0.007472 0.004359 0.007472 0.980697 0.076012 0.201246 0.609346 0.113396 0.021197 0.945137 0.027431 0.006234 0.016230 0.018727 0.058677 0.906367 0.047589 0.031309 0.855354 0.065748 0.703820 0.168441 0.091421 0.036318 0.527970 0.109365 0.230044 0.132621 Consensus sequence: GGYGCTGTCCATGGTGCTGAA Alignment: TTCAGCACCATGGACAGCKCC ------AWVDAGGTCA----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 1 HNF4A Original Motif Original Motif Forward 4 10 0.080340 Original motif 0.417910 0.104478 0.402985 0.074627 0.029851 0.029851 0.835821 0.104478 0.179104 0.059701 0.522388 0.238806 0.074627 0.343284 0.298507 0.283582 0.044776 0.761194 0.059701 0.134328 0.880597 0.014925 0.044776 0.059701 0.791045 0.029851 0.149254 0.029851 0.835821 0.014925 0.119403 0.029851 0.059701 0.059701 0.865672 0.014925 0.089552 0.029851 0.492537 0.388060 0.044776 0.328358 0.164179 0.462687 0.059701 0.731343 0.074627 0.134328 0.626866 0.104478 0.149254 0.119403 Consensus sequence: RGGBCAAAGKYCA Reverse complement motif 0.119403 0.104478 0.149254 0.626866 0.059701 0.074627 0.731343 0.134328 0.462687 0.328358 0.164179 0.044776 0.089552 0.492537 0.029851 0.388060 0.059701 0.865672 0.059701 0.014925 0.029851 0.014925 0.119403 0.835821 0.029851 0.029851 0.149254 0.791045 0.059701 0.014925 0.044776 0.880597 0.044776 0.059701 0.761194 0.134328 0.074627 0.298507 0.343284 0.283582 0.179104 0.522388 0.059701 0.238806 0.029851 0.835821 0.029851 0.104478 0.074627 0.104478 0.402985 0.417910 Consensus sequence: TGMYCTTTGBCCK Alignment: RGGBCAAAGKYCA ---AWVDAGGTCA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 17 TgTGgTGTCACAGTGCTCC Reverse Complement Reverse Complement Forward 10 10 0.088931 Original motif 0.111111 0.083333 0.055556 0.750000 0.125000 0.097222 0.652778 0.125000 0.041667 0.097222 0.027778 0.833333 0.027778 0.027778 0.791667 0.152778 0.055556 0.166667 0.652778 0.125000 0.000000 0.041667 0.013889 0.944444 0.041667 0.000000 0.888889 0.069444 0.027778 0.027778 0.000000 0.944444 0.041667 0.944444 0.013889 0.000000 0.916667 0.027778 0.000000 0.055556 0.069444 0.875000 0.000000 0.055556 0.833333 0.013889 0.013889 0.138889 0.041667 0.069444 0.819444 0.069444 0.027778 0.027778 0.027778 0.916667 0.069444 0.013889 0.847222 0.069444 0.069444 0.777778 0.027778 0.125000 0.055556 0.041667 0.027778 0.875000 0.041667 0.708333 0.125000 0.125000 0.111111 0.819444 0.055556 0.013889 Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif 0.111111 0.055556 0.819444 0.013889 0.041667 0.125000 0.708333 0.125000 0.875000 0.041667 0.027778 0.055556 0.069444 0.027778 0.777778 0.125000 0.069444 0.847222 0.013889 0.069444 0.916667 0.027778 0.027778 0.027778 0.041667 0.819444 0.069444 0.069444 0.138889 0.013889 0.013889 0.833333 0.069444 0.000000 0.875000 0.055556 0.055556 0.027778 0.000000 0.916667 0.041667 0.013889 0.944444 0.000000 0.944444 0.027778 0.000000 0.027778 0.041667 0.888889 0.000000 0.069444 0.944444 0.041667 0.013889 0.000000 0.055556 0.652778 0.166667 0.125000 0.027778 0.791667 0.027778 0.152778 0.833333 0.097222 0.027778 0.041667 0.125000 0.652778 0.097222 0.125000 0.750000 0.083333 0.055556 0.111111 Consensus sequence: GGAGCACTGTGACACCACA Alignment: GGAGCACTGTGACACCACA ---------TGACCTDVWT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 25 wwCCAmAGTCmt Original Motif Original Motif Backward 2 10 0.092250 Original motif 0.454545 0.045455 0.227273 0.272727 0.363636 0.136364 0.136364 0.363636 0.000000 1.000000 0.000000 0.000000 0.000000 0.954545 0.045455 0.000000 1.000000 0.000000 0.000000 0.000000 0.409091 0.590909 0.000000 0.000000 0.909091 0.045455 0.045455 0.000000 0.000000 0.000000 1.000000 0.000000 0.045455 0.000000 0.000000 0.954545 0.045455 0.909091 0.000000 0.045455 0.272727 0.318182 0.181818 0.227273 0.181818 0.227273 0.227273 0.363636 Consensus sequence: DDCCAMAGTCHB Reverse complement motif 0.363636 0.227273 0.227273 0.181818 0.272727 0.181818 0.318182 0.227273 0.045455 0.000000 0.909091 0.045455 0.954545 0.000000 0.000000 0.045455 0.000000 1.000000 0.000000 0.000000 0.000000 0.045455 0.045455 0.909091 0.409091 0.000000 0.590909 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.045455 0.954545 0.000000 0.000000 0.000000 1.000000 0.000000 0.363636 0.136364 0.136364 0.363636 0.272727 0.045455 0.227273 0.454545 Consensus sequence: VDGACTRTGGDD Alignment: DDCCAMAGTCHB -AWVDAGGTCA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 9 ESR2 Original Motif Reverse Complement Backward 4 10 0.098821 Original motif 0.218487 0.450980 0.176471 0.154062 0.442577 0.142857 0.114846 0.299720 0.521008 0.042017 0.431373 0.005602 0.075630 0.000000 0.770308 0.154062 0.050420 0.056022 0.893557 0.000000 0.036415 0.053221 0.092437 0.817927 0.000000 1.000000 0.000000 0.000000 0.943978 0.002801 0.000000 0.053221 0.137255 0.344538 0.316527 0.201681 0.179272 0.176471 0.417367 0.226891 0.145658 0.170868 0.411765 0.271709 0.058824 0.092437 0.067227 0.781513 0.176471 0.070028 0.742297 0.011204 0.498599 0.277311 0.053221 0.170868 0.095238 0.750700 0.005602 0.148459 0.128852 0.809524 0.000000 0.061625 0.075630 0.252101 0.000000 0.672269 0.168067 0.263305 0.380952 0.187675 Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif 0.168067 0.380952 0.263305 0.187675 0.672269 0.252101 0.000000 0.075630 0.128852 0.000000 0.809524 0.061625 0.095238 0.005602 0.750700 0.148459 0.170868 0.277311 0.053221 0.498599 0.176471 0.742297 0.070028 0.011204 0.781513 0.092437 0.067227 0.058824 0.145658 0.411765 0.170868 0.271709 0.179272 0.417367 0.176471 0.226891 0.137255 0.316527 0.344538 0.201681 0.053221 0.002801 0.000000 0.943978 0.000000 0.000000 1.000000 0.000000 0.817927 0.053221 0.092437 0.036415 0.050420 0.893557 0.056022 0.000000 0.075630 0.770308 0.000000 0.154062 0.005602 0.042017 0.431373 0.521008 0.299720 0.142857 0.114846 0.442577 0.218487 0.176471 0.450980 0.154062 Consensus sequence: BAGGYCABHBTGACCKHV Alignment: BAGGYCABHBTGACCKHV -----AWVDAGGTCA--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 13 Motif name: MIZF Original motif 0.100000 0.300000 0.250000 0.350000 0.650000 0.050000 0.000000 0.300000 1.000000 0.000000 0.000000 0.000000 0.100000 0.850000 0.050000 0.000000 0.000000 0.000000 0.950000 0.050000 0.000000 0.050000 0.000000 0.950000 0.000000 0.950000 0.000000 0.050000 0.000000 0.900000 0.100000 0.000000 0.000000 0.000000 0.950000 0.050000 0.100000 0.650000 0.050000 0.200000 Consensus sequence: BAACGTCCGC Reserve complement motif 0.100000 0.050000 0.650000 0.200000 0.000000 0.950000 0.000000 0.050000 0.000000 0.100000 0.900000 0.000000 0.000000 0.000000 0.950000 0.050000 0.950000 0.050000 0.000000 0.000000 0.000000 0.950000 0.000000 0.050000 0.100000 0.050000 0.850000 0.000000 0.000000 0.000000 0.000000 1.000000 0.300000 0.050000 0.000000 0.650000 0.350000 0.300000 0.250000 0.100000 Consensus sequence: GCGGACGTTV ************************************************************************ Best Matches for Motif ID 13 (Highest to Lowest) ************************************************************************ Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 9 ESR2 Reverse Complement Reverse Complement Backward 1 10 0.060578 Original motif 0.218487 0.450980 0.176471 0.154062 0.442577 0.142857 0.114846 0.299720 0.521008 0.042017 0.431373 0.005602 0.075630 0.000000 0.770308 0.154062 0.050420 0.056022 0.893557 0.000000 0.036415 0.053221 0.092437 0.817927 0.000000 1.000000 0.000000 0.000000 0.943978 0.002801 0.000000 0.053221 0.137255 0.344538 0.316527 0.201681 0.179272 0.176471 0.417367 0.226891 0.145658 0.170868 0.411765 0.271709 0.058824 0.092437 0.067227 0.781513 0.176471 0.070028 0.742297 0.011204 0.498599 0.277311 0.053221 0.170868 0.095238 0.750700 0.005602 0.148459 0.128852 0.809524 0.000000 0.061625 0.075630 0.252101 0.000000 0.672269 0.168067 0.263305 0.380952 0.187675 Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif 0.168067 0.380952 0.263305 0.187675 0.672269 0.252101 0.000000 0.075630 0.128852 0.000000 0.809524 0.061625 0.095238 0.005602 0.750700 0.148459 0.170868 0.277311 0.053221 0.498599 0.176471 0.742297 0.070028 0.011204 0.781513 0.092437 0.067227 0.058824 0.145658 0.411765 0.170868 0.271709 0.179272 0.417367 0.176471 0.226891 0.137255 0.316527 0.344538 0.201681 0.053221 0.002801 0.000000 0.943978 0.000000 0.000000 1.000000 0.000000 0.817927 0.053221 0.092437 0.036415 0.050420 0.893557 0.056022 0.000000 0.075630 0.770308 0.000000 0.154062 0.005602 0.042017 0.431373 0.521008 0.299720 0.142857 0.114846 0.442577 0.218487 0.176471 0.450980 0.154062 Consensus sequence: BAGGYCABHBTGACCKHV Alignment: BAGGYCABHBTGACCKHV --------GCGGACGTTV ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 3 ESR1 Original Motif Original Motif Backward 8 10 0.061457 Original motif 0.261242 0.256959 0.329764 0.152034 0.228632 0.170940 0.350427 0.250000 0.136752 0.369658 0.318376 0.175214 0.176596 0.487234 0.138298 0.197872 0.285106 0.493617 0.100000 0.121277 0.651163 0.059197 0.188161 0.101480 0.075949 0.016878 0.816456 0.090717 0.040000 0.037895 0.884211 0.037895 0.069474 0.086316 0.191579 0.652632 0.008421 0.829474 0.111579 0.050526 0.837895 0.027368 0.056842 0.077895 0.122105 0.526316 0.225263 0.126316 0.132632 0.581053 0.111579 0.174737 0.134737 0.543158 0.204211 0.117895 0.067368 0.040000 0.016842 0.875789 0.044211 0.046316 0.896842 0.012632 0.642105 0.223158 0.065263 0.069474 0.021053 0.917895 0.025263 0.035789 0.124211 0.743158 0.004211 0.128421 0.054737 0.347368 0.046316 0.551579 Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif 0.551579 0.347368 0.046316 0.054737 0.124211 0.004211 0.743158 0.128421 0.021053 0.025263 0.917895 0.035789 0.069474 0.223158 0.065263 0.642105 0.044211 0.896842 0.046316 0.012632 0.875789 0.040000 0.016842 0.067368 0.134737 0.204211 0.543158 0.117895 0.132632 0.111579 0.581053 0.174737 0.122105 0.225263 0.526316 0.126316 0.077895 0.027368 0.056842 0.837895 0.008421 0.111579 0.829474 0.050526 0.652632 0.086316 0.191579 0.069474 0.040000 0.884211 0.037895 0.037895 0.075949 0.816456 0.016878 0.090717 0.101480 0.059197 0.188161 0.651163 0.285106 0.100000 0.493617 0.121277 0.176596 0.138298 0.487234 0.197872 0.136752 0.318376 0.369658 0.175214 0.228632 0.350427 0.170940 0.250000 0.261242 0.329764 0.256959 0.152034 Consensus sequence: MGGTCAGGGTGACCTRDBHV Alignment: VDBHMAGGTCACCCTGACCY ---BAACGTCCGC------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 10 NR1H2RXRA Original Motif Original Motif Backward 1 10 0.064607 Original motif 0.680000 0.200000 0.000000 0.120000 0.680000 0.040000 0.200000 0.080000 0.800000 0.000000 0.200000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.040000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.000000 0.040000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.800000 0.040000 0.080000 0.080000 0.000000 0.600000 0.240000 0.160000 Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif 0.000000 0.240000 0.600000 0.160000 0.080000 0.040000 0.080000 0.800000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.040000 0.000000 0.000000 0.960000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.040000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.200000 0.800000 0.080000 0.040000 0.200000 0.680000 0.120000 0.200000 0.000000 0.680000 Consensus sequence: GTTGACCTTTGACCTTT Alignment: AAAGGTCAAAGGTCAAC -------BAACGTCCGC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 32 gCGCGCsCgsG Original Motif Original Motif Forward 1 10 0.065160 Original motif 0.105263 0.210526 0.526316 0.157895 0.000000 0.736842 0.105263 0.157895 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.368421 0.631579 0.000000 0.000000 0.894737 0.105263 0.000000 0.157895 0.157895 0.631579 0.052632 0.052632 0.631579 0.263158 0.052632 0.105263 0.052632 0.789474 0.052632 Consensus sequence: GCGCGCSCGCG Reverse complement motif 0.105263 0.789474 0.052632 0.052632 0.052632 0.263158 0.631579 0.052632 0.157895 0.631579 0.157895 0.052632 0.000000 0.105263 0.894737 0.000000 0.000000 0.631579 0.368421 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.105263 0.736842 0.157895 0.105263 0.526316 0.210526 0.157895 Consensus sequence: CGCGSGCGCGC Alignment: GCGCGCSCGCG BAACGTCCGC- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 16 CTCF Original Motif Reverse Complement Backward 10 10 0.069777 Original motif 0.095290 0.318729 0.083242 0.502738 0.182913 0.158817 0.453450 0.204819 0.307777 0.053669 0.491785 0.146769 0.061336 0.876232 0.023001 0.039430 0.008762 0.989047 0.000000 0.002191 0.814896 0.014239 0.071194 0.099671 0.043812 0.578313 0.365827 0.012048 0.117325 0.474781 0.052632 0.355263 0.933114 0.012061 0.035088 0.019737 0.005488 0.000000 0.991218 0.003293 0.365532 0.003293 0.621295 0.009879 0.059276 0.013172 0.553238 0.374314 0.013187 0.000000 0.978022 0.008791 0.061538 0.008791 0.851648 0.078022 0.114411 0.806381 0.005501 0.073707 0.409241 0.014301 0.557756 0.018702 0.090308 0.530837 0.338106 0.040749 0.128855 0.354626 0.080396 0.436123 0.442731 0.199339 0.292952 0.064978 Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif 0.064978 0.199339 0.292952 0.442731 0.436123 0.354626 0.080396 0.128855 0.090308 0.338106 0.530837 0.040749 0.409241 0.557756 0.014301 0.018702 0.114411 0.005501 0.806381 0.073707 0.061538 0.851648 0.008791 0.078022 0.013187 0.978022 0.000000 0.008791 0.059276 0.553238 0.013172 0.374314 0.365532 0.621295 0.003293 0.009879 0.005488 0.991218 0.000000 0.003293 0.019737 0.012061 0.035088 0.933114 0.117325 0.052632 0.474781 0.355263 0.043812 0.365827 0.578313 0.012048 0.099671 0.014239 0.071194 0.814896 0.008762 0.000000 0.989047 0.002191 0.061336 0.023001 0.876232 0.039430 0.307777 0.491785 0.053669 0.146769 0.182913 0.453450 0.158817 0.204819 0.502738 0.318729 0.083242 0.095290 Consensus sequence: BMSMGCCYMCTKSTGGMHM Alignment: BMSMGCCYMCTKSTGGMHM BAACGTCCGC--------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 7 REST Original Motif Reverse Complement Backward 3 10 0.070815 Original motif 0.132621 0.109365 0.230044 0.527970 0.036318 0.168441 0.091421 0.703820 0.047589 0.855354 0.031309 0.065748 0.906367 0.018727 0.058677 0.016230 0.021197 0.027431 0.945137 0.006234 0.076012 0.609346 0.201246 0.113396 0.980697 0.004359 0.007472 0.007472 0.001868 0.987547 0.007472 0.003113 0.021793 0.922167 0.012453 0.043587 0.568847 0.125234 0.100935 0.204984 0.136534 0.233791 0.077307 0.552369 0.024314 0.004364 0.966958 0.004364 0.012469 0.003117 0.983167 0.001247 0.877105 0.069869 0.021210 0.031815 0.008125 0.800000 0.145625 0.046250 0.983750 0.005625 0.004375 0.006250 0.026349 0.008156 0.959849 0.005646 0.128688 0.632141 0.114878 0.124294 0.229899 0.019472 0.432161 0.318467 0.133962 0.586792 0.200629 0.078616 0.112579 0.700629 0.023270 0.163522 Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif 0.112579 0.023270 0.700629 0.163522 0.133962 0.200629 0.586792 0.078616 0.229899 0.432161 0.019472 0.318467 0.128688 0.114878 0.632141 0.124294 0.026349 0.959849 0.008156 0.005646 0.006250 0.005625 0.004375 0.983750 0.008125 0.145625 0.800000 0.046250 0.031815 0.069869 0.021210 0.877105 0.012469 0.983167 0.003117 0.001247 0.024314 0.966958 0.004364 0.004364 0.552369 0.233791 0.077307 0.136534 0.204984 0.125234 0.100935 0.568847 0.021793 0.012453 0.922167 0.043587 0.001868 0.007472 0.987547 0.003113 0.007472 0.004359 0.007472 0.980697 0.076012 0.201246 0.609346 0.113396 0.021197 0.945137 0.027431 0.006234 0.016230 0.018727 0.058677 0.906367 0.047589 0.031309 0.855354 0.065748 0.703820 0.168441 0.091421 0.036318 0.527970 0.109365 0.230044 0.132621 Consensus sequence: GGYGCTGTCCATGGTGCTGAA Alignment: GGYGCTGTCCATGGTGCTGAA ---------BAACGTCCGC-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 19 atactttggc Original Motif Original Motif Backward 1 10 0.080357 Original motif 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 Consensus sequence: ATACTTTGGC Reverse complement motif 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 Consensus sequence: GCCAAAGTAT Alignment: ATACTTTGGC BAACGTCCGC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 8 Myc Reverse Complement Original Motif Forward 2 9 0.555645 Original motif 0.295154 0.422907 0.158590 0.123348 0.149780 0.233480 0.572687 0.044053 0.035242 0.964758 0.000000 0.000000 0.955947 0.017621 0.022026 0.004405 0.000000 0.933921 0.013216 0.052863 0.083700 0.008811 0.898678 0.008811 0.039648 0.193833 0.000000 0.766520 0.000000 0.008811 0.951542 0.039648 0.000000 0.074890 0.806167 0.118943 0.198238 0.471366 0.105727 0.224670 Consensus sequence: VGCACGTGGH Reverse complement motif 0.198238 0.105727 0.471366 0.224670 0.000000 0.806167 0.074890 0.118943 0.000000 0.951542 0.008811 0.039648 0.766520 0.193833 0.000000 0.039648 0.083700 0.898678 0.008811 0.008811 0.000000 0.013216 0.933921 0.052863 0.004405 0.017621 0.022026 0.955947 0.035242 0.000000 0.964758 0.000000 0.149780 0.572687 0.233480 0.044053 0.295154 0.158590 0.422907 0.123348 Consensus sequence: DCCACGTGCV Alignment: VGCACGTGGH- -GCGGACGTTV ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 29 cCGCGGrCACG Reverse Complement Original Motif Forward 3 9 0.560913 Original motif 0.000000 0.600000 0.200000 0.200000 0.000000 0.800000 0.000000 0.200000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.600000 0.000000 0.400000 0.000000 0.000000 0.800000 0.200000 0.000000 0.800000 0.000000 0.200000 0.000000 0.000000 0.800000 0.200000 0.000000 0.200000 0.000000 0.800000 0.000000 Consensus sequence: CCGCGGRCACG Reverse complement motif 0.200000 0.800000 0.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.200000 0.800000 0.000000 0.000000 0.000000 0.400000 0.600000 0.000000 0.800000 0.200000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.800000 0.200000 0.000000 0.200000 0.600000 0.200000 Consensus sequence: CGTGKCCGCGG Alignment: CCGCGGRCACG- --GCGGACGTTV ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 6 Mycn Reverse Complement Original Motif Forward 2 9 0.561179 Original motif 0.349315 0.363014 0.143836 0.143836 0.089041 0.388128 0.447489 0.075342 0.015982 0.984018 0.000000 0.000000 0.945205 0.000000 0.041096 0.013699 0.000000 0.961187 0.018265 0.020548 0.070776 0.002283 0.924658 0.002283 0.054795 0.221461 0.004566 0.719178 0.000000 0.000000 0.938356 0.061644 0.061644 0.111872 0.739726 0.086758 0.139269 0.605023 0.091324 0.164384 Consensus sequence: HSCACGTGGC Reverse complement motif 0.139269 0.091324 0.605023 0.164384 0.061644 0.739726 0.111872 0.086758 0.000000 0.938356 0.000000 0.061644 0.719178 0.221461 0.004566 0.054795 0.070776 0.924658 0.002283 0.002283 0.000000 0.018265 0.961187 0.020548 0.013699 0.000000 0.041096 0.945205 0.015982 0.000000 0.984018 0.000000 0.089041 0.447489 0.388128 0.075342 0.349315 0.143836 0.363014 0.143836 Consensus sequence: GCCACGTGSD Alignment: HSCACGTGGC- -GCGGACGTTV ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 14 Motif name: PPARGRXRA Original motif 0.109685 0.369895 0.373396 0.147025 0.117716 0.193473 0.148019 0.540793 0.453488 0.026744 0.427907 0.091860 0.116144 0.003484 0.779326 0.101045 0.161253 0.017401 0.781903 0.039443 0.168213 0.149652 0.458237 0.223898 0.082271 0.633835 0.207416 0.076477 0.949015 0.024334 0.017381 0.009270 0.604867 0.055620 0.312862 0.026651 0.825231 0.005787 0.158565 0.010417 0.095017 0.002317 0.888760 0.013905 0.047509 0.010429 0.803013 0.139050 0.025492 0.114716 0.304751 0.555041 0.062645 0.643852 0.167053 0.126450 0.784223 0.067285 0.054524 0.093968 Consensus sequence: BTRGGDCARAGGKCA Reserve complement motif 0.093968 0.067285 0.054524 0.784223 0.062645 0.167053 0.643852 0.126450 0.555041 0.114716 0.304751 0.025492 0.047509 0.803013 0.010429 0.139050 0.095017 0.888760 0.002317 0.013905 0.010417 0.005787 0.158565 0.825231 0.026651 0.055620 0.312862 0.604867 0.009270 0.024334 0.017381 0.949015 0.082271 0.207416 0.633835 0.076477 0.168213 0.458237 0.149652 0.223898 0.161253 0.781903 0.017401 0.039443 0.116144 0.779326 0.003484 0.101045 0.091860 0.026744 0.427907 0.453488 0.540793 0.193473 0.148019 0.117716 0.109685 0.373396 0.369895 0.147025 Consensus sequence: TGRCCTKTGHCCKAB ************************************************************************ Best Matches for Motif ID 14 (Highest to Lowest) ************************************************************************ Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 10 NR1H2RXRA Original Motif Original Motif Backward 3 15 0.044297 Original motif 0.680000 0.200000 0.000000 0.120000 0.680000 0.040000 0.200000 0.080000 0.800000 0.000000 0.200000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.040000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.000000 0.040000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.800000 0.040000 0.080000 0.080000 0.000000 0.600000 0.240000 0.160000 Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif 0.000000 0.240000 0.600000 0.160000 0.080000 0.040000 0.080000 0.800000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.040000 0.000000 0.000000 0.960000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.040000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.200000 0.800000 0.080000 0.040000 0.200000 0.680000 0.120000 0.200000 0.000000 0.680000 Consensus sequence: GTTGACCTTTGACCTTT Alignment: AAAGGTCAAAGGTCAAC BTRGGDCARAGGKCA-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 9 ESR2 Original Motif Original Motif Backward 4 15 0.060241 Original motif 0.218487 0.450980 0.176471 0.154062 0.442577 0.142857 0.114846 0.299720 0.521008 0.042017 0.431373 0.005602 0.075630 0.000000 0.770308 0.154062 0.050420 0.056022 0.893557 0.000000 0.036415 0.053221 0.092437 0.817927 0.000000 1.000000 0.000000 0.000000 0.943978 0.002801 0.000000 0.053221 0.137255 0.344538 0.316527 0.201681 0.179272 0.176471 0.417367 0.226891 0.145658 0.170868 0.411765 0.271709 0.058824 0.092437 0.067227 0.781513 0.176471 0.070028 0.742297 0.011204 0.498599 0.277311 0.053221 0.170868 0.095238 0.750700 0.005602 0.148459 0.128852 0.809524 0.000000 0.061625 0.075630 0.252101 0.000000 0.672269 0.168067 0.263305 0.380952 0.187675 Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif 0.168067 0.380952 0.263305 0.187675 0.672269 0.252101 0.000000 0.075630 0.128852 0.000000 0.809524 0.061625 0.095238 0.005602 0.750700 0.148459 0.170868 0.277311 0.053221 0.498599 0.176471 0.742297 0.070028 0.011204 0.781513 0.092437 0.067227 0.058824 0.145658 0.411765 0.170868 0.271709 0.179272 0.417367 0.176471 0.226891 0.137255 0.316527 0.344538 0.201681 0.053221 0.002801 0.000000 0.943978 0.000000 0.000000 1.000000 0.000000 0.817927 0.053221 0.092437 0.036415 0.050420 0.893557 0.056022 0.000000 0.075630 0.770308 0.000000 0.154062 0.005602 0.042017 0.431373 0.521008 0.299720 0.142857 0.114846 0.442577 0.218487 0.176471 0.450980 0.154062 Consensus sequence: BAGGYCABHBTGACCKHV Alignment: VHRGGTCABDBTGMCCTB BTRGGDCARAGGKCA--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 3 ESR1 Original Motif Original Motif Backward 3 15 0.072309 Original motif 0.261242 0.256959 0.329764 0.152034 0.228632 0.170940 0.350427 0.250000 0.136752 0.369658 0.318376 0.175214 0.176596 0.487234 0.138298 0.197872 0.285106 0.493617 0.100000 0.121277 0.651163 0.059197 0.188161 0.101480 0.075949 0.016878 0.816456 0.090717 0.040000 0.037895 0.884211 0.037895 0.069474 0.086316 0.191579 0.652632 0.008421 0.829474 0.111579 0.050526 0.837895 0.027368 0.056842 0.077895 0.122105 0.526316 0.225263 0.126316 0.132632 0.581053 0.111579 0.174737 0.134737 0.543158 0.204211 0.117895 0.067368 0.040000 0.016842 0.875789 0.044211 0.046316 0.896842 0.012632 0.642105 0.223158 0.065263 0.069474 0.021053 0.917895 0.025263 0.035789 0.124211 0.743158 0.004211 0.128421 0.054737 0.347368 0.046316 0.551579 Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif 0.551579 0.347368 0.046316 0.054737 0.124211 0.004211 0.743158 0.128421 0.021053 0.025263 0.917895 0.035789 0.069474 0.223158 0.065263 0.642105 0.044211 0.896842 0.046316 0.012632 0.875789 0.040000 0.016842 0.067368 0.134737 0.204211 0.543158 0.117895 0.132632 0.111579 0.581053 0.174737 0.122105 0.225263 0.526316 0.126316 0.077895 0.027368 0.056842 0.837895 0.008421 0.111579 0.829474 0.050526 0.652632 0.086316 0.191579 0.069474 0.040000 0.884211 0.037895 0.037895 0.075949 0.816456 0.016878 0.090717 0.101480 0.059197 0.188161 0.651163 0.285106 0.100000 0.493617 0.121277 0.176596 0.138298 0.487234 0.197872 0.136752 0.318376 0.369658 0.175214 0.228632 0.350427 0.170940 0.250000 0.261242 0.329764 0.256959 0.152034 Consensus sequence: MGGTCAGGGTGACCTRDBHV Alignment: VDBHMAGGTCACCCTGACCY ---BTRGGDCARAGGKCA-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 22 CACTGTGrYrtCACAGTGswsCAcT Original Motif Original Motif Forward 6 15 0.074135 Original motif 0.111111 0.746032 0.063492 0.079365 0.857143 0.047619 0.047619 0.047619 0.047619 0.857143 0.079365 0.015873 0.031746 0.000000 0.000000 0.968254 0.031746 0.015873 0.904762 0.047619 0.000000 0.000000 0.000000 1.000000 0.031746 0.000000 0.857143 0.111111 0.396825 0.111111 0.412698 0.079365 0.031746 0.253968 0.015873 0.698413 0.365079 0.000000 0.634921 0.000000 0.079365 0.206349 0.047619 0.666667 0.047619 0.936508 0.015873 0.000000 0.952381 0.000000 0.015873 0.031746 0.015873 0.920635 0.000000 0.063492 0.920635 0.000000 0.000000 0.079365 0.063492 0.047619 0.841270 0.047619 0.000000 0.000000 0.015873 0.984127 0.047619 0.015873 0.904762 0.031746 0.015873 0.603175 0.317460 0.063492 0.396825 0.000000 0.015873 0.587302 0.015873 0.476190 0.428571 0.079365 0.063492 0.920635 0.000000 0.015873 0.920635 0.015873 0.047619 0.015873 0.095238 0.682540 0.095238 0.126984 0.047619 0.015873 0.095238 0.841270 Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif 0.841270 0.015873 0.095238 0.047619 0.095238 0.095238 0.682540 0.126984 0.015873 0.015873 0.047619 0.920635 0.063492 0.000000 0.920635 0.015873 0.015873 0.428571 0.476190 0.079365 0.587302 0.000000 0.015873 0.396825 0.015873 0.317460 0.603175 0.063492 0.047619 0.904762 0.015873 0.031746 0.984127 0.000000 0.015873 0.000000 0.063492 0.841270 0.047619 0.047619 0.079365 0.000000 0.000000 0.920635 0.015873 0.000000 0.920635 0.063492 0.031746 0.000000 0.015873 0.952381 0.047619 0.015873 0.936508 0.000000 0.666667 0.206349 0.047619 0.079365 0.365079 0.634921 0.000000 0.000000 0.698413 0.253968 0.015873 0.031746 0.396825 0.412698 0.111111 0.079365 0.031746 0.857143 0.000000 0.111111 1.000000 0.000000 0.000000 0.000000 0.031746 0.904762 0.015873 0.047619 0.968254 0.000000 0.000000 0.031746 0.047619 0.079365 0.857143 0.015873 0.047619 0.047619 0.047619 0.857143 0.111111 0.063492 0.746032 0.079365 Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG Alignment: CACTGTGRTRTCACAGTGSWSCACT -----BTRGGDCARAGGKCA----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 16 CTCF Original Motif Original Motif Forward 2 15 0.078636 Original motif 0.095290 0.318729 0.083242 0.502738 0.182913 0.158817 0.453450 0.204819 0.307777 0.053669 0.491785 0.146769 0.061336 0.876232 0.023001 0.039430 0.008762 0.989047 0.000000 0.002191 0.814896 0.014239 0.071194 0.099671 0.043812 0.578313 0.365827 0.012048 0.117325 0.474781 0.052632 0.355263 0.933114 0.012061 0.035088 0.019737 0.005488 0.000000 0.991218 0.003293 0.365532 0.003293 0.621295 0.009879 0.059276 0.013172 0.553238 0.374314 0.013187 0.000000 0.978022 0.008791 0.061538 0.008791 0.851648 0.078022 0.114411 0.806381 0.005501 0.073707 0.409241 0.014301 0.557756 0.018702 0.090308 0.530837 0.338106 0.040749 0.128855 0.354626 0.080396 0.436123 0.442731 0.199339 0.292952 0.064978 Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif 0.064978 0.199339 0.292952 0.442731 0.436123 0.354626 0.080396 0.128855 0.090308 0.338106 0.530837 0.040749 0.409241 0.557756 0.014301 0.018702 0.114411 0.005501 0.806381 0.073707 0.061538 0.851648 0.008791 0.078022 0.013187 0.978022 0.000000 0.008791 0.059276 0.553238 0.013172 0.374314 0.365532 0.621295 0.003293 0.009879 0.005488 0.991218 0.000000 0.003293 0.019737 0.012061 0.035088 0.933114 0.117325 0.052632 0.474781 0.355263 0.043812 0.365827 0.578313 0.012048 0.099671 0.014239 0.071194 0.814896 0.008762 0.000000 0.989047 0.002191 0.061336 0.023001 0.876232 0.039430 0.307777 0.491785 0.053669 0.146769 0.182913 0.453450 0.158817 0.204819 0.502738 0.318729 0.083242 0.095290 Consensus sequence: BMSMGCCYMCTKSTGGMHM Alignment: YDRCCASYAGRKGGCRSYV -BTRGGDCARAGGKCA--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 7 REST Original Motif Original Motif Forward 2 15 0.079616 Original motif 0.132621 0.109365 0.230044 0.527970 0.036318 0.168441 0.091421 0.703820 0.047589 0.855354 0.031309 0.065748 0.906367 0.018727 0.058677 0.016230 0.021197 0.027431 0.945137 0.006234 0.076012 0.609346 0.201246 0.113396 0.980697 0.004359 0.007472 0.007472 0.001868 0.987547 0.007472 0.003113 0.021793 0.922167 0.012453 0.043587 0.568847 0.125234 0.100935 0.204984 0.136534 0.233791 0.077307 0.552369 0.024314 0.004364 0.966958 0.004364 0.012469 0.003117 0.983167 0.001247 0.877105 0.069869 0.021210 0.031815 0.008125 0.800000 0.145625 0.046250 0.983750 0.005625 0.004375 0.006250 0.026349 0.008156 0.959849 0.005646 0.128688 0.632141 0.114878 0.124294 0.229899 0.019472 0.432161 0.318467 0.133962 0.586792 0.200629 0.078616 0.112579 0.700629 0.023270 0.163522 Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif 0.112579 0.023270 0.700629 0.163522 0.133962 0.200629 0.586792 0.078616 0.229899 0.432161 0.019472 0.318467 0.128688 0.114878 0.632141 0.124294 0.026349 0.959849 0.008156 0.005646 0.006250 0.005625 0.004375 0.983750 0.008125 0.145625 0.800000 0.046250 0.031815 0.069869 0.021210 0.877105 0.012469 0.983167 0.003117 0.001247 0.024314 0.966958 0.004364 0.004364 0.552369 0.233791 0.077307 0.136534 0.204984 0.125234 0.100935 0.568847 0.021793 0.012453 0.922167 0.043587 0.001868 0.007472 0.987547 0.003113 0.007472 0.004359 0.007472 0.980697 0.076012 0.201246 0.609346 0.113396 0.021197 0.945137 0.027431 0.006234 0.016230 0.018727 0.058677 0.906367 0.047589 0.031309 0.855354 0.065748 0.703820 0.168441 0.091421 0.036318 0.527970 0.109365 0.230044 0.132621 Consensus sequence: GGYGCTGTCCATGGTGCTGAA Alignment: TTCAGCACCATGGACAGCKCC -BTRGGDCARAGGKCA----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 23 TGGAGCACTGTGACAcCACAGTGg Original Motif Reverse Complement Forward 7 15 0.081341 Original motif 0.054054 0.040541 0.054054 0.851351 0.040541 0.013514 0.824324 0.121622 0.094595 0.135135 0.756757 0.013514 0.891892 0.000000 0.000000 0.108108 0.040541 0.094595 0.810811 0.054054 0.081081 0.797297 0.054054 0.067568 0.932432 0.027027 0.000000 0.040541 0.054054 0.756757 0.135135 0.054054 0.108108 0.027027 0.013514 0.851351 0.108108 0.000000 0.851351 0.040541 0.013514 0.000000 0.027027 0.959459 0.000000 0.013514 0.945946 0.040541 0.905405 0.000000 0.067568 0.027027 0.054054 0.837838 0.000000 0.108108 0.945946 0.013514 0.040541 0.000000 0.162162 0.500000 0.189189 0.148649 0.108108 0.824324 0.000000 0.067568 0.945946 0.000000 0.040541 0.013514 0.081081 0.837838 0.027027 0.054054 0.945946 0.000000 0.013514 0.040541 0.054054 0.067568 0.783784 0.094595 0.054054 0.027027 0.000000 0.918919 0.040541 0.013514 0.864865 0.081081 0.148649 0.121622 0.675676 0.054054 Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif 0.148649 0.675676 0.121622 0.054054 0.040541 0.864865 0.013514 0.081081 0.918919 0.027027 0.000000 0.054054 0.054054 0.783784 0.067568 0.094595 0.040541 0.000000 0.013514 0.945946 0.081081 0.027027 0.837838 0.054054 0.013514 0.000000 0.040541 0.945946 0.108108 0.000000 0.824324 0.067568 0.162162 0.189189 0.500000 0.148649 0.000000 0.013514 0.040541 0.945946 0.054054 0.000000 0.837838 0.108108 0.027027 0.000000 0.067568 0.905405 0.000000 0.945946 0.013514 0.040541 0.959459 0.000000 0.027027 0.013514 0.108108 0.851351 0.000000 0.040541 0.851351 0.027027 0.013514 0.108108 0.054054 0.135135 0.756757 0.054054 0.040541 0.027027 0.000000 0.932432 0.081081 0.054054 0.797297 0.067568 0.040541 0.810811 0.094595 0.054054 0.108108 0.000000 0.000000 0.891892 0.094595 0.756757 0.135135 0.013514 0.040541 0.824324 0.013514 0.121622 0.851351 0.040541 0.054054 0.054054 Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA Alignment: CCACTGTGVTGTCACAGTGCTCCA ------BTRGGDCARAGGKCA--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 17 TgTGgTGTCACAGTGCTCC Original Motif Original Motif Forward 3 15 0.081865 Original motif 0.111111 0.083333 0.055556 0.750000 0.125000 0.097222 0.652778 0.125000 0.041667 0.097222 0.027778 0.833333 0.027778 0.027778 0.791667 0.152778 0.055556 0.166667 0.652778 0.125000 0.000000 0.041667 0.013889 0.944444 0.041667 0.000000 0.888889 0.069444 0.027778 0.027778 0.000000 0.944444 0.041667 0.944444 0.013889 0.000000 0.916667 0.027778 0.000000 0.055556 0.069444 0.875000 0.000000 0.055556 0.833333 0.013889 0.013889 0.138889 0.041667 0.069444 0.819444 0.069444 0.027778 0.027778 0.027778 0.916667 0.069444 0.013889 0.847222 0.069444 0.069444 0.777778 0.027778 0.125000 0.055556 0.041667 0.027778 0.875000 0.041667 0.708333 0.125000 0.125000 0.111111 0.819444 0.055556 0.013889 Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif 0.111111 0.055556 0.819444 0.013889 0.041667 0.125000 0.708333 0.125000 0.875000 0.041667 0.027778 0.055556 0.069444 0.027778 0.777778 0.125000 0.069444 0.847222 0.013889 0.069444 0.916667 0.027778 0.027778 0.027778 0.041667 0.819444 0.069444 0.069444 0.138889 0.013889 0.013889 0.833333 0.069444 0.000000 0.875000 0.055556 0.055556 0.027778 0.000000 0.916667 0.041667 0.013889 0.944444 0.000000 0.944444 0.027778 0.000000 0.027778 0.041667 0.888889 0.000000 0.069444 0.944444 0.041667 0.013889 0.000000 0.055556 0.652778 0.166667 0.125000 0.027778 0.791667 0.027778 0.152778 0.833333 0.097222 0.027778 0.041667 0.125000 0.652778 0.097222 0.125000 0.750000 0.083333 0.055556 0.111111 Consensus sequence: GGAGCACTGTGACACCACA Alignment: TGTGGTGTCACAGTGCTCC --BTRGGDCARAGGKCA-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 2 NR2F1 Original Motif Reverse Complement Forward 1 14 0.536521 Original motif 0.000000 0.000000 0.153846 0.846154 0.076923 0.000000 0.923077 0.000000 0.923077 0.000000 0.076923 0.000000 0.461538 0.538462 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.230769 0.000000 0.769231 0.000000 0.153846 0.000000 0.846154 0.076923 0.000000 0.000000 0.923077 0.153846 0.000000 0.846154 0.000000 0.461538 0.307692 0.230769 0.000000 0.461538 0.384615 0.076923 0.076923 0.076923 0.769231 0.076923 0.076923 0.230769 0.461538 0.000000 0.307692 0.000000 0.230769 0.230769 0.538462 Consensus sequence: TGAMCTTTGMMCYT Reverse complement motif 0.538462 0.230769 0.230769 0.000000 0.230769 0.000000 0.461538 0.307692 0.076923 0.076923 0.769231 0.076923 0.076923 0.384615 0.076923 0.461538 0.000000 0.307692 0.230769 0.461538 0.153846 0.846154 0.000000 0.000000 0.923077 0.000000 0.000000 0.076923 0.846154 0.153846 0.000000 0.000000 0.769231 0.230769 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.461538 0.000000 0.538462 0.000000 0.000000 0.000000 0.076923 0.923077 0.076923 0.923077 0.000000 0.000000 0.846154 0.000000 0.153846 0.000000 Consensus sequence: AKGYYCAAAGRTCA Alignment: AKGYYCAAAGRTCA- BTRGGDCARAGGKCA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 15 Tcfcp2l1 Reverse Complement Reverse Complement Backward 1 14 0.584465 Original motif 0.001968 0.925480 0.062715 0.009838 0.069973 0.807513 0.005401 0.117113 0.594508 0.005148 0.275803 0.124540 0.005884 0.023780 0.967149 0.003187 0.175477 0.336270 0.025698 0.462555 0.098385 0.289280 0.062163 0.550171 0.173924 0.397260 0.151174 0.277642 0.357213 0.224939 0.252323 0.165526 0.631540 0.069682 0.190954 0.107824 0.394421 0.051382 0.310497 0.243700 0.003669 0.933219 0.054795 0.008317 0.061719 0.812148 0.002939 0.123194 0.536555 0.007360 0.305937 0.150147 0.012039 0.028993 0.954791 0.004177 Consensus sequence: CCAGYYHVADCCRG Reverse complement motif 0.012039 0.954791 0.028993 0.004177 0.150147 0.007360 0.305937 0.536555 0.061719 0.002939 0.812148 0.123194 0.003669 0.054795 0.933219 0.008317 0.243700 0.051382 0.310497 0.394421 0.107824 0.069682 0.190954 0.631540 0.165526 0.224939 0.252323 0.357213 0.173924 0.151174 0.397260 0.277642 0.550171 0.289280 0.062163 0.098385 0.462555 0.336270 0.025698 0.175477 0.005884 0.967149 0.023780 0.003187 0.124540 0.005148 0.275803 0.594508 0.069973 0.005401 0.807513 0.117113 0.001968 0.062715 0.925480 0.009838 Consensus sequence: CKGGDTBDMMCTGG Alignment: -CKGGDTBDMMCTGG TGRCCTKTGHCCKAB ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 15 Motif name: Tcfcp2l1 Original motif 0.001968 0.925480 0.062715 0.009838 0.069973 0.807513 0.005401 0.117113 0.594508 0.005148 0.275803 0.124540 0.005884 0.023780 0.967149 0.003187 0.175477 0.336270 0.025698 0.462555 0.098385 0.289280 0.062163 0.550171 0.173924 0.397260 0.151174 0.277642 0.357213 0.224939 0.252323 0.165526 0.631540 0.069682 0.190954 0.107824 0.394421 0.051382 0.310497 0.243700 0.003669 0.933219 0.054795 0.008317 0.061719 0.812148 0.002939 0.123194 0.536555 0.007360 0.305937 0.150147 0.012039 0.028993 0.954791 0.004177 Consensus sequence: CCAGYYHVADCCRG Reserve complement motif 0.012039 0.954791 0.028993 0.004177 0.150147 0.007360 0.305937 0.536555 0.061719 0.002939 0.812148 0.123194 0.003669 0.054795 0.933219 0.008317 0.243700 0.051382 0.310497 0.394421 0.107824 0.069682 0.190954 0.631540 0.165526 0.224939 0.252323 0.357213 0.173924 0.151174 0.397260 0.277642 0.550171 0.289280 0.062163 0.098385 0.462555 0.336270 0.025698 0.175477 0.005884 0.967149 0.023780 0.003187 0.124540 0.005148 0.275803 0.594508 0.069973 0.005401 0.807513 0.117113 0.001968 0.062715 0.925480 0.009838 Consensus sequence: CKGGDTBDMMCTGG ************************************************************************ Best Matches for Motif ID 15 (Highest to Lowest) ************************************************************************ Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 3 ESR1 Original Motif Reverse Complement Forward 4 14 0.045340 Original motif 0.261242 0.256959 0.329764 0.152034 0.228632 0.170940 0.350427 0.250000 0.136752 0.369658 0.318376 0.175214 0.176596 0.487234 0.138298 0.197872 0.285106 0.493617 0.100000 0.121277 0.651163 0.059197 0.188161 0.101480 0.075949 0.016878 0.816456 0.090717 0.040000 0.037895 0.884211 0.037895 0.069474 0.086316 0.191579 0.652632 0.008421 0.829474 0.111579 0.050526 0.837895 0.027368 0.056842 0.077895 0.122105 0.526316 0.225263 0.126316 0.132632 0.581053 0.111579 0.174737 0.134737 0.543158 0.204211 0.117895 0.067368 0.040000 0.016842 0.875789 0.044211 0.046316 0.896842 0.012632 0.642105 0.223158 0.065263 0.069474 0.021053 0.917895 0.025263 0.035789 0.124211 0.743158 0.004211 0.128421 0.054737 0.347368 0.046316 0.551579 Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif 0.551579 0.347368 0.046316 0.054737 0.124211 0.004211 0.743158 0.128421 0.021053 0.025263 0.917895 0.035789 0.069474 0.223158 0.065263 0.642105 0.044211 0.896842 0.046316 0.012632 0.875789 0.040000 0.016842 0.067368 0.134737 0.204211 0.543158 0.117895 0.132632 0.111579 0.581053 0.174737 0.122105 0.225263 0.526316 0.126316 0.077895 0.027368 0.056842 0.837895 0.008421 0.111579 0.829474 0.050526 0.652632 0.086316 0.191579 0.069474 0.040000 0.884211 0.037895 0.037895 0.075949 0.816456 0.016878 0.090717 0.101480 0.059197 0.188161 0.651163 0.285106 0.100000 0.493617 0.121277 0.176596 0.138298 0.487234 0.197872 0.136752 0.318376 0.369658 0.175214 0.228632 0.350427 0.170940 0.250000 0.261242 0.329764 0.256959 0.152034 Consensus sequence: MGGTCAGGGTGACCTRDBHV Alignment: MGGTCAGGGTGACCTRDBHV ---CCAGYYHVADCCRG--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 16 CTCF Original Motif Original Motif Forward 4 14 0.049111 Original motif 0.095290 0.318729 0.083242 0.502738 0.182913 0.158817 0.453450 0.204819 0.307777 0.053669 0.491785 0.146769 0.061336 0.876232 0.023001 0.039430 0.008762 0.989047 0.000000 0.002191 0.814896 0.014239 0.071194 0.099671 0.043812 0.578313 0.365827 0.012048 0.117325 0.474781 0.052632 0.355263 0.933114 0.012061 0.035088 0.019737 0.005488 0.000000 0.991218 0.003293 0.365532 0.003293 0.621295 0.009879 0.059276 0.013172 0.553238 0.374314 0.013187 0.000000 0.978022 0.008791 0.061538 0.008791 0.851648 0.078022 0.114411 0.806381 0.005501 0.073707 0.409241 0.014301 0.557756 0.018702 0.090308 0.530837 0.338106 0.040749 0.128855 0.354626 0.080396 0.436123 0.442731 0.199339 0.292952 0.064978 Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif 0.064978 0.199339 0.292952 0.442731 0.436123 0.354626 0.080396 0.128855 0.090308 0.338106 0.530837 0.040749 0.409241 0.557756 0.014301 0.018702 0.114411 0.005501 0.806381 0.073707 0.061538 0.851648 0.008791 0.078022 0.013187 0.978022 0.000000 0.008791 0.059276 0.553238 0.013172 0.374314 0.365532 0.621295 0.003293 0.009879 0.005488 0.991218 0.000000 0.003293 0.019737 0.012061 0.035088 0.933114 0.117325 0.052632 0.474781 0.355263 0.043812 0.365827 0.578313 0.012048 0.099671 0.014239 0.071194 0.814896 0.008762 0.000000 0.989047 0.002191 0.061336 0.023001 0.876232 0.039430 0.307777 0.491785 0.053669 0.146769 0.182913 0.453450 0.158817 0.204819 0.502738 0.318729 0.083242 0.095290 Consensus sequence: BMSMGCCYMCTKSTGGMHM Alignment: YDRCCASYAGRKGGCRSYV ---CCAGYYHVADCCRG-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 9 ESR2 Reverse Complement Original Motif Backward 1 14 0.056817 Original motif 0.218487 0.450980 0.176471 0.154062 0.442577 0.142857 0.114846 0.299720 0.521008 0.042017 0.431373 0.005602 0.075630 0.000000 0.770308 0.154062 0.050420 0.056022 0.893557 0.000000 0.036415 0.053221 0.092437 0.817927 0.000000 1.000000 0.000000 0.000000 0.943978 0.002801 0.000000 0.053221 0.137255 0.344538 0.316527 0.201681 0.179272 0.176471 0.417367 0.226891 0.145658 0.170868 0.411765 0.271709 0.058824 0.092437 0.067227 0.781513 0.176471 0.070028 0.742297 0.011204 0.498599 0.277311 0.053221 0.170868 0.095238 0.750700 0.005602 0.148459 0.128852 0.809524 0.000000 0.061625 0.075630 0.252101 0.000000 0.672269 0.168067 0.263305 0.380952 0.187675 Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif 0.168067 0.380952 0.263305 0.187675 0.672269 0.252101 0.000000 0.075630 0.128852 0.000000 0.809524 0.061625 0.095238 0.005602 0.750700 0.148459 0.170868 0.277311 0.053221 0.498599 0.176471 0.742297 0.070028 0.011204 0.781513 0.092437 0.067227 0.058824 0.145658 0.411765 0.170868 0.271709 0.179272 0.417367 0.176471 0.226891 0.137255 0.316527 0.344538 0.201681 0.053221 0.002801 0.000000 0.943978 0.000000 0.000000 1.000000 0.000000 0.817927 0.053221 0.092437 0.036415 0.050420 0.893557 0.056022 0.000000 0.075630 0.770308 0.000000 0.154062 0.005602 0.042017 0.431373 0.521008 0.299720 0.142857 0.114846 0.442577 0.218487 0.176471 0.450980 0.154062 Consensus sequence: BAGGYCABHBTGACCKHV Alignment: VHRGGTCABDBTGMCCTB ----CKGGDTBDMMCTGG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 14 PPARGRXRA Reverse Complement Reverse Complement Forward 2 14 0.056940 Original motif 0.109685 0.369895 0.373396 0.147025 0.117716 0.193473 0.148019 0.540793 0.453488 0.026744 0.427907 0.091860 0.116144 0.003484 0.779326 0.101045 0.161253 0.017401 0.781903 0.039443 0.168213 0.149652 0.458237 0.223898 0.082271 0.633835 0.207416 0.076477 0.949015 0.024334 0.017381 0.009270 0.604867 0.055620 0.312862 0.026651 0.825231 0.005787 0.158565 0.010417 0.095017 0.002317 0.888760 0.013905 0.047509 0.010429 0.803013 0.139050 0.025492 0.114716 0.304751 0.555041 0.062645 0.643852 0.167053 0.126450 0.784223 0.067285 0.054524 0.093968 Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif 0.093968 0.067285 0.054524 0.784223 0.062645 0.167053 0.643852 0.126450 0.555041 0.114716 0.304751 0.025492 0.047509 0.803013 0.010429 0.139050 0.095017 0.888760 0.002317 0.013905 0.010417 0.005787 0.158565 0.825231 0.026651 0.055620 0.312862 0.604867 0.009270 0.024334 0.017381 0.949015 0.082271 0.207416 0.633835 0.076477 0.168213 0.458237 0.149652 0.223898 0.161253 0.781903 0.017401 0.039443 0.116144 0.779326 0.003484 0.101045 0.091860 0.026744 0.427907 0.453488 0.540793 0.193473 0.148019 0.117716 0.109685 0.373396 0.369895 0.147025 Consensus sequence: TGRCCTKTGHCCKAB Alignment: TGRCCTKTGHCCKAB -CKGGDTBDMMCTGG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 20 CagTGCTCCACTGTGgT Reverse Complement Reverse Complement Forward 5 13 0.551995 Original motif 0.150000 0.700000 0.016667 0.133333 0.650000 0.150000 0.050000 0.150000 0.166667 0.116667 0.633333 0.083333 0.050000 0.033333 0.066667 0.850000 0.050000 0.000000 0.833333 0.116667 0.016667 0.966667 0.000000 0.016667 0.050000 0.016667 0.000000 0.933333 0.066667 0.833333 0.066667 0.033333 0.033333 0.966667 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.050000 0.916667 0.016667 0.016667 0.166667 0.000000 0.000000 0.833333 0.083333 0.016667 0.900000 0.000000 0.000000 0.016667 0.016667 0.966667 0.000000 0.016667 0.966667 0.016667 0.116667 0.166667 0.483333 0.233333 0.066667 0.083333 0.050000 0.800000 Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif 0.800000 0.083333 0.050000 0.066667 0.116667 0.483333 0.166667 0.233333 0.000000 0.966667 0.016667 0.016667 0.966667 0.016667 0.016667 0.000000 0.083333 0.900000 0.016667 0.000000 0.833333 0.000000 0.000000 0.166667 0.050000 0.016667 0.916667 0.016667 0.000000 0.000000 0.000000 1.000000 0.033333 0.000000 0.966667 0.000000 0.066667 0.066667 0.833333 0.033333 0.933333 0.016667 0.000000 0.050000 0.016667 0.000000 0.966667 0.016667 0.050000 0.833333 0.000000 0.116667 0.850000 0.033333 0.066667 0.050000 0.166667 0.633333 0.116667 0.083333 0.150000 0.150000 0.050000 0.650000 0.150000 0.016667 0.700000 0.133333 Consensus sequence: ABCACAGTGGAGCACTG Alignment: ABCACAGTGGAGCACTG- ----CKGGDTBDMMCTGG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 22 CACTGTGrYrtCACAGTGswsCAcT Reverse Complement Original Motif Forward 14 12 1.050456 Original motif 0.111111 0.746032 0.063492 0.079365 0.857143 0.047619 0.047619 0.047619 0.047619 0.857143 0.079365 0.015873 0.031746 0.000000 0.000000 0.968254 0.031746 0.015873 0.904762 0.047619 0.000000 0.000000 0.000000 1.000000 0.031746 0.000000 0.857143 0.111111 0.396825 0.111111 0.412698 0.079365 0.031746 0.253968 0.015873 0.698413 0.365079 0.000000 0.634921 0.000000 0.079365 0.206349 0.047619 0.666667 0.047619 0.936508 0.015873 0.000000 0.952381 0.000000 0.015873 0.031746 0.015873 0.920635 0.000000 0.063492 0.920635 0.000000 0.000000 0.079365 0.063492 0.047619 0.841270 0.047619 0.000000 0.000000 0.015873 0.984127 0.047619 0.015873 0.904762 0.031746 0.015873 0.603175 0.317460 0.063492 0.396825 0.000000 0.015873 0.587302 0.015873 0.476190 0.428571 0.079365 0.063492 0.920635 0.000000 0.015873 0.920635 0.015873 0.047619 0.015873 0.095238 0.682540 0.095238 0.126984 0.047619 0.015873 0.095238 0.841270 Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif 0.841270 0.015873 0.095238 0.047619 0.095238 0.095238 0.682540 0.126984 0.015873 0.015873 0.047619 0.920635 0.063492 0.000000 0.920635 0.015873 0.015873 0.428571 0.476190 0.079365 0.587302 0.000000 0.015873 0.396825 0.015873 0.317460 0.603175 0.063492 0.047619 0.904762 0.015873 0.031746 0.984127 0.000000 0.015873 0.000000 0.063492 0.841270 0.047619 0.047619 0.079365 0.000000 0.000000 0.920635 0.015873 0.000000 0.920635 0.063492 0.031746 0.000000 0.015873 0.952381 0.047619 0.015873 0.936508 0.000000 0.666667 0.206349 0.047619 0.079365 0.365079 0.634921 0.000000 0.000000 0.698413 0.253968 0.015873 0.031746 0.396825 0.412698 0.111111 0.079365 0.031746 0.857143 0.000000 0.111111 1.000000 0.000000 0.000000 0.000000 0.031746 0.904762 0.015873 0.047619 0.968254 0.000000 0.000000 0.031746 0.047619 0.079365 0.857143 0.015873 0.047619 0.047619 0.047619 0.857143 0.111111 0.063492 0.746032 0.079365 Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG Alignment: CACTGTGRTRTCACAGTGSWSCACT-- -------------CKGGDTBDMMCTGG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 7 REST Reverse Complement Original Motif Backward 10 12 1.051106 Original motif 0.132621 0.109365 0.230044 0.527970 0.036318 0.168441 0.091421 0.703820 0.047589 0.855354 0.031309 0.065748 0.906367 0.018727 0.058677 0.016230 0.021197 0.027431 0.945137 0.006234 0.076012 0.609346 0.201246 0.113396 0.980697 0.004359 0.007472 0.007472 0.001868 0.987547 0.007472 0.003113 0.021793 0.922167 0.012453 0.043587 0.568847 0.125234 0.100935 0.204984 0.136534 0.233791 0.077307 0.552369 0.024314 0.004364 0.966958 0.004364 0.012469 0.003117 0.983167 0.001247 0.877105 0.069869 0.021210 0.031815 0.008125 0.800000 0.145625 0.046250 0.983750 0.005625 0.004375 0.006250 0.026349 0.008156 0.959849 0.005646 0.128688 0.632141 0.114878 0.124294 0.229899 0.019472 0.432161 0.318467 0.133962 0.586792 0.200629 0.078616 0.112579 0.700629 0.023270 0.163522 Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif 0.112579 0.023270 0.700629 0.163522 0.133962 0.200629 0.586792 0.078616 0.229899 0.432161 0.019472 0.318467 0.128688 0.114878 0.632141 0.124294 0.026349 0.959849 0.008156 0.005646 0.006250 0.005625 0.004375 0.983750 0.008125 0.145625 0.800000 0.046250 0.031815 0.069869 0.021210 0.877105 0.012469 0.983167 0.003117 0.001247 0.024314 0.966958 0.004364 0.004364 0.552369 0.233791 0.077307 0.136534 0.204984 0.125234 0.100935 0.568847 0.021793 0.012453 0.922167 0.043587 0.001868 0.007472 0.987547 0.003113 0.007472 0.004359 0.007472 0.980697 0.076012 0.201246 0.609346 0.113396 0.021197 0.945137 0.027431 0.006234 0.016230 0.018727 0.058677 0.906367 0.047589 0.031309 0.855354 0.065748 0.703820 0.168441 0.091421 0.036318 0.527970 0.109365 0.230044 0.132621 Consensus sequence: GGYGCTGTCCATGGTGCTGAA Alignment: --TTCAGCACCATGGACAGCKCC CKGGDTBDMMCTGG--------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 1 HNF4A Reverse Complement Reverse Complement Forward 2 12 1.053875 Original motif 0.417910 0.104478 0.402985 0.074627 0.029851 0.029851 0.835821 0.104478 0.179104 0.059701 0.522388 0.238806 0.074627 0.343284 0.298507 0.283582 0.044776 0.761194 0.059701 0.134328 0.880597 0.014925 0.044776 0.059701 0.791045 0.029851 0.149254 0.029851 0.835821 0.014925 0.119403 0.029851 0.059701 0.059701 0.865672 0.014925 0.089552 0.029851 0.492537 0.388060 0.044776 0.328358 0.164179 0.462687 0.059701 0.731343 0.074627 0.134328 0.626866 0.104478 0.149254 0.119403 Consensus sequence: RGGBCAAAGKYCA Reverse complement motif 0.119403 0.104478 0.149254 0.626866 0.059701 0.074627 0.731343 0.134328 0.462687 0.328358 0.164179 0.044776 0.089552 0.492537 0.029851 0.388060 0.059701 0.865672 0.059701 0.014925 0.029851 0.014925 0.119403 0.835821 0.029851 0.029851 0.149254 0.791045 0.059701 0.014925 0.044776 0.880597 0.044776 0.059701 0.761194 0.134328 0.074627 0.298507 0.343284 0.283582 0.179104 0.522388 0.059701 0.238806 0.029851 0.835821 0.029851 0.104478 0.074627 0.104478 0.402985 0.417910 Consensus sequence: TGMYCTTTGBCCK Alignment: TGMYCTTTGBCCK-- -CKGGDTBDMMCTGG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 26 CAcCACAGTGGAGCAct Reverse Complement Original Motif Forward 6 12 1.055410 Original motif 0.078125 0.734375 0.046875 0.140625 0.828125 0.046875 0.078125 0.046875 0.203125 0.484375 0.156250 0.156250 0.015625 0.984375 0.000000 0.000000 0.968750 0.015625 0.015625 0.000000 0.000000 0.906250 0.015625 0.078125 0.859375 0.000000 0.000000 0.140625 0.031250 0.000000 0.906250 0.062500 0.000000 0.015625 0.000000 0.984375 0.000000 0.000000 0.968750 0.031250 0.046875 0.062500 0.812500 0.078125 0.937500 0.015625 0.015625 0.031250 0.015625 0.031250 0.921875 0.031250 0.125000 0.796875 0.000000 0.078125 0.875000 0.046875 0.046875 0.031250 0.093750 0.656250 0.093750 0.156250 0.156250 0.078125 0.109375 0.656250 Consensus sequence: CAHCACAGTGGAGCACT Reverse complement motif 0.656250 0.078125 0.109375 0.156250 0.093750 0.093750 0.656250 0.156250 0.031250 0.046875 0.046875 0.875000 0.125000 0.000000 0.796875 0.078125 0.015625 0.921875 0.031250 0.031250 0.031250 0.015625 0.015625 0.937500 0.046875 0.812500 0.062500 0.078125 0.000000 0.968750 0.000000 0.031250 0.984375 0.015625 0.000000 0.000000 0.031250 0.906250 0.000000 0.062500 0.140625 0.000000 0.000000 0.859375 0.000000 0.015625 0.906250 0.078125 0.000000 0.015625 0.015625 0.968750 0.015625 0.000000 0.984375 0.000000 0.203125 0.156250 0.484375 0.156250 0.046875 0.046875 0.078125 0.828125 0.078125 0.046875 0.734375 0.140625 Consensus sequence: AGTGCTCCACTGTGDTG Alignment: CAHCACAGTGGAGCACT-- -----CKGGDTBDMMCTGG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 2 NR2F1 Reverse Complement Reverse Complement Backward 4 11 1.557021 Original motif 0.000000 0.000000 0.153846 0.846154 0.076923 0.000000 0.923077 0.000000 0.923077 0.000000 0.076923 0.000000 0.461538 0.538462 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.230769 0.000000 0.769231 0.000000 0.153846 0.000000 0.846154 0.076923 0.000000 0.000000 0.923077 0.153846 0.000000 0.846154 0.000000 0.461538 0.307692 0.230769 0.000000 0.461538 0.384615 0.076923 0.076923 0.076923 0.769231 0.076923 0.076923 0.230769 0.461538 0.000000 0.307692 0.000000 0.230769 0.230769 0.538462 Consensus sequence: TGAMCTTTGMMCYT Reverse complement motif 0.538462 0.230769 0.230769 0.000000 0.230769 0.000000 0.461538 0.307692 0.076923 0.076923 0.769231 0.076923 0.076923 0.384615 0.076923 0.461538 0.000000 0.307692 0.230769 0.461538 0.153846 0.846154 0.000000 0.000000 0.923077 0.000000 0.000000 0.076923 0.846154 0.153846 0.000000 0.000000 0.769231 0.230769 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.461538 0.000000 0.538462 0.000000 0.000000 0.000000 0.076923 0.923077 0.076923 0.923077 0.000000 0.000000 0.846154 0.000000 0.153846 0.000000 Consensus sequence: AKGYYCAAAGRTCA Alignment: ---AKGYYCAAAGRTCA CKGGDTBDMMCTGG--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 16 Motif name: CTCF Original motif 0.095290 0.318729 0.083242 0.502738 0.182913 0.158817 0.453450 0.204819 0.307777 0.053669 0.491785 0.146769 0.061336 0.876232 0.023001 0.039430 0.008762 0.989047 0.000000 0.002191 0.814896 0.014239 0.071194 0.099671 0.043812 0.578313 0.365827 0.012048 0.117325 0.474781 0.052632 0.355263 0.933114 0.012061 0.035088 0.019737 0.005488 0.000000 0.991218 0.003293 0.365532 0.003293 0.621295 0.009879 0.059276 0.013172 0.553238 0.374314 0.013187 0.000000 0.978022 0.008791 0.061538 0.008791 0.851648 0.078022 0.114411 0.806381 0.005501 0.073707 0.409241 0.014301 0.557756 0.018702 0.090308 0.530837 0.338106 0.040749 0.128855 0.354626 0.080396 0.436123 0.442731 0.199339 0.292952 0.064978 Consensus sequence: YDRCCASYAGRKGGCRSYV Reserve complement motif 0.064978 0.199339 0.292952 0.442731 0.436123 0.354626 0.080396 0.128855 0.090308 0.338106 0.530837 0.040749 0.409241 0.557756 0.014301 0.018702 0.114411 0.005501 0.806381 0.073707 0.061538 0.851648 0.008791 0.078022 0.013187 0.978022 0.000000 0.008791 0.059276 0.553238 0.013172 0.374314 0.365532 0.621295 0.003293 0.009879 0.005488 0.991218 0.000000 0.003293 0.019737 0.012061 0.035088 0.933114 0.117325 0.052632 0.474781 0.355263 0.043812 0.365827 0.578313 0.012048 0.099671 0.014239 0.071194 0.814896 0.008762 0.000000 0.989047 0.002191 0.061336 0.023001 0.876232 0.039430 0.307777 0.491785 0.053669 0.146769 0.182913 0.453450 0.158817 0.204819 0.502738 0.318729 0.083242 0.095290 Consensus sequence: BMSMGCCYMCTKSTGGMHM ************************************************************************ Best Matches for Motif ID 16 (Highest to Lowest) ************************************************************************ Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 3 ESR1 Original Motif Reverse Complement Forward 2 19 0.065551 Original motif 0.261242 0.256959 0.329764 0.152034 0.228632 0.170940 0.350427 0.250000 0.136752 0.369658 0.318376 0.175214 0.176596 0.487234 0.138298 0.197872 0.285106 0.493617 0.100000 0.121277 0.651163 0.059197 0.188161 0.101480 0.075949 0.016878 0.816456 0.090717 0.040000 0.037895 0.884211 0.037895 0.069474 0.086316 0.191579 0.652632 0.008421 0.829474 0.111579 0.050526 0.837895 0.027368 0.056842 0.077895 0.122105 0.526316 0.225263 0.126316 0.132632 0.581053 0.111579 0.174737 0.134737 0.543158 0.204211 0.117895 0.067368 0.040000 0.016842 0.875789 0.044211 0.046316 0.896842 0.012632 0.642105 0.223158 0.065263 0.069474 0.021053 0.917895 0.025263 0.035789 0.124211 0.743158 0.004211 0.128421 0.054737 0.347368 0.046316 0.551579 Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif 0.551579 0.347368 0.046316 0.054737 0.124211 0.004211 0.743158 0.128421 0.021053 0.025263 0.917895 0.035789 0.069474 0.223158 0.065263 0.642105 0.044211 0.896842 0.046316 0.012632 0.875789 0.040000 0.016842 0.067368 0.134737 0.204211 0.543158 0.117895 0.132632 0.111579 0.581053 0.174737 0.122105 0.225263 0.526316 0.126316 0.077895 0.027368 0.056842 0.837895 0.008421 0.111579 0.829474 0.050526 0.652632 0.086316 0.191579 0.069474 0.040000 0.884211 0.037895 0.037895 0.075949 0.816456 0.016878 0.090717 0.101480 0.059197 0.188161 0.651163 0.285106 0.100000 0.493617 0.121277 0.176596 0.138298 0.487234 0.197872 0.136752 0.318376 0.369658 0.175214 0.228632 0.350427 0.170940 0.250000 0.261242 0.329764 0.256959 0.152034 Consensus sequence: MGGTCAGGGTGACCTRDBHV Alignment: MGGTCAGGGTGACCTRDBHV -YDRCCASYAGRKGGCRSYV ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 27 AgTGCTCCACTGTGgTGTCACAgT Original Motif Reverse Complement Forward 7 18 0.563463 Original motif 0.690141 0.126761 0.042254 0.140845 0.169014 0.098592 0.676056 0.056338 0.042254 0.028169 0.028169 0.901408 0.056338 0.000000 0.774648 0.169014 0.042254 0.887324 0.042254 0.028169 0.000000 0.014085 0.000000 0.985915 0.056338 0.830986 0.042254 0.070423 0.028169 0.957746 0.014085 0.000000 0.957746 0.000000 0.014085 0.028169 0.084507 0.845070 0.014085 0.056338 0.028169 0.014085 0.000000 0.957746 0.140845 0.028169 0.802817 0.028169 0.014085 0.014085 0.014085 0.957746 0.014085 0.000000 0.929577 0.056338 0.056338 0.154930 0.619718 0.169014 0.014085 0.028169 0.000000 0.957746 0.056338 0.014085 0.873239 0.056338 0.014085 0.000000 0.000000 0.985915 0.042254 0.929577 0.000000 0.028169 0.957746 0.028169 0.000000 0.014085 0.028169 0.845070 0.028169 0.098592 0.873239 0.014085 0.042254 0.070423 0.098592 0.154930 0.563380 0.183099 0.070423 0.014085 0.112676 0.802817 Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif 0.802817 0.014085 0.112676 0.070423 0.098592 0.563380 0.154930 0.183099 0.070423 0.014085 0.042254 0.873239 0.028169 0.028169 0.845070 0.098592 0.014085 0.028169 0.000000 0.957746 0.042254 0.000000 0.929577 0.028169 0.985915 0.000000 0.000000 0.014085 0.056338 0.873239 0.014085 0.056338 0.957746 0.028169 0.000000 0.014085 0.056338 0.619718 0.154930 0.169014 0.014085 0.929577 0.000000 0.056338 0.957746 0.014085 0.014085 0.014085 0.140845 0.802817 0.028169 0.028169 0.957746 0.014085 0.000000 0.028169 0.084507 0.014085 0.845070 0.056338 0.028169 0.000000 0.014085 0.957746 0.028169 0.014085 0.957746 0.000000 0.056338 0.042254 0.830986 0.070423 0.985915 0.014085 0.000000 0.000000 0.042254 0.042254 0.887324 0.028169 0.056338 0.774648 0.000000 0.169014 0.901408 0.028169 0.028169 0.042254 0.169014 0.676056 0.098592 0.056338 0.140845 0.126761 0.042254 0.690141 Consensus sequence: ACTGTGACACCACAGTGGAGCACT Alignment: ACTGTGACACCACAGTGGAGCACT- ------YDRCCASYAGRKGGCRSYV ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 22 CACTGTGrYrtCACAGTGswsCAcT Reverse Complement Reverse Complement Backward 8 18 0.566264 Original motif 0.111111 0.746032 0.063492 0.079365 0.857143 0.047619 0.047619 0.047619 0.047619 0.857143 0.079365 0.015873 0.031746 0.000000 0.000000 0.968254 0.031746 0.015873 0.904762 0.047619 0.000000 0.000000 0.000000 1.000000 0.031746 0.000000 0.857143 0.111111 0.396825 0.111111 0.412698 0.079365 0.031746 0.253968 0.015873 0.698413 0.365079 0.000000 0.634921 0.000000 0.079365 0.206349 0.047619 0.666667 0.047619 0.936508 0.015873 0.000000 0.952381 0.000000 0.015873 0.031746 0.015873 0.920635 0.000000 0.063492 0.920635 0.000000 0.000000 0.079365 0.063492 0.047619 0.841270 0.047619 0.000000 0.000000 0.015873 0.984127 0.047619 0.015873 0.904762 0.031746 0.015873 0.603175 0.317460 0.063492 0.396825 0.000000 0.015873 0.587302 0.015873 0.476190 0.428571 0.079365 0.063492 0.920635 0.000000 0.015873 0.920635 0.015873 0.047619 0.015873 0.095238 0.682540 0.095238 0.126984 0.047619 0.015873 0.095238 0.841270 Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif 0.841270 0.015873 0.095238 0.047619 0.095238 0.095238 0.682540 0.126984 0.015873 0.015873 0.047619 0.920635 0.063492 0.000000 0.920635 0.015873 0.015873 0.428571 0.476190 0.079365 0.587302 0.000000 0.015873 0.396825 0.015873 0.317460 0.603175 0.063492 0.047619 0.904762 0.015873 0.031746 0.984127 0.000000 0.015873 0.000000 0.063492 0.841270 0.047619 0.047619 0.079365 0.000000 0.000000 0.920635 0.015873 0.000000 0.920635 0.063492 0.031746 0.000000 0.015873 0.952381 0.047619 0.015873 0.936508 0.000000 0.666667 0.206349 0.047619 0.079365 0.365079 0.634921 0.000000 0.000000 0.698413 0.253968 0.015873 0.031746 0.396825 0.412698 0.111111 0.079365 0.031746 0.857143 0.000000 0.111111 1.000000 0.000000 0.000000 0.000000 0.031746 0.904762 0.015873 0.047619 0.968254 0.000000 0.000000 0.031746 0.047619 0.079365 0.857143 0.015873 0.047619 0.047619 0.047619 0.857143 0.111111 0.063492 0.746032 0.079365 Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG Alignment: -AGTGSWSCACTGTGAMAMCACAGTG BMSMGCCYMCTKSTGGMHM------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 20 CagTGCTCCACTGTGgT Original Motif Reverse Complement Backward 1 17 1.052362 Original motif 0.150000 0.700000 0.016667 0.133333 0.650000 0.150000 0.050000 0.150000 0.166667 0.116667 0.633333 0.083333 0.050000 0.033333 0.066667 0.850000 0.050000 0.000000 0.833333 0.116667 0.016667 0.966667 0.000000 0.016667 0.050000 0.016667 0.000000 0.933333 0.066667 0.833333 0.066667 0.033333 0.033333 0.966667 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.050000 0.916667 0.016667 0.016667 0.166667 0.000000 0.000000 0.833333 0.083333 0.016667 0.900000 0.000000 0.000000 0.016667 0.016667 0.966667 0.000000 0.016667 0.966667 0.016667 0.116667 0.166667 0.483333 0.233333 0.066667 0.083333 0.050000 0.800000 Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif 0.800000 0.083333 0.050000 0.066667 0.116667 0.483333 0.166667 0.233333 0.000000 0.966667 0.016667 0.016667 0.966667 0.016667 0.016667 0.000000 0.083333 0.900000 0.016667 0.000000 0.833333 0.000000 0.000000 0.166667 0.050000 0.016667 0.916667 0.016667 0.000000 0.000000 0.000000 1.000000 0.033333 0.000000 0.966667 0.000000 0.066667 0.066667 0.833333 0.033333 0.933333 0.016667 0.000000 0.050000 0.016667 0.000000 0.966667 0.016667 0.050000 0.833333 0.000000 0.116667 0.850000 0.033333 0.066667 0.050000 0.166667 0.633333 0.116667 0.083333 0.150000 0.150000 0.050000 0.650000 0.150000 0.016667 0.700000 0.133333 Consensus sequence: ABCACAGTGGAGCACTG Alignment: --ABCACAGTGGAGCACTG YDRCCASYAGRKGGCRSYV ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 26 CAcCACAGTGGAGCAct Original Motif Original Motif Backward 3 15 2.061841 Original motif 0.078125 0.734375 0.046875 0.140625 0.828125 0.046875 0.078125 0.046875 0.203125 0.484375 0.156250 0.156250 0.015625 0.984375 0.000000 0.000000 0.968750 0.015625 0.015625 0.000000 0.000000 0.906250 0.015625 0.078125 0.859375 0.000000 0.000000 0.140625 0.031250 0.000000 0.906250 0.062500 0.000000 0.015625 0.000000 0.984375 0.000000 0.000000 0.968750 0.031250 0.046875 0.062500 0.812500 0.078125 0.937500 0.015625 0.015625 0.031250 0.015625 0.031250 0.921875 0.031250 0.125000 0.796875 0.000000 0.078125 0.875000 0.046875 0.046875 0.031250 0.093750 0.656250 0.093750 0.156250 0.156250 0.078125 0.109375 0.656250 Consensus sequence: CAHCACAGTGGAGCACT Reverse complement motif 0.656250 0.078125 0.109375 0.156250 0.093750 0.093750 0.656250 0.156250 0.031250 0.046875 0.046875 0.875000 0.125000 0.000000 0.796875 0.078125 0.015625 0.921875 0.031250 0.031250 0.031250 0.015625 0.015625 0.937500 0.046875 0.812500 0.062500 0.078125 0.000000 0.968750 0.000000 0.031250 0.984375 0.015625 0.000000 0.000000 0.031250 0.906250 0.000000 0.062500 0.140625 0.000000 0.000000 0.859375 0.000000 0.015625 0.906250 0.078125 0.000000 0.015625 0.015625 0.968750 0.015625 0.000000 0.984375 0.000000 0.203125 0.156250 0.484375 0.156250 0.046875 0.046875 0.078125 0.828125 0.078125 0.046875 0.734375 0.140625 Consensus sequence: AGTGCTCCACTGTGDTG Alignment: ----CAHCACAGTGGAGCACT YDRCCASYAGRKGGCRSYV-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 23 TGGAGCACTGTGACAcCACAGTGg Original Motif Original Motif Forward 10 15 2.066982 Original motif 0.054054 0.040541 0.054054 0.851351 0.040541 0.013514 0.824324 0.121622 0.094595 0.135135 0.756757 0.013514 0.891892 0.000000 0.000000 0.108108 0.040541 0.094595 0.810811 0.054054 0.081081 0.797297 0.054054 0.067568 0.932432 0.027027 0.000000 0.040541 0.054054 0.756757 0.135135 0.054054 0.108108 0.027027 0.013514 0.851351 0.108108 0.000000 0.851351 0.040541 0.013514 0.000000 0.027027 0.959459 0.000000 0.013514 0.945946 0.040541 0.905405 0.000000 0.067568 0.027027 0.054054 0.837838 0.000000 0.108108 0.945946 0.013514 0.040541 0.000000 0.162162 0.500000 0.189189 0.148649 0.108108 0.824324 0.000000 0.067568 0.945946 0.000000 0.040541 0.013514 0.081081 0.837838 0.027027 0.054054 0.945946 0.000000 0.013514 0.040541 0.054054 0.067568 0.783784 0.094595 0.054054 0.027027 0.000000 0.918919 0.040541 0.013514 0.864865 0.081081 0.148649 0.121622 0.675676 0.054054 Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif 0.148649 0.675676 0.121622 0.054054 0.040541 0.864865 0.013514 0.081081 0.918919 0.027027 0.000000 0.054054 0.054054 0.783784 0.067568 0.094595 0.040541 0.000000 0.013514 0.945946 0.081081 0.027027 0.837838 0.054054 0.013514 0.000000 0.040541 0.945946 0.108108 0.000000 0.824324 0.067568 0.162162 0.189189 0.500000 0.148649 0.000000 0.013514 0.040541 0.945946 0.054054 0.000000 0.837838 0.108108 0.027027 0.000000 0.067568 0.905405 0.000000 0.945946 0.013514 0.040541 0.959459 0.000000 0.027027 0.013514 0.108108 0.851351 0.000000 0.040541 0.851351 0.027027 0.013514 0.108108 0.054054 0.135135 0.756757 0.054054 0.040541 0.027027 0.000000 0.932432 0.081081 0.054054 0.797297 0.067568 0.040541 0.810811 0.094595 0.054054 0.108108 0.000000 0.000000 0.891892 0.094595 0.756757 0.135135 0.013514 0.040541 0.824324 0.013514 0.121622 0.851351 0.040541 0.054054 0.054054 Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA Alignment: TGGAGCACTGTGACAVCACAGTGG---- ---------YDRCCASYAGRKGGCRSYV ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 15 Tcfcp2l1 Original Motif Original Motif Backward 2 13 3.056130 Original motif 0.001968 0.925480 0.062715 0.009838 0.069973 0.807513 0.005401 0.117113 0.594508 0.005148 0.275803 0.124540 0.005884 0.023780 0.967149 0.003187 0.175477 0.336270 0.025698 0.462555 0.098385 0.289280 0.062163 0.550171 0.173924 0.397260 0.151174 0.277642 0.357213 0.224939 0.252323 0.165526 0.631540 0.069682 0.190954 0.107824 0.394421 0.051382 0.310497 0.243700 0.003669 0.933219 0.054795 0.008317 0.061719 0.812148 0.002939 0.123194 0.536555 0.007360 0.305937 0.150147 0.012039 0.028993 0.954791 0.004177 Consensus sequence: CCAGYYHVADCCRG Reverse complement motif 0.012039 0.954791 0.028993 0.004177 0.150147 0.007360 0.305937 0.536555 0.061719 0.002939 0.812148 0.123194 0.003669 0.054795 0.933219 0.008317 0.243700 0.051382 0.310497 0.394421 0.107824 0.069682 0.190954 0.631540 0.165526 0.224939 0.252323 0.357213 0.173924 0.151174 0.397260 0.277642 0.550171 0.289280 0.062163 0.098385 0.462555 0.336270 0.025698 0.175477 0.005884 0.967149 0.023780 0.003187 0.124540 0.005148 0.275803 0.594508 0.069973 0.005401 0.807513 0.117113 0.001968 0.062715 0.925480 0.009838 Consensus sequence: CKGGDTBDMMCTGG Alignment: ------CCAGYYHVADCCRG YDRCCASYAGRKGGCRSYV- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 9 ESR2 Original Motif Original Motif Backward 6 13 3.060479 Original motif 0.218487 0.450980 0.176471 0.154062 0.442577 0.142857 0.114846 0.299720 0.521008 0.042017 0.431373 0.005602 0.075630 0.000000 0.770308 0.154062 0.050420 0.056022 0.893557 0.000000 0.036415 0.053221 0.092437 0.817927 0.000000 1.000000 0.000000 0.000000 0.943978 0.002801 0.000000 0.053221 0.137255 0.344538 0.316527 0.201681 0.179272 0.176471 0.417367 0.226891 0.145658 0.170868 0.411765 0.271709 0.058824 0.092437 0.067227 0.781513 0.176471 0.070028 0.742297 0.011204 0.498599 0.277311 0.053221 0.170868 0.095238 0.750700 0.005602 0.148459 0.128852 0.809524 0.000000 0.061625 0.075630 0.252101 0.000000 0.672269 0.168067 0.263305 0.380952 0.187675 Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif 0.168067 0.380952 0.263305 0.187675 0.672269 0.252101 0.000000 0.075630 0.128852 0.000000 0.809524 0.061625 0.095238 0.005602 0.750700 0.148459 0.170868 0.277311 0.053221 0.498599 0.176471 0.742297 0.070028 0.011204 0.781513 0.092437 0.067227 0.058824 0.145658 0.411765 0.170868 0.271709 0.179272 0.417367 0.176471 0.226891 0.137255 0.316527 0.344538 0.201681 0.053221 0.002801 0.000000 0.943978 0.000000 0.000000 1.000000 0.000000 0.817927 0.053221 0.092437 0.036415 0.050420 0.893557 0.056022 0.000000 0.075630 0.770308 0.000000 0.154062 0.005602 0.042017 0.431373 0.521008 0.299720 0.142857 0.114846 0.442577 0.218487 0.176471 0.450980 0.154062 Consensus sequence: BAGGYCABHBTGACCKHV Alignment: ------VHRGGTCABDBTGMCCTB YDRCCASYAGRKGGCRSYV----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 14 PPARGRXRA Original Motif Original Motif Backward 3 13 3.065651 Original motif 0.109685 0.369895 0.373396 0.147025 0.117716 0.193473 0.148019 0.540793 0.453488 0.026744 0.427907 0.091860 0.116144 0.003484 0.779326 0.101045 0.161253 0.017401 0.781903 0.039443 0.168213 0.149652 0.458237 0.223898 0.082271 0.633835 0.207416 0.076477 0.949015 0.024334 0.017381 0.009270 0.604867 0.055620 0.312862 0.026651 0.825231 0.005787 0.158565 0.010417 0.095017 0.002317 0.888760 0.013905 0.047509 0.010429 0.803013 0.139050 0.025492 0.114716 0.304751 0.555041 0.062645 0.643852 0.167053 0.126450 0.784223 0.067285 0.054524 0.093968 Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif 0.093968 0.067285 0.054524 0.784223 0.062645 0.167053 0.643852 0.126450 0.555041 0.114716 0.304751 0.025492 0.047509 0.803013 0.010429 0.139050 0.095017 0.888760 0.002317 0.013905 0.010417 0.005787 0.158565 0.825231 0.026651 0.055620 0.312862 0.604867 0.009270 0.024334 0.017381 0.949015 0.082271 0.207416 0.633835 0.076477 0.168213 0.458237 0.149652 0.223898 0.161253 0.781903 0.017401 0.039443 0.116144 0.779326 0.003484 0.101045 0.091860 0.026744 0.427907 0.453488 0.540793 0.193473 0.148019 0.117716 0.109685 0.373396 0.369895 0.147025 Consensus sequence: TGRCCTKTGHCCKAB Alignment: ------BTRGGDCARAGGKCA YDRCCASYAGRKGGCRSYV-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 24 ssCCCCGCSssk Reverse Complement Original Motif Forward 1 12 3.561849 Original motif 0.000000 0.444444 0.370370 0.185185 0.111111 0.407407 0.333333 0.148148 0.000000 0.888889 0.037037 0.074074 0.000000 0.888889 0.074074 0.037037 0.000000 0.777778 0.222222 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.037037 0.888889 0.000000 0.074074 0.000000 0.703704 0.296296 0.000000 0.000000 0.518519 0.370370 0.111111 0.111111 0.407407 0.259259 0.222222 0.074074 0.222222 0.407407 0.296296 Consensus sequence: SBCCCCGCCSBB Reverse complement motif 0.074074 0.407407 0.222222 0.296296 0.111111 0.259259 0.407407 0.222222 0.000000 0.370370 0.518519 0.111111 0.000000 0.296296 0.703704 0.000000 0.037037 0.000000 0.888889 0.074074 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.222222 0.777778 0.000000 0.000000 0.074074 0.888889 0.037037 0.000000 0.037037 0.888889 0.074074 0.111111 0.333333 0.407407 0.148148 0.000000 0.370370 0.444444 0.185185 Consensus sequence: BBSGGCGGGGBS Alignment: SBCCCCGCCSBB------- BMSMGCCYMCTKSTGGMHM ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 2 Motif ID: 17 Motif name: TgTGgTGTCACAGTGCTCC Original motif 0.111111 0.083333 0.055556 0.750000 0.125000 0.097222 0.652778 0.125000 0.041667 0.097222 0.027778 0.833333 0.027778 0.027778 0.791667 0.152778 0.055556 0.166667 0.652778 0.125000 0.000000 0.041667 0.013889 0.944444 0.041667 0.000000 0.888889 0.069444 0.027778 0.027778 0.000000 0.944444 0.041667 0.944444 0.013889 0.000000 0.916667 0.027778 0.000000 0.055556 0.069444 0.875000 0.000000 0.055556 0.833333 0.013889 0.013889 0.138889 0.041667 0.069444 0.819444 0.069444 0.027778 0.027778 0.027778 0.916667 0.069444 0.013889 0.847222 0.069444 0.069444 0.777778 0.027778 0.125000 0.055556 0.041667 0.027778 0.875000 0.041667 0.708333 0.125000 0.125000 0.111111 0.819444 0.055556 0.013889 Consensus sequence: TGTGGTGTCACAGTGCTCC Reserve complement motif 0.111111 0.055556 0.819444 0.013889 0.041667 0.125000 0.708333 0.125000 0.875000 0.041667 0.027778 0.055556 0.069444 0.027778 0.777778 0.125000 0.069444 0.847222 0.013889 0.069444 0.916667 0.027778 0.027778 0.027778 0.041667 0.819444 0.069444 0.069444 0.138889 0.013889 0.013889 0.833333 0.069444 0.000000 0.875000 0.055556 0.055556 0.027778 0.000000 0.916667 0.041667 0.013889 0.944444 0.000000 0.944444 0.027778 0.000000 0.027778 0.041667 0.888889 0.000000 0.069444 0.944444 0.041667 0.013889 0.000000 0.055556 0.652778 0.166667 0.125000 0.027778 0.791667 0.027778 0.152778 0.833333 0.097222 0.027778 0.041667 0.125000 0.652778 0.097222 0.125000 0.750000 0.083333 0.055556 0.111111 Consensus sequence: GGAGCACTGTGACACCACA ************************************************************************ Best Matches for Motif ID 17 (Highest to Lowest) ************************************************************************ Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 23 TGGAGCACTGTGACAcCACAGTGg Reverse Complement Original Motif Backward 5 19 0.000000 Original motif 0.054054 0.040541 0.054054 0.851351 0.040541 0.013514 0.824324 0.121622 0.094595 0.135135 0.756757 0.013514 0.891892 0.000000 0.000000 0.108108 0.040541 0.094595 0.810811 0.054054 0.081081 0.797297 0.054054 0.067568 0.932432 0.027027 0.000000 0.040541 0.054054 0.756757 0.135135 0.054054 0.108108 0.027027 0.013514 0.851351 0.108108 0.000000 0.851351 0.040541 0.013514 0.000000 0.027027 0.959459 0.000000 0.013514 0.945946 0.040541 0.905405 0.000000 0.067568 0.027027 0.054054 0.837838 0.000000 0.108108 0.945946 0.013514 0.040541 0.000000 0.162162 0.500000 0.189189 0.148649 0.108108 0.824324 0.000000 0.067568 0.945946 0.000000 0.040541 0.013514 0.081081 0.837838 0.027027 0.054054 0.945946 0.000000 0.013514 0.040541 0.054054 0.067568 0.783784 0.094595 0.054054 0.027027 0.000000 0.918919 0.040541 0.013514 0.864865 0.081081 0.148649 0.121622 0.675676 0.054054 Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif 0.148649 0.675676 0.121622 0.054054 0.040541 0.864865 0.013514 0.081081 0.918919 0.027027 0.000000 0.054054 0.054054 0.783784 0.067568 0.094595 0.040541 0.000000 0.013514 0.945946 0.081081 0.027027 0.837838 0.054054 0.013514 0.000000 0.040541 0.945946 0.108108 0.000000 0.824324 0.067568 0.162162 0.189189 0.500000 0.148649 0.000000 0.013514 0.040541 0.945946 0.054054 0.000000 0.837838 0.108108 0.027027 0.000000 0.067568 0.905405 0.000000 0.945946 0.013514 0.040541 0.959459 0.000000 0.027027 0.013514 0.108108 0.851351 0.000000 0.040541 0.851351 0.027027 0.013514 0.108108 0.054054 0.135135 0.756757 0.054054 0.040541 0.027027 0.000000 0.932432 0.081081 0.054054 0.797297 0.067568 0.040541 0.810811 0.094595 0.054054 0.108108 0.000000 0.000000 0.891892 0.094595 0.756757 0.135135 0.013514 0.040541 0.824324 0.013514 0.121622 0.851351 0.040541 0.054054 0.054054 Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA Alignment: TGGAGCACTGTGACAVCACAGTGG -GGAGCACTGTGACACCACA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 22 CACTGTGrYrtCACAGTGswsCAcT Reverse Complement Reverse Complement Forward 4 19 0.021726 Original motif 0.111111 0.746032 0.063492 0.079365 0.857143 0.047619 0.047619 0.047619 0.047619 0.857143 0.079365 0.015873 0.031746 0.000000 0.000000 0.968254 0.031746 0.015873 0.904762 0.047619 0.000000 0.000000 0.000000 1.000000 0.031746 0.000000 0.857143 0.111111 0.396825 0.111111 0.412698 0.079365 0.031746 0.253968 0.015873 0.698413 0.365079 0.000000 0.634921 0.000000 0.079365 0.206349 0.047619 0.666667 0.047619 0.936508 0.015873 0.000000 0.952381 0.000000 0.015873 0.031746 0.015873 0.920635 0.000000 0.063492 0.920635 0.000000 0.000000 0.079365 0.063492 0.047619 0.841270 0.047619 0.000000 0.000000 0.015873 0.984127 0.047619 0.015873 0.904762 0.031746 0.015873 0.603175 0.317460 0.063492 0.396825 0.000000 0.015873 0.587302 0.015873 0.476190 0.428571 0.079365 0.063492 0.920635 0.000000 0.015873 0.920635 0.015873 0.047619 0.015873 0.095238 0.682540 0.095238 0.126984 0.047619 0.015873 0.095238 0.841270 Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif 0.841270 0.015873 0.095238 0.047619 0.095238 0.095238 0.682540 0.126984 0.015873 0.015873 0.047619 0.920635 0.063492 0.000000 0.920635 0.015873 0.015873 0.428571 0.476190 0.079365 0.587302 0.000000 0.015873 0.396825 0.015873 0.317460 0.603175 0.063492 0.047619 0.904762 0.015873 0.031746 0.984127 0.000000 0.015873 0.000000 0.063492 0.841270 0.047619 0.047619 0.079365 0.000000 0.000000 0.920635 0.015873 0.000000 0.920635 0.063492 0.031746 0.000000 0.015873 0.952381 0.047619 0.015873 0.936508 0.000000 0.666667 0.206349 0.047619 0.079365 0.365079 0.634921 0.000000 0.000000 0.698413 0.253968 0.015873 0.031746 0.396825 0.412698 0.111111 0.079365 0.031746 0.857143 0.000000 0.111111 1.000000 0.000000 0.000000 0.000000 0.031746 0.904762 0.015873 0.047619 0.968254 0.000000 0.000000 0.031746 0.047619 0.079365 0.857143 0.015873 0.047619 0.047619 0.047619 0.857143 0.111111 0.063492 0.746032 0.079365 Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG Alignment: AGTGSWSCACTGTGAMAMCACAGTG ---GGAGCACTGTGACACCACA--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 27 AgTGCTCCACTGTGgTGTCACAgT Original Motif Reverse Complement Forward 3 19 0.074816 Original motif 0.690141 0.126761 0.042254 0.140845 0.169014 0.098592 0.676056 0.056338 0.042254 0.028169 0.028169 0.901408 0.056338 0.000000 0.774648 0.169014 0.042254 0.887324 0.042254 0.028169 0.000000 0.014085 0.000000 0.985915 0.056338 0.830986 0.042254 0.070423 0.028169 0.957746 0.014085 0.000000 0.957746 0.000000 0.014085 0.028169 0.084507 0.845070 0.014085 0.056338 0.028169 0.014085 0.000000 0.957746 0.140845 0.028169 0.802817 0.028169 0.014085 0.014085 0.014085 0.957746 0.014085 0.000000 0.929577 0.056338 0.056338 0.154930 0.619718 0.169014 0.014085 0.028169 0.000000 0.957746 0.056338 0.014085 0.873239 0.056338 0.014085 0.000000 0.000000 0.985915 0.042254 0.929577 0.000000 0.028169 0.957746 0.028169 0.000000 0.014085 0.028169 0.845070 0.028169 0.098592 0.873239 0.014085 0.042254 0.070423 0.098592 0.154930 0.563380 0.183099 0.070423 0.014085 0.112676 0.802817 Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif 0.802817 0.014085 0.112676 0.070423 0.098592 0.563380 0.154930 0.183099 0.070423 0.014085 0.042254 0.873239 0.028169 0.028169 0.845070 0.098592 0.014085 0.028169 0.000000 0.957746 0.042254 0.000000 0.929577 0.028169 0.985915 0.000000 0.000000 0.014085 0.056338 0.873239 0.014085 0.056338 0.957746 0.028169 0.000000 0.014085 0.056338 0.619718 0.154930 0.169014 0.014085 0.929577 0.000000 0.056338 0.957746 0.014085 0.014085 0.014085 0.140845 0.802817 0.028169 0.028169 0.957746 0.014085 0.000000 0.028169 0.084507 0.014085 0.845070 0.056338 0.028169 0.000000 0.014085 0.957746 0.028169 0.014085 0.957746 0.000000 0.056338 0.042254 0.830986 0.070423 0.985915 0.014085 0.000000 0.000000 0.042254 0.042254 0.887324 0.028169 0.056338 0.774648 0.000000 0.169014 0.901408 0.028169 0.028169 0.042254 0.169014 0.676056 0.098592 0.056338 0.140845 0.126761 0.042254 0.690141 Consensus sequence: ACTGTGACACCACAGTGGAGCACT Alignment: ACTGTGACACCACAGTGGAGCACT --TGTGGTGTCACAGTGCTCC--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 3 ESR1 Original Motif Original Motif Forward 2 19 0.085726 Original motif 0.261242 0.256959 0.329764 0.152034 0.228632 0.170940 0.350427 0.250000 0.136752 0.369658 0.318376 0.175214 0.176596 0.487234 0.138298 0.197872 0.285106 0.493617 0.100000 0.121277 0.651163 0.059197 0.188161 0.101480 0.075949 0.016878 0.816456 0.090717 0.040000 0.037895 0.884211 0.037895 0.069474 0.086316 0.191579 0.652632 0.008421 0.829474 0.111579 0.050526 0.837895 0.027368 0.056842 0.077895 0.122105 0.526316 0.225263 0.126316 0.132632 0.581053 0.111579 0.174737 0.134737 0.543158 0.204211 0.117895 0.067368 0.040000 0.016842 0.875789 0.044211 0.046316 0.896842 0.012632 0.642105 0.223158 0.065263 0.069474 0.021053 0.917895 0.025263 0.035789 0.124211 0.743158 0.004211 0.128421 0.054737 0.347368 0.046316 0.551579 Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif 0.551579 0.347368 0.046316 0.054737 0.124211 0.004211 0.743158 0.128421 0.021053 0.025263 0.917895 0.035789 0.069474 0.223158 0.065263 0.642105 0.044211 0.896842 0.046316 0.012632 0.875789 0.040000 0.016842 0.067368 0.134737 0.204211 0.543158 0.117895 0.132632 0.111579 0.581053 0.174737 0.122105 0.225263 0.526316 0.126316 0.077895 0.027368 0.056842 0.837895 0.008421 0.111579 0.829474 0.050526 0.652632 0.086316 0.191579 0.069474 0.040000 0.884211 0.037895 0.037895 0.075949 0.816456 0.016878 0.090717 0.101480 0.059197 0.188161 0.651163 0.285106 0.100000 0.493617 0.121277 0.176596 0.138298 0.487234 0.197872 0.136752 0.318376 0.369658 0.175214 0.228632 0.350427 0.170940 0.250000 0.261242 0.329764 0.256959 0.152034 Consensus sequence: MGGTCAGGGTGACCTRDBHV Alignment: VDBHMAGGTCACCCTGACCY -TGTGGTGTCACAGTGCTCC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 9 ESR2 Original Motif Original Motif Backward 2 17 1.080006 Original motif 0.218487 0.450980 0.176471 0.154062 0.442577 0.142857 0.114846 0.299720 0.521008 0.042017 0.431373 0.005602 0.075630 0.000000 0.770308 0.154062 0.050420 0.056022 0.893557 0.000000 0.036415 0.053221 0.092437 0.817927 0.000000 1.000000 0.000000 0.000000 0.943978 0.002801 0.000000 0.053221 0.137255 0.344538 0.316527 0.201681 0.179272 0.176471 0.417367 0.226891 0.145658 0.170868 0.411765 0.271709 0.058824 0.092437 0.067227 0.781513 0.176471 0.070028 0.742297 0.011204 0.498599 0.277311 0.053221 0.170868 0.095238 0.750700 0.005602 0.148459 0.128852 0.809524 0.000000 0.061625 0.075630 0.252101 0.000000 0.672269 0.168067 0.263305 0.380952 0.187675 Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif 0.168067 0.380952 0.263305 0.187675 0.672269 0.252101 0.000000 0.075630 0.128852 0.000000 0.809524 0.061625 0.095238 0.005602 0.750700 0.148459 0.170868 0.277311 0.053221 0.498599 0.176471 0.742297 0.070028 0.011204 0.781513 0.092437 0.067227 0.058824 0.145658 0.411765 0.170868 0.271709 0.179272 0.417367 0.176471 0.226891 0.137255 0.316527 0.344538 0.201681 0.053221 0.002801 0.000000 0.943978 0.000000 0.000000 1.000000 0.000000 0.817927 0.053221 0.092437 0.036415 0.050420 0.893557 0.056022 0.000000 0.075630 0.770308 0.000000 0.154062 0.005602 0.042017 0.431373 0.521008 0.299720 0.142857 0.114846 0.442577 0.218487 0.176471 0.450980 0.154062 Consensus sequence: BAGGYCABHBTGACCKHV Alignment: --VHRGGTCABDBTGMCCTB TGTGGTGTCACAGTGCTCC- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 20 CagTGCTCCACTGTGgT Original Motif Original Motif Forward 1 17 1.088470 Original motif 0.150000 0.700000 0.016667 0.133333 0.650000 0.150000 0.050000 0.150000 0.166667 0.116667 0.633333 0.083333 0.050000 0.033333 0.066667 0.850000 0.050000 0.000000 0.833333 0.116667 0.016667 0.966667 0.000000 0.016667 0.050000 0.016667 0.000000 0.933333 0.066667 0.833333 0.066667 0.033333 0.033333 0.966667 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.050000 0.916667 0.016667 0.016667 0.166667 0.000000 0.000000 0.833333 0.083333 0.016667 0.900000 0.000000 0.000000 0.016667 0.016667 0.966667 0.000000 0.016667 0.966667 0.016667 0.116667 0.166667 0.483333 0.233333 0.066667 0.083333 0.050000 0.800000 Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif 0.800000 0.083333 0.050000 0.066667 0.116667 0.483333 0.166667 0.233333 0.000000 0.966667 0.016667 0.016667 0.966667 0.016667 0.016667 0.000000 0.083333 0.900000 0.016667 0.000000 0.833333 0.000000 0.000000 0.166667 0.050000 0.016667 0.916667 0.016667 0.000000 0.000000 0.000000 1.000000 0.033333 0.000000 0.966667 0.000000 0.066667 0.066667 0.833333 0.033333 0.933333 0.016667 0.000000 0.050000 0.016667 0.000000 0.966667 0.016667 0.050000 0.833333 0.000000 0.116667 0.850000 0.033333 0.066667 0.050000 0.166667 0.633333 0.116667 0.083333 0.150000 0.150000 0.050000 0.650000 0.150000 0.016667 0.700000 0.133333 Consensus sequence: ABCACAGTGGAGCACTG Alignment: CAGTGCTCCACTGTGBT-- TGTGGTGTCACAGTGCTCC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 21 AmTGTGACACCACAGT Reverse Complement Reverse Complement Forward 1 16 1.594523 Original motif 0.703125 0.187500 0.015625 0.093750 0.265625 0.500000 0.125000 0.109375 0.015625 0.046875 0.031250 0.906250 0.078125 0.015625 0.890625 0.015625 0.000000 0.000000 0.000000 1.000000 0.000000 0.031250 0.906250 0.062500 0.953125 0.000000 0.015625 0.031250 0.046875 0.890625 0.000000 0.062500 0.968750 0.000000 0.015625 0.015625 0.109375 0.781250 0.062500 0.046875 0.062500 0.890625 0.000000 0.046875 0.953125 0.000000 0.031250 0.015625 0.031250 0.781250 0.046875 0.140625 0.937500 0.015625 0.031250 0.015625 0.093750 0.078125 0.734375 0.093750 0.031250 0.078125 0.000000 0.890625 Consensus sequence: AMTGTGACACCACAGT Reverse complement motif 0.890625 0.078125 0.000000 0.031250 0.093750 0.734375 0.078125 0.093750 0.015625 0.015625 0.031250 0.937500 0.031250 0.046875 0.781250 0.140625 0.015625 0.000000 0.031250 0.953125 0.062500 0.000000 0.890625 0.046875 0.109375 0.062500 0.781250 0.046875 0.015625 0.000000 0.015625 0.968750 0.046875 0.000000 0.890625 0.062500 0.031250 0.000000 0.015625 0.953125 0.000000 0.906250 0.031250 0.062500 1.000000 0.000000 0.000000 0.000000 0.078125 0.890625 0.015625 0.015625 0.906250 0.046875 0.031250 0.015625 0.265625 0.125000 0.500000 0.109375 0.093750 0.187500 0.015625 0.703125 Consensus sequence: ACTGTGGTGTCACART Alignment: ACTGTGGTGTCACART--- GGAGCACTGTGACACCACA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 14 PPARGRXRA Reverse Complement Original Motif Forward 1 15 2.100068 Original motif 0.109685 0.369895 0.373396 0.147025 0.117716 0.193473 0.148019 0.540793 0.453488 0.026744 0.427907 0.091860 0.116144 0.003484 0.779326 0.101045 0.161253 0.017401 0.781903 0.039443 0.168213 0.149652 0.458237 0.223898 0.082271 0.633835 0.207416 0.076477 0.949015 0.024334 0.017381 0.009270 0.604867 0.055620 0.312862 0.026651 0.825231 0.005787 0.158565 0.010417 0.095017 0.002317 0.888760 0.013905 0.047509 0.010429 0.803013 0.139050 0.025492 0.114716 0.304751 0.555041 0.062645 0.643852 0.167053 0.126450 0.784223 0.067285 0.054524 0.093968 Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif 0.093968 0.067285 0.054524 0.784223 0.062645 0.167053 0.643852 0.126450 0.555041 0.114716 0.304751 0.025492 0.047509 0.803013 0.010429 0.139050 0.095017 0.888760 0.002317 0.013905 0.010417 0.005787 0.158565 0.825231 0.026651 0.055620 0.312862 0.604867 0.009270 0.024334 0.017381 0.949015 0.082271 0.207416 0.633835 0.076477 0.168213 0.458237 0.149652 0.223898 0.161253 0.781903 0.017401 0.039443 0.116144 0.779326 0.003484 0.101045 0.091860 0.026744 0.427907 0.453488 0.540793 0.193473 0.148019 0.117716 0.109685 0.373396 0.369895 0.147025 Consensus sequence: TGRCCTKTGHCCKAB Alignment: BTRGGDCARAGGKCA---- GGAGCACTGTGACACCACA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 26 CAcCACAGTGGAGCAct Original Motif Original Motif Backward 4 14 2.575542 Original motif 0.078125 0.734375 0.046875 0.140625 0.828125 0.046875 0.078125 0.046875 0.203125 0.484375 0.156250 0.156250 0.015625 0.984375 0.000000 0.000000 0.968750 0.015625 0.015625 0.000000 0.000000 0.906250 0.015625 0.078125 0.859375 0.000000 0.000000 0.140625 0.031250 0.000000 0.906250 0.062500 0.000000 0.015625 0.000000 0.984375 0.000000 0.000000 0.968750 0.031250 0.046875 0.062500 0.812500 0.078125 0.937500 0.015625 0.015625 0.031250 0.015625 0.031250 0.921875 0.031250 0.125000 0.796875 0.000000 0.078125 0.875000 0.046875 0.046875 0.031250 0.093750 0.656250 0.093750 0.156250 0.156250 0.078125 0.109375 0.656250 Consensus sequence: CAHCACAGTGGAGCACT Reverse complement motif 0.656250 0.078125 0.109375 0.156250 0.093750 0.093750 0.656250 0.156250 0.031250 0.046875 0.046875 0.875000 0.125000 0.000000 0.796875 0.078125 0.015625 0.921875 0.031250 0.031250 0.031250 0.015625 0.015625 0.937500 0.046875 0.812500 0.062500 0.078125 0.000000 0.968750 0.000000 0.031250 0.984375 0.015625 0.000000 0.000000 0.031250 0.906250 0.000000 0.062500 0.140625 0.000000 0.000000 0.859375 0.000000 0.015625 0.906250 0.078125 0.000000 0.015625 0.015625 0.968750 0.015625 0.000000 0.984375 0.000000 0.203125 0.156250 0.484375 0.156250 0.046875 0.046875 0.078125 0.828125 0.078125 0.046875 0.734375 0.140625 Consensus sequence: AGTGCTCCACTGTGDTG Alignment: -----CAHCACAGTGGAGCACT TGTGGTGTCACAGTGCTCC--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 4 Esrrb Reverse Complement Original Motif Backward 1 12 3.589144 Original motif 0.290198 0.220264 0.271200 0.218337 0.184941 0.227810 0.376477 0.210772 0.115226 0.332236 0.331687 0.220850 0.070959 0.342466 0.122740 0.463836 0.084862 0.729264 0.171640 0.014235 0.909737 0.008753 0.067834 0.013676 0.975656 0.000547 0.016411 0.007385 0.008758 0.001368 0.981390 0.008484 0.005750 0.003286 0.986309 0.004655 0.049904 0.012613 0.066904 0.870579 0.002473 0.927473 0.046703 0.023352 0.951569 0.005504 0.035498 0.007430 Consensus sequence: VBBYCAAGGTCA Reverse complement motif 0.007430 0.005504 0.035498 0.951569 0.002473 0.046703 0.927473 0.023352 0.870579 0.012613 0.066904 0.049904 0.005750 0.986309 0.003286 0.004655 0.008758 0.981390 0.001368 0.008484 0.007385 0.000547 0.016411 0.975656 0.013676 0.008753 0.067834 0.909737 0.084862 0.171640 0.729264 0.014235 0.463836 0.342466 0.122740 0.070959 0.115226 0.331687 0.332236 0.220850 0.184941 0.376477 0.227810 0.210772 0.218337 0.220264 0.271200 0.290198 Consensus sequence: TGACCTTGMBBB Alignment: -------VBBYCAAGGTCA GGAGCACTGTGACACCACA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 2 Motif ID: 18 Motif name: sscCCCGCGcs Original motif 0.147059 0.441176 0.264706 0.147059 0.117647 0.529412 0.294118 0.058824 0.000000 0.676471 0.235294 0.088235 0.029412 0.852941 0.117647 0.000000 0.000000 0.823529 0.176471 0.000000 0.000000 0.794118 0.205882 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.058824 0.941176 0.000000 0.117647 0.470588 0.235294 0.176471 0.000000 0.323529 0.529412 0.147059 Consensus sequence: BSCCCCGCGBS Reserve complement motif 0.000000 0.529412 0.323529 0.147059 0.117647 0.235294 0.470588 0.176471 0.000000 0.941176 0.058824 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.205882 0.794118 0.000000 0.000000 0.176471 0.823529 0.000000 0.029412 0.117647 0.852941 0.000000 0.000000 0.235294 0.676471 0.088235 0.117647 0.294118 0.529412 0.058824 0.147059 0.264706 0.441176 0.147059 Consensus sequence: SBCGCGGGGSB ************************************************************************ Best Matches for Motif ID 18 (Highest to Lowest) ************************************************************************ Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 24 ssCCCCGCSssk Original Motif Original Motif Forward 1 11 0.000000 Original motif 0.000000 0.444444 0.370370 0.185185 0.111111 0.407407 0.333333 0.148148 0.000000 0.888889 0.037037 0.074074 0.000000 0.888889 0.074074 0.037037 0.000000 0.777778 0.222222 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.037037 0.888889 0.000000 0.074074 0.000000 0.703704 0.296296 0.000000 0.000000 0.518519 0.370370 0.111111 0.111111 0.407407 0.259259 0.222222 0.074074 0.222222 0.407407 0.296296 Consensus sequence: SBCCCCGCCSBB Reverse complement motif 0.074074 0.407407 0.222222 0.296296 0.111111 0.259259 0.407407 0.222222 0.000000 0.370370 0.518519 0.111111 0.000000 0.296296 0.703704 0.000000 0.037037 0.000000 0.888889 0.074074 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.222222 0.777778 0.000000 0.000000 0.074074 0.888889 0.037037 0.000000 0.037037 0.888889 0.074074 0.111111 0.333333 0.407407 0.148148 0.000000 0.370370 0.444444 0.185185 Consensus sequence: BBSGGCGGGGBS Alignment: SBCCCCGCCSBB BSCCCCGCGBS- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 32 gCGCGCsCgsG Original Motif Original Motif Backward 1 11 0.041723 Original motif 0.105263 0.210526 0.526316 0.157895 0.000000 0.736842 0.105263 0.157895 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.368421 0.631579 0.000000 0.000000 0.894737 0.105263 0.000000 0.157895 0.157895 0.631579 0.052632 0.052632 0.631579 0.263158 0.052632 0.105263 0.052632 0.789474 0.052632 Consensus sequence: GCGCGCSCGCG Reverse complement motif 0.105263 0.789474 0.052632 0.052632 0.052632 0.263158 0.631579 0.052632 0.157895 0.631579 0.157895 0.052632 0.000000 0.105263 0.894737 0.000000 0.000000 0.631579 0.368421 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.105263 0.736842 0.157895 0.105263 0.526316 0.210526 0.157895 Consensus sequence: CGCGSGCGCGC Alignment: GCGCGCSCGCG BSCCCCGCGBS ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 28 ssGCkTGCssk Reverse Complement Reverse Complement Backward 1 11 0.052312 Original motif 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 0.500000 0.500000 Consensus sequence: SSGCKTGCSSK Reverse complement motif 0.000000 0.500000 0.000000 0.500000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.000000 0.500000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 Consensus sequence: YSSGCAYGCSS Alignment: YSSGCAYGCSS SBCGCGGGGSB ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 16 CTCF Reverse Complement Original Motif Backward 7 11 0.056400 Original motif 0.095290 0.318729 0.083242 0.502738 0.182913 0.158817 0.453450 0.204819 0.307777 0.053669 0.491785 0.146769 0.061336 0.876232 0.023001 0.039430 0.008762 0.989047 0.000000 0.002191 0.814896 0.014239 0.071194 0.099671 0.043812 0.578313 0.365827 0.012048 0.117325 0.474781 0.052632 0.355263 0.933114 0.012061 0.035088 0.019737 0.005488 0.000000 0.991218 0.003293 0.365532 0.003293 0.621295 0.009879 0.059276 0.013172 0.553238 0.374314 0.013187 0.000000 0.978022 0.008791 0.061538 0.008791 0.851648 0.078022 0.114411 0.806381 0.005501 0.073707 0.409241 0.014301 0.557756 0.018702 0.090308 0.530837 0.338106 0.040749 0.128855 0.354626 0.080396 0.436123 0.442731 0.199339 0.292952 0.064978 Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif 0.064978 0.199339 0.292952 0.442731 0.436123 0.354626 0.080396 0.128855 0.090308 0.338106 0.530837 0.040749 0.409241 0.557756 0.014301 0.018702 0.114411 0.005501 0.806381 0.073707 0.061538 0.851648 0.008791 0.078022 0.013187 0.978022 0.000000 0.008791 0.059276 0.553238 0.013172 0.374314 0.365532 0.621295 0.003293 0.009879 0.005488 0.991218 0.000000 0.003293 0.019737 0.012061 0.035088 0.933114 0.117325 0.052632 0.474781 0.355263 0.043812 0.365827 0.578313 0.012048 0.099671 0.014239 0.071194 0.814896 0.008762 0.000000 0.989047 0.002191 0.061336 0.023001 0.876232 0.039430 0.307777 0.491785 0.053669 0.146769 0.182913 0.453450 0.158817 0.204819 0.502738 0.318729 0.083242 0.095290 Consensus sequence: BMSMGCCYMCTKSTGGMHM Alignment: YDRCCASYAGRKGGCRSYV --SBCGCGGGGSB------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 3 ESR1 Original Motif Reverse Complement Forward 1 11 0.073498 Original motif 0.261242 0.256959 0.329764 0.152034 0.228632 0.170940 0.350427 0.250000 0.136752 0.369658 0.318376 0.175214 0.176596 0.487234 0.138298 0.197872 0.285106 0.493617 0.100000 0.121277 0.651163 0.059197 0.188161 0.101480 0.075949 0.016878 0.816456 0.090717 0.040000 0.037895 0.884211 0.037895 0.069474 0.086316 0.191579 0.652632 0.008421 0.829474 0.111579 0.050526 0.837895 0.027368 0.056842 0.077895 0.122105 0.526316 0.225263 0.126316 0.132632 0.581053 0.111579 0.174737 0.134737 0.543158 0.204211 0.117895 0.067368 0.040000 0.016842 0.875789 0.044211 0.046316 0.896842 0.012632 0.642105 0.223158 0.065263 0.069474 0.021053 0.917895 0.025263 0.035789 0.124211 0.743158 0.004211 0.128421 0.054737 0.347368 0.046316 0.551579 Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif 0.551579 0.347368 0.046316 0.054737 0.124211 0.004211 0.743158 0.128421 0.021053 0.025263 0.917895 0.035789 0.069474 0.223158 0.065263 0.642105 0.044211 0.896842 0.046316 0.012632 0.875789 0.040000 0.016842 0.067368 0.134737 0.204211 0.543158 0.117895 0.132632 0.111579 0.581053 0.174737 0.122105 0.225263 0.526316 0.126316 0.077895 0.027368 0.056842 0.837895 0.008421 0.111579 0.829474 0.050526 0.652632 0.086316 0.191579 0.069474 0.040000 0.884211 0.037895 0.037895 0.075949 0.816456 0.016878 0.090717 0.101480 0.059197 0.188161 0.651163 0.285106 0.100000 0.493617 0.121277 0.176596 0.138298 0.487234 0.197872 0.136752 0.318376 0.369658 0.175214 0.228632 0.350427 0.170940 0.250000 0.261242 0.329764 0.256959 0.152034 Consensus sequence: MGGTCAGGGTGACCTRDBHV Alignment: MGGTCAGGGTGACCTRDBHV BSCCCCGCGBS--------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 29 cCGCGGrCACG Original Motif Original Motif Backward 1 11 0.075708 Original motif 0.000000 0.600000 0.200000 0.200000 0.000000 0.800000 0.000000 0.200000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.600000 0.000000 0.400000 0.000000 0.000000 0.800000 0.200000 0.000000 0.800000 0.000000 0.200000 0.000000 0.000000 0.800000 0.200000 0.000000 0.200000 0.000000 0.800000 0.000000 Consensus sequence: CCGCGGRCACG Reverse complement motif 0.200000 0.800000 0.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.200000 0.800000 0.000000 0.000000 0.000000 0.400000 0.600000 0.000000 0.800000 0.200000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.800000 0.200000 0.000000 0.200000 0.600000 0.200000 Consensus sequence: CGTGKCCGCGG Alignment: CCGCGGRCACG BSCCCCGCGBS ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 7 REST Reverse Complement Reverse Complement Backward 11 11 0.075810 Original motif 0.132621 0.109365 0.230044 0.527970 0.036318 0.168441 0.091421 0.703820 0.047589 0.855354 0.031309 0.065748 0.906367 0.018727 0.058677 0.016230 0.021197 0.027431 0.945137 0.006234 0.076012 0.609346 0.201246 0.113396 0.980697 0.004359 0.007472 0.007472 0.001868 0.987547 0.007472 0.003113 0.021793 0.922167 0.012453 0.043587 0.568847 0.125234 0.100935 0.204984 0.136534 0.233791 0.077307 0.552369 0.024314 0.004364 0.966958 0.004364 0.012469 0.003117 0.983167 0.001247 0.877105 0.069869 0.021210 0.031815 0.008125 0.800000 0.145625 0.046250 0.983750 0.005625 0.004375 0.006250 0.026349 0.008156 0.959849 0.005646 0.128688 0.632141 0.114878 0.124294 0.229899 0.019472 0.432161 0.318467 0.133962 0.586792 0.200629 0.078616 0.112579 0.700629 0.023270 0.163522 Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif 0.112579 0.023270 0.700629 0.163522 0.133962 0.200629 0.586792 0.078616 0.229899 0.432161 0.019472 0.318467 0.128688 0.114878 0.632141 0.124294 0.026349 0.959849 0.008156 0.005646 0.006250 0.005625 0.004375 0.983750 0.008125 0.145625 0.800000 0.046250 0.031815 0.069869 0.021210 0.877105 0.012469 0.983167 0.003117 0.001247 0.024314 0.966958 0.004364 0.004364 0.552369 0.233791 0.077307 0.136534 0.204984 0.125234 0.100935 0.568847 0.021793 0.012453 0.922167 0.043587 0.001868 0.007472 0.987547 0.003113 0.007472 0.004359 0.007472 0.980697 0.076012 0.201246 0.609346 0.113396 0.021197 0.945137 0.027431 0.006234 0.016230 0.018727 0.058677 0.906367 0.047589 0.031309 0.855354 0.065748 0.703820 0.168441 0.091421 0.036318 0.527970 0.109365 0.230044 0.132621 Consensus sequence: GGYGCTGTCCATGGTGCTGAA Alignment: GGYGCTGTCCATGGTGCTGAA SBCGCGGGGSB---------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 8 Myc Reverse Complement Original Motif Backward 1 10 0.535606 Original motif 0.295154 0.422907 0.158590 0.123348 0.149780 0.233480 0.572687 0.044053 0.035242 0.964758 0.000000 0.000000 0.955947 0.017621 0.022026 0.004405 0.000000 0.933921 0.013216 0.052863 0.083700 0.008811 0.898678 0.008811 0.039648 0.193833 0.000000 0.766520 0.000000 0.008811 0.951542 0.039648 0.000000 0.074890 0.806167 0.118943 0.198238 0.471366 0.105727 0.224670 Consensus sequence: VGCACGTGGH Reverse complement motif 0.198238 0.105727 0.471366 0.224670 0.000000 0.806167 0.074890 0.118943 0.000000 0.951542 0.008811 0.039648 0.766520 0.193833 0.000000 0.039648 0.083700 0.898678 0.008811 0.008811 0.000000 0.013216 0.933921 0.052863 0.004405 0.017621 0.022026 0.955947 0.035242 0.000000 0.964758 0.000000 0.149780 0.572687 0.233480 0.044053 0.295154 0.158590 0.422907 0.123348 Consensus sequence: DCCACGTGCV Alignment: -VGCACGTGGH SBCGCGGGGSB ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 6 Mycn Reverse Complement Original Motif Backward 1 10 0.536235 Original motif 0.349315 0.363014 0.143836 0.143836 0.089041 0.388128 0.447489 0.075342 0.015982 0.984018 0.000000 0.000000 0.945205 0.000000 0.041096 0.013699 0.000000 0.961187 0.018265 0.020548 0.070776 0.002283 0.924658 0.002283 0.054795 0.221461 0.004566 0.719178 0.000000 0.000000 0.938356 0.061644 0.061644 0.111872 0.739726 0.086758 0.139269 0.605023 0.091324 0.164384 Consensus sequence: HSCACGTGGC Reverse complement motif 0.139269 0.091324 0.605023 0.164384 0.061644 0.739726 0.111872 0.086758 0.000000 0.938356 0.000000 0.061644 0.719178 0.221461 0.004566 0.054795 0.070776 0.924658 0.002283 0.002283 0.000000 0.018265 0.961187 0.020548 0.013699 0.000000 0.041096 0.945205 0.015982 0.000000 0.984018 0.000000 0.089041 0.447489 0.388128 0.075342 0.349315 0.143836 0.363014 0.143836 Consensus sequence: GCCACGTGSD Alignment: -HSCACGTGGC SBCGCGGGGSB ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 33 srACyCCGAyr Reverse Complement Reverse Complement Forward 2 10 0.571697 Original motif 0.000000 0.500000 0.500000 0.000000 0.500000 0.000000 0.500000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.000000 0.500000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.000000 0.500000 0.500000 0.000000 0.500000 0.000000 Consensus sequence: SRACYCCGAYR Reverse complement motif 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.500000 0.500000 0.000000 Consensus sequence: KKTCGGKGTKS Alignment: KKTCGGKGTKS- -SBCGCGGGGSB ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 2 Motif ID: 19 Motif name: atactttggc Original motif 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 Consensus sequence: ATACTTTGGC Reserve complement motif 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 Consensus sequence: GCCAAAGTAT ************************************************************************ Best Matches for Motif ID 19 (Highest to Lowest) ************************************************************************ Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 25 wwCCAmAGTCmt Reverse Complement Original Motif Forward 2 10 0.021591 Original motif 0.454545 0.045455 0.227273 0.272727 0.363636 0.136364 0.136364 0.363636 0.000000 1.000000 0.000000 0.000000 0.000000 0.954545 0.045455 0.000000 1.000000 0.000000 0.000000 0.000000 0.409091 0.590909 0.000000 0.000000 0.909091 0.045455 0.045455 0.000000 0.000000 0.000000 1.000000 0.000000 0.045455 0.000000 0.000000 0.954545 0.045455 0.909091 0.000000 0.045455 0.272727 0.318182 0.181818 0.227273 0.181818 0.227273 0.227273 0.363636 Consensus sequence: DDCCAMAGTCHB Reverse complement motif 0.363636 0.227273 0.227273 0.181818 0.272727 0.181818 0.318182 0.227273 0.045455 0.000000 0.909091 0.045455 0.954545 0.000000 0.000000 0.045455 0.000000 1.000000 0.000000 0.000000 0.000000 0.045455 0.045455 0.909091 0.409091 0.000000 0.590909 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.045455 0.954545 0.000000 0.000000 0.000000 1.000000 0.000000 0.363636 0.136364 0.136364 0.363636 0.272727 0.045455 0.227273 0.454545 Consensus sequence: VDGACTRTGGDD Alignment: DDCCAMAGTCHB -GCCAAAGTAT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 30 taaacgatgcc Reverse Complement Reverse Complement Backward 2 10 0.037500 Original motif 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 Consensus sequence: TAAACGATGCC Reverse complement motif 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 Consensus sequence: GGCATCGTTTA Alignment: GGCATCGTTTA GCCAAAGTAT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 10 NR1H2RXRA Original Motif Reverse Complement Forward 5 10 0.039500 Original motif 0.680000 0.200000 0.000000 0.120000 0.680000 0.040000 0.200000 0.080000 0.800000 0.000000 0.200000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.040000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.000000 0.040000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.800000 0.040000 0.080000 0.080000 0.000000 0.600000 0.240000 0.160000 Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif 0.000000 0.240000 0.600000 0.160000 0.080000 0.040000 0.080000 0.800000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.040000 0.000000 0.000000 0.960000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.040000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.200000 0.800000 0.080000 0.040000 0.200000 0.680000 0.120000 0.200000 0.000000 0.680000 Consensus sequence: GTTGACCTTTGACCTTT Alignment: GTTGACCTTTGACCTTT ----ATACTTTGGC--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 17 TgTGgTGTCACAGTGCTCC Original Motif Reverse Complement Backward 4 10 0.047222 Original motif 0.111111 0.083333 0.055556 0.750000 0.125000 0.097222 0.652778 0.125000 0.041667 0.097222 0.027778 0.833333 0.027778 0.027778 0.791667 0.152778 0.055556 0.166667 0.652778 0.125000 0.000000 0.041667 0.013889 0.944444 0.041667 0.000000 0.888889 0.069444 0.027778 0.027778 0.000000 0.944444 0.041667 0.944444 0.013889 0.000000 0.916667 0.027778 0.000000 0.055556 0.069444 0.875000 0.000000 0.055556 0.833333 0.013889 0.013889 0.138889 0.041667 0.069444 0.819444 0.069444 0.027778 0.027778 0.027778 0.916667 0.069444 0.013889 0.847222 0.069444 0.069444 0.777778 0.027778 0.125000 0.055556 0.041667 0.027778 0.875000 0.041667 0.708333 0.125000 0.125000 0.111111 0.819444 0.055556 0.013889 Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif 0.111111 0.055556 0.819444 0.013889 0.041667 0.125000 0.708333 0.125000 0.875000 0.041667 0.027778 0.055556 0.069444 0.027778 0.777778 0.125000 0.069444 0.847222 0.013889 0.069444 0.916667 0.027778 0.027778 0.027778 0.041667 0.819444 0.069444 0.069444 0.138889 0.013889 0.013889 0.833333 0.069444 0.000000 0.875000 0.055556 0.055556 0.027778 0.000000 0.916667 0.041667 0.013889 0.944444 0.000000 0.944444 0.027778 0.000000 0.027778 0.041667 0.888889 0.000000 0.069444 0.944444 0.041667 0.013889 0.000000 0.055556 0.652778 0.166667 0.125000 0.027778 0.791667 0.027778 0.152778 0.833333 0.097222 0.027778 0.041667 0.125000 0.652778 0.097222 0.125000 0.750000 0.083333 0.055556 0.111111 Consensus sequence: GGAGCACTGTGACACCACA Alignment: GGAGCACTGTGACACCACA ------ATACTTTGGC--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 22 CACTGTGrYrtCACAGTGswsCAcT Reverse Complement Original Motif Forward 10 10 0.047421 Original motif 0.111111 0.746032 0.063492 0.079365 0.857143 0.047619 0.047619 0.047619 0.047619 0.857143 0.079365 0.015873 0.031746 0.000000 0.000000 0.968254 0.031746 0.015873 0.904762 0.047619 0.000000 0.000000 0.000000 1.000000 0.031746 0.000000 0.857143 0.111111 0.396825 0.111111 0.412698 0.079365 0.031746 0.253968 0.015873 0.698413 0.365079 0.000000 0.634921 0.000000 0.079365 0.206349 0.047619 0.666667 0.047619 0.936508 0.015873 0.000000 0.952381 0.000000 0.015873 0.031746 0.015873 0.920635 0.000000 0.063492 0.920635 0.000000 0.000000 0.079365 0.063492 0.047619 0.841270 0.047619 0.000000 0.000000 0.015873 0.984127 0.047619 0.015873 0.904762 0.031746 0.015873 0.603175 0.317460 0.063492 0.396825 0.000000 0.015873 0.587302 0.015873 0.476190 0.428571 0.079365 0.063492 0.920635 0.000000 0.015873 0.920635 0.015873 0.047619 0.015873 0.095238 0.682540 0.095238 0.126984 0.047619 0.015873 0.095238 0.841270 Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif 0.841270 0.015873 0.095238 0.047619 0.095238 0.095238 0.682540 0.126984 0.015873 0.015873 0.047619 0.920635 0.063492 0.000000 0.920635 0.015873 0.015873 0.428571 0.476190 0.079365 0.587302 0.000000 0.015873 0.396825 0.015873 0.317460 0.603175 0.063492 0.047619 0.904762 0.015873 0.031746 0.984127 0.000000 0.015873 0.000000 0.063492 0.841270 0.047619 0.047619 0.079365 0.000000 0.000000 0.920635 0.015873 0.000000 0.920635 0.063492 0.031746 0.000000 0.015873 0.952381 0.047619 0.015873 0.936508 0.000000 0.666667 0.206349 0.047619 0.079365 0.365079 0.634921 0.000000 0.000000 0.698413 0.253968 0.015873 0.031746 0.396825 0.412698 0.111111 0.079365 0.031746 0.857143 0.000000 0.111111 1.000000 0.000000 0.000000 0.000000 0.031746 0.904762 0.015873 0.047619 0.968254 0.000000 0.000000 0.031746 0.047619 0.079365 0.857143 0.015873 0.047619 0.047619 0.047619 0.857143 0.111111 0.063492 0.746032 0.079365 Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG Alignment: CACTGTGRTRTCACAGTGSWSCACT ---------GCCAAAGTAT------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 1 HNF4A Original Motif Reverse Complement Forward 3 10 0.048321 Original motif 0.417910 0.104478 0.402985 0.074627 0.029851 0.029851 0.835821 0.104478 0.179104 0.059701 0.522388 0.238806 0.074627 0.343284 0.298507 0.283582 0.044776 0.761194 0.059701 0.134328 0.880597 0.014925 0.044776 0.059701 0.791045 0.029851 0.149254 0.029851 0.835821 0.014925 0.119403 0.029851 0.059701 0.059701 0.865672 0.014925 0.089552 0.029851 0.492537 0.388060 0.044776 0.328358 0.164179 0.462687 0.059701 0.731343 0.074627 0.134328 0.626866 0.104478 0.149254 0.119403 Consensus sequence: RGGBCAAAGKYCA Reverse complement motif 0.119403 0.104478 0.149254 0.626866 0.059701 0.074627 0.731343 0.134328 0.462687 0.328358 0.164179 0.044776 0.089552 0.492537 0.029851 0.388060 0.059701 0.865672 0.059701 0.014925 0.029851 0.014925 0.119403 0.835821 0.029851 0.029851 0.149254 0.791045 0.059701 0.014925 0.044776 0.880597 0.044776 0.059701 0.761194 0.134328 0.074627 0.298507 0.343284 0.283582 0.179104 0.522388 0.059701 0.238806 0.029851 0.835821 0.029851 0.104478 0.074627 0.104478 0.402985 0.417910 Consensus sequence: TGMYCTTTGBCCK Alignment: TGMYCTTTGBCCK --ATACTTTGGC- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 2 NR2F1 Original Motif Original Motif Forward 2 10 0.049038 Original motif 0.000000 0.000000 0.153846 0.846154 0.076923 0.000000 0.923077 0.000000 0.923077 0.000000 0.076923 0.000000 0.461538 0.538462 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.230769 0.000000 0.769231 0.000000 0.153846 0.000000 0.846154 0.076923 0.000000 0.000000 0.923077 0.153846 0.000000 0.846154 0.000000 0.461538 0.307692 0.230769 0.000000 0.461538 0.384615 0.076923 0.076923 0.076923 0.769231 0.076923 0.076923 0.230769 0.461538 0.000000 0.307692 0.000000 0.230769 0.230769 0.538462 Consensus sequence: TGAMCTTTGMMCYT Reverse complement motif 0.538462 0.230769 0.230769 0.000000 0.230769 0.000000 0.461538 0.307692 0.076923 0.076923 0.769231 0.076923 0.076923 0.384615 0.076923 0.461538 0.000000 0.307692 0.230769 0.461538 0.153846 0.846154 0.000000 0.000000 0.923077 0.000000 0.000000 0.076923 0.846154 0.153846 0.000000 0.000000 0.769231 0.230769 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.461538 0.000000 0.538462 0.000000 0.000000 0.000000 0.076923 0.923077 0.076923 0.923077 0.000000 0.000000 0.846154 0.000000 0.153846 0.000000 Consensus sequence: AKGYYCAAAGRTCA Alignment: TGAMCTTTGMMCYT -ATACTTTGGC--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 23 TGGAGCACTGTGACAcCACAGTGg Reverse Complement Reverse Complement Backward 5 10 0.049324 Original motif 0.054054 0.040541 0.054054 0.851351 0.040541 0.013514 0.824324 0.121622 0.094595 0.135135 0.756757 0.013514 0.891892 0.000000 0.000000 0.108108 0.040541 0.094595 0.810811 0.054054 0.081081 0.797297 0.054054 0.067568 0.932432 0.027027 0.000000 0.040541 0.054054 0.756757 0.135135 0.054054 0.108108 0.027027 0.013514 0.851351 0.108108 0.000000 0.851351 0.040541 0.013514 0.000000 0.027027 0.959459 0.000000 0.013514 0.945946 0.040541 0.905405 0.000000 0.067568 0.027027 0.054054 0.837838 0.000000 0.108108 0.945946 0.013514 0.040541 0.000000 0.162162 0.500000 0.189189 0.148649 0.108108 0.824324 0.000000 0.067568 0.945946 0.000000 0.040541 0.013514 0.081081 0.837838 0.027027 0.054054 0.945946 0.000000 0.013514 0.040541 0.054054 0.067568 0.783784 0.094595 0.054054 0.027027 0.000000 0.918919 0.040541 0.013514 0.864865 0.081081 0.148649 0.121622 0.675676 0.054054 Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif 0.148649 0.675676 0.121622 0.054054 0.040541 0.864865 0.013514 0.081081 0.918919 0.027027 0.000000 0.054054 0.054054 0.783784 0.067568 0.094595 0.040541 0.000000 0.013514 0.945946 0.081081 0.027027 0.837838 0.054054 0.013514 0.000000 0.040541 0.945946 0.108108 0.000000 0.824324 0.067568 0.162162 0.189189 0.500000 0.148649 0.000000 0.013514 0.040541 0.945946 0.054054 0.000000 0.837838 0.108108 0.027027 0.000000 0.067568 0.905405 0.000000 0.945946 0.013514 0.040541 0.959459 0.000000 0.027027 0.013514 0.108108 0.851351 0.000000 0.040541 0.851351 0.027027 0.013514 0.108108 0.054054 0.135135 0.756757 0.054054 0.040541 0.027027 0.000000 0.932432 0.081081 0.054054 0.797297 0.067568 0.040541 0.810811 0.094595 0.054054 0.108108 0.000000 0.000000 0.891892 0.094595 0.756757 0.135135 0.013514 0.040541 0.824324 0.013514 0.121622 0.851351 0.040541 0.054054 0.054054 Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA Alignment: CCACTGTGVTGTCACAGTGCTCCA ----------GCCAAAGTAT---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 27 AgTGCTCCACTGTGgTGTCACAgT Reverse Complement Reverse Complement Forward 9 10 0.049824 Original motif 0.690141 0.126761 0.042254 0.140845 0.169014 0.098592 0.676056 0.056338 0.042254 0.028169 0.028169 0.901408 0.056338 0.000000 0.774648 0.169014 0.042254 0.887324 0.042254 0.028169 0.000000 0.014085 0.000000 0.985915 0.056338 0.830986 0.042254 0.070423 0.028169 0.957746 0.014085 0.000000 0.957746 0.000000 0.014085 0.028169 0.084507 0.845070 0.014085 0.056338 0.028169 0.014085 0.000000 0.957746 0.140845 0.028169 0.802817 0.028169 0.014085 0.014085 0.014085 0.957746 0.014085 0.000000 0.929577 0.056338 0.056338 0.154930 0.619718 0.169014 0.014085 0.028169 0.000000 0.957746 0.056338 0.014085 0.873239 0.056338 0.014085 0.000000 0.000000 0.985915 0.042254 0.929577 0.000000 0.028169 0.957746 0.028169 0.000000 0.014085 0.028169 0.845070 0.028169 0.098592 0.873239 0.014085 0.042254 0.070423 0.098592 0.154930 0.563380 0.183099 0.070423 0.014085 0.112676 0.802817 Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif 0.802817 0.014085 0.112676 0.070423 0.098592 0.563380 0.154930 0.183099 0.070423 0.014085 0.042254 0.873239 0.028169 0.028169 0.845070 0.098592 0.014085 0.028169 0.000000 0.957746 0.042254 0.000000 0.929577 0.028169 0.985915 0.000000 0.000000 0.014085 0.056338 0.873239 0.014085 0.056338 0.957746 0.028169 0.000000 0.014085 0.056338 0.619718 0.154930 0.169014 0.014085 0.929577 0.000000 0.056338 0.957746 0.014085 0.014085 0.014085 0.140845 0.802817 0.028169 0.028169 0.957746 0.014085 0.000000 0.028169 0.084507 0.014085 0.845070 0.056338 0.028169 0.000000 0.014085 0.957746 0.028169 0.014085 0.957746 0.000000 0.056338 0.042254 0.830986 0.070423 0.985915 0.014085 0.000000 0.000000 0.042254 0.042254 0.887324 0.028169 0.056338 0.774648 0.000000 0.169014 0.901408 0.028169 0.028169 0.042254 0.169014 0.676056 0.098592 0.056338 0.140845 0.126761 0.042254 0.690141 Consensus sequence: ACTGTGACACCACAGTGGAGCACT Alignment: ACTGTGACACCACAGTGGAGCACT --------GCCAAAGTAT------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 26 CAcCACAGTGGAGCAct Original Motif Reverse Complement Backward 2 10 0.052734 Original motif 0.078125 0.734375 0.046875 0.140625 0.828125 0.046875 0.078125 0.046875 0.203125 0.484375 0.156250 0.156250 0.015625 0.984375 0.000000 0.000000 0.968750 0.015625 0.015625 0.000000 0.000000 0.906250 0.015625 0.078125 0.859375 0.000000 0.000000 0.140625 0.031250 0.000000 0.906250 0.062500 0.000000 0.015625 0.000000 0.984375 0.000000 0.000000 0.968750 0.031250 0.046875 0.062500 0.812500 0.078125 0.937500 0.015625 0.015625 0.031250 0.015625 0.031250 0.921875 0.031250 0.125000 0.796875 0.000000 0.078125 0.875000 0.046875 0.046875 0.031250 0.093750 0.656250 0.093750 0.156250 0.156250 0.078125 0.109375 0.656250 Consensus sequence: CAHCACAGTGGAGCACT Reverse complement motif 0.656250 0.078125 0.109375 0.156250 0.093750 0.093750 0.656250 0.156250 0.031250 0.046875 0.046875 0.875000 0.125000 0.000000 0.796875 0.078125 0.015625 0.921875 0.031250 0.031250 0.031250 0.015625 0.015625 0.937500 0.046875 0.812500 0.062500 0.078125 0.000000 0.968750 0.000000 0.031250 0.984375 0.015625 0.000000 0.000000 0.031250 0.906250 0.000000 0.062500 0.140625 0.000000 0.000000 0.859375 0.000000 0.015625 0.906250 0.078125 0.000000 0.015625 0.015625 0.968750 0.015625 0.000000 0.984375 0.000000 0.203125 0.156250 0.484375 0.156250 0.046875 0.046875 0.078125 0.828125 0.078125 0.046875 0.734375 0.140625 Consensus sequence: AGTGCTCCACTGTGDTG Alignment: AGTGCTCCACTGTGDTG ------ATACTTTGGC- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 2 Motif ID: 20 Motif name: CagTGCTCCACTGTGgT Original motif 0.150000 0.700000 0.016667 0.133333 0.650000 0.150000 0.050000 0.150000 0.166667 0.116667 0.633333 0.083333 0.050000 0.033333 0.066667 0.850000 0.050000 0.000000 0.833333 0.116667 0.016667 0.966667 0.000000 0.016667 0.050000 0.016667 0.000000 0.933333 0.066667 0.833333 0.066667 0.033333 0.033333 0.966667 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.050000 0.916667 0.016667 0.016667 0.166667 0.000000 0.000000 0.833333 0.083333 0.016667 0.900000 0.000000 0.000000 0.016667 0.016667 0.966667 0.000000 0.016667 0.966667 0.016667 0.116667 0.166667 0.483333 0.233333 0.066667 0.083333 0.050000 0.800000 Consensus sequence: CAGTGCTCCACTGTGBT Reserve complement motif 0.800000 0.083333 0.050000 0.066667 0.116667 0.483333 0.166667 0.233333 0.000000 0.966667 0.016667 0.016667 0.966667 0.016667 0.016667 0.000000 0.083333 0.900000 0.016667 0.000000 0.833333 0.000000 0.000000 0.166667 0.050000 0.016667 0.916667 0.016667 0.000000 0.000000 0.000000 1.000000 0.033333 0.000000 0.966667 0.000000 0.066667 0.066667 0.833333 0.033333 0.933333 0.016667 0.000000 0.050000 0.016667 0.000000 0.966667 0.016667 0.050000 0.833333 0.000000 0.116667 0.850000 0.033333 0.066667 0.050000 0.166667 0.633333 0.116667 0.083333 0.150000 0.150000 0.050000 0.650000 0.150000 0.016667 0.700000 0.133333 Consensus sequence: ABCACAGTGGAGCACTG ************************************************************************ Best Matches for Motif ID 20 (Highest to Lowest) ************************************************************************ Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 16 CTCF Original Motif Reverse Complement Backward 1 17 0.095705 Original motif 0.095290 0.318729 0.083242 0.502738 0.182913 0.158817 0.453450 0.204819 0.307777 0.053669 0.491785 0.146769 0.061336 0.876232 0.023001 0.039430 0.008762 0.989047 0.000000 0.002191 0.814896 0.014239 0.071194 0.099671 0.043812 0.578313 0.365827 0.012048 0.117325 0.474781 0.052632 0.355263 0.933114 0.012061 0.035088 0.019737 0.005488 0.000000 0.991218 0.003293 0.365532 0.003293 0.621295 0.009879 0.059276 0.013172 0.553238 0.374314 0.013187 0.000000 0.978022 0.008791 0.061538 0.008791 0.851648 0.078022 0.114411 0.806381 0.005501 0.073707 0.409241 0.014301 0.557756 0.018702 0.090308 0.530837 0.338106 0.040749 0.128855 0.354626 0.080396 0.436123 0.442731 0.199339 0.292952 0.064978 Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif 0.064978 0.199339 0.292952 0.442731 0.436123 0.354626 0.080396 0.128855 0.090308 0.338106 0.530837 0.040749 0.409241 0.557756 0.014301 0.018702 0.114411 0.005501 0.806381 0.073707 0.061538 0.851648 0.008791 0.078022 0.013187 0.978022 0.000000 0.008791 0.059276 0.553238 0.013172 0.374314 0.365532 0.621295 0.003293 0.009879 0.005488 0.991218 0.000000 0.003293 0.019737 0.012061 0.035088 0.933114 0.117325 0.052632 0.474781 0.355263 0.043812 0.365827 0.578313 0.012048 0.099671 0.014239 0.071194 0.814896 0.008762 0.000000 0.989047 0.002191 0.061336 0.023001 0.876232 0.039430 0.307777 0.491785 0.053669 0.146769 0.182913 0.453450 0.158817 0.204819 0.502738 0.318729 0.083242 0.095290 Consensus sequence: BMSMGCCYMCTKSTGGMHM Alignment: BMSMGCCYMCTKSTGGMHM --CAGTGCTCCACTGTGBT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 7 REST Reverse Complement Original Motif Forward 2 17 0.097587 Original motif 0.132621 0.109365 0.230044 0.527970 0.036318 0.168441 0.091421 0.703820 0.047589 0.855354 0.031309 0.065748 0.906367 0.018727 0.058677 0.016230 0.021197 0.027431 0.945137 0.006234 0.076012 0.609346 0.201246 0.113396 0.980697 0.004359 0.007472 0.007472 0.001868 0.987547 0.007472 0.003113 0.021793 0.922167 0.012453 0.043587 0.568847 0.125234 0.100935 0.204984 0.136534 0.233791 0.077307 0.552369 0.024314 0.004364 0.966958 0.004364 0.012469 0.003117 0.983167 0.001247 0.877105 0.069869 0.021210 0.031815 0.008125 0.800000 0.145625 0.046250 0.983750 0.005625 0.004375 0.006250 0.026349 0.008156 0.959849 0.005646 0.128688 0.632141 0.114878 0.124294 0.229899 0.019472 0.432161 0.318467 0.133962 0.586792 0.200629 0.078616 0.112579 0.700629 0.023270 0.163522 Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif 0.112579 0.023270 0.700629 0.163522 0.133962 0.200629 0.586792 0.078616 0.229899 0.432161 0.019472 0.318467 0.128688 0.114878 0.632141 0.124294 0.026349 0.959849 0.008156 0.005646 0.006250 0.005625 0.004375 0.983750 0.008125 0.145625 0.800000 0.046250 0.031815 0.069869 0.021210 0.877105 0.012469 0.983167 0.003117 0.001247 0.024314 0.966958 0.004364 0.004364 0.552369 0.233791 0.077307 0.136534 0.204984 0.125234 0.100935 0.568847 0.021793 0.012453 0.922167 0.043587 0.001868 0.007472 0.987547 0.003113 0.007472 0.004359 0.007472 0.980697 0.076012 0.201246 0.609346 0.113396 0.021197 0.945137 0.027431 0.006234 0.016230 0.018727 0.058677 0.906367 0.047589 0.031309 0.855354 0.065748 0.703820 0.168441 0.091421 0.036318 0.527970 0.109365 0.230044 0.132621 Consensus sequence: GGYGCTGTCCATGGTGCTGAA Alignment: TTCAGCACCATGGACAGCKCC -ABCACAGTGGAGCACTG--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 17 TgTGgTGTCACAGTGCTCC Original Motif Original Motif Backward 3 17 0.098087 Original motif 0.111111 0.083333 0.055556 0.750000 0.125000 0.097222 0.652778 0.125000 0.041667 0.097222 0.027778 0.833333 0.027778 0.027778 0.791667 0.152778 0.055556 0.166667 0.652778 0.125000 0.000000 0.041667 0.013889 0.944444 0.041667 0.000000 0.888889 0.069444 0.027778 0.027778 0.000000 0.944444 0.041667 0.944444 0.013889 0.000000 0.916667 0.027778 0.000000 0.055556 0.069444 0.875000 0.000000 0.055556 0.833333 0.013889 0.013889 0.138889 0.041667 0.069444 0.819444 0.069444 0.027778 0.027778 0.027778 0.916667 0.069444 0.013889 0.847222 0.069444 0.069444 0.777778 0.027778 0.125000 0.055556 0.041667 0.027778 0.875000 0.041667 0.708333 0.125000 0.125000 0.111111 0.819444 0.055556 0.013889 Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif 0.111111 0.055556 0.819444 0.013889 0.041667 0.125000 0.708333 0.125000 0.875000 0.041667 0.027778 0.055556 0.069444 0.027778 0.777778 0.125000 0.069444 0.847222 0.013889 0.069444 0.916667 0.027778 0.027778 0.027778 0.041667 0.819444 0.069444 0.069444 0.138889 0.013889 0.013889 0.833333 0.069444 0.000000 0.875000 0.055556 0.055556 0.027778 0.000000 0.916667 0.041667 0.013889 0.944444 0.000000 0.944444 0.027778 0.000000 0.027778 0.041667 0.888889 0.000000 0.069444 0.944444 0.041667 0.013889 0.000000 0.055556 0.652778 0.166667 0.125000 0.027778 0.791667 0.027778 0.152778 0.833333 0.097222 0.027778 0.041667 0.125000 0.652778 0.097222 0.125000 0.750000 0.083333 0.055556 0.111111 Consensus sequence: GGAGCACTGTGACACCACA Alignment: TGTGGTGTCACAGTGCTCC CAGTGCTCCACTGTGBT-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 27 AgTGCTCCACTGTGgTGTCACAgT Reverse Complement Original Motif Backward 3 17 0.099784 Original motif 0.690141 0.126761 0.042254 0.140845 0.169014 0.098592 0.676056 0.056338 0.042254 0.028169 0.028169 0.901408 0.056338 0.000000 0.774648 0.169014 0.042254 0.887324 0.042254 0.028169 0.000000 0.014085 0.000000 0.985915 0.056338 0.830986 0.042254 0.070423 0.028169 0.957746 0.014085 0.000000 0.957746 0.000000 0.014085 0.028169 0.084507 0.845070 0.014085 0.056338 0.028169 0.014085 0.000000 0.957746 0.140845 0.028169 0.802817 0.028169 0.014085 0.014085 0.014085 0.957746 0.014085 0.000000 0.929577 0.056338 0.056338 0.154930 0.619718 0.169014 0.014085 0.028169 0.000000 0.957746 0.056338 0.014085 0.873239 0.056338 0.014085 0.000000 0.000000 0.985915 0.042254 0.929577 0.000000 0.028169 0.957746 0.028169 0.000000 0.014085 0.028169 0.845070 0.028169 0.098592 0.873239 0.014085 0.042254 0.070423 0.098592 0.154930 0.563380 0.183099 0.070423 0.014085 0.112676 0.802817 Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif 0.802817 0.014085 0.112676 0.070423 0.098592 0.563380 0.154930 0.183099 0.070423 0.014085 0.042254 0.873239 0.028169 0.028169 0.845070 0.098592 0.014085 0.028169 0.000000 0.957746 0.042254 0.000000 0.929577 0.028169 0.985915 0.000000 0.000000 0.014085 0.056338 0.873239 0.014085 0.056338 0.957746 0.028169 0.000000 0.014085 0.056338 0.619718 0.154930 0.169014 0.014085 0.929577 0.000000 0.056338 0.957746 0.014085 0.014085 0.014085 0.140845 0.802817 0.028169 0.028169 0.957746 0.014085 0.000000 0.028169 0.084507 0.014085 0.845070 0.056338 0.028169 0.000000 0.014085 0.957746 0.028169 0.014085 0.957746 0.000000 0.056338 0.042254 0.830986 0.070423 0.985915 0.014085 0.000000 0.000000 0.042254 0.042254 0.887324 0.028169 0.056338 0.774648 0.000000 0.169014 0.901408 0.028169 0.028169 0.042254 0.169014 0.676056 0.098592 0.056338 0.140845 0.126761 0.042254 0.690141 Consensus sequence: ACTGTGACACCACAGTGGAGCACT Alignment: AGTGCTCCACTGTGGTGTCACAGT -----ABCACAGTGGAGCACTG-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 22 CACTGTGrYrtCACAGTGswsCAcT Reverse Complement Reverse Complement Forward 6 17 0.104226 Original motif 0.111111 0.746032 0.063492 0.079365 0.857143 0.047619 0.047619 0.047619 0.047619 0.857143 0.079365 0.015873 0.031746 0.000000 0.000000 0.968254 0.031746 0.015873 0.904762 0.047619 0.000000 0.000000 0.000000 1.000000 0.031746 0.000000 0.857143 0.111111 0.396825 0.111111 0.412698 0.079365 0.031746 0.253968 0.015873 0.698413 0.365079 0.000000 0.634921 0.000000 0.079365 0.206349 0.047619 0.666667 0.047619 0.936508 0.015873 0.000000 0.952381 0.000000 0.015873 0.031746 0.015873 0.920635 0.000000 0.063492 0.920635 0.000000 0.000000 0.079365 0.063492 0.047619 0.841270 0.047619 0.000000 0.000000 0.015873 0.984127 0.047619 0.015873 0.904762 0.031746 0.015873 0.603175 0.317460 0.063492 0.396825 0.000000 0.015873 0.587302 0.015873 0.476190 0.428571 0.079365 0.063492 0.920635 0.000000 0.015873 0.920635 0.015873 0.047619 0.015873 0.095238 0.682540 0.095238 0.126984 0.047619 0.015873 0.095238 0.841270 Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif 0.841270 0.015873 0.095238 0.047619 0.095238 0.095238 0.682540 0.126984 0.015873 0.015873 0.047619 0.920635 0.063492 0.000000 0.920635 0.015873 0.015873 0.428571 0.476190 0.079365 0.587302 0.000000 0.015873 0.396825 0.015873 0.317460 0.603175 0.063492 0.047619 0.904762 0.015873 0.031746 0.984127 0.000000 0.015873 0.000000 0.063492 0.841270 0.047619 0.047619 0.079365 0.000000 0.000000 0.920635 0.015873 0.000000 0.920635 0.063492 0.031746 0.000000 0.015873 0.952381 0.047619 0.015873 0.936508 0.000000 0.666667 0.206349 0.047619 0.079365 0.365079 0.634921 0.000000 0.000000 0.698413 0.253968 0.015873 0.031746 0.396825 0.412698 0.111111 0.079365 0.031746 0.857143 0.000000 0.111111 1.000000 0.000000 0.000000 0.000000 0.031746 0.904762 0.015873 0.047619 0.968254 0.000000 0.000000 0.031746 0.047619 0.079365 0.857143 0.015873 0.047619 0.047619 0.047619 0.857143 0.111111 0.063492 0.746032 0.079365 Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG Alignment: AGTGSWSCACTGTGAMAMCACAGTG -----ABCACAGTGGAGCACTG--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 23 TGGAGCACTGTGACAcCACAGTGg Reverse Complement Original Motif Backward 5 17 0.107548 Original motif 0.054054 0.040541 0.054054 0.851351 0.040541 0.013514 0.824324 0.121622 0.094595 0.135135 0.756757 0.013514 0.891892 0.000000 0.000000 0.108108 0.040541 0.094595 0.810811 0.054054 0.081081 0.797297 0.054054 0.067568 0.932432 0.027027 0.000000 0.040541 0.054054 0.756757 0.135135 0.054054 0.108108 0.027027 0.013514 0.851351 0.108108 0.000000 0.851351 0.040541 0.013514 0.000000 0.027027 0.959459 0.000000 0.013514 0.945946 0.040541 0.905405 0.000000 0.067568 0.027027 0.054054 0.837838 0.000000 0.108108 0.945946 0.013514 0.040541 0.000000 0.162162 0.500000 0.189189 0.148649 0.108108 0.824324 0.000000 0.067568 0.945946 0.000000 0.040541 0.013514 0.081081 0.837838 0.027027 0.054054 0.945946 0.000000 0.013514 0.040541 0.054054 0.067568 0.783784 0.094595 0.054054 0.027027 0.000000 0.918919 0.040541 0.013514 0.864865 0.081081 0.148649 0.121622 0.675676 0.054054 Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif 0.148649 0.675676 0.121622 0.054054 0.040541 0.864865 0.013514 0.081081 0.918919 0.027027 0.000000 0.054054 0.054054 0.783784 0.067568 0.094595 0.040541 0.000000 0.013514 0.945946 0.081081 0.027027 0.837838 0.054054 0.013514 0.000000 0.040541 0.945946 0.108108 0.000000 0.824324 0.067568 0.162162 0.189189 0.500000 0.148649 0.000000 0.013514 0.040541 0.945946 0.054054 0.000000 0.837838 0.108108 0.027027 0.000000 0.067568 0.905405 0.000000 0.945946 0.013514 0.040541 0.959459 0.000000 0.027027 0.013514 0.108108 0.851351 0.000000 0.040541 0.851351 0.027027 0.013514 0.108108 0.054054 0.135135 0.756757 0.054054 0.040541 0.027027 0.000000 0.932432 0.081081 0.054054 0.797297 0.067568 0.040541 0.810811 0.094595 0.054054 0.108108 0.000000 0.000000 0.891892 0.094595 0.756757 0.135135 0.013514 0.040541 0.824324 0.013514 0.121622 0.851351 0.040541 0.054054 0.054054 Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA Alignment: TGGAGCACTGTGACAVCACAGTGG ---ABCACAGTGGAGCACTG---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 26 CAcCACAGTGGAGCAct Original Motif Reverse Complement Backward 2 16 0.500000 Original motif 0.078125 0.734375 0.046875 0.140625 0.828125 0.046875 0.078125 0.046875 0.203125 0.484375 0.156250 0.156250 0.015625 0.984375 0.000000 0.000000 0.968750 0.015625 0.015625 0.000000 0.000000 0.906250 0.015625 0.078125 0.859375 0.000000 0.000000 0.140625 0.031250 0.000000 0.906250 0.062500 0.000000 0.015625 0.000000 0.984375 0.000000 0.000000 0.968750 0.031250 0.046875 0.062500 0.812500 0.078125 0.937500 0.015625 0.015625 0.031250 0.015625 0.031250 0.921875 0.031250 0.125000 0.796875 0.000000 0.078125 0.875000 0.046875 0.046875 0.031250 0.093750 0.656250 0.093750 0.156250 0.156250 0.078125 0.109375 0.656250 Consensus sequence: CAHCACAGTGGAGCACT Reverse complement motif 0.656250 0.078125 0.109375 0.156250 0.093750 0.093750 0.656250 0.156250 0.031250 0.046875 0.046875 0.875000 0.125000 0.000000 0.796875 0.078125 0.015625 0.921875 0.031250 0.031250 0.031250 0.015625 0.015625 0.937500 0.046875 0.812500 0.062500 0.078125 0.000000 0.968750 0.000000 0.031250 0.984375 0.015625 0.000000 0.000000 0.031250 0.906250 0.000000 0.062500 0.140625 0.000000 0.000000 0.859375 0.000000 0.015625 0.906250 0.078125 0.000000 0.015625 0.015625 0.968750 0.015625 0.000000 0.984375 0.000000 0.203125 0.156250 0.484375 0.156250 0.046875 0.046875 0.078125 0.828125 0.078125 0.046875 0.734375 0.140625 Consensus sequence: AGTGCTCCACTGTGDTG Alignment: -AGTGCTCCACTGTGDTG CAGTGCTCCACTGTGBT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 21 AmTGTGACACCACAGT Original Motif Original Motif Backward 1 16 0.607943 Original motif 0.703125 0.187500 0.015625 0.093750 0.265625 0.500000 0.125000 0.109375 0.015625 0.046875 0.031250 0.906250 0.078125 0.015625 0.890625 0.015625 0.000000 0.000000 0.000000 1.000000 0.000000 0.031250 0.906250 0.062500 0.953125 0.000000 0.015625 0.031250 0.046875 0.890625 0.000000 0.062500 0.968750 0.000000 0.015625 0.015625 0.109375 0.781250 0.062500 0.046875 0.062500 0.890625 0.000000 0.046875 0.953125 0.000000 0.031250 0.015625 0.031250 0.781250 0.046875 0.140625 0.937500 0.015625 0.031250 0.015625 0.093750 0.078125 0.734375 0.093750 0.031250 0.078125 0.000000 0.890625 Consensus sequence: AMTGTGACACCACAGT Reverse complement motif 0.890625 0.078125 0.000000 0.031250 0.093750 0.734375 0.078125 0.093750 0.015625 0.015625 0.031250 0.937500 0.031250 0.046875 0.781250 0.140625 0.015625 0.000000 0.031250 0.953125 0.062500 0.000000 0.890625 0.046875 0.109375 0.062500 0.781250 0.046875 0.015625 0.000000 0.015625 0.968750 0.046875 0.000000 0.890625 0.062500 0.031250 0.000000 0.015625 0.953125 0.000000 0.906250 0.031250 0.062500 1.000000 0.000000 0.000000 0.000000 0.078125 0.890625 0.015625 0.015625 0.906250 0.046875 0.031250 0.015625 0.265625 0.125000 0.500000 0.109375 0.093750 0.187500 0.015625 0.703125 Consensus sequence: ACTGTGGTGTCACART Alignment: -AMTGTGACACCACAGT CAGTGCTCCACTGTGBT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 15 Tcfcp2l1 Reverse Complement Reverse Complement Backward 2 13 2.106298 Original motif 0.001968 0.925480 0.062715 0.009838 0.069973 0.807513 0.005401 0.117113 0.594508 0.005148 0.275803 0.124540 0.005884 0.023780 0.967149 0.003187 0.175477 0.336270 0.025698 0.462555 0.098385 0.289280 0.062163 0.550171 0.173924 0.397260 0.151174 0.277642 0.357213 0.224939 0.252323 0.165526 0.631540 0.069682 0.190954 0.107824 0.394421 0.051382 0.310497 0.243700 0.003669 0.933219 0.054795 0.008317 0.061719 0.812148 0.002939 0.123194 0.536555 0.007360 0.305937 0.150147 0.012039 0.028993 0.954791 0.004177 Consensus sequence: CCAGYYHVADCCRG Reverse complement motif 0.012039 0.954791 0.028993 0.004177 0.150147 0.007360 0.305937 0.536555 0.061719 0.002939 0.812148 0.123194 0.003669 0.054795 0.933219 0.008317 0.243700 0.051382 0.310497 0.394421 0.107824 0.069682 0.190954 0.631540 0.165526 0.224939 0.252323 0.357213 0.173924 0.151174 0.397260 0.277642 0.550171 0.289280 0.062163 0.098385 0.462555 0.336270 0.025698 0.175477 0.005884 0.967149 0.023780 0.003187 0.124540 0.005148 0.275803 0.594508 0.069973 0.005401 0.807513 0.117113 0.001968 0.062715 0.925480 0.009838 Consensus sequence: CKGGDTBDMMCTGG Alignment: ----CKGGDTBDMMCTGG ABCACAGTGGAGCACTG- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 25 wwCCAmAGTCmt Reverse Complement Reverse Complement Forward 1 12 2.583076 Original motif 0.454545 0.045455 0.227273 0.272727 0.363636 0.136364 0.136364 0.363636 0.000000 1.000000 0.000000 0.000000 0.000000 0.954545 0.045455 0.000000 1.000000 0.000000 0.000000 0.000000 0.409091 0.590909 0.000000 0.000000 0.909091 0.045455 0.045455 0.000000 0.000000 0.000000 1.000000 0.000000 0.045455 0.000000 0.000000 0.954545 0.045455 0.909091 0.000000 0.045455 0.272727 0.318182 0.181818 0.227273 0.181818 0.227273 0.227273 0.363636 Consensus sequence: DDCCAMAGTCHB Reverse complement motif 0.363636 0.227273 0.227273 0.181818 0.272727 0.181818 0.318182 0.227273 0.045455 0.000000 0.909091 0.045455 0.954545 0.000000 0.000000 0.045455 0.000000 1.000000 0.000000 0.000000 0.000000 0.045455 0.045455 0.909091 0.409091 0.000000 0.590909 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.045455 0.954545 0.000000 0.000000 0.000000 1.000000 0.000000 0.363636 0.136364 0.136364 0.363636 0.272727 0.045455 0.227273 0.454545 Consensus sequence: VDGACTRTGGDD Alignment: VDGACTRTGGDD----- ABCACAGTGGAGCACTG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 2 Motif ID: 21 Motif name: AmTGTGACACCACAGT Original motif 0.703125 0.187500 0.015625 0.093750 0.265625 0.500000 0.125000 0.109375 0.015625 0.046875 0.031250 0.906250 0.078125 0.015625 0.890625 0.015625 0.000000 0.000000 0.000000 1.000000 0.000000 0.031250 0.906250 0.062500 0.953125 0.000000 0.015625 0.031250 0.046875 0.890625 0.000000 0.062500 0.968750 0.000000 0.015625 0.015625 0.109375 0.781250 0.062500 0.046875 0.062500 0.890625 0.000000 0.046875 0.953125 0.000000 0.031250 0.015625 0.031250 0.781250 0.046875 0.140625 0.937500 0.015625 0.031250 0.015625 0.093750 0.078125 0.734375 0.093750 0.031250 0.078125 0.000000 0.890625 Consensus sequence: AMTGTGACACCACAGT Reserve complement motif 0.890625 0.078125 0.000000 0.031250 0.093750 0.734375 0.078125 0.093750 0.015625 0.015625 0.031250 0.937500 0.031250 0.046875 0.781250 0.140625 0.015625 0.000000 0.031250 0.953125 0.062500 0.000000 0.890625 0.046875 0.109375 0.062500 0.781250 0.046875 0.015625 0.000000 0.015625 0.968750 0.046875 0.000000 0.890625 0.062500 0.031250 0.000000 0.015625 0.953125 0.000000 0.906250 0.031250 0.062500 1.000000 0.000000 0.000000 0.000000 0.078125 0.890625 0.015625 0.015625 0.906250 0.046875 0.031250 0.015625 0.265625 0.125000 0.500000 0.109375 0.093750 0.187500 0.015625 0.703125 Consensus sequence: ACTGTGGTGTCACART ************************************************************************ Best Matches for Motif ID 21 (Highest to Lowest) ************************************************************************ Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 27 AgTGCTCCACTGTGgTGTCACAgT Original Motif Reverse Complement Forward 1 16 0.000000 Original motif 0.690141 0.126761 0.042254 0.140845 0.169014 0.098592 0.676056 0.056338 0.042254 0.028169 0.028169 0.901408 0.056338 0.000000 0.774648 0.169014 0.042254 0.887324 0.042254 0.028169 0.000000 0.014085 0.000000 0.985915 0.056338 0.830986 0.042254 0.070423 0.028169 0.957746 0.014085 0.000000 0.957746 0.000000 0.014085 0.028169 0.084507 0.845070 0.014085 0.056338 0.028169 0.014085 0.000000 0.957746 0.140845 0.028169 0.802817 0.028169 0.014085 0.014085 0.014085 0.957746 0.014085 0.000000 0.929577 0.056338 0.056338 0.154930 0.619718 0.169014 0.014085 0.028169 0.000000 0.957746 0.056338 0.014085 0.873239 0.056338 0.014085 0.000000 0.000000 0.985915 0.042254 0.929577 0.000000 0.028169 0.957746 0.028169 0.000000 0.014085 0.028169 0.845070 0.028169 0.098592 0.873239 0.014085 0.042254 0.070423 0.098592 0.154930 0.563380 0.183099 0.070423 0.014085 0.112676 0.802817 Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif 0.802817 0.014085 0.112676 0.070423 0.098592 0.563380 0.154930 0.183099 0.070423 0.014085 0.042254 0.873239 0.028169 0.028169 0.845070 0.098592 0.014085 0.028169 0.000000 0.957746 0.042254 0.000000 0.929577 0.028169 0.985915 0.000000 0.000000 0.014085 0.056338 0.873239 0.014085 0.056338 0.957746 0.028169 0.000000 0.014085 0.056338 0.619718 0.154930 0.169014 0.014085 0.929577 0.000000 0.056338 0.957746 0.014085 0.014085 0.014085 0.140845 0.802817 0.028169 0.028169 0.957746 0.014085 0.000000 0.028169 0.084507 0.014085 0.845070 0.056338 0.028169 0.000000 0.014085 0.957746 0.028169 0.014085 0.957746 0.000000 0.056338 0.042254 0.830986 0.070423 0.985915 0.014085 0.000000 0.000000 0.042254 0.042254 0.887324 0.028169 0.056338 0.774648 0.000000 0.169014 0.901408 0.028169 0.028169 0.042254 0.169014 0.676056 0.098592 0.056338 0.140845 0.126761 0.042254 0.690141 Consensus sequence: ACTGTGACACCACAGTGGAGCACT Alignment: ACTGTGACACCACAGTGGAGCACT AMTGTGACACCACAGT-------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 23 TGGAGCACTGTGACAcCACAGTGg Reverse Complement Reverse Complement Forward 3 16 0.001718 Original motif 0.054054 0.040541 0.054054 0.851351 0.040541 0.013514 0.824324 0.121622 0.094595 0.135135 0.756757 0.013514 0.891892 0.000000 0.000000 0.108108 0.040541 0.094595 0.810811 0.054054 0.081081 0.797297 0.054054 0.067568 0.932432 0.027027 0.000000 0.040541 0.054054 0.756757 0.135135 0.054054 0.108108 0.027027 0.013514 0.851351 0.108108 0.000000 0.851351 0.040541 0.013514 0.000000 0.027027 0.959459 0.000000 0.013514 0.945946 0.040541 0.905405 0.000000 0.067568 0.027027 0.054054 0.837838 0.000000 0.108108 0.945946 0.013514 0.040541 0.000000 0.162162 0.500000 0.189189 0.148649 0.108108 0.824324 0.000000 0.067568 0.945946 0.000000 0.040541 0.013514 0.081081 0.837838 0.027027 0.054054 0.945946 0.000000 0.013514 0.040541 0.054054 0.067568 0.783784 0.094595 0.054054 0.027027 0.000000 0.918919 0.040541 0.013514 0.864865 0.081081 0.148649 0.121622 0.675676 0.054054 Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif 0.148649 0.675676 0.121622 0.054054 0.040541 0.864865 0.013514 0.081081 0.918919 0.027027 0.000000 0.054054 0.054054 0.783784 0.067568 0.094595 0.040541 0.000000 0.013514 0.945946 0.081081 0.027027 0.837838 0.054054 0.013514 0.000000 0.040541 0.945946 0.108108 0.000000 0.824324 0.067568 0.162162 0.189189 0.500000 0.148649 0.000000 0.013514 0.040541 0.945946 0.054054 0.000000 0.837838 0.108108 0.027027 0.000000 0.067568 0.905405 0.000000 0.945946 0.013514 0.040541 0.959459 0.000000 0.027027 0.013514 0.108108 0.851351 0.000000 0.040541 0.851351 0.027027 0.013514 0.108108 0.054054 0.135135 0.756757 0.054054 0.040541 0.027027 0.000000 0.932432 0.081081 0.054054 0.797297 0.067568 0.040541 0.810811 0.094595 0.054054 0.108108 0.000000 0.000000 0.891892 0.094595 0.756757 0.135135 0.013514 0.040541 0.824324 0.013514 0.121622 0.851351 0.040541 0.054054 0.054054 Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA Alignment: CCACTGTGVTGTCACAGTGCTCCA --ACTGTGGTGTCACART------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 22 CACTGTGrYrtCACAGTGswsCAcT Reverse Complement Original Motif Forward 2 16 0.019728 Original motif 0.111111 0.746032 0.063492 0.079365 0.857143 0.047619 0.047619 0.047619 0.047619 0.857143 0.079365 0.015873 0.031746 0.000000 0.000000 0.968254 0.031746 0.015873 0.904762 0.047619 0.000000 0.000000 0.000000 1.000000 0.031746 0.000000 0.857143 0.111111 0.396825 0.111111 0.412698 0.079365 0.031746 0.253968 0.015873 0.698413 0.365079 0.000000 0.634921 0.000000 0.079365 0.206349 0.047619 0.666667 0.047619 0.936508 0.015873 0.000000 0.952381 0.000000 0.015873 0.031746 0.015873 0.920635 0.000000 0.063492 0.920635 0.000000 0.000000 0.079365 0.063492 0.047619 0.841270 0.047619 0.000000 0.000000 0.015873 0.984127 0.047619 0.015873 0.904762 0.031746 0.015873 0.603175 0.317460 0.063492 0.396825 0.000000 0.015873 0.587302 0.015873 0.476190 0.428571 0.079365 0.063492 0.920635 0.000000 0.015873 0.920635 0.015873 0.047619 0.015873 0.095238 0.682540 0.095238 0.126984 0.047619 0.015873 0.095238 0.841270 Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif 0.841270 0.015873 0.095238 0.047619 0.095238 0.095238 0.682540 0.126984 0.015873 0.015873 0.047619 0.920635 0.063492 0.000000 0.920635 0.015873 0.015873 0.428571 0.476190 0.079365 0.587302 0.000000 0.015873 0.396825 0.015873 0.317460 0.603175 0.063492 0.047619 0.904762 0.015873 0.031746 0.984127 0.000000 0.015873 0.000000 0.063492 0.841270 0.047619 0.047619 0.079365 0.000000 0.000000 0.920635 0.015873 0.000000 0.920635 0.063492 0.031746 0.000000 0.015873 0.952381 0.047619 0.015873 0.936508 0.000000 0.666667 0.206349 0.047619 0.079365 0.365079 0.634921 0.000000 0.000000 0.698413 0.253968 0.015873 0.031746 0.396825 0.412698 0.111111 0.079365 0.031746 0.857143 0.000000 0.111111 1.000000 0.000000 0.000000 0.000000 0.031746 0.904762 0.015873 0.047619 0.968254 0.000000 0.000000 0.031746 0.047619 0.079365 0.857143 0.015873 0.047619 0.047619 0.047619 0.857143 0.111111 0.063492 0.746032 0.079365 Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG Alignment: CACTGTGRTRTCACAGTGSWSCACT -ACTGTGGTGTCACART-------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 17 TgTGgTGTCACAGTGCTCC Reverse Complement Reverse Complement Backward 4 16 0.095094 Original motif 0.111111 0.083333 0.055556 0.750000 0.125000 0.097222 0.652778 0.125000 0.041667 0.097222 0.027778 0.833333 0.027778 0.027778 0.791667 0.152778 0.055556 0.166667 0.652778 0.125000 0.000000 0.041667 0.013889 0.944444 0.041667 0.000000 0.888889 0.069444 0.027778 0.027778 0.000000 0.944444 0.041667 0.944444 0.013889 0.000000 0.916667 0.027778 0.000000 0.055556 0.069444 0.875000 0.000000 0.055556 0.833333 0.013889 0.013889 0.138889 0.041667 0.069444 0.819444 0.069444 0.027778 0.027778 0.027778 0.916667 0.069444 0.013889 0.847222 0.069444 0.069444 0.777778 0.027778 0.125000 0.055556 0.041667 0.027778 0.875000 0.041667 0.708333 0.125000 0.125000 0.111111 0.819444 0.055556 0.013889 Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif 0.111111 0.055556 0.819444 0.013889 0.041667 0.125000 0.708333 0.125000 0.875000 0.041667 0.027778 0.055556 0.069444 0.027778 0.777778 0.125000 0.069444 0.847222 0.013889 0.069444 0.916667 0.027778 0.027778 0.027778 0.041667 0.819444 0.069444 0.069444 0.138889 0.013889 0.013889 0.833333 0.069444 0.000000 0.875000 0.055556 0.055556 0.027778 0.000000 0.916667 0.041667 0.013889 0.944444 0.000000 0.944444 0.027778 0.000000 0.027778 0.041667 0.888889 0.000000 0.069444 0.944444 0.041667 0.013889 0.000000 0.055556 0.652778 0.166667 0.125000 0.027778 0.791667 0.027778 0.152778 0.833333 0.097222 0.027778 0.041667 0.125000 0.652778 0.097222 0.125000 0.750000 0.083333 0.055556 0.111111 Consensus sequence: GGAGCACTGTGACACCACA Alignment: GGAGCACTGTGACACCACA ACTGTGGTGTCACART--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 20 CagTGCTCCACTGTGgT Original Motif Original Motif Backward 1 16 0.098897 Original motif 0.150000 0.700000 0.016667 0.133333 0.650000 0.150000 0.050000 0.150000 0.166667 0.116667 0.633333 0.083333 0.050000 0.033333 0.066667 0.850000 0.050000 0.000000 0.833333 0.116667 0.016667 0.966667 0.000000 0.016667 0.050000 0.016667 0.000000 0.933333 0.066667 0.833333 0.066667 0.033333 0.033333 0.966667 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.050000 0.916667 0.016667 0.016667 0.166667 0.000000 0.000000 0.833333 0.083333 0.016667 0.900000 0.000000 0.000000 0.016667 0.016667 0.966667 0.000000 0.016667 0.966667 0.016667 0.116667 0.166667 0.483333 0.233333 0.066667 0.083333 0.050000 0.800000 Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif 0.800000 0.083333 0.050000 0.066667 0.116667 0.483333 0.166667 0.233333 0.000000 0.966667 0.016667 0.016667 0.966667 0.016667 0.016667 0.000000 0.083333 0.900000 0.016667 0.000000 0.833333 0.000000 0.000000 0.166667 0.050000 0.016667 0.916667 0.016667 0.000000 0.000000 0.000000 1.000000 0.033333 0.000000 0.966667 0.000000 0.066667 0.066667 0.833333 0.033333 0.933333 0.016667 0.000000 0.050000 0.016667 0.000000 0.966667 0.016667 0.050000 0.833333 0.000000 0.116667 0.850000 0.033333 0.066667 0.050000 0.166667 0.633333 0.116667 0.083333 0.150000 0.150000 0.050000 0.650000 0.150000 0.016667 0.700000 0.133333 Consensus sequence: ABCACAGTGGAGCACTG Alignment: CAGTGCTCCACTGTGBT -AMTGTGACACCACAGT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 26 CAcCACAGTGGAGCAct Original Motif Reverse Complement Forward 1 16 0.101875 Original motif 0.078125 0.734375 0.046875 0.140625 0.828125 0.046875 0.078125 0.046875 0.203125 0.484375 0.156250 0.156250 0.015625 0.984375 0.000000 0.000000 0.968750 0.015625 0.015625 0.000000 0.000000 0.906250 0.015625 0.078125 0.859375 0.000000 0.000000 0.140625 0.031250 0.000000 0.906250 0.062500 0.000000 0.015625 0.000000 0.984375 0.000000 0.000000 0.968750 0.031250 0.046875 0.062500 0.812500 0.078125 0.937500 0.015625 0.015625 0.031250 0.015625 0.031250 0.921875 0.031250 0.125000 0.796875 0.000000 0.078125 0.875000 0.046875 0.046875 0.031250 0.093750 0.656250 0.093750 0.156250 0.156250 0.078125 0.109375 0.656250 Consensus sequence: CAHCACAGTGGAGCACT Reverse complement motif 0.656250 0.078125 0.109375 0.156250 0.093750 0.093750 0.656250 0.156250 0.031250 0.046875 0.046875 0.875000 0.125000 0.000000 0.796875 0.078125 0.015625 0.921875 0.031250 0.031250 0.031250 0.015625 0.015625 0.937500 0.046875 0.812500 0.062500 0.078125 0.000000 0.968750 0.000000 0.031250 0.984375 0.015625 0.000000 0.000000 0.031250 0.906250 0.000000 0.062500 0.140625 0.000000 0.000000 0.859375 0.000000 0.015625 0.906250 0.078125 0.000000 0.015625 0.015625 0.968750 0.015625 0.000000 0.984375 0.000000 0.203125 0.156250 0.484375 0.156250 0.046875 0.046875 0.078125 0.828125 0.078125 0.046875 0.734375 0.140625 Consensus sequence: AGTGCTCCACTGTGDTG Alignment: AGTGCTCCACTGTGDTG AMTGTGACACCACAGT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 3 ESR1 Original Motif Reverse Complement Backward 6 15 0.595092 Original motif 0.261242 0.256959 0.329764 0.152034 0.228632 0.170940 0.350427 0.250000 0.136752 0.369658 0.318376 0.175214 0.176596 0.487234 0.138298 0.197872 0.285106 0.493617 0.100000 0.121277 0.651163 0.059197 0.188161 0.101480 0.075949 0.016878 0.816456 0.090717 0.040000 0.037895 0.884211 0.037895 0.069474 0.086316 0.191579 0.652632 0.008421 0.829474 0.111579 0.050526 0.837895 0.027368 0.056842 0.077895 0.122105 0.526316 0.225263 0.126316 0.132632 0.581053 0.111579 0.174737 0.134737 0.543158 0.204211 0.117895 0.067368 0.040000 0.016842 0.875789 0.044211 0.046316 0.896842 0.012632 0.642105 0.223158 0.065263 0.069474 0.021053 0.917895 0.025263 0.035789 0.124211 0.743158 0.004211 0.128421 0.054737 0.347368 0.046316 0.551579 Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif 0.551579 0.347368 0.046316 0.054737 0.124211 0.004211 0.743158 0.128421 0.021053 0.025263 0.917895 0.035789 0.069474 0.223158 0.065263 0.642105 0.044211 0.896842 0.046316 0.012632 0.875789 0.040000 0.016842 0.067368 0.134737 0.204211 0.543158 0.117895 0.132632 0.111579 0.581053 0.174737 0.122105 0.225263 0.526316 0.126316 0.077895 0.027368 0.056842 0.837895 0.008421 0.111579 0.829474 0.050526 0.652632 0.086316 0.191579 0.069474 0.040000 0.884211 0.037895 0.037895 0.075949 0.816456 0.016878 0.090717 0.101480 0.059197 0.188161 0.651163 0.285106 0.100000 0.493617 0.121277 0.176596 0.138298 0.487234 0.197872 0.136752 0.318376 0.369658 0.175214 0.228632 0.350427 0.170940 0.250000 0.261242 0.329764 0.256959 0.152034 Consensus sequence: MGGTCAGGGTGACCTRDBHV Alignment: -MGGTCAGGGTGACCTRDBHV AMTGTGACACCACAGT----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 7 REST Reverse Complement Reverse Complement Backward 8 14 1.101904 Original motif 0.132621 0.109365 0.230044 0.527970 0.036318 0.168441 0.091421 0.703820 0.047589 0.855354 0.031309 0.065748 0.906367 0.018727 0.058677 0.016230 0.021197 0.027431 0.945137 0.006234 0.076012 0.609346 0.201246 0.113396 0.980697 0.004359 0.007472 0.007472 0.001868 0.987547 0.007472 0.003113 0.021793 0.922167 0.012453 0.043587 0.568847 0.125234 0.100935 0.204984 0.136534 0.233791 0.077307 0.552369 0.024314 0.004364 0.966958 0.004364 0.012469 0.003117 0.983167 0.001247 0.877105 0.069869 0.021210 0.031815 0.008125 0.800000 0.145625 0.046250 0.983750 0.005625 0.004375 0.006250 0.026349 0.008156 0.959849 0.005646 0.128688 0.632141 0.114878 0.124294 0.229899 0.019472 0.432161 0.318467 0.133962 0.586792 0.200629 0.078616 0.112579 0.700629 0.023270 0.163522 Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif 0.112579 0.023270 0.700629 0.163522 0.133962 0.200629 0.586792 0.078616 0.229899 0.432161 0.019472 0.318467 0.128688 0.114878 0.632141 0.124294 0.026349 0.959849 0.008156 0.005646 0.006250 0.005625 0.004375 0.983750 0.008125 0.145625 0.800000 0.046250 0.031815 0.069869 0.021210 0.877105 0.012469 0.983167 0.003117 0.001247 0.024314 0.966958 0.004364 0.004364 0.552369 0.233791 0.077307 0.136534 0.204984 0.125234 0.100935 0.568847 0.021793 0.012453 0.922167 0.043587 0.001868 0.007472 0.987547 0.003113 0.007472 0.004359 0.007472 0.980697 0.076012 0.201246 0.609346 0.113396 0.021197 0.945137 0.027431 0.006234 0.016230 0.018727 0.058677 0.906367 0.047589 0.031309 0.855354 0.065748 0.703820 0.168441 0.091421 0.036318 0.527970 0.109365 0.230044 0.132621 Consensus sequence: GGYGCTGTCCATGGTGCTGAA Alignment: --GGYGCTGTCCATGGTGCTGAA ACTGTGGTGTCACART------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 9 ESR2 Original Motif Reverse Complement Backward 7 12 2.077993 Original motif 0.218487 0.450980 0.176471 0.154062 0.442577 0.142857 0.114846 0.299720 0.521008 0.042017 0.431373 0.005602 0.075630 0.000000 0.770308 0.154062 0.050420 0.056022 0.893557 0.000000 0.036415 0.053221 0.092437 0.817927 0.000000 1.000000 0.000000 0.000000 0.943978 0.002801 0.000000 0.053221 0.137255 0.344538 0.316527 0.201681 0.179272 0.176471 0.417367 0.226891 0.145658 0.170868 0.411765 0.271709 0.058824 0.092437 0.067227 0.781513 0.176471 0.070028 0.742297 0.011204 0.498599 0.277311 0.053221 0.170868 0.095238 0.750700 0.005602 0.148459 0.128852 0.809524 0.000000 0.061625 0.075630 0.252101 0.000000 0.672269 0.168067 0.263305 0.380952 0.187675 Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif 0.168067 0.380952 0.263305 0.187675 0.672269 0.252101 0.000000 0.075630 0.128852 0.000000 0.809524 0.061625 0.095238 0.005602 0.750700 0.148459 0.170868 0.277311 0.053221 0.498599 0.176471 0.742297 0.070028 0.011204 0.781513 0.092437 0.067227 0.058824 0.145658 0.411765 0.170868 0.271709 0.179272 0.417367 0.176471 0.226891 0.137255 0.316527 0.344538 0.201681 0.053221 0.002801 0.000000 0.943978 0.000000 0.000000 1.000000 0.000000 0.817927 0.053221 0.092437 0.036415 0.050420 0.893557 0.056022 0.000000 0.075630 0.770308 0.000000 0.154062 0.005602 0.042017 0.431373 0.521008 0.299720 0.142857 0.114846 0.442577 0.218487 0.176471 0.450980 0.154062 Consensus sequence: BAGGYCABHBTGACCKHV Alignment: ----BAGGYCABHBTGACCKHV AMTGTGACACCACAGT------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 10 NR1H2RXRA Original Motif Reverse Complement Backward 6 12 2.102253 Original motif 0.680000 0.200000 0.000000 0.120000 0.680000 0.040000 0.200000 0.080000 0.800000 0.000000 0.200000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.040000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.000000 0.040000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.800000 0.040000 0.080000 0.080000 0.000000 0.600000 0.240000 0.160000 Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif 0.000000 0.240000 0.600000 0.160000 0.080000 0.040000 0.080000 0.800000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.040000 0.000000 0.000000 0.960000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.040000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.200000 0.800000 0.080000 0.040000 0.200000 0.680000 0.120000 0.200000 0.000000 0.680000 Consensus sequence: GTTGACCTTTGACCTTT Alignment: ----GTTGACCTTTGACCTTT AMTGTGACACCACAGT----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 2 Motif ID: 22 Motif name: CACTGTGrYrtCACAGTGswsCAcT Original motif 0.111111 0.746032 0.063492 0.079365 0.857143 0.047619 0.047619 0.047619 0.047619 0.857143 0.079365 0.015873 0.031746 0.000000 0.000000 0.968254 0.031746 0.015873 0.904762 0.047619 0.000000 0.000000 0.000000 1.000000 0.031746 0.000000 0.857143 0.111111 0.396825 0.111111 0.412698 0.079365 0.031746 0.253968 0.015873 0.698413 0.365079 0.000000 0.634921 0.000000 0.079365 0.206349 0.047619 0.666667 0.047619 0.936508 0.015873 0.000000 0.952381 0.000000 0.015873 0.031746 0.015873 0.920635 0.000000 0.063492 0.920635 0.000000 0.000000 0.079365 0.063492 0.047619 0.841270 0.047619 0.000000 0.000000 0.015873 0.984127 0.047619 0.015873 0.904762 0.031746 0.015873 0.603175 0.317460 0.063492 0.396825 0.000000 0.015873 0.587302 0.015873 0.476190 0.428571 0.079365 0.063492 0.920635 0.000000 0.015873 0.920635 0.015873 0.047619 0.015873 0.095238 0.682540 0.095238 0.126984 0.047619 0.015873 0.095238 0.841270 Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reserve complement motif 0.841270 0.015873 0.095238 0.047619 0.095238 0.095238 0.682540 0.126984 0.015873 0.015873 0.047619 0.920635 0.063492 0.000000 0.920635 0.015873 0.015873 0.428571 0.476190 0.079365 0.587302 0.000000 0.015873 0.396825 0.015873 0.317460 0.603175 0.063492 0.047619 0.904762 0.015873 0.031746 0.984127 0.000000 0.015873 0.000000 0.063492 0.841270 0.047619 0.047619 0.079365 0.000000 0.000000 0.920635 0.015873 0.000000 0.920635 0.063492 0.031746 0.000000 0.015873 0.952381 0.047619 0.015873 0.936508 0.000000 0.666667 0.206349 0.047619 0.079365 0.365079 0.634921 0.000000 0.000000 0.698413 0.253968 0.015873 0.031746 0.396825 0.412698 0.111111 0.079365 0.031746 0.857143 0.000000 0.111111 1.000000 0.000000 0.000000 0.000000 0.031746 0.904762 0.015873 0.047619 0.968254 0.000000 0.000000 0.031746 0.047619 0.079365 0.857143 0.015873 0.047619 0.047619 0.047619 0.857143 0.111111 0.063492 0.746032 0.079365 Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG ************************************************************************ Best Matches for Motif ID 22 (Highest to Lowest) ************************************************************************ Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 27 AgTGCTCCACTGTGgTGTCACAgT Original Motif Reverse Complement Backward 1 24 0.024717 Original motif 0.690141 0.126761 0.042254 0.140845 0.169014 0.098592 0.676056 0.056338 0.042254 0.028169 0.028169 0.901408 0.056338 0.000000 0.774648 0.169014 0.042254 0.887324 0.042254 0.028169 0.000000 0.014085 0.000000 0.985915 0.056338 0.830986 0.042254 0.070423 0.028169 0.957746 0.014085 0.000000 0.957746 0.000000 0.014085 0.028169 0.084507 0.845070 0.014085 0.056338 0.028169 0.014085 0.000000 0.957746 0.140845 0.028169 0.802817 0.028169 0.014085 0.014085 0.014085 0.957746 0.014085 0.000000 0.929577 0.056338 0.056338 0.154930 0.619718 0.169014 0.014085 0.028169 0.000000 0.957746 0.056338 0.014085 0.873239 0.056338 0.014085 0.000000 0.000000 0.985915 0.042254 0.929577 0.000000 0.028169 0.957746 0.028169 0.000000 0.014085 0.028169 0.845070 0.028169 0.098592 0.873239 0.014085 0.042254 0.070423 0.098592 0.154930 0.563380 0.183099 0.070423 0.014085 0.112676 0.802817 Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif 0.802817 0.014085 0.112676 0.070423 0.098592 0.563380 0.154930 0.183099 0.070423 0.014085 0.042254 0.873239 0.028169 0.028169 0.845070 0.098592 0.014085 0.028169 0.000000 0.957746 0.042254 0.000000 0.929577 0.028169 0.985915 0.000000 0.000000 0.014085 0.056338 0.873239 0.014085 0.056338 0.957746 0.028169 0.000000 0.014085 0.056338 0.619718 0.154930 0.169014 0.014085 0.929577 0.000000 0.056338 0.957746 0.014085 0.014085 0.014085 0.140845 0.802817 0.028169 0.028169 0.957746 0.014085 0.000000 0.028169 0.084507 0.014085 0.845070 0.056338 0.028169 0.000000 0.014085 0.957746 0.028169 0.014085 0.957746 0.000000 0.056338 0.042254 0.830986 0.070423 0.985915 0.014085 0.000000 0.000000 0.042254 0.042254 0.887324 0.028169 0.056338 0.774648 0.000000 0.169014 0.901408 0.028169 0.028169 0.042254 0.169014 0.676056 0.098592 0.056338 0.140845 0.126761 0.042254 0.690141 Consensus sequence: ACTGTGACACCACAGTGGAGCACT Alignment: -ACTGTGACACCACAGTGGAGCACT CACTGTGRTRTCACAGTGSWSCACT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 23 TGGAGCACTGTGACAcCACAGTGg Reverse Complement Original Motif Backward 2 23 0.500966 Original motif 0.054054 0.040541 0.054054 0.851351 0.040541 0.013514 0.824324 0.121622 0.094595 0.135135 0.756757 0.013514 0.891892 0.000000 0.000000 0.108108 0.040541 0.094595 0.810811 0.054054 0.081081 0.797297 0.054054 0.067568 0.932432 0.027027 0.000000 0.040541 0.054054 0.756757 0.135135 0.054054 0.108108 0.027027 0.013514 0.851351 0.108108 0.000000 0.851351 0.040541 0.013514 0.000000 0.027027 0.959459 0.000000 0.013514 0.945946 0.040541 0.905405 0.000000 0.067568 0.027027 0.054054 0.837838 0.000000 0.108108 0.945946 0.013514 0.040541 0.000000 0.162162 0.500000 0.189189 0.148649 0.108108 0.824324 0.000000 0.067568 0.945946 0.000000 0.040541 0.013514 0.081081 0.837838 0.027027 0.054054 0.945946 0.000000 0.013514 0.040541 0.054054 0.067568 0.783784 0.094595 0.054054 0.027027 0.000000 0.918919 0.040541 0.013514 0.864865 0.081081 0.148649 0.121622 0.675676 0.054054 Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif 0.148649 0.675676 0.121622 0.054054 0.040541 0.864865 0.013514 0.081081 0.918919 0.027027 0.000000 0.054054 0.054054 0.783784 0.067568 0.094595 0.040541 0.000000 0.013514 0.945946 0.081081 0.027027 0.837838 0.054054 0.013514 0.000000 0.040541 0.945946 0.108108 0.000000 0.824324 0.067568 0.162162 0.189189 0.500000 0.148649 0.000000 0.013514 0.040541 0.945946 0.054054 0.000000 0.837838 0.108108 0.027027 0.000000 0.067568 0.905405 0.000000 0.945946 0.013514 0.040541 0.959459 0.000000 0.027027 0.013514 0.108108 0.851351 0.000000 0.040541 0.851351 0.027027 0.013514 0.108108 0.054054 0.135135 0.756757 0.054054 0.040541 0.027027 0.000000 0.932432 0.081081 0.054054 0.797297 0.067568 0.040541 0.810811 0.094595 0.054054 0.108108 0.000000 0.000000 0.891892 0.094595 0.756757 0.135135 0.013514 0.040541 0.824324 0.013514 0.121622 0.851351 0.040541 0.054054 0.054054 Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA Alignment: --TGGAGCACTGTGACAVCACAGTGG AGTGSWSCACTGTGAMAMCACAGTG- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 3 ESR1 Original Motif Reverse Complement Forward 3 18 3.082459 Original motif 0.261242 0.256959 0.329764 0.152034 0.228632 0.170940 0.350427 0.250000 0.136752 0.369658 0.318376 0.175214 0.176596 0.487234 0.138298 0.197872 0.285106 0.493617 0.100000 0.121277 0.651163 0.059197 0.188161 0.101480 0.075949 0.016878 0.816456 0.090717 0.040000 0.037895 0.884211 0.037895 0.069474 0.086316 0.191579 0.652632 0.008421 0.829474 0.111579 0.050526 0.837895 0.027368 0.056842 0.077895 0.122105 0.526316 0.225263 0.126316 0.132632 0.581053 0.111579 0.174737 0.134737 0.543158 0.204211 0.117895 0.067368 0.040000 0.016842 0.875789 0.044211 0.046316 0.896842 0.012632 0.642105 0.223158 0.065263 0.069474 0.021053 0.917895 0.025263 0.035789 0.124211 0.743158 0.004211 0.128421 0.054737 0.347368 0.046316 0.551579 Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif 0.551579 0.347368 0.046316 0.054737 0.124211 0.004211 0.743158 0.128421 0.021053 0.025263 0.917895 0.035789 0.069474 0.223158 0.065263 0.642105 0.044211 0.896842 0.046316 0.012632 0.875789 0.040000 0.016842 0.067368 0.134737 0.204211 0.543158 0.117895 0.132632 0.111579 0.581053 0.174737 0.122105 0.225263 0.526316 0.126316 0.077895 0.027368 0.056842 0.837895 0.008421 0.111579 0.829474 0.050526 0.652632 0.086316 0.191579 0.069474 0.040000 0.884211 0.037895 0.037895 0.075949 0.816456 0.016878 0.090717 0.101480 0.059197 0.188161 0.651163 0.285106 0.100000 0.493617 0.121277 0.176596 0.138298 0.487234 0.197872 0.136752 0.318376 0.369658 0.175214 0.228632 0.350427 0.170940 0.250000 0.261242 0.329764 0.256959 0.152034 Consensus sequence: MGGTCAGGGTGACCTRDBHV Alignment: MGGTCAGGGTGACCTRDBHV------- --CACTGTGRTRTCACAGTGSWSCACT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 16 CTCF Reverse Complement Reverse Complement Forward 2 18 3.088421 Original motif 0.095290 0.318729 0.083242 0.502738 0.182913 0.158817 0.453450 0.204819 0.307777 0.053669 0.491785 0.146769 0.061336 0.876232 0.023001 0.039430 0.008762 0.989047 0.000000 0.002191 0.814896 0.014239 0.071194 0.099671 0.043812 0.578313 0.365827 0.012048 0.117325 0.474781 0.052632 0.355263 0.933114 0.012061 0.035088 0.019737 0.005488 0.000000 0.991218 0.003293 0.365532 0.003293 0.621295 0.009879 0.059276 0.013172 0.553238 0.374314 0.013187 0.000000 0.978022 0.008791 0.061538 0.008791 0.851648 0.078022 0.114411 0.806381 0.005501 0.073707 0.409241 0.014301 0.557756 0.018702 0.090308 0.530837 0.338106 0.040749 0.128855 0.354626 0.080396 0.436123 0.442731 0.199339 0.292952 0.064978 Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif 0.064978 0.199339 0.292952 0.442731 0.436123 0.354626 0.080396 0.128855 0.090308 0.338106 0.530837 0.040749 0.409241 0.557756 0.014301 0.018702 0.114411 0.005501 0.806381 0.073707 0.061538 0.851648 0.008791 0.078022 0.013187 0.978022 0.000000 0.008791 0.059276 0.553238 0.013172 0.374314 0.365532 0.621295 0.003293 0.009879 0.005488 0.991218 0.000000 0.003293 0.019737 0.012061 0.035088 0.933114 0.117325 0.052632 0.474781 0.355263 0.043812 0.365827 0.578313 0.012048 0.099671 0.014239 0.071194 0.814896 0.008762 0.000000 0.989047 0.002191 0.061336 0.023001 0.876232 0.039430 0.307777 0.491785 0.053669 0.146769 0.182913 0.453450 0.158817 0.204819 0.502738 0.318729 0.083242 0.095290 Consensus sequence: BMSMGCCYMCTKSTGGMHM Alignment: BMSMGCCYMCTKSTGGMHM------- -AGTGSWSCACTGTGAMAMCACAGTG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 17 TgTGgTGTCACAGTGCTCC Original Motif Reverse Complement Forward 2 18 3.089842 Original motif 0.111111 0.083333 0.055556 0.750000 0.125000 0.097222 0.652778 0.125000 0.041667 0.097222 0.027778 0.833333 0.027778 0.027778 0.791667 0.152778 0.055556 0.166667 0.652778 0.125000 0.000000 0.041667 0.013889 0.944444 0.041667 0.000000 0.888889 0.069444 0.027778 0.027778 0.000000 0.944444 0.041667 0.944444 0.013889 0.000000 0.916667 0.027778 0.000000 0.055556 0.069444 0.875000 0.000000 0.055556 0.833333 0.013889 0.013889 0.138889 0.041667 0.069444 0.819444 0.069444 0.027778 0.027778 0.027778 0.916667 0.069444 0.013889 0.847222 0.069444 0.069444 0.777778 0.027778 0.125000 0.055556 0.041667 0.027778 0.875000 0.041667 0.708333 0.125000 0.125000 0.111111 0.819444 0.055556 0.013889 Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif 0.111111 0.055556 0.819444 0.013889 0.041667 0.125000 0.708333 0.125000 0.875000 0.041667 0.027778 0.055556 0.069444 0.027778 0.777778 0.125000 0.069444 0.847222 0.013889 0.069444 0.916667 0.027778 0.027778 0.027778 0.041667 0.819444 0.069444 0.069444 0.138889 0.013889 0.013889 0.833333 0.069444 0.000000 0.875000 0.055556 0.055556 0.027778 0.000000 0.916667 0.041667 0.013889 0.944444 0.000000 0.944444 0.027778 0.000000 0.027778 0.041667 0.888889 0.000000 0.069444 0.944444 0.041667 0.013889 0.000000 0.055556 0.652778 0.166667 0.125000 0.027778 0.791667 0.027778 0.152778 0.833333 0.097222 0.027778 0.041667 0.125000 0.652778 0.097222 0.125000 0.750000 0.083333 0.055556 0.111111 Consensus sequence: GGAGCACTGTGACACCACA Alignment: GGAGCACTGTGACACCACA------- -CACTGTGRTRTCACAGTGSWSCACT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 26 CAcCACAGTGGAGCAct Original Motif Original Motif Backward 1 17 3.524494 Original motif 0.078125 0.734375 0.046875 0.140625 0.828125 0.046875 0.078125 0.046875 0.203125 0.484375 0.156250 0.156250 0.015625 0.984375 0.000000 0.000000 0.968750 0.015625 0.015625 0.000000 0.000000 0.906250 0.015625 0.078125 0.859375 0.000000 0.000000 0.140625 0.031250 0.000000 0.906250 0.062500 0.000000 0.015625 0.000000 0.984375 0.000000 0.000000 0.968750 0.031250 0.046875 0.062500 0.812500 0.078125 0.937500 0.015625 0.015625 0.031250 0.015625 0.031250 0.921875 0.031250 0.125000 0.796875 0.000000 0.078125 0.875000 0.046875 0.046875 0.031250 0.093750 0.656250 0.093750 0.156250 0.156250 0.078125 0.109375 0.656250 Consensus sequence: CAHCACAGTGGAGCACT Reverse complement motif 0.656250 0.078125 0.109375 0.156250 0.093750 0.093750 0.656250 0.156250 0.031250 0.046875 0.046875 0.875000 0.125000 0.000000 0.796875 0.078125 0.015625 0.921875 0.031250 0.031250 0.031250 0.015625 0.015625 0.937500 0.046875 0.812500 0.062500 0.078125 0.000000 0.968750 0.000000 0.031250 0.984375 0.015625 0.000000 0.000000 0.031250 0.906250 0.000000 0.062500 0.140625 0.000000 0.000000 0.859375 0.000000 0.015625 0.906250 0.078125 0.000000 0.015625 0.015625 0.968750 0.015625 0.000000 0.984375 0.000000 0.203125 0.156250 0.484375 0.156250 0.046875 0.046875 0.078125 0.828125 0.078125 0.046875 0.734375 0.140625 Consensus sequence: AGTGCTCCACTGTGDTG Alignment: --------CAHCACAGTGGAGCACT CACTGTGRTRTCACAGTGSWSCACT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 20 CagTGCTCCACTGTGgT Reverse Complement Original Motif Backward 2 16 4.022653 Original motif 0.150000 0.700000 0.016667 0.133333 0.650000 0.150000 0.050000 0.150000 0.166667 0.116667 0.633333 0.083333 0.050000 0.033333 0.066667 0.850000 0.050000 0.000000 0.833333 0.116667 0.016667 0.966667 0.000000 0.016667 0.050000 0.016667 0.000000 0.933333 0.066667 0.833333 0.066667 0.033333 0.033333 0.966667 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.050000 0.916667 0.016667 0.016667 0.166667 0.000000 0.000000 0.833333 0.083333 0.016667 0.900000 0.000000 0.000000 0.016667 0.016667 0.966667 0.000000 0.016667 0.966667 0.016667 0.116667 0.166667 0.483333 0.233333 0.066667 0.083333 0.050000 0.800000 Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif 0.800000 0.083333 0.050000 0.066667 0.116667 0.483333 0.166667 0.233333 0.000000 0.966667 0.016667 0.016667 0.966667 0.016667 0.016667 0.000000 0.083333 0.900000 0.016667 0.000000 0.833333 0.000000 0.000000 0.166667 0.050000 0.016667 0.916667 0.016667 0.000000 0.000000 0.000000 1.000000 0.033333 0.000000 0.966667 0.000000 0.066667 0.066667 0.833333 0.033333 0.933333 0.016667 0.000000 0.050000 0.016667 0.000000 0.966667 0.016667 0.050000 0.833333 0.000000 0.116667 0.850000 0.033333 0.066667 0.050000 0.166667 0.633333 0.116667 0.083333 0.150000 0.150000 0.050000 0.650000 0.150000 0.016667 0.700000 0.133333 Consensus sequence: ABCACAGTGGAGCACTG Alignment: ---------CAGTGCTCCACTGTGBT AGTGSWSCACTGTGAMAMCACAGTG- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 9 ESR2 Reverse Complement Original Motif Forward 6 13 5.583006 Original motif 0.218487 0.450980 0.176471 0.154062 0.442577 0.142857 0.114846 0.299720 0.521008 0.042017 0.431373 0.005602 0.075630 0.000000 0.770308 0.154062 0.050420 0.056022 0.893557 0.000000 0.036415 0.053221 0.092437 0.817927 0.000000 1.000000 0.000000 0.000000 0.943978 0.002801 0.000000 0.053221 0.137255 0.344538 0.316527 0.201681 0.179272 0.176471 0.417367 0.226891 0.145658 0.170868 0.411765 0.271709 0.058824 0.092437 0.067227 0.781513 0.176471 0.070028 0.742297 0.011204 0.498599 0.277311 0.053221 0.170868 0.095238 0.750700 0.005602 0.148459 0.128852 0.809524 0.000000 0.061625 0.075630 0.252101 0.000000 0.672269 0.168067 0.263305 0.380952 0.187675 Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif 0.168067 0.380952 0.263305 0.187675 0.672269 0.252101 0.000000 0.075630 0.128852 0.000000 0.809524 0.061625 0.095238 0.005602 0.750700 0.148459 0.170868 0.277311 0.053221 0.498599 0.176471 0.742297 0.070028 0.011204 0.781513 0.092437 0.067227 0.058824 0.145658 0.411765 0.170868 0.271709 0.179272 0.417367 0.176471 0.226891 0.137255 0.316527 0.344538 0.201681 0.053221 0.002801 0.000000 0.943978 0.000000 0.000000 1.000000 0.000000 0.817927 0.053221 0.092437 0.036415 0.050420 0.893557 0.056022 0.000000 0.075630 0.770308 0.000000 0.154062 0.005602 0.042017 0.431373 0.521008 0.299720 0.142857 0.114846 0.442577 0.218487 0.176471 0.450980 0.154062 Consensus sequence: BAGGYCABHBTGACCKHV Alignment: VHRGGTCABDBTGMCCTB------------ -----AGTGSWSCACTGTGAMAMCACAGTG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 21 AmTGTGACACCACAGT Original Motif Reverse Complement Forward 4 13 5.585969 Original motif 0.703125 0.187500 0.015625 0.093750 0.265625 0.500000 0.125000 0.109375 0.015625 0.046875 0.031250 0.906250 0.078125 0.015625 0.890625 0.015625 0.000000 0.000000 0.000000 1.000000 0.000000 0.031250 0.906250 0.062500 0.953125 0.000000 0.015625 0.031250 0.046875 0.890625 0.000000 0.062500 0.968750 0.000000 0.015625 0.015625 0.109375 0.781250 0.062500 0.046875 0.062500 0.890625 0.000000 0.046875 0.953125 0.000000 0.031250 0.015625 0.031250 0.781250 0.046875 0.140625 0.937500 0.015625 0.031250 0.015625 0.093750 0.078125 0.734375 0.093750 0.031250 0.078125 0.000000 0.890625 Consensus sequence: AMTGTGACACCACAGT Reverse complement motif 0.890625 0.078125 0.000000 0.031250 0.093750 0.734375 0.078125 0.093750 0.015625 0.015625 0.031250 0.937500 0.031250 0.046875 0.781250 0.140625 0.015625 0.000000 0.031250 0.953125 0.062500 0.000000 0.890625 0.046875 0.109375 0.062500 0.781250 0.046875 0.015625 0.000000 0.015625 0.968750 0.046875 0.000000 0.890625 0.062500 0.031250 0.000000 0.015625 0.953125 0.000000 0.906250 0.031250 0.062500 1.000000 0.000000 0.000000 0.000000 0.078125 0.890625 0.015625 0.015625 0.906250 0.046875 0.031250 0.015625 0.265625 0.125000 0.500000 0.109375 0.093750 0.187500 0.015625 0.703125 Consensus sequence: ACTGTGGTGTCACART Alignment: ACTGTGGTGTCACART------------ ---CACTGTGRTRTCACAGTGSWSCACT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 7 REST Original Motif Reverse Complement Backward 10 12 6.078256 Original motif 0.132621 0.109365 0.230044 0.527970 0.036318 0.168441 0.091421 0.703820 0.047589 0.855354 0.031309 0.065748 0.906367 0.018727 0.058677 0.016230 0.021197 0.027431 0.945137 0.006234 0.076012 0.609346 0.201246 0.113396 0.980697 0.004359 0.007472 0.007472 0.001868 0.987547 0.007472 0.003113 0.021793 0.922167 0.012453 0.043587 0.568847 0.125234 0.100935 0.204984 0.136534 0.233791 0.077307 0.552369 0.024314 0.004364 0.966958 0.004364 0.012469 0.003117 0.983167 0.001247 0.877105 0.069869 0.021210 0.031815 0.008125 0.800000 0.145625 0.046250 0.983750 0.005625 0.004375 0.006250 0.026349 0.008156 0.959849 0.005646 0.128688 0.632141 0.114878 0.124294 0.229899 0.019472 0.432161 0.318467 0.133962 0.586792 0.200629 0.078616 0.112579 0.700629 0.023270 0.163522 Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif 0.112579 0.023270 0.700629 0.163522 0.133962 0.200629 0.586792 0.078616 0.229899 0.432161 0.019472 0.318467 0.128688 0.114878 0.632141 0.124294 0.026349 0.959849 0.008156 0.005646 0.006250 0.005625 0.004375 0.983750 0.008125 0.145625 0.800000 0.046250 0.031815 0.069869 0.021210 0.877105 0.012469 0.983167 0.003117 0.001247 0.024314 0.966958 0.004364 0.004364 0.552369 0.233791 0.077307 0.136534 0.204984 0.125234 0.100935 0.568847 0.021793 0.012453 0.922167 0.043587 0.001868 0.007472 0.987547 0.003113 0.007472 0.004359 0.007472 0.980697 0.076012 0.201246 0.609346 0.113396 0.021197 0.945137 0.027431 0.006234 0.016230 0.018727 0.058677 0.906367 0.047589 0.031309 0.855354 0.065748 0.703820 0.168441 0.091421 0.036318 0.527970 0.109365 0.230044 0.132621 Consensus sequence: GGYGCTGTCCATGGTGCTGAA Alignment: -------------GGYGCTGTCCATGGTGCTGAA CACTGTGRTRTCACAGTGSWSCACT--------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 2 Motif ID: 23 Motif name: TGGAGCACTGTGACAcCACAGTGg Original motif 0.054054 0.040541 0.054054 0.851351 0.040541 0.013514 0.824324 0.121622 0.094595 0.135135 0.756757 0.013514 0.891892 0.000000 0.000000 0.108108 0.040541 0.094595 0.810811 0.054054 0.081081 0.797297 0.054054 0.067568 0.932432 0.027027 0.000000 0.040541 0.054054 0.756757 0.135135 0.054054 0.108108 0.027027 0.013514 0.851351 0.108108 0.000000 0.851351 0.040541 0.013514 0.000000 0.027027 0.959459 0.000000 0.013514 0.945946 0.040541 0.905405 0.000000 0.067568 0.027027 0.054054 0.837838 0.000000 0.108108 0.945946 0.013514 0.040541 0.000000 0.162162 0.500000 0.189189 0.148649 0.108108 0.824324 0.000000 0.067568 0.945946 0.000000 0.040541 0.013514 0.081081 0.837838 0.027027 0.054054 0.945946 0.000000 0.013514 0.040541 0.054054 0.067568 0.783784 0.094595 0.054054 0.027027 0.000000 0.918919 0.040541 0.013514 0.864865 0.081081 0.148649 0.121622 0.675676 0.054054 Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reserve complement motif 0.148649 0.675676 0.121622 0.054054 0.040541 0.864865 0.013514 0.081081 0.918919 0.027027 0.000000 0.054054 0.054054 0.783784 0.067568 0.094595 0.040541 0.000000 0.013514 0.945946 0.081081 0.027027 0.837838 0.054054 0.013514 0.000000 0.040541 0.945946 0.108108 0.000000 0.824324 0.067568 0.162162 0.189189 0.500000 0.148649 0.000000 0.013514 0.040541 0.945946 0.054054 0.000000 0.837838 0.108108 0.027027 0.000000 0.067568 0.905405 0.000000 0.945946 0.013514 0.040541 0.959459 0.000000 0.027027 0.013514 0.108108 0.851351 0.000000 0.040541 0.851351 0.027027 0.013514 0.108108 0.054054 0.135135 0.756757 0.054054 0.040541 0.027027 0.000000 0.932432 0.081081 0.054054 0.797297 0.067568 0.040541 0.810811 0.094595 0.054054 0.108108 0.000000 0.000000 0.891892 0.094595 0.756757 0.135135 0.013514 0.040541 0.824324 0.013514 0.121622 0.851351 0.040541 0.054054 0.054054 Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA ************************************************************************ Best Matches for Motif ID 23 (Highest to Lowest) ************************************************************************ Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 22 CACTGTGrYrtCACAGTGswsCAcT Original Motif Reverse Complement Backward 3 23 0.013654 Original motif 0.111111 0.746032 0.063492 0.079365 0.857143 0.047619 0.047619 0.047619 0.047619 0.857143 0.079365 0.015873 0.031746 0.000000 0.000000 0.968254 0.031746 0.015873 0.904762 0.047619 0.000000 0.000000 0.000000 1.000000 0.031746 0.000000 0.857143 0.111111 0.396825 0.111111 0.412698 0.079365 0.031746 0.253968 0.015873 0.698413 0.365079 0.000000 0.634921 0.000000 0.079365 0.206349 0.047619 0.666667 0.047619 0.936508 0.015873 0.000000 0.952381 0.000000 0.015873 0.031746 0.015873 0.920635 0.000000 0.063492 0.920635 0.000000 0.000000 0.079365 0.063492 0.047619 0.841270 0.047619 0.000000 0.000000 0.015873 0.984127 0.047619 0.015873 0.904762 0.031746 0.015873 0.603175 0.317460 0.063492 0.396825 0.000000 0.015873 0.587302 0.015873 0.476190 0.428571 0.079365 0.063492 0.920635 0.000000 0.015873 0.920635 0.015873 0.047619 0.015873 0.095238 0.682540 0.095238 0.126984 0.047619 0.015873 0.095238 0.841270 Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif 0.841270 0.015873 0.095238 0.047619 0.095238 0.095238 0.682540 0.126984 0.015873 0.015873 0.047619 0.920635 0.063492 0.000000 0.920635 0.015873 0.015873 0.428571 0.476190 0.079365 0.587302 0.000000 0.015873 0.396825 0.015873 0.317460 0.603175 0.063492 0.047619 0.904762 0.015873 0.031746 0.984127 0.000000 0.015873 0.000000 0.063492 0.841270 0.047619 0.047619 0.079365 0.000000 0.000000 0.920635 0.015873 0.000000 0.920635 0.063492 0.031746 0.000000 0.015873 0.952381 0.047619 0.015873 0.936508 0.000000 0.666667 0.206349 0.047619 0.079365 0.365079 0.634921 0.000000 0.000000 0.698413 0.253968 0.015873 0.031746 0.396825 0.412698 0.111111 0.079365 0.031746 0.857143 0.000000 0.111111 1.000000 0.000000 0.000000 0.000000 0.031746 0.904762 0.015873 0.047619 0.968254 0.000000 0.000000 0.031746 0.047619 0.079365 0.857143 0.015873 0.047619 0.047619 0.047619 0.857143 0.111111 0.063492 0.746032 0.079365 Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG Alignment: -AGTGSWSCACTGTGAMAMCACAGTG TGGAGCACTGTGACAVCACAGTGG-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 27 AgTGCTCCACTGTGgTGTCACAgT Reverse Complement Reverse Complement Backward 3 22 0.560082 Original motif 0.690141 0.126761 0.042254 0.140845 0.169014 0.098592 0.676056 0.056338 0.042254 0.028169 0.028169 0.901408 0.056338 0.000000 0.774648 0.169014 0.042254 0.887324 0.042254 0.028169 0.000000 0.014085 0.000000 0.985915 0.056338 0.830986 0.042254 0.070423 0.028169 0.957746 0.014085 0.000000 0.957746 0.000000 0.014085 0.028169 0.084507 0.845070 0.014085 0.056338 0.028169 0.014085 0.000000 0.957746 0.140845 0.028169 0.802817 0.028169 0.014085 0.014085 0.014085 0.957746 0.014085 0.000000 0.929577 0.056338 0.056338 0.154930 0.619718 0.169014 0.014085 0.028169 0.000000 0.957746 0.056338 0.014085 0.873239 0.056338 0.014085 0.000000 0.000000 0.985915 0.042254 0.929577 0.000000 0.028169 0.957746 0.028169 0.000000 0.014085 0.028169 0.845070 0.028169 0.098592 0.873239 0.014085 0.042254 0.070423 0.098592 0.154930 0.563380 0.183099 0.070423 0.014085 0.112676 0.802817 Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif 0.802817 0.014085 0.112676 0.070423 0.098592 0.563380 0.154930 0.183099 0.070423 0.014085 0.042254 0.873239 0.028169 0.028169 0.845070 0.098592 0.014085 0.028169 0.000000 0.957746 0.042254 0.000000 0.929577 0.028169 0.985915 0.000000 0.000000 0.014085 0.056338 0.873239 0.014085 0.056338 0.957746 0.028169 0.000000 0.014085 0.056338 0.619718 0.154930 0.169014 0.014085 0.929577 0.000000 0.056338 0.957746 0.014085 0.014085 0.014085 0.140845 0.802817 0.028169 0.028169 0.957746 0.014085 0.000000 0.028169 0.084507 0.014085 0.845070 0.056338 0.028169 0.000000 0.014085 0.957746 0.028169 0.014085 0.957746 0.000000 0.056338 0.042254 0.830986 0.070423 0.985915 0.014085 0.000000 0.000000 0.042254 0.042254 0.887324 0.028169 0.056338 0.774648 0.000000 0.169014 0.901408 0.028169 0.028169 0.042254 0.169014 0.676056 0.098592 0.056338 0.140845 0.126761 0.042254 0.690141 Consensus sequence: ACTGTGACACCACAGTGGAGCACT Alignment: --ACTGTGACACCACAGTGGAGCACT CCACTGTGVTGTCACAGTGCTCCA-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 9 ESR2 Original Motif Reverse Complement Backward 1 18 2.583305 Original motif 0.218487 0.450980 0.176471 0.154062 0.442577 0.142857 0.114846 0.299720 0.521008 0.042017 0.431373 0.005602 0.075630 0.000000 0.770308 0.154062 0.050420 0.056022 0.893557 0.000000 0.036415 0.053221 0.092437 0.817927 0.000000 1.000000 0.000000 0.000000 0.943978 0.002801 0.000000 0.053221 0.137255 0.344538 0.316527 0.201681 0.179272 0.176471 0.417367 0.226891 0.145658 0.170868 0.411765 0.271709 0.058824 0.092437 0.067227 0.781513 0.176471 0.070028 0.742297 0.011204 0.498599 0.277311 0.053221 0.170868 0.095238 0.750700 0.005602 0.148459 0.128852 0.809524 0.000000 0.061625 0.075630 0.252101 0.000000 0.672269 0.168067 0.263305 0.380952 0.187675 Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif 0.168067 0.380952 0.263305 0.187675 0.672269 0.252101 0.000000 0.075630 0.128852 0.000000 0.809524 0.061625 0.095238 0.005602 0.750700 0.148459 0.170868 0.277311 0.053221 0.498599 0.176471 0.742297 0.070028 0.011204 0.781513 0.092437 0.067227 0.058824 0.145658 0.411765 0.170868 0.271709 0.179272 0.417367 0.176471 0.226891 0.137255 0.316527 0.344538 0.201681 0.053221 0.002801 0.000000 0.943978 0.000000 0.000000 1.000000 0.000000 0.817927 0.053221 0.092437 0.036415 0.050420 0.893557 0.056022 0.000000 0.075630 0.770308 0.000000 0.154062 0.005602 0.042017 0.431373 0.521008 0.299720 0.142857 0.114846 0.442577 0.218487 0.176471 0.450980 0.154062 Consensus sequence: BAGGYCABHBTGACCKHV Alignment: ------BAGGYCABHBTGACCKHV TGGAGCACTGTGACAVCACAGTGG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 3 ESR1 Reverse Complement Reverse Complement Forward 4 17 3.102387 Original motif 0.261242 0.256959 0.329764 0.152034 0.228632 0.170940 0.350427 0.250000 0.136752 0.369658 0.318376 0.175214 0.176596 0.487234 0.138298 0.197872 0.285106 0.493617 0.100000 0.121277 0.651163 0.059197 0.188161 0.101480 0.075949 0.016878 0.816456 0.090717 0.040000 0.037895 0.884211 0.037895 0.069474 0.086316 0.191579 0.652632 0.008421 0.829474 0.111579 0.050526 0.837895 0.027368 0.056842 0.077895 0.122105 0.526316 0.225263 0.126316 0.132632 0.581053 0.111579 0.174737 0.134737 0.543158 0.204211 0.117895 0.067368 0.040000 0.016842 0.875789 0.044211 0.046316 0.896842 0.012632 0.642105 0.223158 0.065263 0.069474 0.021053 0.917895 0.025263 0.035789 0.124211 0.743158 0.004211 0.128421 0.054737 0.347368 0.046316 0.551579 Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif 0.551579 0.347368 0.046316 0.054737 0.124211 0.004211 0.743158 0.128421 0.021053 0.025263 0.917895 0.035789 0.069474 0.223158 0.065263 0.642105 0.044211 0.896842 0.046316 0.012632 0.875789 0.040000 0.016842 0.067368 0.134737 0.204211 0.543158 0.117895 0.132632 0.111579 0.581053 0.174737 0.122105 0.225263 0.526316 0.126316 0.077895 0.027368 0.056842 0.837895 0.008421 0.111579 0.829474 0.050526 0.652632 0.086316 0.191579 0.069474 0.040000 0.884211 0.037895 0.037895 0.075949 0.816456 0.016878 0.090717 0.101480 0.059197 0.188161 0.651163 0.285106 0.100000 0.493617 0.121277 0.176596 0.138298 0.487234 0.197872 0.136752 0.318376 0.369658 0.175214 0.228632 0.350427 0.170940 0.250000 0.261242 0.329764 0.256959 0.152034 Consensus sequence: MGGTCAGGGTGACCTRDBHV Alignment: MGGTCAGGGTGACCTRDBHV------- ---CCACTGTGVTGTCACAGTGCTCCA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 17 TgTGgTGTCACAGTGCTCC Reverse Complement Reverse Complement Forward 4 16 3.560152 Original motif 0.111111 0.083333 0.055556 0.750000 0.125000 0.097222 0.652778 0.125000 0.041667 0.097222 0.027778 0.833333 0.027778 0.027778 0.791667 0.152778 0.055556 0.166667 0.652778 0.125000 0.000000 0.041667 0.013889 0.944444 0.041667 0.000000 0.888889 0.069444 0.027778 0.027778 0.000000 0.944444 0.041667 0.944444 0.013889 0.000000 0.916667 0.027778 0.000000 0.055556 0.069444 0.875000 0.000000 0.055556 0.833333 0.013889 0.013889 0.138889 0.041667 0.069444 0.819444 0.069444 0.027778 0.027778 0.027778 0.916667 0.069444 0.013889 0.847222 0.069444 0.069444 0.777778 0.027778 0.125000 0.055556 0.041667 0.027778 0.875000 0.041667 0.708333 0.125000 0.125000 0.111111 0.819444 0.055556 0.013889 Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif 0.111111 0.055556 0.819444 0.013889 0.041667 0.125000 0.708333 0.125000 0.875000 0.041667 0.027778 0.055556 0.069444 0.027778 0.777778 0.125000 0.069444 0.847222 0.013889 0.069444 0.916667 0.027778 0.027778 0.027778 0.041667 0.819444 0.069444 0.069444 0.138889 0.013889 0.013889 0.833333 0.069444 0.000000 0.875000 0.055556 0.055556 0.027778 0.000000 0.916667 0.041667 0.013889 0.944444 0.000000 0.944444 0.027778 0.000000 0.027778 0.041667 0.888889 0.000000 0.069444 0.944444 0.041667 0.013889 0.000000 0.055556 0.652778 0.166667 0.125000 0.027778 0.791667 0.027778 0.152778 0.833333 0.097222 0.027778 0.041667 0.125000 0.652778 0.097222 0.125000 0.750000 0.083333 0.055556 0.111111 Consensus sequence: GGAGCACTGTGACACCACA Alignment: GGAGCACTGTGACACCACA-------- ---CCACTGTGVTGTCACAGTGCTCCA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 20 CagTGCTCCACTGTGgT Reverse Complement Reverse Complement Forward 2 16 3.588448 Original motif 0.150000 0.700000 0.016667 0.133333 0.650000 0.150000 0.050000 0.150000 0.166667 0.116667 0.633333 0.083333 0.050000 0.033333 0.066667 0.850000 0.050000 0.000000 0.833333 0.116667 0.016667 0.966667 0.000000 0.016667 0.050000 0.016667 0.000000 0.933333 0.066667 0.833333 0.066667 0.033333 0.033333 0.966667 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.050000 0.916667 0.016667 0.016667 0.166667 0.000000 0.000000 0.833333 0.083333 0.016667 0.900000 0.000000 0.000000 0.016667 0.016667 0.966667 0.000000 0.016667 0.966667 0.016667 0.116667 0.166667 0.483333 0.233333 0.066667 0.083333 0.050000 0.800000 Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif 0.800000 0.083333 0.050000 0.066667 0.116667 0.483333 0.166667 0.233333 0.000000 0.966667 0.016667 0.016667 0.966667 0.016667 0.016667 0.000000 0.083333 0.900000 0.016667 0.000000 0.833333 0.000000 0.000000 0.166667 0.050000 0.016667 0.916667 0.016667 0.000000 0.000000 0.000000 1.000000 0.033333 0.000000 0.966667 0.000000 0.066667 0.066667 0.833333 0.033333 0.933333 0.016667 0.000000 0.050000 0.016667 0.000000 0.966667 0.016667 0.050000 0.833333 0.000000 0.116667 0.850000 0.033333 0.066667 0.050000 0.166667 0.633333 0.116667 0.083333 0.150000 0.150000 0.050000 0.650000 0.150000 0.016667 0.700000 0.133333 Consensus sequence: ABCACAGTGGAGCACTG Alignment: ABCACAGTGGAGCACTG-------- -CCACTGTGVTGTCACAGTGCTCCA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 26 CAcCACAGTGGAGCAct Original Motif Reverse Complement Forward 3 15 4.071127 Original motif 0.078125 0.734375 0.046875 0.140625 0.828125 0.046875 0.078125 0.046875 0.203125 0.484375 0.156250 0.156250 0.015625 0.984375 0.000000 0.000000 0.968750 0.015625 0.015625 0.000000 0.000000 0.906250 0.015625 0.078125 0.859375 0.000000 0.000000 0.140625 0.031250 0.000000 0.906250 0.062500 0.000000 0.015625 0.000000 0.984375 0.000000 0.000000 0.968750 0.031250 0.046875 0.062500 0.812500 0.078125 0.937500 0.015625 0.015625 0.031250 0.015625 0.031250 0.921875 0.031250 0.125000 0.796875 0.000000 0.078125 0.875000 0.046875 0.046875 0.031250 0.093750 0.656250 0.093750 0.156250 0.156250 0.078125 0.109375 0.656250 Consensus sequence: CAHCACAGTGGAGCACT Reverse complement motif 0.656250 0.078125 0.109375 0.156250 0.093750 0.093750 0.656250 0.156250 0.031250 0.046875 0.046875 0.875000 0.125000 0.000000 0.796875 0.078125 0.015625 0.921875 0.031250 0.031250 0.031250 0.015625 0.015625 0.937500 0.046875 0.812500 0.062500 0.078125 0.000000 0.968750 0.000000 0.031250 0.984375 0.015625 0.000000 0.000000 0.031250 0.906250 0.000000 0.062500 0.140625 0.000000 0.000000 0.859375 0.000000 0.015625 0.906250 0.078125 0.000000 0.015625 0.015625 0.968750 0.015625 0.000000 0.984375 0.000000 0.203125 0.156250 0.484375 0.156250 0.046875 0.046875 0.078125 0.828125 0.078125 0.046875 0.734375 0.140625 Consensus sequence: AGTGCTCCACTGTGDTG Alignment: AGTGCTCCACTGTGDTG--------- --TGGAGCACTGTGACAVCACAGTGG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 16 CTCF Original Motif Original Motif Backward 5 15 4.101826 Original motif 0.095290 0.318729 0.083242 0.502738 0.182913 0.158817 0.453450 0.204819 0.307777 0.053669 0.491785 0.146769 0.061336 0.876232 0.023001 0.039430 0.008762 0.989047 0.000000 0.002191 0.814896 0.014239 0.071194 0.099671 0.043812 0.578313 0.365827 0.012048 0.117325 0.474781 0.052632 0.355263 0.933114 0.012061 0.035088 0.019737 0.005488 0.000000 0.991218 0.003293 0.365532 0.003293 0.621295 0.009879 0.059276 0.013172 0.553238 0.374314 0.013187 0.000000 0.978022 0.008791 0.061538 0.008791 0.851648 0.078022 0.114411 0.806381 0.005501 0.073707 0.409241 0.014301 0.557756 0.018702 0.090308 0.530837 0.338106 0.040749 0.128855 0.354626 0.080396 0.436123 0.442731 0.199339 0.292952 0.064978 Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif 0.064978 0.199339 0.292952 0.442731 0.436123 0.354626 0.080396 0.128855 0.090308 0.338106 0.530837 0.040749 0.409241 0.557756 0.014301 0.018702 0.114411 0.005501 0.806381 0.073707 0.061538 0.851648 0.008791 0.078022 0.013187 0.978022 0.000000 0.008791 0.059276 0.553238 0.013172 0.374314 0.365532 0.621295 0.003293 0.009879 0.005488 0.991218 0.000000 0.003293 0.019737 0.012061 0.035088 0.933114 0.117325 0.052632 0.474781 0.355263 0.043812 0.365827 0.578313 0.012048 0.099671 0.014239 0.071194 0.814896 0.008762 0.000000 0.989047 0.002191 0.061336 0.023001 0.876232 0.039430 0.307777 0.491785 0.053669 0.146769 0.182913 0.453450 0.158817 0.204819 0.502738 0.318729 0.083242 0.095290 Consensus sequence: BMSMGCCYMCTKSTGGMHM Alignment: ---------YDRCCASYAGRKGGCRSYV TGGAGCACTGTGACAVCACAGTGG---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 14 PPARGRXRA Original Motif Original Motif Forward 2 14 4.603254 Original motif 0.109685 0.369895 0.373396 0.147025 0.117716 0.193473 0.148019 0.540793 0.453488 0.026744 0.427907 0.091860 0.116144 0.003484 0.779326 0.101045 0.161253 0.017401 0.781903 0.039443 0.168213 0.149652 0.458237 0.223898 0.082271 0.633835 0.207416 0.076477 0.949015 0.024334 0.017381 0.009270 0.604867 0.055620 0.312862 0.026651 0.825231 0.005787 0.158565 0.010417 0.095017 0.002317 0.888760 0.013905 0.047509 0.010429 0.803013 0.139050 0.025492 0.114716 0.304751 0.555041 0.062645 0.643852 0.167053 0.126450 0.784223 0.067285 0.054524 0.093968 Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif 0.093968 0.067285 0.054524 0.784223 0.062645 0.167053 0.643852 0.126450 0.555041 0.114716 0.304751 0.025492 0.047509 0.803013 0.010429 0.139050 0.095017 0.888760 0.002317 0.013905 0.010417 0.005787 0.158565 0.825231 0.026651 0.055620 0.312862 0.604867 0.009270 0.024334 0.017381 0.949015 0.082271 0.207416 0.633835 0.076477 0.168213 0.458237 0.149652 0.223898 0.161253 0.781903 0.017401 0.039443 0.116144 0.779326 0.003484 0.101045 0.091860 0.026744 0.427907 0.453488 0.540793 0.193473 0.148019 0.117716 0.109685 0.373396 0.369895 0.147025 Consensus sequence: TGRCCTKTGHCCKAB Alignment: BTRGGDCARAGGKCA---------- -TGGAGCACTGTGACAVCACAGTGG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 7 REST Original Motif Original Motif Backward 9 13 5.080326 Original motif 0.132621 0.109365 0.230044 0.527970 0.036318 0.168441 0.091421 0.703820 0.047589 0.855354 0.031309 0.065748 0.906367 0.018727 0.058677 0.016230 0.021197 0.027431 0.945137 0.006234 0.076012 0.609346 0.201246 0.113396 0.980697 0.004359 0.007472 0.007472 0.001868 0.987547 0.007472 0.003113 0.021793 0.922167 0.012453 0.043587 0.568847 0.125234 0.100935 0.204984 0.136534 0.233791 0.077307 0.552369 0.024314 0.004364 0.966958 0.004364 0.012469 0.003117 0.983167 0.001247 0.877105 0.069869 0.021210 0.031815 0.008125 0.800000 0.145625 0.046250 0.983750 0.005625 0.004375 0.006250 0.026349 0.008156 0.959849 0.005646 0.128688 0.632141 0.114878 0.124294 0.229899 0.019472 0.432161 0.318467 0.133962 0.586792 0.200629 0.078616 0.112579 0.700629 0.023270 0.163522 Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif 0.112579 0.023270 0.700629 0.163522 0.133962 0.200629 0.586792 0.078616 0.229899 0.432161 0.019472 0.318467 0.128688 0.114878 0.632141 0.124294 0.026349 0.959849 0.008156 0.005646 0.006250 0.005625 0.004375 0.983750 0.008125 0.145625 0.800000 0.046250 0.031815 0.069869 0.021210 0.877105 0.012469 0.983167 0.003117 0.001247 0.024314 0.966958 0.004364 0.004364 0.552369 0.233791 0.077307 0.136534 0.204984 0.125234 0.100935 0.568847 0.021793 0.012453 0.922167 0.043587 0.001868 0.007472 0.987547 0.003113 0.007472 0.004359 0.007472 0.980697 0.076012 0.201246 0.609346 0.113396 0.021197 0.945137 0.027431 0.006234 0.016230 0.018727 0.058677 0.906367 0.047589 0.031309 0.855354 0.065748 0.703820 0.168441 0.091421 0.036318 0.527970 0.109365 0.230044 0.132621 Consensus sequence: GGYGCTGTCCATGGTGCTGAA Alignment: -----------TTCAGCACCATGGACAGCKCC TGGAGCACTGTGACAVCACAGTGG-------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 2 Motif ID: 24 Motif name: ssCCCCGCSssk Original motif 0.000000 0.444444 0.370370 0.185185 0.111111 0.407407 0.333333 0.148148 0.000000 0.888889 0.037037 0.074074 0.000000 0.888889 0.074074 0.037037 0.000000 0.777778 0.222222 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.037037 0.888889 0.000000 0.074074 0.000000 0.703704 0.296296 0.000000 0.000000 0.518519 0.370370 0.111111 0.111111 0.407407 0.259259 0.222222 0.074074 0.222222 0.407407 0.296296 Consensus sequence: SBCCCCGCCSBB Reserve complement motif 0.074074 0.407407 0.222222 0.296296 0.111111 0.259259 0.407407 0.222222 0.000000 0.370370 0.518519 0.111111 0.000000 0.296296 0.703704 0.000000 0.037037 0.000000 0.888889 0.074074 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.222222 0.777778 0.000000 0.000000 0.074074 0.888889 0.037037 0.000000 0.037037 0.888889 0.074074 0.111111 0.333333 0.407407 0.148148 0.000000 0.370370 0.444444 0.185185 Consensus sequence: BBSGGCGGGGBS ************************************************************************ Best Matches for Motif ID 24 (Highest to Lowest) ************************************************************************ Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 3 ESR1 Reverse Complement Reverse Complement Backward 2 12 0.063076 Original motif 0.261242 0.256959 0.329764 0.152034 0.228632 0.170940 0.350427 0.250000 0.136752 0.369658 0.318376 0.175214 0.176596 0.487234 0.138298 0.197872 0.285106 0.493617 0.100000 0.121277 0.651163 0.059197 0.188161 0.101480 0.075949 0.016878 0.816456 0.090717 0.040000 0.037895 0.884211 0.037895 0.069474 0.086316 0.191579 0.652632 0.008421 0.829474 0.111579 0.050526 0.837895 0.027368 0.056842 0.077895 0.122105 0.526316 0.225263 0.126316 0.132632 0.581053 0.111579 0.174737 0.134737 0.543158 0.204211 0.117895 0.067368 0.040000 0.016842 0.875789 0.044211 0.046316 0.896842 0.012632 0.642105 0.223158 0.065263 0.069474 0.021053 0.917895 0.025263 0.035789 0.124211 0.743158 0.004211 0.128421 0.054737 0.347368 0.046316 0.551579 Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif 0.551579 0.347368 0.046316 0.054737 0.124211 0.004211 0.743158 0.128421 0.021053 0.025263 0.917895 0.035789 0.069474 0.223158 0.065263 0.642105 0.044211 0.896842 0.046316 0.012632 0.875789 0.040000 0.016842 0.067368 0.134737 0.204211 0.543158 0.117895 0.132632 0.111579 0.581053 0.174737 0.122105 0.225263 0.526316 0.126316 0.077895 0.027368 0.056842 0.837895 0.008421 0.111579 0.829474 0.050526 0.652632 0.086316 0.191579 0.069474 0.040000 0.884211 0.037895 0.037895 0.075949 0.816456 0.016878 0.090717 0.101480 0.059197 0.188161 0.651163 0.285106 0.100000 0.493617 0.121277 0.176596 0.138298 0.487234 0.197872 0.136752 0.318376 0.369658 0.175214 0.228632 0.350427 0.170940 0.250000 0.261242 0.329764 0.256959 0.152034 Consensus sequence: MGGTCAGGGTGACCTRDBHV Alignment: MGGTCAGGGTGACCTRDBHV -------BBSGGCGGGGBS- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 16 CTCF Reverse Complement Original Motif Forward 2 12 0.064209 Original motif 0.095290 0.318729 0.083242 0.502738 0.182913 0.158817 0.453450 0.204819 0.307777 0.053669 0.491785 0.146769 0.061336 0.876232 0.023001 0.039430 0.008762 0.989047 0.000000 0.002191 0.814896 0.014239 0.071194 0.099671 0.043812 0.578313 0.365827 0.012048 0.117325 0.474781 0.052632 0.355263 0.933114 0.012061 0.035088 0.019737 0.005488 0.000000 0.991218 0.003293 0.365532 0.003293 0.621295 0.009879 0.059276 0.013172 0.553238 0.374314 0.013187 0.000000 0.978022 0.008791 0.061538 0.008791 0.851648 0.078022 0.114411 0.806381 0.005501 0.073707 0.409241 0.014301 0.557756 0.018702 0.090308 0.530837 0.338106 0.040749 0.128855 0.354626 0.080396 0.436123 0.442731 0.199339 0.292952 0.064978 Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif 0.064978 0.199339 0.292952 0.442731 0.436123 0.354626 0.080396 0.128855 0.090308 0.338106 0.530837 0.040749 0.409241 0.557756 0.014301 0.018702 0.114411 0.005501 0.806381 0.073707 0.061538 0.851648 0.008791 0.078022 0.013187 0.978022 0.000000 0.008791 0.059276 0.553238 0.013172 0.374314 0.365532 0.621295 0.003293 0.009879 0.005488 0.991218 0.000000 0.003293 0.019737 0.012061 0.035088 0.933114 0.117325 0.052632 0.474781 0.355263 0.043812 0.365827 0.578313 0.012048 0.099671 0.014239 0.071194 0.814896 0.008762 0.000000 0.989047 0.002191 0.061336 0.023001 0.876232 0.039430 0.307777 0.491785 0.053669 0.146769 0.182913 0.453450 0.158817 0.204819 0.502738 0.318729 0.083242 0.095290 Consensus sequence: BMSMGCCYMCTKSTGGMHM Alignment: YDRCCASYAGRKGGCRSYV -BBSGGCGGGGBS------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 14 PPARGRXRA Original Motif Reverse Complement Backward 3 12 0.067155 Original motif 0.109685 0.369895 0.373396 0.147025 0.117716 0.193473 0.148019 0.540793 0.453488 0.026744 0.427907 0.091860 0.116144 0.003484 0.779326 0.101045 0.161253 0.017401 0.781903 0.039443 0.168213 0.149652 0.458237 0.223898 0.082271 0.633835 0.207416 0.076477 0.949015 0.024334 0.017381 0.009270 0.604867 0.055620 0.312862 0.026651 0.825231 0.005787 0.158565 0.010417 0.095017 0.002317 0.888760 0.013905 0.047509 0.010429 0.803013 0.139050 0.025492 0.114716 0.304751 0.555041 0.062645 0.643852 0.167053 0.126450 0.784223 0.067285 0.054524 0.093968 Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif 0.093968 0.067285 0.054524 0.784223 0.062645 0.167053 0.643852 0.126450 0.555041 0.114716 0.304751 0.025492 0.047509 0.803013 0.010429 0.139050 0.095017 0.888760 0.002317 0.013905 0.010417 0.005787 0.158565 0.825231 0.026651 0.055620 0.312862 0.604867 0.009270 0.024334 0.017381 0.949015 0.082271 0.207416 0.633835 0.076477 0.168213 0.458237 0.149652 0.223898 0.161253 0.781903 0.017401 0.039443 0.116144 0.779326 0.003484 0.101045 0.091860 0.026744 0.427907 0.453488 0.540793 0.193473 0.148019 0.117716 0.109685 0.373396 0.369895 0.147025 Consensus sequence: TGRCCTKTGHCCKAB Alignment: TGRCCTKTGHCCKAB -SBCCCCGCCSBB-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 9 ESR2 Original Motif Reverse Complement Forward 2 12 0.073448 Original motif 0.218487 0.450980 0.176471 0.154062 0.442577 0.142857 0.114846 0.299720 0.521008 0.042017 0.431373 0.005602 0.075630 0.000000 0.770308 0.154062 0.050420 0.056022 0.893557 0.000000 0.036415 0.053221 0.092437 0.817927 0.000000 1.000000 0.000000 0.000000 0.943978 0.002801 0.000000 0.053221 0.137255 0.344538 0.316527 0.201681 0.179272 0.176471 0.417367 0.226891 0.145658 0.170868 0.411765 0.271709 0.058824 0.092437 0.067227 0.781513 0.176471 0.070028 0.742297 0.011204 0.498599 0.277311 0.053221 0.170868 0.095238 0.750700 0.005602 0.148459 0.128852 0.809524 0.000000 0.061625 0.075630 0.252101 0.000000 0.672269 0.168067 0.263305 0.380952 0.187675 Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif 0.168067 0.380952 0.263305 0.187675 0.672269 0.252101 0.000000 0.075630 0.128852 0.000000 0.809524 0.061625 0.095238 0.005602 0.750700 0.148459 0.170868 0.277311 0.053221 0.498599 0.176471 0.742297 0.070028 0.011204 0.781513 0.092437 0.067227 0.058824 0.145658 0.411765 0.170868 0.271709 0.179272 0.417367 0.176471 0.226891 0.137255 0.316527 0.344538 0.201681 0.053221 0.002801 0.000000 0.943978 0.000000 0.000000 1.000000 0.000000 0.817927 0.053221 0.092437 0.036415 0.050420 0.893557 0.056022 0.000000 0.075630 0.770308 0.000000 0.154062 0.005602 0.042017 0.431373 0.521008 0.299720 0.142857 0.114846 0.442577 0.218487 0.176471 0.450980 0.154062 Consensus sequence: BAGGYCABHBTGACCKHV Alignment: BAGGYCABHBTGACCKHV -SBCCCCGCCSBB----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 7 REST Reverse Complement Original Motif Backward 10 12 0.075108 Original motif 0.132621 0.109365 0.230044 0.527970 0.036318 0.168441 0.091421 0.703820 0.047589 0.855354 0.031309 0.065748 0.906367 0.018727 0.058677 0.016230 0.021197 0.027431 0.945137 0.006234 0.076012 0.609346 0.201246 0.113396 0.980697 0.004359 0.007472 0.007472 0.001868 0.987547 0.007472 0.003113 0.021793 0.922167 0.012453 0.043587 0.568847 0.125234 0.100935 0.204984 0.136534 0.233791 0.077307 0.552369 0.024314 0.004364 0.966958 0.004364 0.012469 0.003117 0.983167 0.001247 0.877105 0.069869 0.021210 0.031815 0.008125 0.800000 0.145625 0.046250 0.983750 0.005625 0.004375 0.006250 0.026349 0.008156 0.959849 0.005646 0.128688 0.632141 0.114878 0.124294 0.229899 0.019472 0.432161 0.318467 0.133962 0.586792 0.200629 0.078616 0.112579 0.700629 0.023270 0.163522 Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif 0.112579 0.023270 0.700629 0.163522 0.133962 0.200629 0.586792 0.078616 0.229899 0.432161 0.019472 0.318467 0.128688 0.114878 0.632141 0.124294 0.026349 0.959849 0.008156 0.005646 0.006250 0.005625 0.004375 0.983750 0.008125 0.145625 0.800000 0.046250 0.031815 0.069869 0.021210 0.877105 0.012469 0.983167 0.003117 0.001247 0.024314 0.966958 0.004364 0.004364 0.552369 0.233791 0.077307 0.136534 0.204984 0.125234 0.100935 0.568847 0.021793 0.012453 0.922167 0.043587 0.001868 0.007472 0.987547 0.003113 0.007472 0.004359 0.007472 0.980697 0.076012 0.201246 0.609346 0.113396 0.021197 0.945137 0.027431 0.006234 0.016230 0.018727 0.058677 0.906367 0.047589 0.031309 0.855354 0.065748 0.703820 0.168441 0.091421 0.036318 0.527970 0.109365 0.230044 0.132621 Consensus sequence: GGYGCTGTCCATGGTGCTGAA Alignment: TTCAGCACCATGGACAGCKCC BBSGGCGGGGBS--------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 18 sscCCCGCGcs Original Motif Original Motif Forward 1 11 0.500000 Original motif 0.147059 0.441176 0.264706 0.147059 0.117647 0.529412 0.294118 0.058824 0.000000 0.676471 0.235294 0.088235 0.029412 0.852941 0.117647 0.000000 0.000000 0.823529 0.176471 0.000000 0.000000 0.794118 0.205882 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.058824 0.941176 0.000000 0.117647 0.470588 0.235294 0.176471 0.000000 0.323529 0.529412 0.147059 Consensus sequence: BSCCCCGCGBS Reverse complement motif 0.000000 0.529412 0.323529 0.147059 0.117647 0.235294 0.470588 0.176471 0.000000 0.941176 0.058824 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.205882 0.794118 0.000000 0.000000 0.176471 0.823529 0.000000 0.029412 0.117647 0.852941 0.000000 0.000000 0.235294 0.676471 0.088235 0.117647 0.294118 0.529412 0.058824 0.147059 0.264706 0.441176 0.147059 Consensus sequence: SBCGCGGGGSB Alignment: BSCCCCGCGBS- SBCCCCGCCSBB ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 32 gCGCGCsCgsG Original Motif Original Motif Forward 1 11 0.548902 Original motif 0.105263 0.210526 0.526316 0.157895 0.000000 0.736842 0.105263 0.157895 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.368421 0.631579 0.000000 0.000000 0.894737 0.105263 0.000000 0.157895 0.157895 0.631579 0.052632 0.052632 0.631579 0.263158 0.052632 0.105263 0.052632 0.789474 0.052632 Consensus sequence: GCGCGCSCGCG Reverse complement motif 0.105263 0.789474 0.052632 0.052632 0.052632 0.263158 0.631579 0.052632 0.157895 0.631579 0.157895 0.052632 0.000000 0.105263 0.894737 0.000000 0.000000 0.631579 0.368421 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.105263 0.736842 0.157895 0.105263 0.526316 0.210526 0.157895 Consensus sequence: CGCGSGCGCGC Alignment: GCGCGCSCGCG- SBCCCCGCCSBB ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 28 ssGCkTGCssk Reverse Complement Reverse Complement Backward 1 11 0.550852 Original motif 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 0.500000 0.500000 Consensus sequence: SSGCKTGCSSK Reverse complement motif 0.000000 0.500000 0.000000 0.500000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.000000 0.500000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 Consensus sequence: YSSGCAYGCSS Alignment: -YSSGCAYGCSS BBSGGCGGGGBS ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 29 cCGCGGrCACG Reverse Complement Reverse Complement Forward 1 11 0.566340 Original motif 0.000000 0.600000 0.200000 0.200000 0.000000 0.800000 0.000000 0.200000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.600000 0.000000 0.400000 0.000000 0.000000 0.800000 0.200000 0.000000 0.800000 0.000000 0.200000 0.000000 0.000000 0.800000 0.200000 0.000000 0.200000 0.000000 0.800000 0.000000 Consensus sequence: CCGCGGRCACG Reverse complement motif 0.200000 0.800000 0.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.200000 0.800000 0.000000 0.000000 0.000000 0.400000 0.600000 0.000000 0.800000 0.200000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.800000 0.200000 0.000000 0.200000 0.600000 0.200000 Consensus sequence: CGTGKCCGCGG Alignment: CGTGKCCGCGG- BBSGGCGGGGBS ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 4 Esrrb Reverse Complement Original Motif Forward 2 11 0.571364 Original motif 0.290198 0.220264 0.271200 0.218337 0.184941 0.227810 0.376477 0.210772 0.115226 0.332236 0.331687 0.220850 0.070959 0.342466 0.122740 0.463836 0.084862 0.729264 0.171640 0.014235 0.909737 0.008753 0.067834 0.013676 0.975656 0.000547 0.016411 0.007385 0.008758 0.001368 0.981390 0.008484 0.005750 0.003286 0.986309 0.004655 0.049904 0.012613 0.066904 0.870579 0.002473 0.927473 0.046703 0.023352 0.951569 0.005504 0.035498 0.007430 Consensus sequence: VBBYCAAGGTCA Reverse complement motif 0.007430 0.005504 0.035498 0.951569 0.002473 0.046703 0.927473 0.023352 0.870579 0.012613 0.066904 0.049904 0.005750 0.986309 0.003286 0.004655 0.008758 0.981390 0.001368 0.008484 0.007385 0.000547 0.016411 0.975656 0.013676 0.008753 0.067834 0.909737 0.084862 0.171640 0.729264 0.014235 0.463836 0.342466 0.122740 0.070959 0.115226 0.331687 0.332236 0.220850 0.184941 0.376477 0.227810 0.210772 0.218337 0.220264 0.271200 0.290198 Consensus sequence: TGACCTTGMBBB Alignment: VBBYCAAGGTCA- -BBSGGCGGGGBS ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 2 Motif ID: 25 Motif name: wwCCAmAGTCmt Original motif 0.454545 0.045455 0.227273 0.272727 0.363636 0.136364 0.136364 0.363636 0.000000 1.000000 0.000000 0.000000 0.000000 0.954545 0.045455 0.000000 1.000000 0.000000 0.000000 0.000000 0.409091 0.590909 0.000000 0.000000 0.909091 0.045455 0.045455 0.000000 0.000000 0.000000 1.000000 0.000000 0.045455 0.000000 0.000000 0.954545 0.045455 0.909091 0.000000 0.045455 0.272727 0.318182 0.181818 0.227273 0.181818 0.227273 0.227273 0.363636 Consensus sequence: DDCCAMAGTCHB Reserve complement motif 0.363636 0.227273 0.227273 0.181818 0.272727 0.181818 0.318182 0.227273 0.045455 0.000000 0.909091 0.045455 0.954545 0.000000 0.000000 0.045455 0.000000 1.000000 0.000000 0.000000 0.000000 0.045455 0.045455 0.909091 0.409091 0.000000 0.590909 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.045455 0.954545 0.000000 0.000000 0.000000 1.000000 0.000000 0.363636 0.136364 0.136364 0.363636 0.272727 0.045455 0.227273 0.454545 Consensus sequence: VDGACTRTGGDD ************************************************************************ Best Matches for Motif ID 25 (Highest to Lowest) ************************************************************************ Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 22 CACTGTGrYrtCACAGTGswsCAcT Original Motif Original Motif Backward 6 12 0.026365 Original motif 0.111111 0.746032 0.063492 0.079365 0.857143 0.047619 0.047619 0.047619 0.047619 0.857143 0.079365 0.015873 0.031746 0.000000 0.000000 0.968254 0.031746 0.015873 0.904762 0.047619 0.000000 0.000000 0.000000 1.000000 0.031746 0.000000 0.857143 0.111111 0.396825 0.111111 0.412698 0.079365 0.031746 0.253968 0.015873 0.698413 0.365079 0.000000 0.634921 0.000000 0.079365 0.206349 0.047619 0.666667 0.047619 0.936508 0.015873 0.000000 0.952381 0.000000 0.015873 0.031746 0.015873 0.920635 0.000000 0.063492 0.920635 0.000000 0.000000 0.079365 0.063492 0.047619 0.841270 0.047619 0.000000 0.000000 0.015873 0.984127 0.047619 0.015873 0.904762 0.031746 0.015873 0.603175 0.317460 0.063492 0.396825 0.000000 0.015873 0.587302 0.015873 0.476190 0.428571 0.079365 0.063492 0.920635 0.000000 0.015873 0.920635 0.015873 0.047619 0.015873 0.095238 0.682540 0.095238 0.126984 0.047619 0.015873 0.095238 0.841270 Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif 0.841270 0.015873 0.095238 0.047619 0.095238 0.095238 0.682540 0.126984 0.015873 0.015873 0.047619 0.920635 0.063492 0.000000 0.920635 0.015873 0.015873 0.428571 0.476190 0.079365 0.587302 0.000000 0.015873 0.396825 0.015873 0.317460 0.603175 0.063492 0.047619 0.904762 0.015873 0.031746 0.984127 0.000000 0.015873 0.000000 0.063492 0.841270 0.047619 0.047619 0.079365 0.000000 0.000000 0.920635 0.015873 0.000000 0.920635 0.063492 0.031746 0.000000 0.015873 0.952381 0.047619 0.015873 0.936508 0.000000 0.666667 0.206349 0.047619 0.079365 0.365079 0.634921 0.000000 0.000000 0.698413 0.253968 0.015873 0.031746 0.396825 0.412698 0.111111 0.079365 0.031746 0.857143 0.000000 0.111111 1.000000 0.000000 0.000000 0.000000 0.031746 0.904762 0.015873 0.047619 0.968254 0.000000 0.000000 0.031746 0.047619 0.079365 0.857143 0.015873 0.047619 0.047619 0.047619 0.857143 0.111111 0.063492 0.746032 0.079365 Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG Alignment: CACTGTGRTRTCACAGTGSWSCACT --------DDCCAMAGTCHB----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 20 CagTGCTCCACTGTGgT Reverse Complement Reverse Complement Backward 6 12 0.028283 Original motif 0.150000 0.700000 0.016667 0.133333 0.650000 0.150000 0.050000 0.150000 0.166667 0.116667 0.633333 0.083333 0.050000 0.033333 0.066667 0.850000 0.050000 0.000000 0.833333 0.116667 0.016667 0.966667 0.000000 0.016667 0.050000 0.016667 0.000000 0.933333 0.066667 0.833333 0.066667 0.033333 0.033333 0.966667 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.050000 0.916667 0.016667 0.016667 0.166667 0.000000 0.000000 0.833333 0.083333 0.016667 0.900000 0.000000 0.000000 0.016667 0.016667 0.966667 0.000000 0.016667 0.966667 0.016667 0.116667 0.166667 0.483333 0.233333 0.066667 0.083333 0.050000 0.800000 Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif 0.800000 0.083333 0.050000 0.066667 0.116667 0.483333 0.166667 0.233333 0.000000 0.966667 0.016667 0.016667 0.966667 0.016667 0.016667 0.000000 0.083333 0.900000 0.016667 0.000000 0.833333 0.000000 0.000000 0.166667 0.050000 0.016667 0.916667 0.016667 0.000000 0.000000 0.000000 1.000000 0.033333 0.000000 0.966667 0.000000 0.066667 0.066667 0.833333 0.033333 0.933333 0.016667 0.000000 0.050000 0.016667 0.000000 0.966667 0.016667 0.050000 0.833333 0.000000 0.116667 0.850000 0.033333 0.066667 0.050000 0.166667 0.633333 0.116667 0.083333 0.150000 0.150000 0.050000 0.650000 0.150000 0.016667 0.700000 0.133333 Consensus sequence: ABCACAGTGGAGCACTG Alignment: ABCACAGTGGAGCACTG VDGACTRTGGDD----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 26 CAcCACAGTGGAGCAct Reverse Complement Reverse Complement Forward 6 12 0.029109 Original motif 0.078125 0.734375 0.046875 0.140625 0.828125 0.046875 0.078125 0.046875 0.203125 0.484375 0.156250 0.156250 0.015625 0.984375 0.000000 0.000000 0.968750 0.015625 0.015625 0.000000 0.000000 0.906250 0.015625 0.078125 0.859375 0.000000 0.000000 0.140625 0.031250 0.000000 0.906250 0.062500 0.000000 0.015625 0.000000 0.984375 0.000000 0.000000 0.968750 0.031250 0.046875 0.062500 0.812500 0.078125 0.937500 0.015625 0.015625 0.031250 0.015625 0.031250 0.921875 0.031250 0.125000 0.796875 0.000000 0.078125 0.875000 0.046875 0.046875 0.031250 0.093750 0.656250 0.093750 0.156250 0.156250 0.078125 0.109375 0.656250 Consensus sequence: CAHCACAGTGGAGCACT Reverse complement motif 0.656250 0.078125 0.109375 0.156250 0.093750 0.093750 0.656250 0.156250 0.031250 0.046875 0.046875 0.875000 0.125000 0.000000 0.796875 0.078125 0.015625 0.921875 0.031250 0.031250 0.031250 0.015625 0.015625 0.937500 0.046875 0.812500 0.062500 0.078125 0.000000 0.968750 0.000000 0.031250 0.984375 0.015625 0.000000 0.000000 0.031250 0.906250 0.000000 0.062500 0.140625 0.000000 0.000000 0.859375 0.000000 0.015625 0.906250 0.078125 0.000000 0.015625 0.015625 0.968750 0.015625 0.000000 0.984375 0.000000 0.203125 0.156250 0.484375 0.156250 0.046875 0.046875 0.078125 0.828125 0.078125 0.046875 0.734375 0.140625 Consensus sequence: AGTGCTCCACTGTGDTG Alignment: AGTGCTCCACTGTGDTG -----VDGACTRTGGDD ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 27 AgTGCTCCACTGTGgTGTCACAgT Reverse Complement Original Motif Forward 6 12 0.030192 Original motif 0.690141 0.126761 0.042254 0.140845 0.169014 0.098592 0.676056 0.056338 0.042254 0.028169 0.028169 0.901408 0.056338 0.000000 0.774648 0.169014 0.042254 0.887324 0.042254 0.028169 0.000000 0.014085 0.000000 0.985915 0.056338 0.830986 0.042254 0.070423 0.028169 0.957746 0.014085 0.000000 0.957746 0.000000 0.014085 0.028169 0.084507 0.845070 0.014085 0.056338 0.028169 0.014085 0.000000 0.957746 0.140845 0.028169 0.802817 0.028169 0.014085 0.014085 0.014085 0.957746 0.014085 0.000000 0.929577 0.056338 0.056338 0.154930 0.619718 0.169014 0.014085 0.028169 0.000000 0.957746 0.056338 0.014085 0.873239 0.056338 0.014085 0.000000 0.000000 0.985915 0.042254 0.929577 0.000000 0.028169 0.957746 0.028169 0.000000 0.014085 0.028169 0.845070 0.028169 0.098592 0.873239 0.014085 0.042254 0.070423 0.098592 0.154930 0.563380 0.183099 0.070423 0.014085 0.112676 0.802817 Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif 0.802817 0.014085 0.112676 0.070423 0.098592 0.563380 0.154930 0.183099 0.070423 0.014085 0.042254 0.873239 0.028169 0.028169 0.845070 0.098592 0.014085 0.028169 0.000000 0.957746 0.042254 0.000000 0.929577 0.028169 0.985915 0.000000 0.000000 0.014085 0.056338 0.873239 0.014085 0.056338 0.957746 0.028169 0.000000 0.014085 0.056338 0.619718 0.154930 0.169014 0.014085 0.929577 0.000000 0.056338 0.957746 0.014085 0.014085 0.014085 0.140845 0.802817 0.028169 0.028169 0.957746 0.014085 0.000000 0.028169 0.084507 0.014085 0.845070 0.056338 0.028169 0.000000 0.014085 0.957746 0.028169 0.014085 0.957746 0.000000 0.056338 0.042254 0.830986 0.070423 0.985915 0.014085 0.000000 0.000000 0.042254 0.042254 0.887324 0.028169 0.056338 0.774648 0.000000 0.169014 0.901408 0.028169 0.028169 0.042254 0.169014 0.676056 0.098592 0.056338 0.140845 0.126761 0.042254 0.690141 Consensus sequence: ACTGTGACACCACAGTGGAGCACT Alignment: AGTGCTCCACTGTGGTGTCACAGT -----VDGACTRTGGDD------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 1 HNF4A Original Motif Original Motif Forward 2 12 0.032442 Original motif 0.417910 0.104478 0.402985 0.074627 0.029851 0.029851 0.835821 0.104478 0.179104 0.059701 0.522388 0.238806 0.074627 0.343284 0.298507 0.283582 0.044776 0.761194 0.059701 0.134328 0.880597 0.014925 0.044776 0.059701 0.791045 0.029851 0.149254 0.029851 0.835821 0.014925 0.119403 0.029851 0.059701 0.059701 0.865672 0.014925 0.089552 0.029851 0.492537 0.388060 0.044776 0.328358 0.164179 0.462687 0.059701 0.731343 0.074627 0.134328 0.626866 0.104478 0.149254 0.119403 Consensus sequence: RGGBCAAAGKYCA Reverse complement motif 0.119403 0.104478 0.149254 0.626866 0.059701 0.074627 0.731343 0.134328 0.462687 0.328358 0.164179 0.044776 0.089552 0.492537 0.029851 0.388060 0.059701 0.865672 0.059701 0.014925 0.029851 0.014925 0.119403 0.835821 0.029851 0.029851 0.149254 0.791045 0.059701 0.014925 0.044776 0.880597 0.044776 0.059701 0.761194 0.134328 0.074627 0.298507 0.343284 0.283582 0.179104 0.522388 0.059701 0.238806 0.029851 0.835821 0.029851 0.104478 0.074627 0.104478 0.402985 0.417910 Consensus sequence: TGMYCTTTGBCCK Alignment: RGGBCAAAGKYCA -DDCCAMAGTCHB ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 23 TGGAGCACTGTGACAcCACAGTGg Original Motif Reverse Complement Forward 4 12 0.036070 Original motif 0.054054 0.040541 0.054054 0.851351 0.040541 0.013514 0.824324 0.121622 0.094595 0.135135 0.756757 0.013514 0.891892 0.000000 0.000000 0.108108 0.040541 0.094595 0.810811 0.054054 0.081081 0.797297 0.054054 0.067568 0.932432 0.027027 0.000000 0.040541 0.054054 0.756757 0.135135 0.054054 0.108108 0.027027 0.013514 0.851351 0.108108 0.000000 0.851351 0.040541 0.013514 0.000000 0.027027 0.959459 0.000000 0.013514 0.945946 0.040541 0.905405 0.000000 0.067568 0.027027 0.054054 0.837838 0.000000 0.108108 0.945946 0.013514 0.040541 0.000000 0.162162 0.500000 0.189189 0.148649 0.108108 0.824324 0.000000 0.067568 0.945946 0.000000 0.040541 0.013514 0.081081 0.837838 0.027027 0.054054 0.945946 0.000000 0.013514 0.040541 0.054054 0.067568 0.783784 0.094595 0.054054 0.027027 0.000000 0.918919 0.040541 0.013514 0.864865 0.081081 0.148649 0.121622 0.675676 0.054054 Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif 0.148649 0.675676 0.121622 0.054054 0.040541 0.864865 0.013514 0.081081 0.918919 0.027027 0.000000 0.054054 0.054054 0.783784 0.067568 0.094595 0.040541 0.000000 0.013514 0.945946 0.081081 0.027027 0.837838 0.054054 0.013514 0.000000 0.040541 0.945946 0.108108 0.000000 0.824324 0.067568 0.162162 0.189189 0.500000 0.148649 0.000000 0.013514 0.040541 0.945946 0.054054 0.000000 0.837838 0.108108 0.027027 0.000000 0.067568 0.905405 0.000000 0.945946 0.013514 0.040541 0.959459 0.000000 0.027027 0.013514 0.108108 0.851351 0.000000 0.040541 0.851351 0.027027 0.013514 0.108108 0.054054 0.135135 0.756757 0.054054 0.040541 0.027027 0.000000 0.932432 0.081081 0.054054 0.797297 0.067568 0.040541 0.810811 0.094595 0.054054 0.108108 0.000000 0.000000 0.891892 0.094595 0.756757 0.135135 0.013514 0.040541 0.824324 0.013514 0.121622 0.851351 0.040541 0.054054 0.054054 Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA Alignment: CCACTGTGVTGTCACAGTGCTCCA ---DDCCAMAGTCHB--------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 7 REST Original Motif Reverse Complement Forward 4 12 0.039123 Original motif 0.132621 0.109365 0.230044 0.527970 0.036318 0.168441 0.091421 0.703820 0.047589 0.855354 0.031309 0.065748 0.906367 0.018727 0.058677 0.016230 0.021197 0.027431 0.945137 0.006234 0.076012 0.609346 0.201246 0.113396 0.980697 0.004359 0.007472 0.007472 0.001868 0.987547 0.007472 0.003113 0.021793 0.922167 0.012453 0.043587 0.568847 0.125234 0.100935 0.204984 0.136534 0.233791 0.077307 0.552369 0.024314 0.004364 0.966958 0.004364 0.012469 0.003117 0.983167 0.001247 0.877105 0.069869 0.021210 0.031815 0.008125 0.800000 0.145625 0.046250 0.983750 0.005625 0.004375 0.006250 0.026349 0.008156 0.959849 0.005646 0.128688 0.632141 0.114878 0.124294 0.229899 0.019472 0.432161 0.318467 0.133962 0.586792 0.200629 0.078616 0.112579 0.700629 0.023270 0.163522 Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif 0.112579 0.023270 0.700629 0.163522 0.133962 0.200629 0.586792 0.078616 0.229899 0.432161 0.019472 0.318467 0.128688 0.114878 0.632141 0.124294 0.026349 0.959849 0.008156 0.005646 0.006250 0.005625 0.004375 0.983750 0.008125 0.145625 0.800000 0.046250 0.031815 0.069869 0.021210 0.877105 0.012469 0.983167 0.003117 0.001247 0.024314 0.966958 0.004364 0.004364 0.552369 0.233791 0.077307 0.136534 0.204984 0.125234 0.100935 0.568847 0.021793 0.012453 0.922167 0.043587 0.001868 0.007472 0.987547 0.003113 0.007472 0.004359 0.007472 0.980697 0.076012 0.201246 0.609346 0.113396 0.021197 0.945137 0.027431 0.006234 0.016230 0.018727 0.058677 0.906367 0.047589 0.031309 0.855354 0.065748 0.703820 0.168441 0.091421 0.036318 0.527970 0.109365 0.230044 0.132621 Consensus sequence: GGYGCTGTCCATGGTGCTGAA Alignment: GGYGCTGTCCATGGTGCTGAA ---DDCCAMAGTCHB------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 17 TgTGgTGTCACAGTGCTCC Original Motif Original Motif Backward 3 12 0.039378 Original motif 0.111111 0.083333 0.055556 0.750000 0.125000 0.097222 0.652778 0.125000 0.041667 0.097222 0.027778 0.833333 0.027778 0.027778 0.791667 0.152778 0.055556 0.166667 0.652778 0.125000 0.000000 0.041667 0.013889 0.944444 0.041667 0.000000 0.888889 0.069444 0.027778 0.027778 0.000000 0.944444 0.041667 0.944444 0.013889 0.000000 0.916667 0.027778 0.000000 0.055556 0.069444 0.875000 0.000000 0.055556 0.833333 0.013889 0.013889 0.138889 0.041667 0.069444 0.819444 0.069444 0.027778 0.027778 0.027778 0.916667 0.069444 0.013889 0.847222 0.069444 0.069444 0.777778 0.027778 0.125000 0.055556 0.041667 0.027778 0.875000 0.041667 0.708333 0.125000 0.125000 0.111111 0.819444 0.055556 0.013889 Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif 0.111111 0.055556 0.819444 0.013889 0.041667 0.125000 0.708333 0.125000 0.875000 0.041667 0.027778 0.055556 0.069444 0.027778 0.777778 0.125000 0.069444 0.847222 0.013889 0.069444 0.916667 0.027778 0.027778 0.027778 0.041667 0.819444 0.069444 0.069444 0.138889 0.013889 0.013889 0.833333 0.069444 0.000000 0.875000 0.055556 0.055556 0.027778 0.000000 0.916667 0.041667 0.013889 0.944444 0.000000 0.944444 0.027778 0.000000 0.027778 0.041667 0.888889 0.000000 0.069444 0.944444 0.041667 0.013889 0.000000 0.055556 0.652778 0.166667 0.125000 0.027778 0.791667 0.027778 0.152778 0.833333 0.097222 0.027778 0.041667 0.125000 0.652778 0.097222 0.125000 0.750000 0.083333 0.055556 0.111111 Consensus sequence: GGAGCACTGTGACACCACA Alignment: TGTGGTGTCACAGTGCTCC -----DDCCAMAGTCHB-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 3 ESR1 Original Motif Original Motif Forward 1 12 0.040730 Original motif 0.261242 0.256959 0.329764 0.152034 0.228632 0.170940 0.350427 0.250000 0.136752 0.369658 0.318376 0.175214 0.176596 0.487234 0.138298 0.197872 0.285106 0.493617 0.100000 0.121277 0.651163 0.059197 0.188161 0.101480 0.075949 0.016878 0.816456 0.090717 0.040000 0.037895 0.884211 0.037895 0.069474 0.086316 0.191579 0.652632 0.008421 0.829474 0.111579 0.050526 0.837895 0.027368 0.056842 0.077895 0.122105 0.526316 0.225263 0.126316 0.132632 0.581053 0.111579 0.174737 0.134737 0.543158 0.204211 0.117895 0.067368 0.040000 0.016842 0.875789 0.044211 0.046316 0.896842 0.012632 0.642105 0.223158 0.065263 0.069474 0.021053 0.917895 0.025263 0.035789 0.124211 0.743158 0.004211 0.128421 0.054737 0.347368 0.046316 0.551579 Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif 0.551579 0.347368 0.046316 0.054737 0.124211 0.004211 0.743158 0.128421 0.021053 0.025263 0.917895 0.035789 0.069474 0.223158 0.065263 0.642105 0.044211 0.896842 0.046316 0.012632 0.875789 0.040000 0.016842 0.067368 0.134737 0.204211 0.543158 0.117895 0.132632 0.111579 0.581053 0.174737 0.122105 0.225263 0.526316 0.126316 0.077895 0.027368 0.056842 0.837895 0.008421 0.111579 0.829474 0.050526 0.652632 0.086316 0.191579 0.069474 0.040000 0.884211 0.037895 0.037895 0.075949 0.816456 0.016878 0.090717 0.101480 0.059197 0.188161 0.651163 0.285106 0.100000 0.493617 0.121277 0.176596 0.138298 0.487234 0.197872 0.136752 0.318376 0.369658 0.175214 0.228632 0.350427 0.170940 0.250000 0.261242 0.329764 0.256959 0.152034 Consensus sequence: MGGTCAGGGTGACCTRDBHV Alignment: VDBHMAGGTCACCCTGACCY DDCCAMAGTCHB-------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 10 NR1H2RXRA Original Motif Original Motif Backward 2 12 0.046338 Original motif 0.680000 0.200000 0.000000 0.120000 0.680000 0.040000 0.200000 0.080000 0.800000 0.000000 0.200000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.040000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.000000 0.040000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.800000 0.040000 0.080000 0.080000 0.000000 0.600000 0.240000 0.160000 Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif 0.000000 0.240000 0.600000 0.160000 0.080000 0.040000 0.080000 0.800000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.040000 0.000000 0.000000 0.960000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.040000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.200000 0.800000 0.080000 0.040000 0.200000 0.680000 0.120000 0.200000 0.000000 0.680000 Consensus sequence: GTTGACCTTTGACCTTT Alignment: AAAGGTCAAAGGTCAAC ----DDCCAMAGTCHB- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 2 Motif ID: 26 Motif name: CAcCACAGTGGAGCAct Original motif 0.078125 0.734375 0.046875 0.140625 0.828125 0.046875 0.078125 0.046875 0.203125 0.484375 0.156250 0.156250 0.015625 0.984375 0.000000 0.000000 0.968750 0.015625 0.015625 0.000000 0.000000 0.906250 0.015625 0.078125 0.859375 0.000000 0.000000 0.140625 0.031250 0.000000 0.906250 0.062500 0.000000 0.015625 0.000000 0.984375 0.000000 0.000000 0.968750 0.031250 0.046875 0.062500 0.812500 0.078125 0.937500 0.015625 0.015625 0.031250 0.015625 0.031250 0.921875 0.031250 0.125000 0.796875 0.000000 0.078125 0.875000 0.046875 0.046875 0.031250 0.093750 0.656250 0.093750 0.156250 0.156250 0.078125 0.109375 0.656250 Consensus sequence: CAHCACAGTGGAGCACT Reserve complement motif 0.656250 0.078125 0.109375 0.156250 0.093750 0.093750 0.656250 0.156250 0.031250 0.046875 0.046875 0.875000 0.125000 0.000000 0.796875 0.078125 0.015625 0.921875 0.031250 0.031250 0.031250 0.015625 0.015625 0.937500 0.046875 0.812500 0.062500 0.078125 0.000000 0.968750 0.000000 0.031250 0.984375 0.015625 0.000000 0.000000 0.031250 0.906250 0.000000 0.062500 0.140625 0.000000 0.000000 0.859375 0.000000 0.015625 0.906250 0.078125 0.000000 0.015625 0.015625 0.968750 0.015625 0.000000 0.984375 0.000000 0.203125 0.156250 0.484375 0.156250 0.046875 0.046875 0.078125 0.828125 0.078125 0.046875 0.734375 0.140625 Consensus sequence: AGTGCTCCACTGTGDTG ************************************************************************ Best Matches for Motif ID 26 (Highest to Lowest) ************************************************************************ Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 27 AgTGCTCCACTGTGgTGTCACAgT Original Motif Reverse Complement Forward 8 17 0.007425 Original motif 0.690141 0.126761 0.042254 0.140845 0.169014 0.098592 0.676056 0.056338 0.042254 0.028169 0.028169 0.901408 0.056338 0.000000 0.774648 0.169014 0.042254 0.887324 0.042254 0.028169 0.000000 0.014085 0.000000 0.985915 0.056338 0.830986 0.042254 0.070423 0.028169 0.957746 0.014085 0.000000 0.957746 0.000000 0.014085 0.028169 0.084507 0.845070 0.014085 0.056338 0.028169 0.014085 0.000000 0.957746 0.140845 0.028169 0.802817 0.028169 0.014085 0.014085 0.014085 0.957746 0.014085 0.000000 0.929577 0.056338 0.056338 0.154930 0.619718 0.169014 0.014085 0.028169 0.000000 0.957746 0.056338 0.014085 0.873239 0.056338 0.014085 0.000000 0.000000 0.985915 0.042254 0.929577 0.000000 0.028169 0.957746 0.028169 0.000000 0.014085 0.028169 0.845070 0.028169 0.098592 0.873239 0.014085 0.042254 0.070423 0.098592 0.154930 0.563380 0.183099 0.070423 0.014085 0.112676 0.802817 Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif 0.802817 0.014085 0.112676 0.070423 0.098592 0.563380 0.154930 0.183099 0.070423 0.014085 0.042254 0.873239 0.028169 0.028169 0.845070 0.098592 0.014085 0.028169 0.000000 0.957746 0.042254 0.000000 0.929577 0.028169 0.985915 0.000000 0.000000 0.014085 0.056338 0.873239 0.014085 0.056338 0.957746 0.028169 0.000000 0.014085 0.056338 0.619718 0.154930 0.169014 0.014085 0.929577 0.000000 0.056338 0.957746 0.014085 0.014085 0.014085 0.140845 0.802817 0.028169 0.028169 0.957746 0.014085 0.000000 0.028169 0.084507 0.014085 0.845070 0.056338 0.028169 0.000000 0.014085 0.957746 0.028169 0.014085 0.957746 0.000000 0.056338 0.042254 0.830986 0.070423 0.985915 0.014085 0.000000 0.000000 0.042254 0.042254 0.887324 0.028169 0.056338 0.774648 0.000000 0.169014 0.901408 0.028169 0.028169 0.042254 0.169014 0.676056 0.098592 0.056338 0.140845 0.126761 0.042254 0.690141 Consensus sequence: ACTGTGACACCACAGTGGAGCACT Alignment: ACTGTGACACCACAGTGGAGCACT -------CAHCACAGTGGAGCACT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 22 CACTGTGrYrtCACAGTGswsCAcT Original Motif Original Motif Forward 9 17 0.045680 Original motif 0.111111 0.746032 0.063492 0.079365 0.857143 0.047619 0.047619 0.047619 0.047619 0.857143 0.079365 0.015873 0.031746 0.000000 0.000000 0.968254 0.031746 0.015873 0.904762 0.047619 0.000000 0.000000 0.000000 1.000000 0.031746 0.000000 0.857143 0.111111 0.396825 0.111111 0.412698 0.079365 0.031746 0.253968 0.015873 0.698413 0.365079 0.000000 0.634921 0.000000 0.079365 0.206349 0.047619 0.666667 0.047619 0.936508 0.015873 0.000000 0.952381 0.000000 0.015873 0.031746 0.015873 0.920635 0.000000 0.063492 0.920635 0.000000 0.000000 0.079365 0.063492 0.047619 0.841270 0.047619 0.000000 0.000000 0.015873 0.984127 0.047619 0.015873 0.904762 0.031746 0.015873 0.603175 0.317460 0.063492 0.396825 0.000000 0.015873 0.587302 0.015873 0.476190 0.428571 0.079365 0.063492 0.920635 0.000000 0.015873 0.920635 0.015873 0.047619 0.015873 0.095238 0.682540 0.095238 0.126984 0.047619 0.015873 0.095238 0.841270 Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif 0.841270 0.015873 0.095238 0.047619 0.095238 0.095238 0.682540 0.126984 0.015873 0.015873 0.047619 0.920635 0.063492 0.000000 0.920635 0.015873 0.015873 0.428571 0.476190 0.079365 0.587302 0.000000 0.015873 0.396825 0.015873 0.317460 0.603175 0.063492 0.047619 0.904762 0.015873 0.031746 0.984127 0.000000 0.015873 0.000000 0.063492 0.841270 0.047619 0.047619 0.079365 0.000000 0.000000 0.920635 0.015873 0.000000 0.920635 0.063492 0.031746 0.000000 0.015873 0.952381 0.047619 0.015873 0.936508 0.000000 0.666667 0.206349 0.047619 0.079365 0.365079 0.634921 0.000000 0.000000 0.698413 0.253968 0.015873 0.031746 0.396825 0.412698 0.111111 0.079365 0.031746 0.857143 0.000000 0.111111 1.000000 0.000000 0.000000 0.000000 0.031746 0.904762 0.015873 0.047619 0.968254 0.000000 0.000000 0.031746 0.047619 0.079365 0.857143 0.015873 0.047619 0.047619 0.047619 0.857143 0.111111 0.063492 0.746032 0.079365 Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG Alignment: CACTGTGRTRTCACAGTGSWSCACT --------CAHCACAGTGGAGCACT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 7 REST Original Motif Original Motif Forward 3 17 0.089488 Original motif 0.132621 0.109365 0.230044 0.527970 0.036318 0.168441 0.091421 0.703820 0.047589 0.855354 0.031309 0.065748 0.906367 0.018727 0.058677 0.016230 0.021197 0.027431 0.945137 0.006234 0.076012 0.609346 0.201246 0.113396 0.980697 0.004359 0.007472 0.007472 0.001868 0.987547 0.007472 0.003113 0.021793 0.922167 0.012453 0.043587 0.568847 0.125234 0.100935 0.204984 0.136534 0.233791 0.077307 0.552369 0.024314 0.004364 0.966958 0.004364 0.012469 0.003117 0.983167 0.001247 0.877105 0.069869 0.021210 0.031815 0.008125 0.800000 0.145625 0.046250 0.983750 0.005625 0.004375 0.006250 0.026349 0.008156 0.959849 0.005646 0.128688 0.632141 0.114878 0.124294 0.229899 0.019472 0.432161 0.318467 0.133962 0.586792 0.200629 0.078616 0.112579 0.700629 0.023270 0.163522 Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif 0.112579 0.023270 0.700629 0.163522 0.133962 0.200629 0.586792 0.078616 0.229899 0.432161 0.019472 0.318467 0.128688 0.114878 0.632141 0.124294 0.026349 0.959849 0.008156 0.005646 0.006250 0.005625 0.004375 0.983750 0.008125 0.145625 0.800000 0.046250 0.031815 0.069869 0.021210 0.877105 0.012469 0.983167 0.003117 0.001247 0.024314 0.966958 0.004364 0.004364 0.552369 0.233791 0.077307 0.136534 0.204984 0.125234 0.100935 0.568847 0.021793 0.012453 0.922167 0.043587 0.001868 0.007472 0.987547 0.003113 0.007472 0.004359 0.007472 0.980697 0.076012 0.201246 0.609346 0.113396 0.021197 0.945137 0.027431 0.006234 0.016230 0.018727 0.058677 0.906367 0.047589 0.031309 0.855354 0.065748 0.703820 0.168441 0.091421 0.036318 0.527970 0.109365 0.230044 0.132621 Consensus sequence: GGYGCTGTCCATGGTGCTGAA Alignment: TTCAGCACCATGGACAGCKCC --CAHCACAGTGGAGCACT-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 17 TgTGgTGTCACAGTGCTCC Original Motif Reverse Complement Backward 2 17 0.096254 Original motif 0.111111 0.083333 0.055556 0.750000 0.125000 0.097222 0.652778 0.125000 0.041667 0.097222 0.027778 0.833333 0.027778 0.027778 0.791667 0.152778 0.055556 0.166667 0.652778 0.125000 0.000000 0.041667 0.013889 0.944444 0.041667 0.000000 0.888889 0.069444 0.027778 0.027778 0.000000 0.944444 0.041667 0.944444 0.013889 0.000000 0.916667 0.027778 0.000000 0.055556 0.069444 0.875000 0.000000 0.055556 0.833333 0.013889 0.013889 0.138889 0.041667 0.069444 0.819444 0.069444 0.027778 0.027778 0.027778 0.916667 0.069444 0.013889 0.847222 0.069444 0.069444 0.777778 0.027778 0.125000 0.055556 0.041667 0.027778 0.875000 0.041667 0.708333 0.125000 0.125000 0.111111 0.819444 0.055556 0.013889 Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif 0.111111 0.055556 0.819444 0.013889 0.041667 0.125000 0.708333 0.125000 0.875000 0.041667 0.027778 0.055556 0.069444 0.027778 0.777778 0.125000 0.069444 0.847222 0.013889 0.069444 0.916667 0.027778 0.027778 0.027778 0.041667 0.819444 0.069444 0.069444 0.138889 0.013889 0.013889 0.833333 0.069444 0.000000 0.875000 0.055556 0.055556 0.027778 0.000000 0.916667 0.041667 0.013889 0.944444 0.000000 0.944444 0.027778 0.000000 0.027778 0.041667 0.888889 0.000000 0.069444 0.944444 0.041667 0.013889 0.000000 0.055556 0.652778 0.166667 0.125000 0.027778 0.791667 0.027778 0.152778 0.833333 0.097222 0.027778 0.041667 0.125000 0.652778 0.097222 0.125000 0.750000 0.083333 0.055556 0.111111 Consensus sequence: GGAGCACTGTGACACCACA Alignment: GGAGCACTGTGACACCACA -CAHCACAGTGGAGCACT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 16 CTCF Original Motif Original Motif Forward 2 17 0.097813 Original motif 0.095290 0.318729 0.083242 0.502738 0.182913 0.158817 0.453450 0.204819 0.307777 0.053669 0.491785 0.146769 0.061336 0.876232 0.023001 0.039430 0.008762 0.989047 0.000000 0.002191 0.814896 0.014239 0.071194 0.099671 0.043812 0.578313 0.365827 0.012048 0.117325 0.474781 0.052632 0.355263 0.933114 0.012061 0.035088 0.019737 0.005488 0.000000 0.991218 0.003293 0.365532 0.003293 0.621295 0.009879 0.059276 0.013172 0.553238 0.374314 0.013187 0.000000 0.978022 0.008791 0.061538 0.008791 0.851648 0.078022 0.114411 0.806381 0.005501 0.073707 0.409241 0.014301 0.557756 0.018702 0.090308 0.530837 0.338106 0.040749 0.128855 0.354626 0.080396 0.436123 0.442731 0.199339 0.292952 0.064978 Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif 0.064978 0.199339 0.292952 0.442731 0.436123 0.354626 0.080396 0.128855 0.090308 0.338106 0.530837 0.040749 0.409241 0.557756 0.014301 0.018702 0.114411 0.005501 0.806381 0.073707 0.061538 0.851648 0.008791 0.078022 0.013187 0.978022 0.000000 0.008791 0.059276 0.553238 0.013172 0.374314 0.365532 0.621295 0.003293 0.009879 0.005488 0.991218 0.000000 0.003293 0.019737 0.012061 0.035088 0.933114 0.117325 0.052632 0.474781 0.355263 0.043812 0.365827 0.578313 0.012048 0.099671 0.014239 0.071194 0.814896 0.008762 0.000000 0.989047 0.002191 0.061336 0.023001 0.876232 0.039430 0.307777 0.491785 0.053669 0.146769 0.182913 0.453450 0.158817 0.204819 0.502738 0.318729 0.083242 0.095290 Consensus sequence: BMSMGCCYMCTKSTGGMHM Alignment: YDRCCASYAGRKGGCRSYV -CAHCACAGTGGAGCACT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 23 TGGAGCACTGTGACAcCACAGTGg Reverse Complement Reverse Complement Backward 3 17 0.106708 Original motif 0.054054 0.040541 0.054054 0.851351 0.040541 0.013514 0.824324 0.121622 0.094595 0.135135 0.756757 0.013514 0.891892 0.000000 0.000000 0.108108 0.040541 0.094595 0.810811 0.054054 0.081081 0.797297 0.054054 0.067568 0.932432 0.027027 0.000000 0.040541 0.054054 0.756757 0.135135 0.054054 0.108108 0.027027 0.013514 0.851351 0.108108 0.000000 0.851351 0.040541 0.013514 0.000000 0.027027 0.959459 0.000000 0.013514 0.945946 0.040541 0.905405 0.000000 0.067568 0.027027 0.054054 0.837838 0.000000 0.108108 0.945946 0.013514 0.040541 0.000000 0.162162 0.500000 0.189189 0.148649 0.108108 0.824324 0.000000 0.067568 0.945946 0.000000 0.040541 0.013514 0.081081 0.837838 0.027027 0.054054 0.945946 0.000000 0.013514 0.040541 0.054054 0.067568 0.783784 0.094595 0.054054 0.027027 0.000000 0.918919 0.040541 0.013514 0.864865 0.081081 0.148649 0.121622 0.675676 0.054054 Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif 0.148649 0.675676 0.121622 0.054054 0.040541 0.864865 0.013514 0.081081 0.918919 0.027027 0.000000 0.054054 0.054054 0.783784 0.067568 0.094595 0.040541 0.000000 0.013514 0.945946 0.081081 0.027027 0.837838 0.054054 0.013514 0.000000 0.040541 0.945946 0.108108 0.000000 0.824324 0.067568 0.162162 0.189189 0.500000 0.148649 0.000000 0.013514 0.040541 0.945946 0.054054 0.000000 0.837838 0.108108 0.027027 0.000000 0.067568 0.905405 0.000000 0.945946 0.013514 0.040541 0.959459 0.000000 0.027027 0.013514 0.108108 0.851351 0.000000 0.040541 0.851351 0.027027 0.013514 0.108108 0.054054 0.135135 0.756757 0.054054 0.040541 0.027027 0.000000 0.932432 0.081081 0.054054 0.797297 0.067568 0.040541 0.810811 0.094595 0.054054 0.108108 0.000000 0.000000 0.891892 0.094595 0.756757 0.135135 0.013514 0.040541 0.824324 0.013514 0.121622 0.851351 0.040541 0.054054 0.054054 Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA Alignment: CCACTGTGVTGTCACAGTGCTCCA -----AGTGCTCCACTGTGDTG-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 20 CagTGCTCCACTGTGgT Original Motif Reverse Complement Forward 2 16 0.500000 Original motif 0.150000 0.700000 0.016667 0.133333 0.650000 0.150000 0.050000 0.150000 0.166667 0.116667 0.633333 0.083333 0.050000 0.033333 0.066667 0.850000 0.050000 0.000000 0.833333 0.116667 0.016667 0.966667 0.000000 0.016667 0.050000 0.016667 0.000000 0.933333 0.066667 0.833333 0.066667 0.033333 0.033333 0.966667 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.050000 0.916667 0.016667 0.016667 0.166667 0.000000 0.000000 0.833333 0.083333 0.016667 0.900000 0.000000 0.000000 0.016667 0.016667 0.966667 0.000000 0.016667 0.966667 0.016667 0.116667 0.166667 0.483333 0.233333 0.066667 0.083333 0.050000 0.800000 Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif 0.800000 0.083333 0.050000 0.066667 0.116667 0.483333 0.166667 0.233333 0.000000 0.966667 0.016667 0.016667 0.966667 0.016667 0.016667 0.000000 0.083333 0.900000 0.016667 0.000000 0.833333 0.000000 0.000000 0.166667 0.050000 0.016667 0.916667 0.016667 0.000000 0.000000 0.000000 1.000000 0.033333 0.000000 0.966667 0.000000 0.066667 0.066667 0.833333 0.033333 0.933333 0.016667 0.000000 0.050000 0.016667 0.000000 0.966667 0.016667 0.050000 0.833333 0.000000 0.116667 0.850000 0.033333 0.066667 0.050000 0.166667 0.633333 0.116667 0.083333 0.150000 0.150000 0.050000 0.650000 0.150000 0.016667 0.700000 0.133333 Consensus sequence: ABCACAGTGGAGCACTG Alignment: ABCACAGTGGAGCACTG- -CAHCACAGTGGAGCACT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 21 AmTGTGACACCACAGT Original Motif Reverse Complement Forward 1 16 0.610921 Original motif 0.703125 0.187500 0.015625 0.093750 0.265625 0.500000 0.125000 0.109375 0.015625 0.046875 0.031250 0.906250 0.078125 0.015625 0.890625 0.015625 0.000000 0.000000 0.000000 1.000000 0.000000 0.031250 0.906250 0.062500 0.953125 0.000000 0.015625 0.031250 0.046875 0.890625 0.000000 0.062500 0.968750 0.000000 0.015625 0.015625 0.109375 0.781250 0.062500 0.046875 0.062500 0.890625 0.000000 0.046875 0.953125 0.000000 0.031250 0.015625 0.031250 0.781250 0.046875 0.140625 0.937500 0.015625 0.031250 0.015625 0.093750 0.078125 0.734375 0.093750 0.031250 0.078125 0.000000 0.890625 Consensus sequence: AMTGTGACACCACAGT Reverse complement motif 0.890625 0.078125 0.000000 0.031250 0.093750 0.734375 0.078125 0.093750 0.015625 0.015625 0.031250 0.937500 0.031250 0.046875 0.781250 0.140625 0.015625 0.000000 0.031250 0.953125 0.062500 0.000000 0.890625 0.046875 0.109375 0.062500 0.781250 0.046875 0.015625 0.000000 0.015625 0.968750 0.046875 0.000000 0.890625 0.062500 0.031250 0.000000 0.015625 0.953125 0.000000 0.906250 0.031250 0.062500 1.000000 0.000000 0.000000 0.000000 0.078125 0.890625 0.015625 0.015625 0.906250 0.046875 0.031250 0.015625 0.265625 0.125000 0.500000 0.109375 0.093750 0.187500 0.015625 0.703125 Consensus sequence: ACTGTGGTGTCACART Alignment: ACTGTGGTGTCACART- CAHCACAGTGGAGCACT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 25 wwCCAmAGTCmt Reverse Complement Reverse Complement Backward 1 12 2.583903 Original motif 0.454545 0.045455 0.227273 0.272727 0.363636 0.136364 0.136364 0.363636 0.000000 1.000000 0.000000 0.000000 0.000000 0.954545 0.045455 0.000000 1.000000 0.000000 0.000000 0.000000 0.409091 0.590909 0.000000 0.000000 0.909091 0.045455 0.045455 0.000000 0.000000 0.000000 1.000000 0.000000 0.045455 0.000000 0.000000 0.954545 0.045455 0.909091 0.000000 0.045455 0.272727 0.318182 0.181818 0.227273 0.181818 0.227273 0.227273 0.363636 Consensus sequence: DDCCAMAGTCHB Reverse complement motif 0.363636 0.227273 0.227273 0.181818 0.272727 0.181818 0.318182 0.227273 0.045455 0.000000 0.909091 0.045455 0.954545 0.000000 0.000000 0.045455 0.000000 1.000000 0.000000 0.000000 0.000000 0.045455 0.045455 0.909091 0.409091 0.000000 0.590909 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.045455 0.954545 0.000000 0.000000 0.000000 1.000000 0.000000 0.363636 0.136364 0.136364 0.363636 0.272727 0.045455 0.227273 0.454545 Consensus sequence: VDGACTRTGGDD Alignment: -----VDGACTRTGGDD AGTGCTCCACTGTGDTG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 1 HNF4A Reverse Complement Reverse Complement Backward 2 12 2.603322 Original motif 0.417910 0.104478 0.402985 0.074627 0.029851 0.029851 0.835821 0.104478 0.179104 0.059701 0.522388 0.238806 0.074627 0.343284 0.298507 0.283582 0.044776 0.761194 0.059701 0.134328 0.880597 0.014925 0.044776 0.059701 0.791045 0.029851 0.149254 0.029851 0.835821 0.014925 0.119403 0.029851 0.059701 0.059701 0.865672 0.014925 0.089552 0.029851 0.492537 0.388060 0.044776 0.328358 0.164179 0.462687 0.059701 0.731343 0.074627 0.134328 0.626866 0.104478 0.149254 0.119403 Consensus sequence: RGGBCAAAGKYCA Reverse complement motif 0.119403 0.104478 0.149254 0.626866 0.059701 0.074627 0.731343 0.134328 0.462687 0.328358 0.164179 0.044776 0.089552 0.492537 0.029851 0.388060 0.059701 0.865672 0.059701 0.014925 0.029851 0.014925 0.119403 0.835821 0.029851 0.029851 0.149254 0.791045 0.059701 0.014925 0.044776 0.880597 0.044776 0.059701 0.761194 0.134328 0.074627 0.298507 0.343284 0.283582 0.179104 0.522388 0.059701 0.238806 0.029851 0.835821 0.029851 0.104478 0.074627 0.104478 0.402985 0.417910 Consensus sequence: TGMYCTTTGBCCK Alignment: -----TGMYCTTTGBCCK AGTGCTCCACTGTGDTG- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 2 Motif ID: 27 Motif name: AgTGCTCCACTGTGgTGTCACAgT Original motif 0.690141 0.126761 0.042254 0.140845 0.169014 0.098592 0.676056 0.056338 0.042254 0.028169 0.028169 0.901408 0.056338 0.000000 0.774648 0.169014 0.042254 0.887324 0.042254 0.028169 0.000000 0.014085 0.000000 0.985915 0.056338 0.830986 0.042254 0.070423 0.028169 0.957746 0.014085 0.000000 0.957746 0.000000 0.014085 0.028169 0.084507 0.845070 0.014085 0.056338 0.028169 0.014085 0.000000 0.957746 0.140845 0.028169 0.802817 0.028169 0.014085 0.014085 0.014085 0.957746 0.014085 0.000000 0.929577 0.056338 0.056338 0.154930 0.619718 0.169014 0.014085 0.028169 0.000000 0.957746 0.056338 0.014085 0.873239 0.056338 0.014085 0.000000 0.000000 0.985915 0.042254 0.929577 0.000000 0.028169 0.957746 0.028169 0.000000 0.014085 0.028169 0.845070 0.028169 0.098592 0.873239 0.014085 0.042254 0.070423 0.098592 0.154930 0.563380 0.183099 0.070423 0.014085 0.112676 0.802817 Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reserve complement motif 0.802817 0.014085 0.112676 0.070423 0.098592 0.563380 0.154930 0.183099 0.070423 0.014085 0.042254 0.873239 0.028169 0.028169 0.845070 0.098592 0.014085 0.028169 0.000000 0.957746 0.042254 0.000000 0.929577 0.028169 0.985915 0.000000 0.000000 0.014085 0.056338 0.873239 0.014085 0.056338 0.957746 0.028169 0.000000 0.014085 0.056338 0.619718 0.154930 0.169014 0.014085 0.929577 0.000000 0.056338 0.957746 0.014085 0.014085 0.014085 0.140845 0.802817 0.028169 0.028169 0.957746 0.014085 0.000000 0.028169 0.084507 0.014085 0.845070 0.056338 0.028169 0.000000 0.014085 0.957746 0.028169 0.014085 0.957746 0.000000 0.056338 0.042254 0.830986 0.070423 0.985915 0.014085 0.000000 0.000000 0.042254 0.042254 0.887324 0.028169 0.056338 0.774648 0.000000 0.169014 0.901408 0.028169 0.028169 0.042254 0.169014 0.676056 0.098592 0.056338 0.140845 0.126761 0.042254 0.690141 Consensus sequence: ACTGTGACACCACAGTGGAGCACT ************************************************************************ Best Matches for Motif ID 27 (Highest to Lowest) ************************************************************************ Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 22 CACTGTGrYrtCACAGTGswsCAcT Original Motif Reverse Complement Forward 2 24 0.040959 Original motif 0.111111 0.746032 0.063492 0.079365 0.857143 0.047619 0.047619 0.047619 0.047619 0.857143 0.079365 0.015873 0.031746 0.000000 0.000000 0.968254 0.031746 0.015873 0.904762 0.047619 0.000000 0.000000 0.000000 1.000000 0.031746 0.000000 0.857143 0.111111 0.396825 0.111111 0.412698 0.079365 0.031746 0.253968 0.015873 0.698413 0.365079 0.000000 0.634921 0.000000 0.079365 0.206349 0.047619 0.666667 0.047619 0.936508 0.015873 0.000000 0.952381 0.000000 0.015873 0.031746 0.015873 0.920635 0.000000 0.063492 0.920635 0.000000 0.000000 0.079365 0.063492 0.047619 0.841270 0.047619 0.000000 0.000000 0.015873 0.984127 0.047619 0.015873 0.904762 0.031746 0.015873 0.603175 0.317460 0.063492 0.396825 0.000000 0.015873 0.587302 0.015873 0.476190 0.428571 0.079365 0.063492 0.920635 0.000000 0.015873 0.920635 0.015873 0.047619 0.015873 0.095238 0.682540 0.095238 0.126984 0.047619 0.015873 0.095238 0.841270 Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif 0.841270 0.015873 0.095238 0.047619 0.095238 0.095238 0.682540 0.126984 0.015873 0.015873 0.047619 0.920635 0.063492 0.000000 0.920635 0.015873 0.015873 0.428571 0.476190 0.079365 0.587302 0.000000 0.015873 0.396825 0.015873 0.317460 0.603175 0.063492 0.047619 0.904762 0.015873 0.031746 0.984127 0.000000 0.015873 0.000000 0.063492 0.841270 0.047619 0.047619 0.079365 0.000000 0.000000 0.920635 0.015873 0.000000 0.920635 0.063492 0.031746 0.000000 0.015873 0.952381 0.047619 0.015873 0.936508 0.000000 0.666667 0.206349 0.047619 0.079365 0.365079 0.634921 0.000000 0.000000 0.698413 0.253968 0.015873 0.031746 0.396825 0.412698 0.111111 0.079365 0.031746 0.857143 0.000000 0.111111 1.000000 0.000000 0.000000 0.000000 0.031746 0.904762 0.015873 0.047619 0.968254 0.000000 0.000000 0.031746 0.047619 0.079365 0.857143 0.015873 0.047619 0.047619 0.047619 0.857143 0.111111 0.063492 0.746032 0.079365 Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG Alignment: AGTGSWSCACTGTGAMAMCACAGTG -AGTGCTCCACTGTGGTGTCACAGT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 23 TGGAGCACTGTGACAcCACAGTGg Reverse Complement Reverse Complement Forward 3 22 1.063637 Original motif 0.054054 0.040541 0.054054 0.851351 0.040541 0.013514 0.824324 0.121622 0.094595 0.135135 0.756757 0.013514 0.891892 0.000000 0.000000 0.108108 0.040541 0.094595 0.810811 0.054054 0.081081 0.797297 0.054054 0.067568 0.932432 0.027027 0.000000 0.040541 0.054054 0.756757 0.135135 0.054054 0.108108 0.027027 0.013514 0.851351 0.108108 0.000000 0.851351 0.040541 0.013514 0.000000 0.027027 0.959459 0.000000 0.013514 0.945946 0.040541 0.905405 0.000000 0.067568 0.027027 0.054054 0.837838 0.000000 0.108108 0.945946 0.013514 0.040541 0.000000 0.162162 0.500000 0.189189 0.148649 0.108108 0.824324 0.000000 0.067568 0.945946 0.000000 0.040541 0.013514 0.081081 0.837838 0.027027 0.054054 0.945946 0.000000 0.013514 0.040541 0.054054 0.067568 0.783784 0.094595 0.054054 0.027027 0.000000 0.918919 0.040541 0.013514 0.864865 0.081081 0.148649 0.121622 0.675676 0.054054 Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif 0.148649 0.675676 0.121622 0.054054 0.040541 0.864865 0.013514 0.081081 0.918919 0.027027 0.000000 0.054054 0.054054 0.783784 0.067568 0.094595 0.040541 0.000000 0.013514 0.945946 0.081081 0.027027 0.837838 0.054054 0.013514 0.000000 0.040541 0.945946 0.108108 0.000000 0.824324 0.067568 0.162162 0.189189 0.500000 0.148649 0.000000 0.013514 0.040541 0.945946 0.054054 0.000000 0.837838 0.108108 0.027027 0.000000 0.067568 0.905405 0.000000 0.945946 0.013514 0.040541 0.959459 0.000000 0.027027 0.013514 0.108108 0.851351 0.000000 0.040541 0.851351 0.027027 0.013514 0.108108 0.054054 0.135135 0.756757 0.054054 0.040541 0.027027 0.000000 0.932432 0.081081 0.054054 0.797297 0.067568 0.040541 0.810811 0.094595 0.054054 0.108108 0.000000 0.000000 0.891892 0.094595 0.756757 0.135135 0.013514 0.040541 0.824324 0.013514 0.121622 0.851351 0.040541 0.054054 0.054054 Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA Alignment: CCACTGTGVTGTCACAGTGCTCCA-- --ACTGTGACACCACAGTGGAGCACT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 7 REST Reverse Complement Original Motif Forward 3 19 2.595989 Original motif 0.132621 0.109365 0.230044 0.527970 0.036318 0.168441 0.091421 0.703820 0.047589 0.855354 0.031309 0.065748 0.906367 0.018727 0.058677 0.016230 0.021197 0.027431 0.945137 0.006234 0.076012 0.609346 0.201246 0.113396 0.980697 0.004359 0.007472 0.007472 0.001868 0.987547 0.007472 0.003113 0.021793 0.922167 0.012453 0.043587 0.568847 0.125234 0.100935 0.204984 0.136534 0.233791 0.077307 0.552369 0.024314 0.004364 0.966958 0.004364 0.012469 0.003117 0.983167 0.001247 0.877105 0.069869 0.021210 0.031815 0.008125 0.800000 0.145625 0.046250 0.983750 0.005625 0.004375 0.006250 0.026349 0.008156 0.959849 0.005646 0.128688 0.632141 0.114878 0.124294 0.229899 0.019472 0.432161 0.318467 0.133962 0.586792 0.200629 0.078616 0.112579 0.700629 0.023270 0.163522 Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif 0.112579 0.023270 0.700629 0.163522 0.133962 0.200629 0.586792 0.078616 0.229899 0.432161 0.019472 0.318467 0.128688 0.114878 0.632141 0.124294 0.026349 0.959849 0.008156 0.005646 0.006250 0.005625 0.004375 0.983750 0.008125 0.145625 0.800000 0.046250 0.031815 0.069869 0.021210 0.877105 0.012469 0.983167 0.003117 0.001247 0.024314 0.966958 0.004364 0.004364 0.552369 0.233791 0.077307 0.136534 0.204984 0.125234 0.100935 0.568847 0.021793 0.012453 0.922167 0.043587 0.001868 0.007472 0.987547 0.003113 0.007472 0.004359 0.007472 0.980697 0.076012 0.201246 0.609346 0.113396 0.021197 0.945137 0.027431 0.006234 0.016230 0.018727 0.058677 0.906367 0.047589 0.031309 0.855354 0.065748 0.703820 0.168441 0.091421 0.036318 0.527970 0.109365 0.230044 0.132621 Consensus sequence: GGYGCTGTCCATGGTGCTGAA Alignment: TTCAGCACCATGGACAGCKCC----- --ACTGTGACACCACAGTGGAGCACT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 17 TgTGgTGTCACAGTGCTCC Reverse Complement Reverse Complement Backward 2 18 3.101227 Original motif 0.111111 0.083333 0.055556 0.750000 0.125000 0.097222 0.652778 0.125000 0.041667 0.097222 0.027778 0.833333 0.027778 0.027778 0.791667 0.152778 0.055556 0.166667 0.652778 0.125000 0.000000 0.041667 0.013889 0.944444 0.041667 0.000000 0.888889 0.069444 0.027778 0.027778 0.000000 0.944444 0.041667 0.944444 0.013889 0.000000 0.916667 0.027778 0.000000 0.055556 0.069444 0.875000 0.000000 0.055556 0.833333 0.013889 0.013889 0.138889 0.041667 0.069444 0.819444 0.069444 0.027778 0.027778 0.027778 0.916667 0.069444 0.013889 0.847222 0.069444 0.069444 0.777778 0.027778 0.125000 0.055556 0.041667 0.027778 0.875000 0.041667 0.708333 0.125000 0.125000 0.111111 0.819444 0.055556 0.013889 Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif 0.111111 0.055556 0.819444 0.013889 0.041667 0.125000 0.708333 0.125000 0.875000 0.041667 0.027778 0.055556 0.069444 0.027778 0.777778 0.125000 0.069444 0.847222 0.013889 0.069444 0.916667 0.027778 0.027778 0.027778 0.041667 0.819444 0.069444 0.069444 0.138889 0.013889 0.013889 0.833333 0.069444 0.000000 0.875000 0.055556 0.055556 0.027778 0.000000 0.916667 0.041667 0.013889 0.944444 0.000000 0.944444 0.027778 0.000000 0.027778 0.041667 0.888889 0.000000 0.069444 0.944444 0.041667 0.013889 0.000000 0.055556 0.652778 0.166667 0.125000 0.027778 0.791667 0.027778 0.152778 0.833333 0.097222 0.027778 0.041667 0.125000 0.652778 0.097222 0.125000 0.750000 0.083333 0.055556 0.111111 Consensus sequence: GGAGCACTGTGACACCACA Alignment: ------GGAGCACTGTGACACCACA ACTGTGACACCACAGTGGAGCACT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 16 CTCF Original Motif Reverse Complement Backward 2 18 3.101862 Original motif 0.095290 0.318729 0.083242 0.502738 0.182913 0.158817 0.453450 0.204819 0.307777 0.053669 0.491785 0.146769 0.061336 0.876232 0.023001 0.039430 0.008762 0.989047 0.000000 0.002191 0.814896 0.014239 0.071194 0.099671 0.043812 0.578313 0.365827 0.012048 0.117325 0.474781 0.052632 0.355263 0.933114 0.012061 0.035088 0.019737 0.005488 0.000000 0.991218 0.003293 0.365532 0.003293 0.621295 0.009879 0.059276 0.013172 0.553238 0.374314 0.013187 0.000000 0.978022 0.008791 0.061538 0.008791 0.851648 0.078022 0.114411 0.806381 0.005501 0.073707 0.409241 0.014301 0.557756 0.018702 0.090308 0.530837 0.338106 0.040749 0.128855 0.354626 0.080396 0.436123 0.442731 0.199339 0.292952 0.064978 Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif 0.064978 0.199339 0.292952 0.442731 0.436123 0.354626 0.080396 0.128855 0.090308 0.338106 0.530837 0.040749 0.409241 0.557756 0.014301 0.018702 0.114411 0.005501 0.806381 0.073707 0.061538 0.851648 0.008791 0.078022 0.013187 0.978022 0.000000 0.008791 0.059276 0.553238 0.013172 0.374314 0.365532 0.621295 0.003293 0.009879 0.005488 0.991218 0.000000 0.003293 0.019737 0.012061 0.035088 0.933114 0.117325 0.052632 0.474781 0.355263 0.043812 0.365827 0.578313 0.012048 0.099671 0.014239 0.071194 0.814896 0.008762 0.000000 0.989047 0.002191 0.061336 0.023001 0.876232 0.039430 0.307777 0.491785 0.053669 0.146769 0.182913 0.453450 0.158817 0.204819 0.502738 0.318729 0.083242 0.095290 Consensus sequence: BMSMGCCYMCTKSTGGMHM Alignment: ------BMSMGCCYMCTKSTGGMHM AGTGCTCCACTGTGGTGTCACAGT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 26 CAcCACAGTGGAGCAct Reverse Complement Original Motif Forward 1 17 3.502481 Original motif 0.078125 0.734375 0.046875 0.140625 0.828125 0.046875 0.078125 0.046875 0.203125 0.484375 0.156250 0.156250 0.015625 0.984375 0.000000 0.000000 0.968750 0.015625 0.015625 0.000000 0.000000 0.906250 0.015625 0.078125 0.859375 0.000000 0.000000 0.140625 0.031250 0.000000 0.906250 0.062500 0.000000 0.015625 0.000000 0.984375 0.000000 0.000000 0.968750 0.031250 0.046875 0.062500 0.812500 0.078125 0.937500 0.015625 0.015625 0.031250 0.015625 0.031250 0.921875 0.031250 0.125000 0.796875 0.000000 0.078125 0.875000 0.046875 0.046875 0.031250 0.093750 0.656250 0.093750 0.156250 0.156250 0.078125 0.109375 0.656250 Consensus sequence: CAHCACAGTGGAGCACT Reverse complement motif 0.656250 0.078125 0.109375 0.156250 0.093750 0.093750 0.656250 0.156250 0.031250 0.046875 0.046875 0.875000 0.125000 0.000000 0.796875 0.078125 0.015625 0.921875 0.031250 0.031250 0.031250 0.015625 0.015625 0.937500 0.046875 0.812500 0.062500 0.078125 0.000000 0.968750 0.000000 0.031250 0.984375 0.015625 0.000000 0.000000 0.031250 0.906250 0.000000 0.062500 0.140625 0.000000 0.000000 0.859375 0.000000 0.015625 0.906250 0.078125 0.000000 0.015625 0.015625 0.968750 0.015625 0.000000 0.984375 0.000000 0.203125 0.156250 0.484375 0.156250 0.046875 0.046875 0.078125 0.828125 0.078125 0.046875 0.734375 0.140625 Consensus sequence: AGTGCTCCACTGTGDTG Alignment: CAHCACAGTGGAGCACT------- ACTGTGACACCACAGTGGAGCACT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 20 CagTGCTCCACTGTGgT Reverse Complement Reverse Complement Backward 2 16 4.000000 Original motif 0.150000 0.700000 0.016667 0.133333 0.650000 0.150000 0.050000 0.150000 0.166667 0.116667 0.633333 0.083333 0.050000 0.033333 0.066667 0.850000 0.050000 0.000000 0.833333 0.116667 0.016667 0.966667 0.000000 0.016667 0.050000 0.016667 0.000000 0.933333 0.066667 0.833333 0.066667 0.033333 0.033333 0.966667 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.050000 0.916667 0.016667 0.016667 0.166667 0.000000 0.000000 0.833333 0.083333 0.016667 0.900000 0.000000 0.000000 0.016667 0.016667 0.966667 0.000000 0.016667 0.966667 0.016667 0.116667 0.166667 0.483333 0.233333 0.066667 0.083333 0.050000 0.800000 Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif 0.800000 0.083333 0.050000 0.066667 0.116667 0.483333 0.166667 0.233333 0.000000 0.966667 0.016667 0.016667 0.966667 0.016667 0.016667 0.000000 0.083333 0.900000 0.016667 0.000000 0.833333 0.000000 0.000000 0.166667 0.050000 0.016667 0.916667 0.016667 0.000000 0.000000 0.000000 1.000000 0.033333 0.000000 0.966667 0.000000 0.066667 0.066667 0.833333 0.033333 0.933333 0.016667 0.000000 0.050000 0.016667 0.000000 0.966667 0.016667 0.050000 0.833333 0.000000 0.116667 0.850000 0.033333 0.066667 0.050000 0.166667 0.633333 0.116667 0.083333 0.150000 0.150000 0.050000 0.650000 0.150000 0.016667 0.700000 0.133333 Consensus sequence: ABCACAGTGGAGCACTG Alignment: --------ABCACAGTGGAGCACTG ACTGTGACACCACAGTGGAGCACT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 21 AmTGTGACACCACAGT Reverse Complement Original Motif Backward 1 16 4.004101 Original motif 0.703125 0.187500 0.015625 0.093750 0.265625 0.500000 0.125000 0.109375 0.015625 0.046875 0.031250 0.906250 0.078125 0.015625 0.890625 0.015625 0.000000 0.000000 0.000000 1.000000 0.000000 0.031250 0.906250 0.062500 0.953125 0.000000 0.015625 0.031250 0.046875 0.890625 0.000000 0.062500 0.968750 0.000000 0.015625 0.015625 0.109375 0.781250 0.062500 0.046875 0.062500 0.890625 0.000000 0.046875 0.953125 0.000000 0.031250 0.015625 0.031250 0.781250 0.046875 0.140625 0.937500 0.015625 0.031250 0.015625 0.093750 0.078125 0.734375 0.093750 0.031250 0.078125 0.000000 0.890625 Consensus sequence: AMTGTGACACCACAGT Reverse complement motif 0.890625 0.078125 0.000000 0.031250 0.093750 0.734375 0.078125 0.093750 0.015625 0.015625 0.031250 0.937500 0.031250 0.046875 0.781250 0.140625 0.015625 0.000000 0.031250 0.953125 0.062500 0.000000 0.890625 0.046875 0.109375 0.062500 0.781250 0.046875 0.015625 0.000000 0.015625 0.968750 0.046875 0.000000 0.890625 0.062500 0.031250 0.000000 0.015625 0.953125 0.000000 0.906250 0.031250 0.062500 1.000000 0.000000 0.000000 0.000000 0.078125 0.890625 0.015625 0.015625 0.906250 0.046875 0.031250 0.015625 0.265625 0.125000 0.500000 0.109375 0.093750 0.187500 0.015625 0.703125 Consensus sequence: ACTGTGGTGTCACART Alignment: --------AMTGTGACACCACAGT ACTGTGACACCACAGTGGAGCACT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 3 ESR1 Reverse Complement Reverse Complement Forward 6 15 4.599963 Original motif 0.261242 0.256959 0.329764 0.152034 0.228632 0.170940 0.350427 0.250000 0.136752 0.369658 0.318376 0.175214 0.176596 0.487234 0.138298 0.197872 0.285106 0.493617 0.100000 0.121277 0.651163 0.059197 0.188161 0.101480 0.075949 0.016878 0.816456 0.090717 0.040000 0.037895 0.884211 0.037895 0.069474 0.086316 0.191579 0.652632 0.008421 0.829474 0.111579 0.050526 0.837895 0.027368 0.056842 0.077895 0.122105 0.526316 0.225263 0.126316 0.132632 0.581053 0.111579 0.174737 0.134737 0.543158 0.204211 0.117895 0.067368 0.040000 0.016842 0.875789 0.044211 0.046316 0.896842 0.012632 0.642105 0.223158 0.065263 0.069474 0.021053 0.917895 0.025263 0.035789 0.124211 0.743158 0.004211 0.128421 0.054737 0.347368 0.046316 0.551579 Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif 0.551579 0.347368 0.046316 0.054737 0.124211 0.004211 0.743158 0.128421 0.021053 0.025263 0.917895 0.035789 0.069474 0.223158 0.065263 0.642105 0.044211 0.896842 0.046316 0.012632 0.875789 0.040000 0.016842 0.067368 0.134737 0.204211 0.543158 0.117895 0.132632 0.111579 0.581053 0.174737 0.122105 0.225263 0.526316 0.126316 0.077895 0.027368 0.056842 0.837895 0.008421 0.111579 0.829474 0.050526 0.652632 0.086316 0.191579 0.069474 0.040000 0.884211 0.037895 0.037895 0.075949 0.816456 0.016878 0.090717 0.101480 0.059197 0.188161 0.651163 0.285106 0.100000 0.493617 0.121277 0.176596 0.138298 0.487234 0.197872 0.136752 0.318376 0.369658 0.175214 0.228632 0.350427 0.170940 0.250000 0.261242 0.329764 0.256959 0.152034 Consensus sequence: MGGTCAGGGTGACCTRDBHV Alignment: MGGTCAGGGTGACCTRDBHV--------- -----ACTGTGACACCACAGTGGAGCACT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 9 ESR2 Original Motif Original Motif Backward 7 12 6.080413 Original motif 0.218487 0.450980 0.176471 0.154062 0.442577 0.142857 0.114846 0.299720 0.521008 0.042017 0.431373 0.005602 0.075630 0.000000 0.770308 0.154062 0.050420 0.056022 0.893557 0.000000 0.036415 0.053221 0.092437 0.817927 0.000000 1.000000 0.000000 0.000000 0.943978 0.002801 0.000000 0.053221 0.137255 0.344538 0.316527 0.201681 0.179272 0.176471 0.417367 0.226891 0.145658 0.170868 0.411765 0.271709 0.058824 0.092437 0.067227 0.781513 0.176471 0.070028 0.742297 0.011204 0.498599 0.277311 0.053221 0.170868 0.095238 0.750700 0.005602 0.148459 0.128852 0.809524 0.000000 0.061625 0.075630 0.252101 0.000000 0.672269 0.168067 0.263305 0.380952 0.187675 Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif 0.168067 0.380952 0.263305 0.187675 0.672269 0.252101 0.000000 0.075630 0.128852 0.000000 0.809524 0.061625 0.095238 0.005602 0.750700 0.148459 0.170868 0.277311 0.053221 0.498599 0.176471 0.742297 0.070028 0.011204 0.781513 0.092437 0.067227 0.058824 0.145658 0.411765 0.170868 0.271709 0.179272 0.417367 0.176471 0.226891 0.137255 0.316527 0.344538 0.201681 0.053221 0.002801 0.000000 0.943978 0.000000 0.000000 1.000000 0.000000 0.817927 0.053221 0.092437 0.036415 0.050420 0.893557 0.056022 0.000000 0.075630 0.770308 0.000000 0.154062 0.005602 0.042017 0.431373 0.521008 0.299720 0.142857 0.114846 0.442577 0.218487 0.176471 0.450980 0.154062 Consensus sequence: BAGGYCABHBTGACCKHV Alignment: ------------VHRGGTCABDBTGMCCTB AGTGCTCCACTGTGGTGTCACAGT------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 2 Motif ID: 28 Motif name: ssGCkTGCssk Original motif 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 0.500000 0.500000 Consensus sequence: SSGCKTGCSSK Reserve complement motif 0.000000 0.500000 0.000000 0.500000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.000000 0.500000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 Consensus sequence: YSSGCAYGCSS ************************************************************************ Best Matches for Motif ID 28 (Highest to Lowest) ************************************************************************ Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 32 gCGCGCsCgsG Original Motif Original Motif Backward 1 11 0.004565 Original motif 0.105263 0.210526 0.526316 0.157895 0.000000 0.736842 0.105263 0.157895 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.368421 0.631579 0.000000 0.000000 0.894737 0.105263 0.000000 0.157895 0.157895 0.631579 0.052632 0.052632 0.631579 0.263158 0.052632 0.105263 0.052632 0.789474 0.052632 Consensus sequence: GCGCGCSCGCG Reverse complement motif 0.105263 0.789474 0.052632 0.052632 0.052632 0.263158 0.631579 0.052632 0.157895 0.631579 0.157895 0.052632 0.000000 0.105263 0.894737 0.000000 0.000000 0.631579 0.368421 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.105263 0.736842 0.157895 0.105263 0.526316 0.210526 0.157895 Consensus sequence: CGCGSGCGCGC Alignment: GCGCGCSCGCG SSGCKTGCSSK ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 24 ssCCCCGCSssk Original Motif Original Motif Backward 2 11 0.017635 Original motif 0.000000 0.444444 0.370370 0.185185 0.111111 0.407407 0.333333 0.148148 0.000000 0.888889 0.037037 0.074074 0.000000 0.888889 0.074074 0.037037 0.000000 0.777778 0.222222 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.037037 0.888889 0.000000 0.074074 0.000000 0.703704 0.296296 0.000000 0.000000 0.518519 0.370370 0.111111 0.111111 0.407407 0.259259 0.222222 0.074074 0.222222 0.407407 0.296296 Consensus sequence: SBCCCCGCCSBB Reverse complement motif 0.074074 0.407407 0.222222 0.296296 0.111111 0.259259 0.407407 0.222222 0.000000 0.370370 0.518519 0.111111 0.000000 0.296296 0.703704 0.000000 0.037037 0.000000 0.888889 0.074074 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.222222 0.777778 0.000000 0.000000 0.074074 0.888889 0.037037 0.000000 0.037037 0.888889 0.074074 0.111111 0.333333 0.407407 0.148148 0.000000 0.370370 0.444444 0.185185 Consensus sequence: BBSGGCGGGGBS Alignment: SBCCCCGCCSBB SSGCKTGCSSK- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 18 sscCCCGCGcs Original Motif Original Motif Forward 1 11 0.019095 Original motif 0.147059 0.441176 0.264706 0.147059 0.117647 0.529412 0.294118 0.058824 0.000000 0.676471 0.235294 0.088235 0.029412 0.852941 0.117647 0.000000 0.000000 0.823529 0.176471 0.000000 0.000000 0.794118 0.205882 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.058824 0.941176 0.000000 0.117647 0.470588 0.235294 0.176471 0.000000 0.323529 0.529412 0.147059 Consensus sequence: BSCCCCGCGBS Reverse complement motif 0.000000 0.529412 0.323529 0.147059 0.117647 0.235294 0.470588 0.176471 0.000000 0.941176 0.058824 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.205882 0.794118 0.000000 0.000000 0.176471 0.823529 0.000000 0.029412 0.117647 0.852941 0.000000 0.000000 0.235294 0.676471 0.088235 0.117647 0.294118 0.529412 0.058824 0.147059 0.264706 0.441176 0.147059 Consensus sequence: SBCGCGGGGSB Alignment: BSCCCCGCGBS SSGCKTGCSSK ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 29 cCGCGGrCACG Original Motif Original Motif Backward 1 11 0.027652 Original motif 0.000000 0.600000 0.200000 0.200000 0.000000 0.800000 0.000000 0.200000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.600000 0.000000 0.400000 0.000000 0.000000 0.800000 0.200000 0.000000 0.800000 0.000000 0.200000 0.000000 0.000000 0.800000 0.200000 0.000000 0.200000 0.000000 0.800000 0.000000 Consensus sequence: CCGCGGRCACG Reverse complement motif 0.200000 0.800000 0.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.200000 0.800000 0.000000 0.000000 0.000000 0.400000 0.600000 0.000000 0.800000 0.200000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.800000 0.200000 0.000000 0.200000 0.600000 0.200000 Consensus sequence: CGTGKCCGCGG Alignment: CCGCGGRCACG SSGCKTGCSSK ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 16 CTCF Original Motif Original Motif Forward 8 11 0.034944 Original motif 0.095290 0.318729 0.083242 0.502738 0.182913 0.158817 0.453450 0.204819 0.307777 0.053669 0.491785 0.146769 0.061336 0.876232 0.023001 0.039430 0.008762 0.989047 0.000000 0.002191 0.814896 0.014239 0.071194 0.099671 0.043812 0.578313 0.365827 0.012048 0.117325 0.474781 0.052632 0.355263 0.933114 0.012061 0.035088 0.019737 0.005488 0.000000 0.991218 0.003293 0.365532 0.003293 0.621295 0.009879 0.059276 0.013172 0.553238 0.374314 0.013187 0.000000 0.978022 0.008791 0.061538 0.008791 0.851648 0.078022 0.114411 0.806381 0.005501 0.073707 0.409241 0.014301 0.557756 0.018702 0.090308 0.530837 0.338106 0.040749 0.128855 0.354626 0.080396 0.436123 0.442731 0.199339 0.292952 0.064978 Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif 0.064978 0.199339 0.292952 0.442731 0.436123 0.354626 0.080396 0.128855 0.090308 0.338106 0.530837 0.040749 0.409241 0.557756 0.014301 0.018702 0.114411 0.005501 0.806381 0.073707 0.061538 0.851648 0.008791 0.078022 0.013187 0.978022 0.000000 0.008791 0.059276 0.553238 0.013172 0.374314 0.365532 0.621295 0.003293 0.009879 0.005488 0.991218 0.000000 0.003293 0.019737 0.012061 0.035088 0.933114 0.117325 0.052632 0.474781 0.355263 0.043812 0.365827 0.578313 0.012048 0.099671 0.014239 0.071194 0.814896 0.008762 0.000000 0.989047 0.002191 0.061336 0.023001 0.876232 0.039430 0.307777 0.491785 0.053669 0.146769 0.182913 0.453450 0.158817 0.204819 0.502738 0.318729 0.083242 0.095290 Consensus sequence: BMSMGCCYMCTKSTGGMHM Alignment: YDRCCASYAGRKGGCRSYV -------SSGCKTGCSSK- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 4 Esrrb Reverse Complement Original Motif Backward 1 11 0.035870 Original motif 0.290198 0.220264 0.271200 0.218337 0.184941 0.227810 0.376477 0.210772 0.115226 0.332236 0.331687 0.220850 0.070959 0.342466 0.122740 0.463836 0.084862 0.729264 0.171640 0.014235 0.909737 0.008753 0.067834 0.013676 0.975656 0.000547 0.016411 0.007385 0.008758 0.001368 0.981390 0.008484 0.005750 0.003286 0.986309 0.004655 0.049904 0.012613 0.066904 0.870579 0.002473 0.927473 0.046703 0.023352 0.951569 0.005504 0.035498 0.007430 Consensus sequence: VBBYCAAGGTCA Reverse complement motif 0.007430 0.005504 0.035498 0.951569 0.002473 0.046703 0.927473 0.023352 0.870579 0.012613 0.066904 0.049904 0.005750 0.986309 0.003286 0.004655 0.008758 0.981390 0.001368 0.008484 0.007385 0.000547 0.016411 0.975656 0.013676 0.008753 0.067834 0.909737 0.084862 0.171640 0.729264 0.014235 0.463836 0.342466 0.122740 0.070959 0.115226 0.331687 0.332236 0.220850 0.184941 0.376477 0.227810 0.210772 0.218337 0.220264 0.271200 0.290198 Consensus sequence: TGACCTTGMBBB Alignment: VBBYCAAGGTCA -YSSGCAYGCSS ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 9 ESR2 Reverse Complement Original Motif Backward 3 11 0.037907 Original motif 0.218487 0.450980 0.176471 0.154062 0.442577 0.142857 0.114846 0.299720 0.521008 0.042017 0.431373 0.005602 0.075630 0.000000 0.770308 0.154062 0.050420 0.056022 0.893557 0.000000 0.036415 0.053221 0.092437 0.817927 0.000000 1.000000 0.000000 0.000000 0.943978 0.002801 0.000000 0.053221 0.137255 0.344538 0.316527 0.201681 0.179272 0.176471 0.417367 0.226891 0.145658 0.170868 0.411765 0.271709 0.058824 0.092437 0.067227 0.781513 0.176471 0.070028 0.742297 0.011204 0.498599 0.277311 0.053221 0.170868 0.095238 0.750700 0.005602 0.148459 0.128852 0.809524 0.000000 0.061625 0.075630 0.252101 0.000000 0.672269 0.168067 0.263305 0.380952 0.187675 Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif 0.168067 0.380952 0.263305 0.187675 0.672269 0.252101 0.000000 0.075630 0.128852 0.000000 0.809524 0.061625 0.095238 0.005602 0.750700 0.148459 0.170868 0.277311 0.053221 0.498599 0.176471 0.742297 0.070028 0.011204 0.781513 0.092437 0.067227 0.058824 0.145658 0.411765 0.170868 0.271709 0.179272 0.417367 0.176471 0.226891 0.137255 0.316527 0.344538 0.201681 0.053221 0.002801 0.000000 0.943978 0.000000 0.000000 1.000000 0.000000 0.817927 0.053221 0.092437 0.036415 0.050420 0.893557 0.056022 0.000000 0.075630 0.770308 0.000000 0.154062 0.005602 0.042017 0.431373 0.521008 0.299720 0.142857 0.114846 0.442577 0.218487 0.176471 0.450980 0.154062 Consensus sequence: BAGGYCABHBTGACCKHV Alignment: VHRGGTCABDBTGMCCTB -----YSSGCAYGCSS-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 7 REST Reverse Complement Original Motif Backward 10 11 0.040932 Original motif 0.132621 0.109365 0.230044 0.527970 0.036318 0.168441 0.091421 0.703820 0.047589 0.855354 0.031309 0.065748 0.906367 0.018727 0.058677 0.016230 0.021197 0.027431 0.945137 0.006234 0.076012 0.609346 0.201246 0.113396 0.980697 0.004359 0.007472 0.007472 0.001868 0.987547 0.007472 0.003113 0.021793 0.922167 0.012453 0.043587 0.568847 0.125234 0.100935 0.204984 0.136534 0.233791 0.077307 0.552369 0.024314 0.004364 0.966958 0.004364 0.012469 0.003117 0.983167 0.001247 0.877105 0.069869 0.021210 0.031815 0.008125 0.800000 0.145625 0.046250 0.983750 0.005625 0.004375 0.006250 0.026349 0.008156 0.959849 0.005646 0.128688 0.632141 0.114878 0.124294 0.229899 0.019472 0.432161 0.318467 0.133962 0.586792 0.200629 0.078616 0.112579 0.700629 0.023270 0.163522 Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif 0.112579 0.023270 0.700629 0.163522 0.133962 0.200629 0.586792 0.078616 0.229899 0.432161 0.019472 0.318467 0.128688 0.114878 0.632141 0.124294 0.026349 0.959849 0.008156 0.005646 0.006250 0.005625 0.004375 0.983750 0.008125 0.145625 0.800000 0.046250 0.031815 0.069869 0.021210 0.877105 0.012469 0.983167 0.003117 0.001247 0.024314 0.966958 0.004364 0.004364 0.552369 0.233791 0.077307 0.136534 0.204984 0.125234 0.100935 0.568847 0.021793 0.012453 0.922167 0.043587 0.001868 0.007472 0.987547 0.003113 0.007472 0.004359 0.007472 0.980697 0.076012 0.201246 0.609346 0.113396 0.021197 0.945137 0.027431 0.006234 0.016230 0.018727 0.058677 0.906367 0.047589 0.031309 0.855354 0.065748 0.703820 0.168441 0.091421 0.036318 0.527970 0.109365 0.230044 0.132621 Consensus sequence: GGYGCTGTCCATGGTGCTGAA Alignment: TTCAGCACCATGGACAGCKCC -YSSGCAYGCSS--------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 14 PPARGRXRA Reverse Complement Original Motif Forward 3 11 0.041419 Original motif 0.109685 0.369895 0.373396 0.147025 0.117716 0.193473 0.148019 0.540793 0.453488 0.026744 0.427907 0.091860 0.116144 0.003484 0.779326 0.101045 0.161253 0.017401 0.781903 0.039443 0.168213 0.149652 0.458237 0.223898 0.082271 0.633835 0.207416 0.076477 0.949015 0.024334 0.017381 0.009270 0.604867 0.055620 0.312862 0.026651 0.825231 0.005787 0.158565 0.010417 0.095017 0.002317 0.888760 0.013905 0.047509 0.010429 0.803013 0.139050 0.025492 0.114716 0.304751 0.555041 0.062645 0.643852 0.167053 0.126450 0.784223 0.067285 0.054524 0.093968 Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif 0.093968 0.067285 0.054524 0.784223 0.062645 0.167053 0.643852 0.126450 0.555041 0.114716 0.304751 0.025492 0.047509 0.803013 0.010429 0.139050 0.095017 0.888760 0.002317 0.013905 0.010417 0.005787 0.158565 0.825231 0.026651 0.055620 0.312862 0.604867 0.009270 0.024334 0.017381 0.949015 0.082271 0.207416 0.633835 0.076477 0.168213 0.458237 0.149652 0.223898 0.161253 0.781903 0.017401 0.039443 0.116144 0.779326 0.003484 0.101045 0.091860 0.026744 0.427907 0.453488 0.540793 0.193473 0.148019 0.117716 0.109685 0.373396 0.369895 0.147025 Consensus sequence: TGRCCTKTGHCCKAB Alignment: BTRGGDCARAGGKCA --YSSGCAYGCSS-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 1 HNF4A Reverse Complement Original Motif Forward 3 11 0.043798 Original motif 0.417910 0.104478 0.402985 0.074627 0.029851 0.029851 0.835821 0.104478 0.179104 0.059701 0.522388 0.238806 0.074627 0.343284 0.298507 0.283582 0.044776 0.761194 0.059701 0.134328 0.880597 0.014925 0.044776 0.059701 0.791045 0.029851 0.149254 0.029851 0.835821 0.014925 0.119403 0.029851 0.059701 0.059701 0.865672 0.014925 0.089552 0.029851 0.492537 0.388060 0.044776 0.328358 0.164179 0.462687 0.059701 0.731343 0.074627 0.134328 0.626866 0.104478 0.149254 0.119403 Consensus sequence: RGGBCAAAGKYCA Reverse complement motif 0.119403 0.104478 0.149254 0.626866 0.059701 0.074627 0.731343 0.134328 0.462687 0.328358 0.164179 0.044776 0.089552 0.492537 0.029851 0.388060 0.059701 0.865672 0.059701 0.014925 0.029851 0.014925 0.119403 0.835821 0.029851 0.029851 0.149254 0.791045 0.059701 0.014925 0.044776 0.880597 0.044776 0.059701 0.761194 0.134328 0.074627 0.298507 0.343284 0.283582 0.179104 0.522388 0.059701 0.238806 0.029851 0.835821 0.029851 0.104478 0.074627 0.104478 0.402985 0.417910 Consensus sequence: TGMYCTTTGBCCK Alignment: RGGBCAAAGKYCA --YSSGCAYGCSS ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 2 Motif ID: 29 Motif name: cCGCGGrCACG Original motif 0.000000 0.600000 0.200000 0.200000 0.000000 0.800000 0.000000 0.200000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.600000 0.000000 0.400000 0.000000 0.000000 0.800000 0.200000 0.000000 0.800000 0.000000 0.200000 0.000000 0.000000 0.800000 0.200000 0.000000 0.200000 0.000000 0.800000 0.000000 Consensus sequence: CCGCGGRCACG Reserve complement motif 0.200000 0.800000 0.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.200000 0.800000 0.000000 0.000000 0.000000 0.400000 0.600000 0.000000 0.800000 0.200000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.800000 0.200000 0.000000 0.200000 0.600000 0.200000 Consensus sequence: CGTGKCCGCGG ************************************************************************ Best Matches for Motif ID 29 (Highest to Lowest) ************************************************************************ Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 32 gCGCGCsCgsG Original Motif Original Motif Backward 1 11 0.010473 Original motif 0.105263 0.210526 0.526316 0.157895 0.000000 0.736842 0.105263 0.157895 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.368421 0.631579 0.000000 0.000000 0.894737 0.105263 0.000000 0.157895 0.157895 0.631579 0.052632 0.052632 0.631579 0.263158 0.052632 0.105263 0.052632 0.789474 0.052632 Consensus sequence: GCGCGCSCGCG Reverse complement motif 0.105263 0.789474 0.052632 0.052632 0.052632 0.263158 0.631579 0.052632 0.157895 0.631579 0.157895 0.052632 0.000000 0.105263 0.894737 0.000000 0.000000 0.631579 0.368421 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.105263 0.736842 0.157895 0.105263 0.526316 0.210526 0.157895 Consensus sequence: CGCGSGCGCGC Alignment: GCGCGCSCGCG CCGCGGRCACG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 7 REST Original Motif Original Motif Backward 4 11 0.048444 Original motif 0.132621 0.109365 0.230044 0.527970 0.036318 0.168441 0.091421 0.703820 0.047589 0.855354 0.031309 0.065748 0.906367 0.018727 0.058677 0.016230 0.021197 0.027431 0.945137 0.006234 0.076012 0.609346 0.201246 0.113396 0.980697 0.004359 0.007472 0.007472 0.001868 0.987547 0.007472 0.003113 0.021793 0.922167 0.012453 0.043587 0.568847 0.125234 0.100935 0.204984 0.136534 0.233791 0.077307 0.552369 0.024314 0.004364 0.966958 0.004364 0.012469 0.003117 0.983167 0.001247 0.877105 0.069869 0.021210 0.031815 0.008125 0.800000 0.145625 0.046250 0.983750 0.005625 0.004375 0.006250 0.026349 0.008156 0.959849 0.005646 0.128688 0.632141 0.114878 0.124294 0.229899 0.019472 0.432161 0.318467 0.133962 0.586792 0.200629 0.078616 0.112579 0.700629 0.023270 0.163522 Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif 0.112579 0.023270 0.700629 0.163522 0.133962 0.200629 0.586792 0.078616 0.229899 0.432161 0.019472 0.318467 0.128688 0.114878 0.632141 0.124294 0.026349 0.959849 0.008156 0.005646 0.006250 0.005625 0.004375 0.983750 0.008125 0.145625 0.800000 0.046250 0.031815 0.069869 0.021210 0.877105 0.012469 0.983167 0.003117 0.001247 0.024314 0.966958 0.004364 0.004364 0.552369 0.233791 0.077307 0.136534 0.204984 0.125234 0.100935 0.568847 0.021793 0.012453 0.922167 0.043587 0.001868 0.007472 0.987547 0.003113 0.007472 0.004359 0.007472 0.980697 0.076012 0.201246 0.609346 0.113396 0.021197 0.945137 0.027431 0.006234 0.016230 0.018727 0.058677 0.906367 0.047589 0.031309 0.855354 0.065748 0.703820 0.168441 0.091421 0.036318 0.527970 0.109365 0.230044 0.132621 Consensus sequence: GGYGCTGTCCATGGTGCTGAA Alignment: TTCAGCACCATGGACAGCKCC -------CCGCGGRCACG--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 3 ESR1 Reverse Complement Reverse Complement Backward 3 11 0.048658 Original motif 0.261242 0.256959 0.329764 0.152034 0.228632 0.170940 0.350427 0.250000 0.136752 0.369658 0.318376 0.175214 0.176596 0.487234 0.138298 0.197872 0.285106 0.493617 0.100000 0.121277 0.651163 0.059197 0.188161 0.101480 0.075949 0.016878 0.816456 0.090717 0.040000 0.037895 0.884211 0.037895 0.069474 0.086316 0.191579 0.652632 0.008421 0.829474 0.111579 0.050526 0.837895 0.027368 0.056842 0.077895 0.122105 0.526316 0.225263 0.126316 0.132632 0.581053 0.111579 0.174737 0.134737 0.543158 0.204211 0.117895 0.067368 0.040000 0.016842 0.875789 0.044211 0.046316 0.896842 0.012632 0.642105 0.223158 0.065263 0.069474 0.021053 0.917895 0.025263 0.035789 0.124211 0.743158 0.004211 0.128421 0.054737 0.347368 0.046316 0.551579 Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif 0.551579 0.347368 0.046316 0.054737 0.124211 0.004211 0.743158 0.128421 0.021053 0.025263 0.917895 0.035789 0.069474 0.223158 0.065263 0.642105 0.044211 0.896842 0.046316 0.012632 0.875789 0.040000 0.016842 0.067368 0.134737 0.204211 0.543158 0.117895 0.132632 0.111579 0.581053 0.174737 0.122105 0.225263 0.526316 0.126316 0.077895 0.027368 0.056842 0.837895 0.008421 0.111579 0.829474 0.050526 0.652632 0.086316 0.191579 0.069474 0.040000 0.884211 0.037895 0.037895 0.075949 0.816456 0.016878 0.090717 0.101480 0.059197 0.188161 0.651163 0.285106 0.100000 0.493617 0.121277 0.176596 0.138298 0.487234 0.197872 0.136752 0.318376 0.369658 0.175214 0.228632 0.350427 0.170940 0.250000 0.261242 0.329764 0.256959 0.152034 Consensus sequence: MGGTCAGGGTGACCTRDBHV Alignment: MGGTCAGGGTGACCTRDBHV -------CGTGKCCGCGG-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 28 ssGCkTGCssk Original Motif Original Motif Backward 1 11 0.050306 Original motif 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 0.500000 0.500000 Consensus sequence: SSGCKTGCSSK Reverse complement motif 0.000000 0.500000 0.000000 0.500000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.000000 0.500000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 Consensus sequence: YSSGCAYGCSS Alignment: SSGCKTGCSSK CCGCGGRCACG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 24 ssCCCCGCSssk Reverse Complement Reverse Complement Backward 2 11 0.055777 Original motif 0.000000 0.444444 0.370370 0.185185 0.111111 0.407407 0.333333 0.148148 0.000000 0.888889 0.037037 0.074074 0.000000 0.888889 0.074074 0.037037 0.000000 0.777778 0.222222 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.037037 0.888889 0.000000 0.074074 0.000000 0.703704 0.296296 0.000000 0.000000 0.518519 0.370370 0.111111 0.111111 0.407407 0.259259 0.222222 0.074074 0.222222 0.407407 0.296296 Consensus sequence: SBCCCCGCCSBB Reverse complement motif 0.074074 0.407407 0.222222 0.296296 0.111111 0.259259 0.407407 0.222222 0.000000 0.370370 0.518519 0.111111 0.000000 0.296296 0.703704 0.000000 0.037037 0.000000 0.888889 0.074074 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.222222 0.777778 0.000000 0.000000 0.074074 0.888889 0.037037 0.000000 0.037037 0.888889 0.074074 0.111111 0.333333 0.407407 0.148148 0.000000 0.370370 0.444444 0.185185 Consensus sequence: BBSGGCGGGGBS Alignment: BBSGGCGGGGBS CGTGKCCGCGG- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 16 CTCF Original Motif Original Motif Forward 8 11 0.058866 Original motif 0.095290 0.318729 0.083242 0.502738 0.182913 0.158817 0.453450 0.204819 0.307777 0.053669 0.491785 0.146769 0.061336 0.876232 0.023001 0.039430 0.008762 0.989047 0.000000 0.002191 0.814896 0.014239 0.071194 0.099671 0.043812 0.578313 0.365827 0.012048 0.117325 0.474781 0.052632 0.355263 0.933114 0.012061 0.035088 0.019737 0.005488 0.000000 0.991218 0.003293 0.365532 0.003293 0.621295 0.009879 0.059276 0.013172 0.553238 0.374314 0.013187 0.000000 0.978022 0.008791 0.061538 0.008791 0.851648 0.078022 0.114411 0.806381 0.005501 0.073707 0.409241 0.014301 0.557756 0.018702 0.090308 0.530837 0.338106 0.040749 0.128855 0.354626 0.080396 0.436123 0.442731 0.199339 0.292952 0.064978 Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif 0.064978 0.199339 0.292952 0.442731 0.436123 0.354626 0.080396 0.128855 0.090308 0.338106 0.530837 0.040749 0.409241 0.557756 0.014301 0.018702 0.114411 0.005501 0.806381 0.073707 0.061538 0.851648 0.008791 0.078022 0.013187 0.978022 0.000000 0.008791 0.059276 0.553238 0.013172 0.374314 0.365532 0.621295 0.003293 0.009879 0.005488 0.991218 0.000000 0.003293 0.019737 0.012061 0.035088 0.933114 0.117325 0.052632 0.474781 0.355263 0.043812 0.365827 0.578313 0.012048 0.099671 0.014239 0.071194 0.814896 0.008762 0.000000 0.989047 0.002191 0.061336 0.023001 0.876232 0.039430 0.307777 0.491785 0.053669 0.146769 0.182913 0.453450 0.158817 0.204819 0.502738 0.318729 0.083242 0.095290 Consensus sequence: BMSMGCCYMCTKSTGGMHM Alignment: YDRCCASYAGRKGGCRSYV -------CCGCGGRCACG- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 14 PPARGRXRA Reverse Complement Reverse Complement Backward 2 11 0.062948 Original motif 0.109685 0.369895 0.373396 0.147025 0.117716 0.193473 0.148019 0.540793 0.453488 0.026744 0.427907 0.091860 0.116144 0.003484 0.779326 0.101045 0.161253 0.017401 0.781903 0.039443 0.168213 0.149652 0.458237 0.223898 0.082271 0.633835 0.207416 0.076477 0.949015 0.024334 0.017381 0.009270 0.604867 0.055620 0.312862 0.026651 0.825231 0.005787 0.158565 0.010417 0.095017 0.002317 0.888760 0.013905 0.047509 0.010429 0.803013 0.139050 0.025492 0.114716 0.304751 0.555041 0.062645 0.643852 0.167053 0.126450 0.784223 0.067285 0.054524 0.093968 Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif 0.093968 0.067285 0.054524 0.784223 0.062645 0.167053 0.643852 0.126450 0.555041 0.114716 0.304751 0.025492 0.047509 0.803013 0.010429 0.139050 0.095017 0.888760 0.002317 0.013905 0.010417 0.005787 0.158565 0.825231 0.026651 0.055620 0.312862 0.604867 0.009270 0.024334 0.017381 0.949015 0.082271 0.207416 0.633835 0.076477 0.168213 0.458237 0.149652 0.223898 0.161253 0.781903 0.017401 0.039443 0.116144 0.779326 0.003484 0.101045 0.091860 0.026744 0.427907 0.453488 0.540793 0.193473 0.148019 0.117716 0.109685 0.373396 0.369895 0.147025 Consensus sequence: TGRCCTKTGHCCKAB Alignment: TGRCCTKTGHCCKAB ---CGTGKCCGCGG- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 18 sscCCCGCGcs Original Motif Original Motif Forward 1 11 0.065145 Original motif 0.147059 0.441176 0.264706 0.147059 0.117647 0.529412 0.294118 0.058824 0.000000 0.676471 0.235294 0.088235 0.029412 0.852941 0.117647 0.000000 0.000000 0.823529 0.176471 0.000000 0.000000 0.794118 0.205882 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.058824 0.941176 0.000000 0.117647 0.470588 0.235294 0.176471 0.000000 0.323529 0.529412 0.147059 Consensus sequence: BSCCCCGCGBS Reverse complement motif 0.000000 0.529412 0.323529 0.147059 0.117647 0.235294 0.470588 0.176471 0.000000 0.941176 0.058824 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.205882 0.794118 0.000000 0.000000 0.176471 0.823529 0.000000 0.029412 0.117647 0.852941 0.000000 0.000000 0.235294 0.676471 0.088235 0.117647 0.294118 0.529412 0.058824 0.147059 0.264706 0.441176 0.147059 Consensus sequence: SBCGCGGGGSB Alignment: BSCCCCGCGBS CCGCGGRCACG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 9 ESR2 Reverse Complement Reverse Complement Forward 9 10 0.551597 Original motif 0.218487 0.450980 0.176471 0.154062 0.442577 0.142857 0.114846 0.299720 0.521008 0.042017 0.431373 0.005602 0.075630 0.000000 0.770308 0.154062 0.050420 0.056022 0.893557 0.000000 0.036415 0.053221 0.092437 0.817927 0.000000 1.000000 0.000000 0.000000 0.943978 0.002801 0.000000 0.053221 0.137255 0.344538 0.316527 0.201681 0.179272 0.176471 0.417367 0.226891 0.145658 0.170868 0.411765 0.271709 0.058824 0.092437 0.067227 0.781513 0.176471 0.070028 0.742297 0.011204 0.498599 0.277311 0.053221 0.170868 0.095238 0.750700 0.005602 0.148459 0.128852 0.809524 0.000000 0.061625 0.075630 0.252101 0.000000 0.672269 0.168067 0.263305 0.380952 0.187675 Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif 0.168067 0.380952 0.263305 0.187675 0.672269 0.252101 0.000000 0.075630 0.128852 0.000000 0.809524 0.061625 0.095238 0.005602 0.750700 0.148459 0.170868 0.277311 0.053221 0.498599 0.176471 0.742297 0.070028 0.011204 0.781513 0.092437 0.067227 0.058824 0.145658 0.411765 0.170868 0.271709 0.179272 0.417367 0.176471 0.226891 0.137255 0.316527 0.344538 0.201681 0.053221 0.002801 0.000000 0.943978 0.000000 0.000000 1.000000 0.000000 0.817927 0.053221 0.092437 0.036415 0.050420 0.893557 0.056022 0.000000 0.075630 0.770308 0.000000 0.154062 0.005602 0.042017 0.431373 0.521008 0.299720 0.142857 0.114846 0.442577 0.218487 0.176471 0.450980 0.154062 Consensus sequence: BAGGYCABHBTGACCKHV Alignment: BAGGYCABHBTGACCKHV- --------CGTGKCCGCGG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 8 Myc Reverse Complement Original Motif Forward 2 9 1.048798 Original motif 0.295154 0.422907 0.158590 0.123348 0.149780 0.233480 0.572687 0.044053 0.035242 0.964758 0.000000 0.000000 0.955947 0.017621 0.022026 0.004405 0.000000 0.933921 0.013216 0.052863 0.083700 0.008811 0.898678 0.008811 0.039648 0.193833 0.000000 0.766520 0.000000 0.008811 0.951542 0.039648 0.000000 0.074890 0.806167 0.118943 0.198238 0.471366 0.105727 0.224670 Consensus sequence: VGCACGTGGH Reverse complement motif 0.198238 0.105727 0.471366 0.224670 0.000000 0.806167 0.074890 0.118943 0.000000 0.951542 0.008811 0.039648 0.766520 0.193833 0.000000 0.039648 0.083700 0.898678 0.008811 0.008811 0.000000 0.013216 0.933921 0.052863 0.004405 0.017621 0.022026 0.955947 0.035242 0.000000 0.964758 0.000000 0.149780 0.572687 0.233480 0.044053 0.295154 0.158590 0.422907 0.123348 Consensus sequence: DCCACGTGCV Alignment: VGCACGTGGH-- -CGTGKCCGCGG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 2 Motif ID: 30 Motif name: taaacgatgcc Original motif 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 Consensus sequence: TAAACGATGCC Reserve complement motif 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 Consensus sequence: GGCATCGTTTA ************************************************************************ Best Matches for Motif ID 30 (Highest to Lowest) ************************************************************************ Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 10 NR1H2RXRA Original Motif Reverse Complement Forward 5 11 0.051136 Original motif 0.680000 0.200000 0.000000 0.120000 0.680000 0.040000 0.200000 0.080000 0.800000 0.000000 0.200000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.040000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.000000 0.040000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.800000 0.040000 0.080000 0.080000 0.000000 0.600000 0.240000 0.160000 Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif 0.000000 0.240000 0.600000 0.160000 0.080000 0.040000 0.080000 0.800000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.040000 0.000000 0.000000 0.960000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.040000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.200000 0.800000 0.080000 0.040000 0.200000 0.680000 0.120000 0.200000 0.000000 0.680000 Consensus sequence: GTTGACCTTTGACCTTT Alignment: GTTGACCTTTGACCTTT ----TAAACGATGCC-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 2 NR2F1 Original Motif Original Motif Forward 1 11 0.056381 Original motif 0.000000 0.000000 0.153846 0.846154 0.076923 0.000000 0.923077 0.000000 0.923077 0.000000 0.076923 0.000000 0.461538 0.538462 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.230769 0.000000 0.769231 0.000000 0.153846 0.000000 0.846154 0.076923 0.000000 0.000000 0.923077 0.153846 0.000000 0.846154 0.000000 0.461538 0.307692 0.230769 0.000000 0.461538 0.384615 0.076923 0.076923 0.076923 0.769231 0.076923 0.076923 0.230769 0.461538 0.000000 0.307692 0.000000 0.230769 0.230769 0.538462 Consensus sequence: TGAMCTTTGMMCYT Reverse complement motif 0.538462 0.230769 0.230769 0.000000 0.230769 0.000000 0.461538 0.307692 0.076923 0.076923 0.769231 0.076923 0.076923 0.384615 0.076923 0.461538 0.000000 0.307692 0.230769 0.461538 0.153846 0.846154 0.000000 0.000000 0.923077 0.000000 0.000000 0.076923 0.846154 0.153846 0.000000 0.000000 0.769231 0.230769 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.461538 0.000000 0.538462 0.000000 0.000000 0.000000 0.076923 0.923077 0.076923 0.923077 0.000000 0.000000 0.846154 0.000000 0.153846 0.000000 Consensus sequence: AKGYYCAAAGRTCA Alignment: TGAMCTTTGMMCYT TAAACGATGCC--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 19 atactttggc Reverse Complement Reverse Complement Forward 1 10 0.537500 Original motif 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 Consensus sequence: ATACTTTGGC Reverse complement motif 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 Consensus sequence: GCCAAAGTAT Alignment: GCCAAAGTAT- GGCATCGTTTA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 31 ctatacggacg Original Motif Original Motif Forward 2 10 0.562500 Original motif 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 Consensus sequence: CTATACGGACG Reverse complement motif 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 Consensus sequence: CGTCCGTATAG Alignment: CTATACGGACG- -TAAACGATGCC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 27 AgTGCTCCACTGTGgTGTCACAgT Original Motif Reverse Complement Forward 17 8 1.555018 Original motif 0.690141 0.126761 0.042254 0.140845 0.169014 0.098592 0.676056 0.056338 0.042254 0.028169 0.028169 0.901408 0.056338 0.000000 0.774648 0.169014 0.042254 0.887324 0.042254 0.028169 0.000000 0.014085 0.000000 0.985915 0.056338 0.830986 0.042254 0.070423 0.028169 0.957746 0.014085 0.000000 0.957746 0.000000 0.014085 0.028169 0.084507 0.845070 0.014085 0.056338 0.028169 0.014085 0.000000 0.957746 0.140845 0.028169 0.802817 0.028169 0.014085 0.014085 0.014085 0.957746 0.014085 0.000000 0.929577 0.056338 0.056338 0.154930 0.619718 0.169014 0.014085 0.028169 0.000000 0.957746 0.056338 0.014085 0.873239 0.056338 0.014085 0.000000 0.000000 0.985915 0.042254 0.929577 0.000000 0.028169 0.957746 0.028169 0.000000 0.014085 0.028169 0.845070 0.028169 0.098592 0.873239 0.014085 0.042254 0.070423 0.098592 0.154930 0.563380 0.183099 0.070423 0.014085 0.112676 0.802817 Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif 0.802817 0.014085 0.112676 0.070423 0.098592 0.563380 0.154930 0.183099 0.070423 0.014085 0.042254 0.873239 0.028169 0.028169 0.845070 0.098592 0.014085 0.028169 0.000000 0.957746 0.042254 0.000000 0.929577 0.028169 0.985915 0.000000 0.000000 0.014085 0.056338 0.873239 0.014085 0.056338 0.957746 0.028169 0.000000 0.014085 0.056338 0.619718 0.154930 0.169014 0.014085 0.929577 0.000000 0.056338 0.957746 0.014085 0.014085 0.014085 0.140845 0.802817 0.028169 0.028169 0.957746 0.014085 0.000000 0.028169 0.084507 0.014085 0.845070 0.056338 0.028169 0.000000 0.014085 0.957746 0.028169 0.014085 0.957746 0.000000 0.056338 0.042254 0.830986 0.070423 0.985915 0.014085 0.000000 0.000000 0.042254 0.042254 0.887324 0.028169 0.056338 0.774648 0.000000 0.169014 0.901408 0.028169 0.028169 0.042254 0.169014 0.676056 0.098592 0.056338 0.140845 0.126761 0.042254 0.690141 Consensus sequence: ACTGTGACACCACAGTGGAGCACT Alignment: ACTGTGACACCACAGTGGAGCACT--- ----------------TAAACGATGCC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 21 AmTGTGACACCACAGT Original Motif Original Motif Backward 9 8 1.559082 Original motif 0.703125 0.187500 0.015625 0.093750 0.265625 0.500000 0.125000 0.109375 0.015625 0.046875 0.031250 0.906250 0.078125 0.015625 0.890625 0.015625 0.000000 0.000000 0.000000 1.000000 0.000000 0.031250 0.906250 0.062500 0.953125 0.000000 0.015625 0.031250 0.046875 0.890625 0.000000 0.062500 0.968750 0.000000 0.015625 0.015625 0.109375 0.781250 0.062500 0.046875 0.062500 0.890625 0.000000 0.046875 0.953125 0.000000 0.031250 0.015625 0.031250 0.781250 0.046875 0.140625 0.937500 0.015625 0.031250 0.015625 0.093750 0.078125 0.734375 0.093750 0.031250 0.078125 0.000000 0.890625 Consensus sequence: AMTGTGACACCACAGT Reverse complement motif 0.890625 0.078125 0.000000 0.031250 0.093750 0.734375 0.078125 0.093750 0.015625 0.015625 0.031250 0.937500 0.031250 0.046875 0.781250 0.140625 0.015625 0.000000 0.031250 0.953125 0.062500 0.000000 0.890625 0.046875 0.109375 0.062500 0.781250 0.046875 0.015625 0.000000 0.015625 0.968750 0.046875 0.000000 0.890625 0.062500 0.031250 0.000000 0.015625 0.953125 0.000000 0.906250 0.031250 0.062500 1.000000 0.000000 0.000000 0.000000 0.078125 0.890625 0.015625 0.015625 0.906250 0.046875 0.031250 0.015625 0.265625 0.125000 0.500000 0.109375 0.093750 0.187500 0.015625 0.703125 Consensus sequence: ACTGTGGTGTCACART Alignment: ---AMTGTGACACCACAGT TAAACGATGCC-------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 29 cCGCGGrCACG Reverse Complement Reverse Complement Forward 4 8 1.562500 Original motif 0.000000 0.600000 0.200000 0.200000 0.000000 0.800000 0.000000 0.200000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.600000 0.000000 0.400000 0.000000 0.000000 0.800000 0.200000 0.000000 0.800000 0.000000 0.200000 0.000000 0.000000 0.800000 0.200000 0.000000 0.200000 0.000000 0.800000 0.000000 Consensus sequence: CCGCGGRCACG Reverse complement motif 0.200000 0.800000 0.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.200000 0.800000 0.000000 0.000000 0.000000 0.400000 0.600000 0.000000 0.800000 0.200000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.800000 0.200000 0.000000 0.200000 0.600000 0.200000 Consensus sequence: CGTGKCCGCGG Alignment: CGTGKCCGCGG--- ---GGCATCGTTTA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 33 srACyCCGAyr Original Motif Original Motif Backward 5 7 2.044643 Original motif 0.000000 0.500000 0.500000 0.000000 0.500000 0.000000 0.500000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.000000 0.500000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.000000 0.500000 0.500000 0.000000 0.500000 0.000000 Consensus sequence: SRACYCCGAYR Reverse complement motif 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.500000 0.500000 0.000000 Consensus sequence: KKTCGGKGTKS Alignment: ----SRACYCCGAYR TAAACGATGCC---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 16 CTCF Original Motif Reverse Complement Forward 13 7 2.054157 Original motif 0.095290 0.318729 0.083242 0.502738 0.182913 0.158817 0.453450 0.204819 0.307777 0.053669 0.491785 0.146769 0.061336 0.876232 0.023001 0.039430 0.008762 0.989047 0.000000 0.002191 0.814896 0.014239 0.071194 0.099671 0.043812 0.578313 0.365827 0.012048 0.117325 0.474781 0.052632 0.355263 0.933114 0.012061 0.035088 0.019737 0.005488 0.000000 0.991218 0.003293 0.365532 0.003293 0.621295 0.009879 0.059276 0.013172 0.553238 0.374314 0.013187 0.000000 0.978022 0.008791 0.061538 0.008791 0.851648 0.078022 0.114411 0.806381 0.005501 0.073707 0.409241 0.014301 0.557756 0.018702 0.090308 0.530837 0.338106 0.040749 0.128855 0.354626 0.080396 0.436123 0.442731 0.199339 0.292952 0.064978 Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif 0.064978 0.199339 0.292952 0.442731 0.436123 0.354626 0.080396 0.128855 0.090308 0.338106 0.530837 0.040749 0.409241 0.557756 0.014301 0.018702 0.114411 0.005501 0.806381 0.073707 0.061538 0.851648 0.008791 0.078022 0.013187 0.978022 0.000000 0.008791 0.059276 0.553238 0.013172 0.374314 0.365532 0.621295 0.003293 0.009879 0.005488 0.991218 0.000000 0.003293 0.019737 0.012061 0.035088 0.933114 0.117325 0.052632 0.474781 0.355263 0.043812 0.365827 0.578313 0.012048 0.099671 0.014239 0.071194 0.814896 0.008762 0.000000 0.989047 0.002191 0.061336 0.023001 0.876232 0.039430 0.307777 0.491785 0.053669 0.146769 0.182913 0.453450 0.158817 0.204819 0.502738 0.318729 0.083242 0.095290 Consensus sequence: BMSMGCCYMCTKSTGGMHM Alignment: BMSMGCCYMCTKSTGGMHM---- ------------TAAACGATGCC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 20 CagTGCTCCACTGTGgT Reverse Complement Reverse Complement Forward 11 7 2.059524 Original motif 0.150000 0.700000 0.016667 0.133333 0.650000 0.150000 0.050000 0.150000 0.166667 0.116667 0.633333 0.083333 0.050000 0.033333 0.066667 0.850000 0.050000 0.000000 0.833333 0.116667 0.016667 0.966667 0.000000 0.016667 0.050000 0.016667 0.000000 0.933333 0.066667 0.833333 0.066667 0.033333 0.033333 0.966667 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.050000 0.916667 0.016667 0.016667 0.166667 0.000000 0.000000 0.833333 0.083333 0.016667 0.900000 0.000000 0.000000 0.016667 0.016667 0.966667 0.000000 0.016667 0.966667 0.016667 0.116667 0.166667 0.483333 0.233333 0.066667 0.083333 0.050000 0.800000 Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif 0.800000 0.083333 0.050000 0.066667 0.116667 0.483333 0.166667 0.233333 0.000000 0.966667 0.016667 0.016667 0.966667 0.016667 0.016667 0.000000 0.083333 0.900000 0.016667 0.000000 0.833333 0.000000 0.000000 0.166667 0.050000 0.016667 0.916667 0.016667 0.000000 0.000000 0.000000 1.000000 0.033333 0.000000 0.966667 0.000000 0.066667 0.066667 0.833333 0.033333 0.933333 0.016667 0.000000 0.050000 0.016667 0.000000 0.966667 0.016667 0.050000 0.833333 0.000000 0.116667 0.850000 0.033333 0.066667 0.050000 0.166667 0.633333 0.116667 0.083333 0.150000 0.150000 0.050000 0.650000 0.150000 0.016667 0.700000 0.133333 Consensus sequence: ABCACAGTGGAGCACTG Alignment: ABCACAGTGGAGCACTG---- ----------GGCATCGTTTA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 2 Motif ID: 31 Motif name: ctatacggacg Original motif 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 Consensus sequence: CTATACGGACG Reserve complement motif 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 Consensus sequence: CGTCCGTATAG ************************************************************************ Best Matches for Motif ID 31 (Highest to Lowest) ************************************************************************ Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 33 srACyCCGAyr Original Motif Original Motif Backward 1 11 0.080357 Original motif 0.000000 0.500000 0.500000 0.000000 0.500000 0.000000 0.500000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.000000 0.500000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.000000 0.500000 0.500000 0.000000 0.500000 0.000000 Consensus sequence: SRACYCCGAYR Reverse complement motif 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.500000 0.500000 0.000000 Consensus sequence: KKTCGGKGTKS Alignment: SRACYCCGAYR CTATACGGACG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 30 taaacgatgcc Reverse Complement Reverse Complement Forward 2 10 0.580357 Original motif 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 Consensus sequence: TAAACGATGCC Reverse complement motif 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 Consensus sequence: GGCATCGTTTA Alignment: GGCATCGTTTA- -CGTCCGTATAG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 13 MIZF Reverse Complement Reverse Complement Forward 2 9 1.062302 Original motif 0.100000 0.300000 0.250000 0.350000 0.650000 0.050000 0.000000 0.300000 1.000000 0.000000 0.000000 0.000000 0.100000 0.850000 0.050000 0.000000 0.000000 0.000000 0.950000 0.050000 0.000000 0.050000 0.000000 0.950000 0.000000 0.950000 0.000000 0.050000 0.000000 0.900000 0.100000 0.000000 0.000000 0.000000 0.950000 0.050000 0.100000 0.650000 0.050000 0.200000 Consensus sequence: BAACGTCCGC Reverse complement motif 0.100000 0.050000 0.650000 0.200000 0.000000 0.950000 0.000000 0.050000 0.000000 0.100000 0.900000 0.000000 0.000000 0.000000 0.950000 0.050000 0.950000 0.050000 0.000000 0.000000 0.000000 0.950000 0.000000 0.050000 0.100000 0.050000 0.850000 0.000000 0.000000 0.000000 0.000000 1.000000 0.300000 0.050000 0.000000 0.650000 0.350000 0.300000 0.250000 0.100000 Consensus sequence: GCGGACGTTV Alignment: GCGGACGTTV-- -CGTCCGTATAG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 19 atactttggc Original Motif Original Motif Backward 2 9 1.066468 Original motif 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 Consensus sequence: ATACTTTGGC Reverse complement motif 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 Consensus sequence: GCCAAAGTAT Alignment: --ATACTTTGGC CTATACGGACG- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 29 cCGCGGrCACG Original Motif Original Motif Backward 3 9 1.077579 Original motif 0.000000 0.600000 0.200000 0.200000 0.000000 0.800000 0.000000 0.200000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.600000 0.000000 0.400000 0.000000 0.000000 0.800000 0.200000 0.000000 0.800000 0.000000 0.200000 0.000000 0.000000 0.800000 0.200000 0.000000 0.200000 0.000000 0.800000 0.000000 Consensus sequence: CCGCGGRCACG Reverse complement motif 0.200000 0.800000 0.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.200000 0.800000 0.000000 0.000000 0.000000 0.400000 0.600000 0.000000 0.800000 0.200000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.800000 0.200000 0.000000 0.200000 0.600000 0.200000 Consensus sequence: CGTGKCCGCGG Alignment: --CCGCGGRCACG CTATACGGACG-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 28 ssGCkTGCssk Reverse Complement Original Motif Backward 4 8 1.564732 Original motif 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 0.500000 0.500000 Consensus sequence: SSGCKTGCSSK Reverse complement motif 0.000000 0.500000 0.000000 0.500000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.000000 0.500000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 Consensus sequence: YSSGCAYGCSS Alignment: ---SSGCKTGCSSK CGTCCGTATAG--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 32 gCGCGCsCgsG Reverse Complement Original Motif Forward 4 8 1.578712 Original motif 0.105263 0.210526 0.526316 0.157895 0.000000 0.736842 0.105263 0.157895 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.368421 0.631579 0.000000 0.000000 0.894737 0.105263 0.000000 0.157895 0.157895 0.631579 0.052632 0.052632 0.631579 0.263158 0.052632 0.105263 0.052632 0.789474 0.052632 Consensus sequence: GCGCGCSCGCG Reverse complement motif 0.105263 0.789474 0.052632 0.052632 0.052632 0.263158 0.631579 0.052632 0.157895 0.631579 0.157895 0.052632 0.000000 0.105263 0.894737 0.000000 0.000000 0.631579 0.368421 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.105263 0.736842 0.157895 0.105263 0.526316 0.210526 0.157895 Consensus sequence: CGCGSGCGCGC Alignment: GCGCGCSCGCG--- ---CGTCCGTATAG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 24 ssCCCCGCSssk Original Motif Reverse Complement Forward 6 7 2.067791 Original motif 0.000000 0.444444 0.370370 0.185185 0.111111 0.407407 0.333333 0.148148 0.000000 0.888889 0.037037 0.074074 0.000000 0.888889 0.074074 0.037037 0.000000 0.777778 0.222222 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.037037 0.888889 0.000000 0.074074 0.000000 0.703704 0.296296 0.000000 0.000000 0.518519 0.370370 0.111111 0.111111 0.407407 0.259259 0.222222 0.074074 0.222222 0.407407 0.296296 Consensus sequence: SBCCCCGCCSBB Reverse complement motif 0.074074 0.407407 0.222222 0.296296 0.111111 0.259259 0.407407 0.222222 0.000000 0.370370 0.518519 0.111111 0.000000 0.296296 0.703704 0.000000 0.037037 0.000000 0.888889 0.074074 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.222222 0.777778 0.000000 0.000000 0.074074 0.888889 0.037037 0.000000 0.037037 0.888889 0.074074 0.111111 0.333333 0.407407 0.148148 0.000000 0.370370 0.444444 0.185185 Consensus sequence: BBSGGCGGGGBS Alignment: BBSGGCGGGGBS---- -----CTATACGGACG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 8 Myc Reverse Complement Reverse Complement Forward 5 6 2.547685 Original motif 0.295154 0.422907 0.158590 0.123348 0.149780 0.233480 0.572687 0.044053 0.035242 0.964758 0.000000 0.000000 0.955947 0.017621 0.022026 0.004405 0.000000 0.933921 0.013216 0.052863 0.083700 0.008811 0.898678 0.008811 0.039648 0.193833 0.000000 0.766520 0.000000 0.008811 0.951542 0.039648 0.000000 0.074890 0.806167 0.118943 0.198238 0.471366 0.105727 0.224670 Consensus sequence: VGCACGTGGH Reverse complement motif 0.198238 0.105727 0.471366 0.224670 0.000000 0.806167 0.074890 0.118943 0.000000 0.951542 0.008811 0.039648 0.766520 0.193833 0.000000 0.039648 0.083700 0.898678 0.008811 0.008811 0.000000 0.013216 0.933921 0.052863 0.004405 0.017621 0.022026 0.955947 0.035242 0.000000 0.964758 0.000000 0.149780 0.572687 0.233480 0.044053 0.295154 0.158590 0.422907 0.123348 Consensus sequence: DCCACGTGCV Alignment: DCCACGTGCV----- ----CGTCCGTATAG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 6 Mycn Reverse Complement Reverse Complement Forward 5 6 2.553626 Original motif 0.349315 0.363014 0.143836 0.143836 0.089041 0.388128 0.447489 0.075342 0.015982 0.984018 0.000000 0.000000 0.945205 0.000000 0.041096 0.013699 0.000000 0.961187 0.018265 0.020548 0.070776 0.002283 0.924658 0.002283 0.054795 0.221461 0.004566 0.719178 0.000000 0.000000 0.938356 0.061644 0.061644 0.111872 0.739726 0.086758 0.139269 0.605023 0.091324 0.164384 Consensus sequence: HSCACGTGGC Reverse complement motif 0.139269 0.091324 0.605023 0.164384 0.061644 0.739726 0.111872 0.086758 0.000000 0.938356 0.000000 0.061644 0.719178 0.221461 0.004566 0.054795 0.070776 0.924658 0.002283 0.002283 0.000000 0.018265 0.961187 0.020548 0.013699 0.000000 0.041096 0.945205 0.015982 0.000000 0.984018 0.000000 0.089041 0.447489 0.388128 0.075342 0.349315 0.143836 0.363014 0.143836 Consensus sequence: GCCACGTGSD Alignment: GCCACGTGSD----- ----CGTCCGTATAG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 2 Motif ID: 32 Motif name: gCGCGCsCgsG Original motif 0.105263 0.210526 0.526316 0.157895 0.000000 0.736842 0.105263 0.157895 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.368421 0.631579 0.000000 0.000000 0.894737 0.105263 0.000000 0.157895 0.157895 0.631579 0.052632 0.052632 0.631579 0.263158 0.052632 0.105263 0.052632 0.789474 0.052632 Consensus sequence: GCGCGCSCGCG Reserve complement motif 0.105263 0.789474 0.052632 0.052632 0.052632 0.263158 0.631579 0.052632 0.157895 0.631579 0.157895 0.052632 0.000000 0.105263 0.894737 0.000000 0.000000 0.631579 0.368421 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.105263 0.736842 0.157895 0.105263 0.526316 0.210526 0.157895 Consensus sequence: CGCGSGCGCGC ************************************************************************ Best Matches for Motif ID 32 (Highest to Lowest) ************************************************************************ Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 29 cCGCGGrCACG Original Motif Original Motif Backward 1 11 0.013193 Original motif 0.000000 0.600000 0.200000 0.200000 0.000000 0.800000 0.000000 0.200000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.600000 0.000000 0.400000 0.000000 0.000000 0.800000 0.200000 0.000000 0.800000 0.000000 0.200000 0.000000 0.000000 0.800000 0.200000 0.000000 0.200000 0.000000 0.800000 0.000000 Consensus sequence: CCGCGGRCACG Reverse complement motif 0.200000 0.800000 0.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.200000 0.800000 0.000000 0.000000 0.000000 0.400000 0.600000 0.000000 0.800000 0.200000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.800000 0.200000 0.000000 0.200000 0.600000 0.200000 Consensus sequence: CGTGKCCGCGG Alignment: CCGCGGRCACG GCGCGCSCGCG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 28 ssGCkTGCssk Original Motif Original Motif Backward 1 11 0.029939 Original motif 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 0.500000 0.500000 Consensus sequence: SSGCKTGCSSK Reverse complement motif 0.000000 0.500000 0.000000 0.500000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.000000 0.500000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 Consensus sequence: YSSGCAYGCSS Alignment: SSGCKTGCSSK GCGCGCSCGCG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 18 sscCCCGCGcs Reverse Complement Reverse Complement Forward 1 11 0.033880 Original motif 0.147059 0.441176 0.264706 0.147059 0.117647 0.529412 0.294118 0.058824 0.000000 0.676471 0.235294 0.088235 0.029412 0.852941 0.117647 0.000000 0.000000 0.823529 0.176471 0.000000 0.000000 0.794118 0.205882 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.058824 0.941176 0.000000 0.117647 0.470588 0.235294 0.176471 0.000000 0.323529 0.529412 0.147059 Consensus sequence: BSCCCCGCGBS Reverse complement motif 0.000000 0.529412 0.323529 0.147059 0.117647 0.235294 0.470588 0.176471 0.000000 0.941176 0.058824 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.205882 0.794118 0.000000 0.000000 0.176471 0.823529 0.000000 0.029412 0.117647 0.852941 0.000000 0.000000 0.235294 0.676471 0.088235 0.117647 0.294118 0.529412 0.058824 0.147059 0.264706 0.441176 0.147059 Consensus sequence: SBCGCGGGGSB Alignment: SBCGCGGGGSB CGCGSGCGCGC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 24 ssCCCCGCSssk Reverse Complement Reverse Complement Forward 2 11 0.041059 Original motif 0.000000 0.444444 0.370370 0.185185 0.111111 0.407407 0.333333 0.148148 0.000000 0.888889 0.037037 0.074074 0.000000 0.888889 0.074074 0.037037 0.000000 0.777778 0.222222 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.037037 0.888889 0.000000 0.074074 0.000000 0.703704 0.296296 0.000000 0.000000 0.518519 0.370370 0.111111 0.111111 0.407407 0.259259 0.222222 0.074074 0.222222 0.407407 0.296296 Consensus sequence: SBCCCCGCCSBB Reverse complement motif 0.074074 0.407407 0.222222 0.296296 0.111111 0.259259 0.407407 0.222222 0.000000 0.370370 0.518519 0.111111 0.000000 0.296296 0.703704 0.000000 0.037037 0.000000 0.888889 0.074074 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.222222 0.777778 0.000000 0.000000 0.074074 0.888889 0.037037 0.000000 0.037037 0.888889 0.074074 0.111111 0.333333 0.407407 0.148148 0.000000 0.370370 0.444444 0.185185 Consensus sequence: BBSGGCGGGGBS Alignment: BBSGGCGGGGBS -CGCGSGCGCGC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 16 CTCF Original Motif Reverse Complement Forward 7 11 0.053730 Original motif 0.095290 0.318729 0.083242 0.502738 0.182913 0.158817 0.453450 0.204819 0.307777 0.053669 0.491785 0.146769 0.061336 0.876232 0.023001 0.039430 0.008762 0.989047 0.000000 0.002191 0.814896 0.014239 0.071194 0.099671 0.043812 0.578313 0.365827 0.012048 0.117325 0.474781 0.052632 0.355263 0.933114 0.012061 0.035088 0.019737 0.005488 0.000000 0.991218 0.003293 0.365532 0.003293 0.621295 0.009879 0.059276 0.013172 0.553238 0.374314 0.013187 0.000000 0.978022 0.008791 0.061538 0.008791 0.851648 0.078022 0.114411 0.806381 0.005501 0.073707 0.409241 0.014301 0.557756 0.018702 0.090308 0.530837 0.338106 0.040749 0.128855 0.354626 0.080396 0.436123 0.442731 0.199339 0.292952 0.064978 Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif 0.064978 0.199339 0.292952 0.442731 0.436123 0.354626 0.080396 0.128855 0.090308 0.338106 0.530837 0.040749 0.409241 0.557756 0.014301 0.018702 0.114411 0.005501 0.806381 0.073707 0.061538 0.851648 0.008791 0.078022 0.013187 0.978022 0.000000 0.008791 0.059276 0.553238 0.013172 0.374314 0.365532 0.621295 0.003293 0.009879 0.005488 0.991218 0.000000 0.003293 0.019737 0.012061 0.035088 0.933114 0.117325 0.052632 0.474781 0.355263 0.043812 0.365827 0.578313 0.012048 0.099671 0.014239 0.071194 0.814896 0.008762 0.000000 0.989047 0.002191 0.061336 0.023001 0.876232 0.039430 0.307777 0.491785 0.053669 0.146769 0.182913 0.453450 0.158817 0.204819 0.502738 0.318729 0.083242 0.095290 Consensus sequence: BMSMGCCYMCTKSTGGMHM Alignment: BMSMGCCYMCTKSTGGMHM ------GCGCGCSCGCG-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 3 ESR1 Original Motif Reverse Complement Backward 7 11 0.065160 Original motif 0.261242 0.256959 0.329764 0.152034 0.228632 0.170940 0.350427 0.250000 0.136752 0.369658 0.318376 0.175214 0.176596 0.487234 0.138298 0.197872 0.285106 0.493617 0.100000 0.121277 0.651163 0.059197 0.188161 0.101480 0.075949 0.016878 0.816456 0.090717 0.040000 0.037895 0.884211 0.037895 0.069474 0.086316 0.191579 0.652632 0.008421 0.829474 0.111579 0.050526 0.837895 0.027368 0.056842 0.077895 0.122105 0.526316 0.225263 0.126316 0.132632 0.581053 0.111579 0.174737 0.134737 0.543158 0.204211 0.117895 0.067368 0.040000 0.016842 0.875789 0.044211 0.046316 0.896842 0.012632 0.642105 0.223158 0.065263 0.069474 0.021053 0.917895 0.025263 0.035789 0.124211 0.743158 0.004211 0.128421 0.054737 0.347368 0.046316 0.551579 Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif 0.551579 0.347368 0.046316 0.054737 0.124211 0.004211 0.743158 0.128421 0.021053 0.025263 0.917895 0.035789 0.069474 0.223158 0.065263 0.642105 0.044211 0.896842 0.046316 0.012632 0.875789 0.040000 0.016842 0.067368 0.134737 0.204211 0.543158 0.117895 0.132632 0.111579 0.581053 0.174737 0.122105 0.225263 0.526316 0.126316 0.077895 0.027368 0.056842 0.837895 0.008421 0.111579 0.829474 0.050526 0.652632 0.086316 0.191579 0.069474 0.040000 0.884211 0.037895 0.037895 0.075949 0.816456 0.016878 0.090717 0.101480 0.059197 0.188161 0.651163 0.285106 0.100000 0.493617 0.121277 0.176596 0.138298 0.487234 0.197872 0.136752 0.318376 0.369658 0.175214 0.228632 0.350427 0.170940 0.250000 0.261242 0.329764 0.256959 0.152034 Consensus sequence: MGGTCAGGGTGACCTRDBHV Alignment: MGGTCAGGGTGACCTRDBHV ---GCGCGCSCGCG------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 13 MIZF Original Motif Original Motif Forward 1 10 0.556010 Original motif 0.100000 0.300000 0.250000 0.350000 0.650000 0.050000 0.000000 0.300000 1.000000 0.000000 0.000000 0.000000 0.100000 0.850000 0.050000 0.000000 0.000000 0.000000 0.950000 0.050000 0.000000 0.050000 0.000000 0.950000 0.000000 0.950000 0.000000 0.050000 0.000000 0.900000 0.100000 0.000000 0.000000 0.000000 0.950000 0.050000 0.100000 0.650000 0.050000 0.200000 Consensus sequence: BAACGTCCGC Reverse complement motif 0.100000 0.050000 0.650000 0.200000 0.000000 0.950000 0.000000 0.050000 0.000000 0.100000 0.900000 0.000000 0.000000 0.000000 0.950000 0.050000 0.950000 0.050000 0.000000 0.000000 0.000000 0.950000 0.000000 0.050000 0.100000 0.050000 0.850000 0.000000 0.000000 0.000000 0.000000 1.000000 0.300000 0.050000 0.000000 0.650000 0.350000 0.300000 0.250000 0.100000 Consensus sequence: GCGGACGTTV Alignment: BAACGTCCGC- GCGCGCSCGCG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 8 Myc Original Motif Reverse Complement Forward 1 10 0.561823 Original motif 0.295154 0.422907 0.158590 0.123348 0.149780 0.233480 0.572687 0.044053 0.035242 0.964758 0.000000 0.000000 0.955947 0.017621 0.022026 0.004405 0.000000 0.933921 0.013216 0.052863 0.083700 0.008811 0.898678 0.008811 0.039648 0.193833 0.000000 0.766520 0.000000 0.008811 0.951542 0.039648 0.000000 0.074890 0.806167 0.118943 0.198238 0.471366 0.105727 0.224670 Consensus sequence: VGCACGTGGH Reverse complement motif 0.198238 0.105727 0.471366 0.224670 0.000000 0.806167 0.074890 0.118943 0.000000 0.951542 0.008811 0.039648 0.766520 0.193833 0.000000 0.039648 0.083700 0.898678 0.008811 0.008811 0.000000 0.013216 0.933921 0.052863 0.004405 0.017621 0.022026 0.955947 0.035242 0.000000 0.964758 0.000000 0.149780 0.572687 0.233480 0.044053 0.295154 0.158590 0.422907 0.123348 Consensus sequence: DCCACGTGCV Alignment: DCCACGTGCV- GCGCGCSCGCG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 6 Mycn Original Motif Original Motif Backward 1 10 0.561904 Original motif 0.349315 0.363014 0.143836 0.143836 0.089041 0.388128 0.447489 0.075342 0.015982 0.984018 0.000000 0.000000 0.945205 0.000000 0.041096 0.013699 0.000000 0.961187 0.018265 0.020548 0.070776 0.002283 0.924658 0.002283 0.054795 0.221461 0.004566 0.719178 0.000000 0.000000 0.938356 0.061644 0.061644 0.111872 0.739726 0.086758 0.139269 0.605023 0.091324 0.164384 Consensus sequence: HSCACGTGGC Reverse complement motif 0.139269 0.091324 0.605023 0.164384 0.061644 0.739726 0.111872 0.086758 0.000000 0.938356 0.000000 0.061644 0.719178 0.221461 0.004566 0.054795 0.070776 0.924658 0.002283 0.002283 0.000000 0.018265 0.961187 0.020548 0.013699 0.000000 0.041096 0.945205 0.015982 0.000000 0.984018 0.000000 0.089041 0.447489 0.388128 0.075342 0.349315 0.143836 0.363014 0.143836 Consensus sequence: GCCACGTGSD Alignment: -HSCACGTGGC GCGCGCSCGCG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 31 ctatacggacg Reverse Complement Original Motif Backward 4 8 1.569563 Original motif 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 Consensus sequence: CTATACGGACG Reverse complement motif 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 Consensus sequence: CGTCCGTATAG Alignment: ---CTATACGGACG CGCGSGCGCGC--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 2 Motif ID: 33 Motif name: srACyCCGAyr Original motif 0.000000 0.500000 0.500000 0.000000 0.500000 0.000000 0.500000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.000000 0.500000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.000000 0.500000 0.500000 0.000000 0.500000 0.000000 Consensus sequence: SRACYCCGAYR Reserve complement motif 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.500000 0.500000 0.000000 Consensus sequence: KKTCGGKGTKS ************************************************************************ Best Matches for Motif ID 33 (Highest to Lowest) ************************************************************************ Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 3 ESR1 Reverse Complement Reverse Complement Backward 9 11 0.028725 Original motif 0.261242 0.256959 0.329764 0.152034 0.228632 0.170940 0.350427 0.250000 0.136752 0.369658 0.318376 0.175214 0.176596 0.487234 0.138298 0.197872 0.285106 0.493617 0.100000 0.121277 0.651163 0.059197 0.188161 0.101480 0.075949 0.016878 0.816456 0.090717 0.040000 0.037895 0.884211 0.037895 0.069474 0.086316 0.191579 0.652632 0.008421 0.829474 0.111579 0.050526 0.837895 0.027368 0.056842 0.077895 0.122105 0.526316 0.225263 0.126316 0.132632 0.581053 0.111579 0.174737 0.134737 0.543158 0.204211 0.117895 0.067368 0.040000 0.016842 0.875789 0.044211 0.046316 0.896842 0.012632 0.642105 0.223158 0.065263 0.069474 0.021053 0.917895 0.025263 0.035789 0.124211 0.743158 0.004211 0.128421 0.054737 0.347368 0.046316 0.551579 Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif 0.551579 0.347368 0.046316 0.054737 0.124211 0.004211 0.743158 0.128421 0.021053 0.025263 0.917895 0.035789 0.069474 0.223158 0.065263 0.642105 0.044211 0.896842 0.046316 0.012632 0.875789 0.040000 0.016842 0.067368 0.134737 0.204211 0.543158 0.117895 0.132632 0.111579 0.581053 0.174737 0.122105 0.225263 0.526316 0.126316 0.077895 0.027368 0.056842 0.837895 0.008421 0.111579 0.829474 0.050526 0.652632 0.086316 0.191579 0.069474 0.040000 0.884211 0.037895 0.037895 0.075949 0.816456 0.016878 0.090717 0.101480 0.059197 0.188161 0.651163 0.285106 0.100000 0.493617 0.121277 0.176596 0.138298 0.487234 0.197872 0.136752 0.318376 0.369658 0.175214 0.228632 0.350427 0.170940 0.250000 0.261242 0.329764 0.256959 0.152034 Consensus sequence: MGGTCAGGGTGACCTRDBHV Alignment: MGGTCAGGGTGACCTRDBHV -KKTCGGKGTKS-------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 23 TGGAGCACTGTGACAcCACAGTGg Reverse Complement Reverse Complement Backward 5 11 0.031692 Original motif 0.054054 0.040541 0.054054 0.851351 0.040541 0.013514 0.824324 0.121622 0.094595 0.135135 0.756757 0.013514 0.891892 0.000000 0.000000 0.108108 0.040541 0.094595 0.810811 0.054054 0.081081 0.797297 0.054054 0.067568 0.932432 0.027027 0.000000 0.040541 0.054054 0.756757 0.135135 0.054054 0.108108 0.027027 0.013514 0.851351 0.108108 0.000000 0.851351 0.040541 0.013514 0.000000 0.027027 0.959459 0.000000 0.013514 0.945946 0.040541 0.905405 0.000000 0.067568 0.027027 0.054054 0.837838 0.000000 0.108108 0.945946 0.013514 0.040541 0.000000 0.162162 0.500000 0.189189 0.148649 0.108108 0.824324 0.000000 0.067568 0.945946 0.000000 0.040541 0.013514 0.081081 0.837838 0.027027 0.054054 0.945946 0.000000 0.013514 0.040541 0.054054 0.067568 0.783784 0.094595 0.054054 0.027027 0.000000 0.918919 0.040541 0.013514 0.864865 0.081081 0.148649 0.121622 0.675676 0.054054 Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif 0.148649 0.675676 0.121622 0.054054 0.040541 0.864865 0.013514 0.081081 0.918919 0.027027 0.000000 0.054054 0.054054 0.783784 0.067568 0.094595 0.040541 0.000000 0.013514 0.945946 0.081081 0.027027 0.837838 0.054054 0.013514 0.000000 0.040541 0.945946 0.108108 0.000000 0.824324 0.067568 0.162162 0.189189 0.500000 0.148649 0.000000 0.013514 0.040541 0.945946 0.054054 0.000000 0.837838 0.108108 0.027027 0.000000 0.067568 0.905405 0.000000 0.945946 0.013514 0.040541 0.959459 0.000000 0.027027 0.013514 0.108108 0.851351 0.000000 0.040541 0.851351 0.027027 0.013514 0.108108 0.054054 0.135135 0.756757 0.054054 0.040541 0.027027 0.000000 0.932432 0.081081 0.054054 0.797297 0.067568 0.040541 0.810811 0.094595 0.054054 0.108108 0.000000 0.000000 0.891892 0.094595 0.756757 0.135135 0.013514 0.040541 0.824324 0.013514 0.121622 0.851351 0.040541 0.054054 0.054054 Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA Alignment: CCACTGTGVTGTCACAGTGCTCCA ---------KKTCGGKGTKS---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 9 ESR2 Original Motif Reverse Complement Backward 5 11 0.032424 Original motif 0.218487 0.450980 0.176471 0.154062 0.442577 0.142857 0.114846 0.299720 0.521008 0.042017 0.431373 0.005602 0.075630 0.000000 0.770308 0.154062 0.050420 0.056022 0.893557 0.000000 0.036415 0.053221 0.092437 0.817927 0.000000 1.000000 0.000000 0.000000 0.943978 0.002801 0.000000 0.053221 0.137255 0.344538 0.316527 0.201681 0.179272 0.176471 0.417367 0.226891 0.145658 0.170868 0.411765 0.271709 0.058824 0.092437 0.067227 0.781513 0.176471 0.070028 0.742297 0.011204 0.498599 0.277311 0.053221 0.170868 0.095238 0.750700 0.005602 0.148459 0.128852 0.809524 0.000000 0.061625 0.075630 0.252101 0.000000 0.672269 0.168067 0.263305 0.380952 0.187675 Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif 0.168067 0.380952 0.263305 0.187675 0.672269 0.252101 0.000000 0.075630 0.128852 0.000000 0.809524 0.061625 0.095238 0.005602 0.750700 0.148459 0.170868 0.277311 0.053221 0.498599 0.176471 0.742297 0.070028 0.011204 0.781513 0.092437 0.067227 0.058824 0.145658 0.411765 0.170868 0.271709 0.179272 0.417367 0.176471 0.226891 0.137255 0.316527 0.344538 0.201681 0.053221 0.002801 0.000000 0.943978 0.000000 0.000000 1.000000 0.000000 0.817927 0.053221 0.092437 0.036415 0.050420 0.893557 0.056022 0.000000 0.075630 0.770308 0.000000 0.154062 0.005602 0.042017 0.431373 0.521008 0.299720 0.142857 0.114846 0.442577 0.218487 0.176471 0.450980 0.154062 Consensus sequence: BAGGYCABHBTGACCKHV Alignment: BAGGYCABHBTGACCKHV ---SRACYCCGAYR---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 17 TgTGgTGTCACAGTGCTCC Original Motif Reverse Complement Forward 6 11 0.032639 Original motif 0.111111 0.083333 0.055556 0.750000 0.125000 0.097222 0.652778 0.125000 0.041667 0.097222 0.027778 0.833333 0.027778 0.027778 0.791667 0.152778 0.055556 0.166667 0.652778 0.125000 0.000000 0.041667 0.013889 0.944444 0.041667 0.000000 0.888889 0.069444 0.027778 0.027778 0.000000 0.944444 0.041667 0.944444 0.013889 0.000000 0.916667 0.027778 0.000000 0.055556 0.069444 0.875000 0.000000 0.055556 0.833333 0.013889 0.013889 0.138889 0.041667 0.069444 0.819444 0.069444 0.027778 0.027778 0.027778 0.916667 0.069444 0.013889 0.847222 0.069444 0.069444 0.777778 0.027778 0.125000 0.055556 0.041667 0.027778 0.875000 0.041667 0.708333 0.125000 0.125000 0.111111 0.819444 0.055556 0.013889 Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif 0.111111 0.055556 0.819444 0.013889 0.041667 0.125000 0.708333 0.125000 0.875000 0.041667 0.027778 0.055556 0.069444 0.027778 0.777778 0.125000 0.069444 0.847222 0.013889 0.069444 0.916667 0.027778 0.027778 0.027778 0.041667 0.819444 0.069444 0.069444 0.138889 0.013889 0.013889 0.833333 0.069444 0.000000 0.875000 0.055556 0.055556 0.027778 0.000000 0.916667 0.041667 0.013889 0.944444 0.000000 0.944444 0.027778 0.000000 0.027778 0.041667 0.888889 0.000000 0.069444 0.944444 0.041667 0.013889 0.000000 0.055556 0.652778 0.166667 0.125000 0.027778 0.791667 0.027778 0.152778 0.833333 0.097222 0.027778 0.041667 0.125000 0.652778 0.097222 0.125000 0.750000 0.083333 0.055556 0.111111 Consensus sequence: GGAGCACTGTGACACCACA Alignment: GGAGCACTGTGACACCACA -----SRACYCCGAYR--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 22 CACTGTGrYrtCACAGTGswsCAcT Original Motif Reverse Complement Backward 7 11 0.034217 Original motif 0.111111 0.746032 0.063492 0.079365 0.857143 0.047619 0.047619 0.047619 0.047619 0.857143 0.079365 0.015873 0.031746 0.000000 0.000000 0.968254 0.031746 0.015873 0.904762 0.047619 0.000000 0.000000 0.000000 1.000000 0.031746 0.000000 0.857143 0.111111 0.396825 0.111111 0.412698 0.079365 0.031746 0.253968 0.015873 0.698413 0.365079 0.000000 0.634921 0.000000 0.079365 0.206349 0.047619 0.666667 0.047619 0.936508 0.015873 0.000000 0.952381 0.000000 0.015873 0.031746 0.015873 0.920635 0.000000 0.063492 0.920635 0.000000 0.000000 0.079365 0.063492 0.047619 0.841270 0.047619 0.000000 0.000000 0.015873 0.984127 0.047619 0.015873 0.904762 0.031746 0.015873 0.603175 0.317460 0.063492 0.396825 0.000000 0.015873 0.587302 0.015873 0.476190 0.428571 0.079365 0.063492 0.920635 0.000000 0.015873 0.920635 0.015873 0.047619 0.015873 0.095238 0.682540 0.095238 0.126984 0.047619 0.015873 0.095238 0.841270 Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif 0.841270 0.015873 0.095238 0.047619 0.095238 0.095238 0.682540 0.126984 0.015873 0.015873 0.047619 0.920635 0.063492 0.000000 0.920635 0.015873 0.015873 0.428571 0.476190 0.079365 0.587302 0.000000 0.015873 0.396825 0.015873 0.317460 0.603175 0.063492 0.047619 0.904762 0.015873 0.031746 0.984127 0.000000 0.015873 0.000000 0.063492 0.841270 0.047619 0.047619 0.079365 0.000000 0.000000 0.920635 0.015873 0.000000 0.920635 0.063492 0.031746 0.000000 0.015873 0.952381 0.047619 0.015873 0.936508 0.000000 0.666667 0.206349 0.047619 0.079365 0.365079 0.634921 0.000000 0.000000 0.698413 0.253968 0.015873 0.031746 0.396825 0.412698 0.111111 0.079365 0.031746 0.857143 0.000000 0.111111 1.000000 0.000000 0.000000 0.000000 0.031746 0.904762 0.015873 0.047619 0.968254 0.000000 0.000000 0.031746 0.047619 0.079365 0.857143 0.015873 0.047619 0.047619 0.047619 0.857143 0.111111 0.063492 0.746032 0.079365 Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG Alignment: AGTGSWSCACTGTGAMAMCACAGTG --------SRACYCCGAYR------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 7 REST Reverse Complement Reverse Complement Backward 5 11 0.034725 Original motif 0.132621 0.109365 0.230044 0.527970 0.036318 0.168441 0.091421 0.703820 0.047589 0.855354 0.031309 0.065748 0.906367 0.018727 0.058677 0.016230 0.021197 0.027431 0.945137 0.006234 0.076012 0.609346 0.201246 0.113396 0.980697 0.004359 0.007472 0.007472 0.001868 0.987547 0.007472 0.003113 0.021793 0.922167 0.012453 0.043587 0.568847 0.125234 0.100935 0.204984 0.136534 0.233791 0.077307 0.552369 0.024314 0.004364 0.966958 0.004364 0.012469 0.003117 0.983167 0.001247 0.877105 0.069869 0.021210 0.031815 0.008125 0.800000 0.145625 0.046250 0.983750 0.005625 0.004375 0.006250 0.026349 0.008156 0.959849 0.005646 0.128688 0.632141 0.114878 0.124294 0.229899 0.019472 0.432161 0.318467 0.133962 0.586792 0.200629 0.078616 0.112579 0.700629 0.023270 0.163522 Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif 0.112579 0.023270 0.700629 0.163522 0.133962 0.200629 0.586792 0.078616 0.229899 0.432161 0.019472 0.318467 0.128688 0.114878 0.632141 0.124294 0.026349 0.959849 0.008156 0.005646 0.006250 0.005625 0.004375 0.983750 0.008125 0.145625 0.800000 0.046250 0.031815 0.069869 0.021210 0.877105 0.012469 0.983167 0.003117 0.001247 0.024314 0.966958 0.004364 0.004364 0.552369 0.233791 0.077307 0.136534 0.204984 0.125234 0.100935 0.568847 0.021793 0.012453 0.922167 0.043587 0.001868 0.007472 0.987547 0.003113 0.007472 0.004359 0.007472 0.980697 0.076012 0.201246 0.609346 0.113396 0.021197 0.945137 0.027431 0.006234 0.016230 0.018727 0.058677 0.906367 0.047589 0.031309 0.855354 0.065748 0.703820 0.168441 0.091421 0.036318 0.527970 0.109365 0.230044 0.132621 Consensus sequence: GGYGCTGTCCATGGTGCTGAA Alignment: GGYGCTGTCCATGGTGCTGAA ------KKTCGGKGTKS---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 31 ctatacggacg Original Motif Original Motif Backward 1 11 0.043056 Original motif 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 Consensus sequence: CTATACGGACG Reverse complement motif 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 Consensus sequence: CGTCCGTATAG Alignment: CTATACGGACG SRACYCCGAYR ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 25 wwCCAmAGTCmt Reverse Complement Original Motif Forward 2 11 0.043056 Original motif 0.454545 0.045455 0.227273 0.272727 0.363636 0.136364 0.136364 0.363636 0.000000 1.000000 0.000000 0.000000 0.000000 0.954545 0.045455 0.000000 1.000000 0.000000 0.000000 0.000000 0.409091 0.590909 0.000000 0.000000 0.909091 0.045455 0.045455 0.000000 0.000000 0.000000 1.000000 0.000000 0.045455 0.000000 0.000000 0.954545 0.045455 0.909091 0.000000 0.045455 0.272727 0.318182 0.181818 0.227273 0.181818 0.227273 0.227273 0.363636 Consensus sequence: DDCCAMAGTCHB Reverse complement motif 0.363636 0.227273 0.227273 0.181818 0.272727 0.181818 0.318182 0.227273 0.045455 0.000000 0.909091 0.045455 0.954545 0.000000 0.000000 0.045455 0.000000 1.000000 0.000000 0.000000 0.000000 0.045455 0.045455 0.909091 0.409091 0.000000 0.590909 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.045455 0.954545 0.000000 0.000000 0.000000 1.000000 0.000000 0.363636 0.136364 0.136364 0.363636 0.272727 0.045455 0.227273 0.454545 Consensus sequence: VDGACTRTGGDD Alignment: DDCCAMAGTCHB -KKTCGGKGTKS ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 24 ssCCCCGCSssk Reverse Complement Reverse Complement Forward 3 10 0.513889 Original motif 0.000000 0.444444 0.370370 0.185185 0.111111 0.407407 0.333333 0.148148 0.000000 0.888889 0.037037 0.074074 0.000000 0.888889 0.074074 0.037037 0.000000 0.777778 0.222222 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.037037 0.888889 0.000000 0.074074 0.000000 0.703704 0.296296 0.000000 0.000000 0.518519 0.370370 0.111111 0.111111 0.407407 0.259259 0.222222 0.074074 0.222222 0.407407 0.296296 Consensus sequence: SBCCCCGCCSBB Reverse complement motif 0.074074 0.407407 0.222222 0.296296 0.111111 0.259259 0.407407 0.222222 0.000000 0.370370 0.518519 0.111111 0.000000 0.296296 0.703704 0.000000 0.037037 0.000000 0.888889 0.074074 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.222222 0.777778 0.000000 0.000000 0.074074 0.888889 0.037037 0.000000 0.037037 0.888889 0.074074 0.111111 0.333333 0.407407 0.148148 0.000000 0.370370 0.444444 0.185185 Consensus sequence: BBSGGCGGGGBS Alignment: BBSGGCGGGGBS- --KKTCGGKGTKS ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 18 sscCCCGCGcs Reverse Complement Reverse Complement Backward 2 10 0.535703 Original motif 0.147059 0.441176 0.264706 0.147059 0.117647 0.529412 0.294118 0.058824 0.000000 0.676471 0.235294 0.088235 0.029412 0.852941 0.117647 0.000000 0.000000 0.823529 0.176471 0.000000 0.000000 0.794118 0.205882 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.058824 0.941176 0.000000 0.117647 0.470588 0.235294 0.176471 0.000000 0.323529 0.529412 0.147059 Consensus sequence: BSCCCCGCGBS Reverse complement motif 0.000000 0.529412 0.323529 0.147059 0.117647 0.235294 0.470588 0.176471 0.000000 0.941176 0.058824 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.205882 0.794118 0.000000 0.000000 0.176471 0.823529 0.000000 0.029412 0.117647 0.852941 0.000000 0.000000 0.235294 0.676471 0.088235 0.117647 0.294118 0.529412 0.058824 0.147059 0.264706 0.441176 0.147059 Consensus sequence: SBCGCGGGGSB Alignment: -SBCGCGGGGSB KKTCGGKGTKS- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Results created by MOTIFSIM on 11-19-2016 15:10:45 Runtime: 649.632910 seconds MOTIFSIM is written by Ngoc Tam L. Tran