**************************************************************************************************************************************************************************************************** MOTIFSIM - Motif Similarity Detection Tool Version 2.1 **************************************************************************************************************************************************************************************************** INPUT **************************************************************************************************************************************************************************************************** Input Parameters Number of files: 2 Number of top significant motifs: 10 Number of best matches: 10 Similarity cutoff: >= 0.75 Matching motif database: UniProbe Mus Musculus Phylogenetic tree: Yes Combined similar motifs: Yes Output file type: All Output file format: All Input files and motif counts File name Count of motifs Dataset # PScanChIP_DM05.txt 16 1 RSAT_peak-motifs_DM05.txt 17 2 **************************************************************************************************************************************************************************************************** RESULTS **************************************************************************************************************************************************************************************************** ********************************************************************** Best Matches in Database for Each Motif (Highest to Lowest) ***************************************************************** Dataset #: 1 Motif ID: 1 Motif name: HNF4A Original motif 0.417910 0.104478 0.402985 0.074627 0.029851 0.029851 0.835821 0.104478 0.179104 0.059701 0.522388 0.238806 0.074627 0.343284 0.298507 0.283582 0.044776 0.761194 0.059701 0.134328 0.880597 0.014925 0.044776 0.059701 0.791045 0.029851 0.149254 0.029851 0.835821 0.014925 0.119403 0.029851 0.059701 0.059701 0.865672 0.014925 0.089552 0.029851 0.492537 0.388060 0.044776 0.328358 0.164179 0.462687 0.059701 0.731343 0.074627 0.134328 0.626866 0.104478 0.149254 0.119403 Consensus sequence: RGGBCAAAGKYCA Reserve complement motif 0.119403 0.104478 0.149254 0.626866 0.059701 0.074627 0.731343 0.134328 0.462687 0.328358 0.164179 0.044776 0.089552 0.492537 0.029851 0.388060 0.059701 0.865672 0.059701 0.014925 0.029851 0.014925 0.119403 0.835821 0.029851 0.029851 0.149254 0.791045 0.059701 0.014925 0.044776 0.880597 0.044776 0.059701 0.761194 0.134328 0.074627 0.298507 0.343284 0.283582 0.179104 0.522388 0.059701 0.238806 0.029851 0.835821 0.029851 0.104478 0.074627 0.104478 0.402985 0.417910 Consensus sequence: TGMYCTTTGBCCK ************************************************************************ Best Matches for Motif ID 1 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00058 Tcf3_primary Original Motif Original Motif Backward 2 13 0.035778 Species: Mus musculus Original motif 0.185864 0.201179 0.183663 0.429294 0.371100 0.233868 0.122934 0.272098 0.249563 0.171285 0.128851 0.450301 0.582940 0.043382 0.129099 0.244578 0.041400 0.395349 0.497087 0.066163 0.759123 0.009670 0.005936 0.225270 0.056579 0.008662 0.003986 0.930772 0.043968 0.865783 0.056001 0.034249 0.962748 0.003731 0.003265 0.030256 0.971318 0.003542 0.012299 0.012841 0.937558 0.003991 0.020195 0.038256 0.125931 0.057976 0.798081 0.018012 0.209401 0.172342 0.483980 0.134277 0.485703 0.129227 0.309936 0.075134 0.397027 0.195902 0.152395 0.254676 0.311636 0.231510 0.157732 0.299122 0.320965 0.206031 0.164299 0.308705 Consensus sequence: HHHASATCAAAGVRHHH Reverse complement motif 0.308705 0.206031 0.164299 0.320965 0.299122 0.231510 0.157732 0.311636 0.254676 0.195902 0.152395 0.397027 0.075134 0.129227 0.309936 0.485703 0.209401 0.483980 0.172342 0.134277 0.125931 0.798081 0.057976 0.018012 0.038256 0.003991 0.020195 0.937558 0.012841 0.003542 0.012299 0.971318 0.030256 0.003731 0.003265 0.962748 0.043968 0.056001 0.865783 0.034249 0.930772 0.008662 0.003986 0.056579 0.225270 0.009670 0.005936 0.759123 0.041400 0.497087 0.395349 0.066163 0.244578 0.043382 0.129099 0.582940 0.450301 0.171285 0.128851 0.249563 0.272098 0.233868 0.122934 0.371100 0.429294 0.201179 0.183663 0.185864 Consensus sequence: HHHKVCTTTGATSTHHH Alignment: HHHASATCAAAGVRHHH ---RGGBCAAAGKYCA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00054 Tcf7_primary Original Motif Original Motif Backward 2 13 0.035779 Species: Mus musculus Original motif 0.170811 0.196976 0.220503 0.411710 0.337231 0.228482 0.140137 0.294150 0.299312 0.173780 0.143426 0.383481 0.603957 0.053557 0.128214 0.214271 0.036338 0.377925 0.534647 0.051091 0.725865 0.010314 0.008501 0.255320 0.067855 0.007849 0.004559 0.919737 0.049387 0.815496 0.098330 0.036787 0.960514 0.005036 0.005137 0.029313 0.960631 0.004550 0.018815 0.016004 0.935245 0.005169 0.023866 0.035720 0.159760 0.060340 0.761341 0.018559 0.228534 0.153897 0.523052 0.094517 0.557984 0.123512 0.254154 0.064350 0.490252 0.211976 0.124557 0.173215 0.310463 0.250279 0.132612 0.306646 0.332720 0.248937 0.120633 0.297711 Consensus sequence: BHHASATCAAAGGAHHH Reverse complement motif 0.297711 0.248937 0.120633 0.332720 0.306646 0.250279 0.132612 0.310463 0.173215 0.211976 0.124557 0.490252 0.064350 0.123512 0.254154 0.557984 0.228534 0.523052 0.153897 0.094517 0.159760 0.761341 0.060340 0.018559 0.035720 0.005169 0.023866 0.935245 0.016004 0.004550 0.018815 0.960631 0.029313 0.005036 0.005137 0.960514 0.049387 0.098330 0.815496 0.036787 0.919737 0.007849 0.004559 0.067855 0.255320 0.010314 0.008501 0.725865 0.036338 0.534647 0.377925 0.051091 0.214271 0.053557 0.128214 0.603957 0.383481 0.173780 0.143426 0.299312 0.294150 0.228482 0.140137 0.337231 0.411710 0.196976 0.220503 0.170811 Consensus sequence: HHHTCCTTTGATSTHHV Alignment: BHHASATCAAAGGAHHH ---RGGBCAAAGKYCA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00067 Lef1_primary Original Motif Reverse Complement Forward 4 13 0.035901 Species: Mus musculus Original motif 0.281920 0.214207 0.278077 0.225796 0.325566 0.151435 0.298797 0.224202 0.290253 0.145824 0.243443 0.320480 0.069286 0.404645 0.141614 0.384454 0.070044 0.621448 0.142647 0.165862 0.007295 0.907657 0.038110 0.046938 0.015587 0.018273 0.000658 0.965482 0.005527 0.005886 0.001905 0.986682 0.024512 0.001189 0.001344 0.972955 0.007384 0.025221 0.952270 0.015125 0.966438 0.000630 0.002693 0.030239 0.082252 0.001173 0.001495 0.915080 0.030255 0.677155 0.275323 0.017267 0.199467 0.118815 0.056814 0.624905 0.345445 0.169597 0.216831 0.268127 0.278106 0.150864 0.173693 0.397336 0.251834 0.339733 0.219703 0.188730 Consensus sequence: DDDYCCTTTGATCTDDV Reverse complement motif 0.251834 0.219703 0.339733 0.188730 0.397336 0.150864 0.173693 0.278106 0.268127 0.169597 0.216831 0.345445 0.624905 0.118815 0.056814 0.199467 0.030255 0.275323 0.677155 0.017267 0.915080 0.001173 0.001495 0.082252 0.030239 0.000630 0.002693 0.966438 0.007384 0.952270 0.025221 0.015125 0.972955 0.001189 0.001344 0.024512 0.986682 0.005886 0.001905 0.005527 0.965482 0.018273 0.000658 0.015587 0.007295 0.038110 0.907657 0.046938 0.070044 0.142647 0.621448 0.165862 0.069286 0.141614 0.404645 0.384454 0.320480 0.145824 0.243443 0.290253 0.224202 0.151435 0.298797 0.325566 0.225796 0.214207 0.278077 0.281920 Consensus sequence: VDDAGATCAAAGGKDDD Alignment: VDDAGATCAAAGGKDDD ---RGGBCAAAGKYCA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00083 Tcf7l2_primary Original Motif Reverse Complement Backward 2 13 0.036079 Species: Mus musculus Original motif 0.285725 0.187143 0.254855 0.272277 0.276264 0.157893 0.258178 0.307665 0.238788 0.161120 0.254018 0.346074 0.076041 0.333901 0.150903 0.439156 0.093376 0.526578 0.180529 0.199517 0.010827 0.880320 0.034150 0.074703 0.016546 0.023834 0.000940 0.958680 0.007166 0.008215 0.001941 0.982678 0.029634 0.001363 0.001379 0.967625 0.010872 0.031751 0.926186 0.031190 0.949407 0.000760 0.002581 0.047253 0.109203 0.001362 0.002094 0.887341 0.044198 0.567994 0.353059 0.034749 0.222623 0.142360 0.041281 0.593736 0.358872 0.167597 0.220534 0.252997 0.233072 0.141480 0.230985 0.394463 0.350703 0.243129 0.233961 0.172207 Consensus sequence: DDDYCCTTTGATSTDDV Reverse complement motif 0.172207 0.243129 0.233961 0.350703 0.394463 0.141480 0.230985 0.233072 0.252997 0.167597 0.220534 0.358872 0.593736 0.142360 0.041281 0.222623 0.044198 0.353059 0.567994 0.034749 0.887341 0.001362 0.002094 0.109203 0.047253 0.000760 0.002581 0.949407 0.010872 0.926186 0.031751 0.031190 0.967625 0.001363 0.001379 0.029634 0.982678 0.008215 0.001941 0.007166 0.958680 0.023834 0.000940 0.016546 0.010827 0.034150 0.880320 0.074703 0.093376 0.180529 0.526578 0.199517 0.439156 0.333901 0.150903 0.076041 0.346074 0.161120 0.254018 0.238788 0.307665 0.157893 0.258178 0.276264 0.272277 0.187143 0.254855 0.285725 Consensus sequence: BDDASATCAAAGGMDDD Alignment: BDDASATCAAAGGMDDD ---RGGBCAAAGKYCA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00046 Tcfe2a_secondary Original Motif Original Motif Backward 4 13 0.040576 Species: Mus musculus Original motif 0.296417 0.247522 0.206749 0.249312 0.410113 0.201959 0.303149 0.084779 0.267313 0.132645 0.452057 0.147985 0.187929 0.136827 0.427628 0.247616 0.198671 0.425254 0.234160 0.141915 0.029244 0.953929 0.004092 0.012734 0.954570 0.014314 0.018695 0.012421 0.010025 0.055055 0.845504 0.089415 0.874802 0.040849 0.069178 0.015172 0.015084 0.010551 0.008736 0.965628 0.012981 0.007192 0.965036 0.014791 0.037724 0.016891 0.495632 0.449753 0.021685 0.438927 0.056118 0.483270 0.209872 0.365671 0.139706 0.284751 0.151815 0.336912 0.289382 0.221891 0.152995 0.262354 0.416434 0.168217 0.227567 0.187603 0.447892 0.136938 Consensus sequence: HVDDVCAGATGKYHBBV Reverse complement motif 0.227567 0.447892 0.187603 0.136938 0.152995 0.416434 0.262354 0.168217 0.151815 0.289382 0.336912 0.221891 0.209872 0.139706 0.365671 0.284751 0.483270 0.438927 0.056118 0.021685 0.037724 0.495632 0.016891 0.449753 0.012981 0.965036 0.007192 0.014791 0.965628 0.010551 0.008736 0.015084 0.015172 0.040849 0.069178 0.874802 0.010025 0.845504 0.055055 0.089415 0.012421 0.014314 0.018695 0.954570 0.029244 0.004092 0.953929 0.012734 0.198671 0.234160 0.425254 0.141915 0.187929 0.427628 0.136827 0.247616 0.267313 0.452057 0.132645 0.147985 0.084779 0.201959 0.303149 0.410113 0.249312 0.247522 0.206749 0.296417 Consensus sequence: VBBDMYCATCTGVHHBH Alignment: HVDDVCAGATGKYHBBV -RGGBCAAAGKYCA--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00062 Sox4_primary Reverse Complement Reverse Complement Forward 2 13 0.040991 Species: Mus musculus Original motif 0.427843 0.231210 0.119424 0.221523 0.196506 0.239531 0.304906 0.259057 0.302488 0.156922 0.290190 0.250401 0.433872 0.149126 0.196496 0.220506 0.258426 0.076511 0.475100 0.189963 0.841714 0.046453 0.099915 0.011918 0.983853 0.001612 0.001362 0.013174 0.003460 0.982032 0.005728 0.008780 0.989743 0.002253 0.002020 0.005984 0.990761 0.003397 0.002843 0.003000 0.770864 0.003540 0.001549 0.224048 0.235342 0.002598 0.757383 0.004677 0.371426 0.089574 0.529959 0.009040 0.480804 0.196949 0.240413 0.081833 0.187158 0.355102 0.216599 0.241142 0.248006 0.232182 0.157452 0.362360 0.403367 0.177684 0.164649 0.254300 Consensus sequence: HBDDDAACAAAGRVBHH Reverse complement motif 0.254300 0.177684 0.164649 0.403367 0.362360 0.232182 0.157452 0.248006 0.187158 0.216599 0.355102 0.241142 0.081833 0.196949 0.240413 0.480804 0.371426 0.529959 0.089574 0.009040 0.235342 0.757383 0.002598 0.004677 0.224048 0.003540 0.001549 0.770864 0.003000 0.003397 0.002843 0.990761 0.005984 0.002253 0.002020 0.989743 0.003460 0.005728 0.982032 0.008780 0.013174 0.001612 0.001362 0.983853 0.011918 0.046453 0.099915 0.841714 0.258426 0.475100 0.076511 0.189963 0.220506 0.149126 0.196496 0.433872 0.250401 0.156922 0.290190 0.302488 0.196506 0.304906 0.239531 0.259057 0.221523 0.231210 0.119424 0.427843 Consensus sequence: HHBBMCTTTGTTHDDBH Alignment: HHBBMCTTTGTTHDDBH -TGMYCTTTGBCCK--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00101 Sox12_secondary Reverse Complement Reverse Complement Forward 1 13 0.041322 Species: Mus musculus Original motif 0.378898 0.318901 0.205859 0.096341 0.352524 0.321236 0.224504 0.101736 0.323551 0.182056 0.210897 0.283496 0.135539 0.325230 0.208031 0.331200 0.663106 0.055471 0.154459 0.126963 0.051748 0.292567 0.537307 0.118378 0.886489 0.042361 0.035742 0.035408 0.043647 0.688744 0.094358 0.173252 0.882052 0.039818 0.018899 0.059231 0.864171 0.036011 0.068363 0.031455 0.790158 0.046868 0.041594 0.121379 0.087447 0.143905 0.707798 0.060849 0.295919 0.132479 0.485703 0.085899 0.653156 0.133004 0.110012 0.103828 0.351764 0.131771 0.217730 0.298736 0.203977 0.196773 0.099958 0.499292 Consensus sequence: VVDBASACAAAGRADH Reverse complement motif 0.499292 0.196773 0.099958 0.203977 0.298736 0.131771 0.217730 0.351764 0.103828 0.133004 0.110012 0.653156 0.295919 0.485703 0.132479 0.085899 0.087447 0.707798 0.143905 0.060849 0.121379 0.046868 0.041594 0.790158 0.031455 0.036011 0.068363 0.864171 0.059231 0.039818 0.018899 0.882052 0.043647 0.094358 0.688744 0.173252 0.035408 0.042361 0.035742 0.886489 0.051748 0.537307 0.292567 0.118378 0.126963 0.055471 0.154459 0.663106 0.331200 0.325230 0.208031 0.135539 0.283496 0.182056 0.210897 0.323551 0.101736 0.321236 0.224504 0.352524 0.096341 0.318901 0.205859 0.378898 Consensus sequence: HDTMCTTTGTSTVDBB Alignment: HDTMCTTTGTSTVDBB TGMYCTTTGBCCK--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00030 Sox11_primary Reverse Complement Reverse Complement Forward 2 13 0.042110 Species: Mus musculus Original motif 0.351812 0.238467 0.143954 0.265768 0.195246 0.235838 0.281473 0.287443 0.349478 0.172616 0.210739 0.267167 0.484061 0.110438 0.173131 0.232370 0.276692 0.070713 0.479604 0.172991 0.859124 0.044167 0.083951 0.012758 0.975608 0.002029 0.002285 0.020079 0.006422 0.978485 0.007124 0.007969 0.987489 0.003025 0.002868 0.006617 0.987739 0.005463 0.002730 0.004067 0.693013 0.004067 0.002445 0.300475 0.189100 0.003677 0.801408 0.005814 0.352090 0.072517 0.567737 0.007656 0.542316 0.176545 0.192768 0.088371 0.196382 0.304176 0.205985 0.293457 0.289415 0.201358 0.182937 0.326290 0.385801 0.216362 0.152363 0.245475 Consensus sequence: HBDDRAACAAAGRABHH Reverse complement motif 0.245475 0.216362 0.152363 0.385801 0.326290 0.201358 0.182937 0.289415 0.196382 0.205985 0.304176 0.293457 0.088371 0.176545 0.192768 0.542316 0.352090 0.567737 0.072517 0.007656 0.189100 0.801408 0.003677 0.005814 0.300475 0.004067 0.002445 0.693013 0.004067 0.005463 0.002730 0.987739 0.006617 0.003025 0.002868 0.987489 0.006422 0.007124 0.978485 0.007969 0.020079 0.002029 0.002285 0.975608 0.012758 0.044167 0.083951 0.859124 0.276692 0.479604 0.070713 0.172991 0.232370 0.110438 0.173131 0.484061 0.267167 0.172616 0.210739 0.349478 0.287443 0.235838 0.281473 0.195246 0.265768 0.238467 0.143954 0.351812 Consensus sequence: HHBTMCTTTGTTMDDVH Alignment: HHBTMCTTTGTTMDDVH -TGMYCTTTGBCCK--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00086 Irf3_secondary Original Motif Original Motif Forward 1 13 0.044200 Species: Mus musculus Original motif 0.236565 0.149020 0.414811 0.199604 0.197737 0.139048 0.436764 0.226451 0.598309 0.089963 0.124245 0.187483 0.212136 0.055296 0.648272 0.084296 0.747144 0.027184 0.047789 0.177884 0.766825 0.051238 0.039008 0.142929 0.479462 0.085743 0.175517 0.259279 0.064625 0.107366 0.753079 0.074929 0.058034 0.074096 0.820937 0.046934 0.270072 0.088714 0.217158 0.424057 0.063867 0.384543 0.418514 0.133076 0.047352 0.597210 0.167770 0.187669 0.266737 0.150063 0.382264 0.200936 0.381079 0.204427 0.218492 0.196003 Consensus sequence: DDAGAADGGDSCDV Reverse complement motif 0.196003 0.204427 0.218492 0.381079 0.266737 0.382264 0.150063 0.200936 0.047352 0.167770 0.597210 0.187669 0.063867 0.418514 0.384543 0.133076 0.424057 0.088714 0.217158 0.270072 0.058034 0.820937 0.074096 0.046934 0.064625 0.753079 0.107366 0.074929 0.259279 0.085743 0.175517 0.479462 0.142929 0.051238 0.039008 0.766825 0.177884 0.027184 0.047789 0.747144 0.212136 0.648272 0.055296 0.084296 0.187483 0.089963 0.124245 0.598309 0.197737 0.436764 0.139048 0.226451 0.236565 0.414811 0.149020 0.199604 Consensus sequence: BHGSDCCDTTCTHH Alignment: DDAGAADGGDSCDV RGGBCAAAGKYCA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00082 Zfp187_secondary Original Motif Reverse Complement Backward 1 13 0.044688 Species: Mus musculus Original motif 0.173063 0.169680 0.440836 0.216421 0.353277 0.179996 0.249403 0.217325 0.307337 0.038055 0.616380 0.038228 0.316636 0.564670 0.023732 0.094962 0.015484 0.923764 0.019439 0.041313 0.011243 0.956300 0.009443 0.023014 0.062273 0.107531 0.010739 0.819456 0.126670 0.201521 0.192005 0.479803 0.093090 0.045924 0.835792 0.025194 0.020165 0.015483 0.009567 0.954786 0.010873 0.672448 0.004559 0.312121 0.018002 0.846860 0.017605 0.117533 0.335703 0.408170 0.104095 0.152031 0.150308 0.362296 0.067408 0.419988 0.286490 0.242211 0.176532 0.294767 0.265022 0.249655 0.272219 0.213104 Consensus sequence: DDGMCCTBGTCCHYHV Reverse complement motif 0.265022 0.272219 0.249655 0.213104 0.294767 0.242211 0.176532 0.286490 0.419988 0.362296 0.067408 0.150308 0.335703 0.104095 0.408170 0.152031 0.018002 0.017605 0.846860 0.117533 0.010873 0.004559 0.672448 0.312121 0.954786 0.015483 0.009567 0.020165 0.093090 0.835792 0.045924 0.025194 0.479803 0.201521 0.192005 0.126670 0.819456 0.107531 0.010739 0.062273 0.011243 0.009443 0.956300 0.023014 0.015484 0.019439 0.923764 0.041313 0.316636 0.023732 0.564670 0.094962 0.307337 0.616380 0.038055 0.038228 0.217325 0.179996 0.249403 0.353277 0.173063 0.440836 0.169680 0.216421 Consensus sequence: VHMDGGACVAGGRCDH Alignment: DDGMCCTBGTCCHYHV ---RGGBCAAAGKYCA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 2 Motif name: NR2F1 Original motif 0.000000 0.000000 0.153846 0.846154 0.076923 0.000000 0.923077 0.000000 0.923077 0.000000 0.076923 0.000000 0.461538 0.538462 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.230769 0.000000 0.769231 0.000000 0.153846 0.000000 0.846154 0.076923 0.000000 0.000000 0.923077 0.153846 0.000000 0.846154 0.000000 0.461538 0.307692 0.230769 0.000000 0.461538 0.384615 0.076923 0.076923 0.076923 0.769231 0.076923 0.076923 0.230769 0.461538 0.000000 0.307692 0.000000 0.230769 0.230769 0.538462 Consensus sequence: TGAMCTTTGMMCYT Reserve complement motif 0.538462 0.230769 0.230769 0.000000 0.230769 0.000000 0.461538 0.307692 0.076923 0.076923 0.769231 0.076923 0.076923 0.384615 0.076923 0.461538 0.000000 0.307692 0.230769 0.461538 0.153846 0.846154 0.000000 0.000000 0.923077 0.000000 0.000000 0.076923 0.846154 0.153846 0.000000 0.000000 0.769231 0.230769 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.461538 0.000000 0.538462 0.000000 0.000000 0.000000 0.076923 0.923077 0.076923 0.923077 0.000000 0.000000 0.846154 0.000000 0.153846 0.000000 Consensus sequence: AKGYYCAAAGRTCA ************************************************************************ Best Matches for Motif ID 2 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00083 Tcf7l2_primary Original Motif Original Motif Backward 3 14 0.045236 Species: Mus musculus Original motif 0.285725 0.187143 0.254855 0.272277 0.276264 0.157893 0.258178 0.307665 0.238788 0.161120 0.254018 0.346074 0.076041 0.333901 0.150903 0.439156 0.093376 0.526578 0.180529 0.199517 0.010827 0.880320 0.034150 0.074703 0.016546 0.023834 0.000940 0.958680 0.007166 0.008215 0.001941 0.982678 0.029634 0.001363 0.001379 0.967625 0.010872 0.031751 0.926186 0.031190 0.949407 0.000760 0.002581 0.047253 0.109203 0.001362 0.002094 0.887341 0.044198 0.567994 0.353059 0.034749 0.222623 0.142360 0.041281 0.593736 0.358872 0.167597 0.220534 0.252997 0.233072 0.141480 0.230985 0.394463 0.350703 0.243129 0.233961 0.172207 Consensus sequence: DDDYCCTTTGATSTDDV Reverse complement motif 0.172207 0.243129 0.233961 0.350703 0.394463 0.141480 0.230985 0.233072 0.252997 0.167597 0.220534 0.358872 0.593736 0.142360 0.041281 0.222623 0.044198 0.353059 0.567994 0.034749 0.887341 0.001362 0.002094 0.109203 0.047253 0.000760 0.002581 0.949407 0.010872 0.926186 0.031751 0.031190 0.967625 0.001363 0.001379 0.029634 0.982678 0.008215 0.001941 0.007166 0.958680 0.023834 0.000940 0.016546 0.010827 0.034150 0.880320 0.074703 0.093376 0.180529 0.526578 0.199517 0.439156 0.333901 0.150903 0.076041 0.346074 0.161120 0.254018 0.238788 0.307665 0.157893 0.258178 0.276264 0.272277 0.187143 0.254855 0.285725 Consensus sequence: BDDASATCAAAGGMDDD Alignment: DDDYCCTTTGATSTDDV -TGAMCTTTGMMCYT-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00067 Lef1_primary Reverse Complement Reverse Complement Backward 2 14 0.045345 Species: Mus musculus Original motif 0.281920 0.214207 0.278077 0.225796 0.325566 0.151435 0.298797 0.224202 0.290253 0.145824 0.243443 0.320480 0.069286 0.404645 0.141614 0.384454 0.070044 0.621448 0.142647 0.165862 0.007295 0.907657 0.038110 0.046938 0.015587 0.018273 0.000658 0.965482 0.005527 0.005886 0.001905 0.986682 0.024512 0.001189 0.001344 0.972955 0.007384 0.025221 0.952270 0.015125 0.966438 0.000630 0.002693 0.030239 0.082252 0.001173 0.001495 0.915080 0.030255 0.677155 0.275323 0.017267 0.199467 0.118815 0.056814 0.624905 0.345445 0.169597 0.216831 0.268127 0.278106 0.150864 0.173693 0.397336 0.251834 0.339733 0.219703 0.188730 Consensus sequence: DDDYCCTTTGATCTDDV Reverse complement motif 0.251834 0.219703 0.339733 0.188730 0.397336 0.150864 0.173693 0.278106 0.268127 0.169597 0.216831 0.345445 0.624905 0.118815 0.056814 0.199467 0.030255 0.275323 0.677155 0.017267 0.915080 0.001173 0.001495 0.082252 0.030239 0.000630 0.002693 0.966438 0.007384 0.952270 0.025221 0.015125 0.972955 0.001189 0.001344 0.024512 0.986682 0.005886 0.001905 0.005527 0.965482 0.018273 0.000658 0.015587 0.007295 0.038110 0.907657 0.046938 0.070044 0.142647 0.621448 0.165862 0.069286 0.141614 0.404645 0.384454 0.320480 0.145824 0.243443 0.290253 0.224202 0.151435 0.298797 0.325566 0.225796 0.214207 0.278077 0.281920 Consensus sequence: VDDAGATCAAAGGKDDD Alignment: VDDAGATCAAAGGKDDD --AKGYYCAAAGRTCA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v015681_secondary Original Motif Reverse Complement Forward 8 14 0.046136 Species: Mus musculus Original motif 0.331499 0.188505 0.182841 0.297156 0.328961 0.213025 0.273530 0.184484 0.197213 0.129292 0.524914 0.148581 0.274491 0.226406 0.312118 0.186986 0.103231 0.393726 0.364988 0.138055 0.552594 0.166422 0.186262 0.094722 0.157618 0.064773 0.616497 0.161112 0.139166 0.176098 0.621185 0.063551 0.748420 0.062398 0.012447 0.176735 0.116584 0.009438 0.860326 0.013653 0.005030 0.003646 0.974877 0.016447 0.055257 0.007181 0.921760 0.015802 0.032748 0.058249 0.052709 0.856293 0.105606 0.872231 0.014370 0.007793 0.019480 0.497379 0.125899 0.357242 0.478582 0.269713 0.061464 0.190242 0.253985 0.287006 0.201320 0.257689 0.319384 0.210231 0.175842 0.294543 0.222123 0.287802 0.201294 0.288782 0.139951 0.376041 0.081133 0.402875 0.213450 0.343835 0.383676 0.059039 0.322294 0.355918 0.148062 0.173725 Consensus sequence: HVGVSAGGAGGGTCYHHHHYVH Reverse complement motif 0.322294 0.148062 0.355918 0.173725 0.213450 0.383676 0.343835 0.059039 0.402875 0.376041 0.081133 0.139951 0.288782 0.287802 0.201294 0.222123 0.294543 0.210231 0.175842 0.319384 0.253985 0.201320 0.287006 0.257689 0.190242 0.269713 0.061464 0.478582 0.019480 0.125899 0.497379 0.357242 0.105606 0.014370 0.872231 0.007793 0.856293 0.058249 0.052709 0.032748 0.055257 0.921760 0.007181 0.015802 0.005030 0.974877 0.003646 0.016447 0.116584 0.860326 0.009438 0.013653 0.176735 0.062398 0.012447 0.748420 0.139166 0.621185 0.176098 0.063551 0.157618 0.616497 0.064773 0.161112 0.094722 0.166422 0.186262 0.552594 0.103231 0.364988 0.393726 0.138055 0.274491 0.312118 0.226406 0.186986 0.197213 0.524914 0.129292 0.148581 0.184484 0.213025 0.273530 0.328961 0.297156 0.188505 0.182841 0.331499 Consensus sequence: DVMHHDHKGACCCTCCTSVCBH Alignment: DVMHHDHKGACCCTCCTSVCBH -------TGAMCTTTGMMCYT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00054 Tcf7_primary Reverse Complement Original Motif Backward 2 14 0.046177 Species: Mus musculus Original motif 0.170811 0.196976 0.220503 0.411710 0.337231 0.228482 0.140137 0.294150 0.299312 0.173780 0.143426 0.383481 0.603957 0.053557 0.128214 0.214271 0.036338 0.377925 0.534647 0.051091 0.725865 0.010314 0.008501 0.255320 0.067855 0.007849 0.004559 0.919737 0.049387 0.815496 0.098330 0.036787 0.960514 0.005036 0.005137 0.029313 0.960631 0.004550 0.018815 0.016004 0.935245 0.005169 0.023866 0.035720 0.159760 0.060340 0.761341 0.018559 0.228534 0.153897 0.523052 0.094517 0.557984 0.123512 0.254154 0.064350 0.490252 0.211976 0.124557 0.173215 0.310463 0.250279 0.132612 0.306646 0.332720 0.248937 0.120633 0.297711 Consensus sequence: BHHASATCAAAGGAHHH Reverse complement motif 0.297711 0.248937 0.120633 0.332720 0.306646 0.250279 0.132612 0.310463 0.173215 0.211976 0.124557 0.490252 0.064350 0.123512 0.254154 0.557984 0.228534 0.523052 0.153897 0.094517 0.159760 0.761341 0.060340 0.018559 0.035720 0.005169 0.023866 0.935245 0.016004 0.004550 0.018815 0.960631 0.029313 0.005036 0.005137 0.960514 0.049387 0.098330 0.815496 0.036787 0.919737 0.007849 0.004559 0.067855 0.255320 0.010314 0.008501 0.725865 0.036338 0.534647 0.377925 0.051091 0.214271 0.053557 0.128214 0.603957 0.383481 0.173780 0.143426 0.299312 0.294150 0.228482 0.140137 0.337231 0.411710 0.196976 0.220503 0.170811 Consensus sequence: HHHTCCTTTGATSTHHV Alignment: BHHASATCAAAGGAHHH --AKGYYCAAAGRTCA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00058 Tcf3_primary Reverse Complement Original Motif Backward 2 14 0.047363 Species: Mus musculus Original motif 0.185864 0.201179 0.183663 0.429294 0.371100 0.233868 0.122934 0.272098 0.249563 0.171285 0.128851 0.450301 0.582940 0.043382 0.129099 0.244578 0.041400 0.395349 0.497087 0.066163 0.759123 0.009670 0.005936 0.225270 0.056579 0.008662 0.003986 0.930772 0.043968 0.865783 0.056001 0.034249 0.962748 0.003731 0.003265 0.030256 0.971318 0.003542 0.012299 0.012841 0.937558 0.003991 0.020195 0.038256 0.125931 0.057976 0.798081 0.018012 0.209401 0.172342 0.483980 0.134277 0.485703 0.129227 0.309936 0.075134 0.397027 0.195902 0.152395 0.254676 0.311636 0.231510 0.157732 0.299122 0.320965 0.206031 0.164299 0.308705 Consensus sequence: HHHASATCAAAGVRHHH Reverse complement motif 0.308705 0.206031 0.164299 0.320965 0.299122 0.231510 0.157732 0.311636 0.254676 0.195902 0.152395 0.397027 0.075134 0.129227 0.309936 0.485703 0.209401 0.483980 0.172342 0.134277 0.125931 0.798081 0.057976 0.018012 0.038256 0.003991 0.020195 0.937558 0.012841 0.003542 0.012299 0.971318 0.030256 0.003731 0.003265 0.962748 0.043968 0.056001 0.865783 0.034249 0.930772 0.008662 0.003986 0.056579 0.225270 0.009670 0.005936 0.759123 0.041400 0.497087 0.395349 0.066163 0.244578 0.043382 0.129099 0.582940 0.450301 0.171285 0.128851 0.249563 0.272098 0.233868 0.122934 0.371100 0.429294 0.201179 0.183663 0.185864 Consensus sequence: HHHKVCTTTGATSTHHH Alignment: HHHASATCAAAGVRHHH --AKGYYCAAAGRTCA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00082 Zfp187_secondary Original Motif Original Motif Forward 1 14 0.048019 Species: Mus musculus Original motif 0.173063 0.169680 0.440836 0.216421 0.353277 0.179996 0.249403 0.217325 0.307337 0.038055 0.616380 0.038228 0.316636 0.564670 0.023732 0.094962 0.015484 0.923764 0.019439 0.041313 0.011243 0.956300 0.009443 0.023014 0.062273 0.107531 0.010739 0.819456 0.126670 0.201521 0.192005 0.479803 0.093090 0.045924 0.835792 0.025194 0.020165 0.015483 0.009567 0.954786 0.010873 0.672448 0.004559 0.312121 0.018002 0.846860 0.017605 0.117533 0.335703 0.408170 0.104095 0.152031 0.150308 0.362296 0.067408 0.419988 0.286490 0.242211 0.176532 0.294767 0.265022 0.249655 0.272219 0.213104 Consensus sequence: DDGMCCTBGTCCHYHV Reverse complement motif 0.265022 0.272219 0.249655 0.213104 0.294767 0.242211 0.176532 0.286490 0.419988 0.362296 0.067408 0.150308 0.335703 0.104095 0.408170 0.152031 0.018002 0.017605 0.846860 0.117533 0.010873 0.004559 0.672448 0.312121 0.954786 0.015483 0.009567 0.020165 0.093090 0.835792 0.045924 0.025194 0.479803 0.201521 0.192005 0.126670 0.819456 0.107531 0.010739 0.062273 0.011243 0.009443 0.956300 0.023014 0.015484 0.019439 0.923764 0.041313 0.316636 0.023732 0.564670 0.094962 0.307337 0.616380 0.038055 0.038228 0.217325 0.179996 0.249403 0.353277 0.173063 0.440836 0.169680 0.216421 Consensus sequence: VHMDGGACVAGGRCDH Alignment: DDGMCCTBGTCCHYHV TGAMCTTTGMMCYT-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00062 Sox4_primary Original Motif Reverse Complement Forward 2 14 0.049545 Species: Mus musculus Original motif 0.427843 0.231210 0.119424 0.221523 0.196506 0.239531 0.304906 0.259057 0.302488 0.156922 0.290190 0.250401 0.433872 0.149126 0.196496 0.220506 0.258426 0.076511 0.475100 0.189963 0.841714 0.046453 0.099915 0.011918 0.983853 0.001612 0.001362 0.013174 0.003460 0.982032 0.005728 0.008780 0.989743 0.002253 0.002020 0.005984 0.990761 0.003397 0.002843 0.003000 0.770864 0.003540 0.001549 0.224048 0.235342 0.002598 0.757383 0.004677 0.371426 0.089574 0.529959 0.009040 0.480804 0.196949 0.240413 0.081833 0.187158 0.355102 0.216599 0.241142 0.248006 0.232182 0.157452 0.362360 0.403367 0.177684 0.164649 0.254300 Consensus sequence: HBDDDAACAAAGRVBHH Reverse complement motif 0.254300 0.177684 0.164649 0.403367 0.362360 0.232182 0.157452 0.248006 0.187158 0.216599 0.355102 0.241142 0.081833 0.196949 0.240413 0.480804 0.371426 0.529959 0.089574 0.009040 0.235342 0.757383 0.002598 0.004677 0.224048 0.003540 0.001549 0.770864 0.003000 0.003397 0.002843 0.990761 0.005984 0.002253 0.002020 0.989743 0.003460 0.005728 0.982032 0.008780 0.013174 0.001612 0.001362 0.983853 0.011918 0.046453 0.099915 0.841714 0.258426 0.475100 0.076511 0.189963 0.220506 0.149126 0.196496 0.433872 0.250401 0.156922 0.290190 0.302488 0.196506 0.304906 0.239531 0.259057 0.221523 0.231210 0.119424 0.427843 Consensus sequence: HHBBMCTTTGTTHDDBH Alignment: HHBBMCTTTGTTHDDBH -TGAMCTTTGMMCYT-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00030 Sox11_primary Original Motif Reverse Complement Backward 3 14 0.049903 Species: Mus musculus Original motif 0.351812 0.238467 0.143954 0.265768 0.195246 0.235838 0.281473 0.287443 0.349478 0.172616 0.210739 0.267167 0.484061 0.110438 0.173131 0.232370 0.276692 0.070713 0.479604 0.172991 0.859124 0.044167 0.083951 0.012758 0.975608 0.002029 0.002285 0.020079 0.006422 0.978485 0.007124 0.007969 0.987489 0.003025 0.002868 0.006617 0.987739 0.005463 0.002730 0.004067 0.693013 0.004067 0.002445 0.300475 0.189100 0.003677 0.801408 0.005814 0.352090 0.072517 0.567737 0.007656 0.542316 0.176545 0.192768 0.088371 0.196382 0.304176 0.205985 0.293457 0.289415 0.201358 0.182937 0.326290 0.385801 0.216362 0.152363 0.245475 Consensus sequence: HBDDRAACAAAGRABHH Reverse complement motif 0.245475 0.216362 0.152363 0.385801 0.326290 0.201358 0.182937 0.289415 0.196382 0.205985 0.304176 0.293457 0.088371 0.176545 0.192768 0.542316 0.352090 0.567737 0.072517 0.007656 0.189100 0.801408 0.003677 0.005814 0.300475 0.004067 0.002445 0.693013 0.004067 0.005463 0.002730 0.987739 0.006617 0.003025 0.002868 0.987489 0.006422 0.007124 0.978485 0.007969 0.020079 0.002029 0.002285 0.975608 0.012758 0.044167 0.083951 0.859124 0.276692 0.479604 0.070713 0.172991 0.232370 0.110438 0.173131 0.484061 0.267167 0.172616 0.210739 0.349478 0.287443 0.235838 0.281473 0.195246 0.265768 0.238467 0.143954 0.351812 Consensus sequence: HHBTMCTTTGTTMDDVH Alignment: HHBTMCTTTGTTMDDVH -TGAMCTTTGMMCYT-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00023 Sox30_primary Original Motif Original Motif Forward 3 14 0.051153 Species: Mus musculus Original motif 0.372432 0.102933 0.322145 0.202491 0.328072 0.182071 0.157347 0.332510 0.289417 0.084511 0.292873 0.333198 0.157571 0.227851 0.441662 0.172917 0.716832 0.049010 0.201411 0.032747 0.957368 0.003162 0.004402 0.035068 0.003907 0.862678 0.009407 0.124008 0.977231 0.007658 0.004263 0.010847 0.976481 0.004510 0.015225 0.003784 0.067568 0.004353 0.005071 0.923008 0.158205 0.108442 0.467023 0.266330 0.334549 0.091557 0.510241 0.063654 0.456431 0.182602 0.150234 0.210732 0.387485 0.241062 0.151504 0.219950 0.188387 0.269857 0.176514 0.365242 0.175680 0.243984 0.165833 0.414502 Consensus sequence: DHDBAACAATDRHHHH Reverse complement motif 0.414502 0.243984 0.165833 0.175680 0.365242 0.269857 0.176514 0.188387 0.219950 0.241062 0.151504 0.387485 0.210732 0.182602 0.150234 0.456431 0.334549 0.510241 0.091557 0.063654 0.158205 0.467023 0.108442 0.266330 0.923008 0.004353 0.005071 0.067568 0.003784 0.004510 0.015225 0.976481 0.010847 0.007658 0.004263 0.977231 0.003907 0.009407 0.862678 0.124008 0.035068 0.003162 0.004402 0.957368 0.032747 0.049010 0.201411 0.716832 0.157571 0.441662 0.227851 0.172917 0.333198 0.084511 0.292873 0.289417 0.332510 0.182071 0.157347 0.328072 0.202491 0.102933 0.322145 0.372432 Consensus sequence: HHHHMHATTGTTBDHD Alignment: DHDBAACAATDRHHHH --TGAMCTTTGMMCYT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00005 Tcfap2a_secondary Reverse Complement Reverse Complement Backward 1 14 0.051697 Species: Mus musculus Original motif 0.198427 0.243196 0.159241 0.399136 0.267754 0.388187 0.116811 0.227248 0.448284 0.056403 0.414623 0.080691 0.031469 0.826323 0.055436 0.086772 0.035527 0.756642 0.022985 0.184845 0.127338 0.316078 0.155806 0.400778 0.135021 0.313650 0.287760 0.263570 0.418892 0.082297 0.068352 0.430460 0.201062 0.044735 0.711358 0.042845 0.038934 0.022320 0.903763 0.034982 0.201790 0.065554 0.460526 0.272130 0.006890 0.786923 0.061853 0.144334 0.460666 0.103658 0.196452 0.239224 0.092272 0.204611 0.390375 0.312742 Consensus sequence: HHRCCBBWGGDCDB Reverse complement motif 0.092272 0.390375 0.204611 0.312742 0.239224 0.103658 0.196452 0.460666 0.006890 0.061853 0.786923 0.144334 0.201790 0.460526 0.065554 0.272130 0.038934 0.903763 0.022320 0.034982 0.201062 0.711358 0.044735 0.042845 0.430460 0.082297 0.068352 0.418892 0.135021 0.287760 0.313650 0.263570 0.400778 0.316078 0.155806 0.127338 0.035527 0.022985 0.756642 0.184845 0.031469 0.055436 0.826323 0.086772 0.080691 0.056403 0.414623 0.448284 0.267754 0.116811 0.388187 0.227248 0.399136 0.243196 0.159241 0.198427 Consensus sequence: BDGHCCWBVGGKDH Alignment: BDGHCCWBVGGKDH AKGYYCAAAGRTCA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 3 Motif name: ESR1 Original motif 0.261242 0.256959 0.329764 0.152034 0.228632 0.170940 0.350427 0.250000 0.136752 0.369658 0.318376 0.175214 0.176596 0.487234 0.138298 0.197872 0.285106 0.493617 0.100000 0.121277 0.651163 0.059197 0.188161 0.101480 0.075949 0.016878 0.816456 0.090717 0.040000 0.037895 0.884211 0.037895 0.069474 0.086316 0.191579 0.652632 0.008421 0.829474 0.111579 0.050526 0.837895 0.027368 0.056842 0.077895 0.122105 0.526316 0.225263 0.126316 0.132632 0.581053 0.111579 0.174737 0.134737 0.543158 0.204211 0.117895 0.067368 0.040000 0.016842 0.875789 0.044211 0.046316 0.896842 0.012632 0.642105 0.223158 0.065263 0.069474 0.021053 0.917895 0.025263 0.035789 0.124211 0.743158 0.004211 0.128421 0.054737 0.347368 0.046316 0.551579 Consensus sequence: VDBHMAGGTCACCCTGACCY Reserve complement motif 0.551579 0.347368 0.046316 0.054737 0.124211 0.004211 0.743158 0.128421 0.021053 0.025263 0.917895 0.035789 0.069474 0.223158 0.065263 0.642105 0.044211 0.896842 0.046316 0.012632 0.875789 0.040000 0.016842 0.067368 0.134737 0.204211 0.543158 0.117895 0.132632 0.111579 0.581053 0.174737 0.122105 0.225263 0.526316 0.126316 0.077895 0.027368 0.056842 0.837895 0.008421 0.111579 0.829474 0.050526 0.652632 0.086316 0.191579 0.069474 0.040000 0.884211 0.037895 0.037895 0.075949 0.816456 0.016878 0.090717 0.101480 0.059197 0.188161 0.651163 0.285106 0.100000 0.493617 0.121277 0.176596 0.138298 0.487234 0.197872 0.136752 0.318376 0.369658 0.175214 0.228632 0.350427 0.170940 0.250000 0.261242 0.329764 0.256959 0.152034 Consensus sequence: MGGTCAGGGTGACCTRDBHV ************************************************************************ Best Matches for Motif ID 3 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v016060_secondary Original Motif Reverse Complement Backward 4 20 0.065841 Species: Mus musculus Original motif 0.319838 0.171199 0.138099 0.370865 0.269358 0.196600 0.346909 0.187133 0.176807 0.338888 0.193903 0.290402 0.230268 0.119645 0.310500 0.339587 0.517372 0.257658 0.111673 0.113296 0.159477 0.126524 0.561119 0.152879 0.117072 0.553013 0.130919 0.198996 0.073372 0.163548 0.525014 0.238066 0.143608 0.186896 0.170528 0.498967 0.054943 0.079034 0.722992 0.143031 0.048852 0.015134 0.852458 0.083556 0.029001 0.023938 0.918900 0.028160 0.036727 0.092645 0.090591 0.780037 0.017757 0.057598 0.895222 0.029423 0.026113 0.048113 0.879744 0.046030 0.023041 0.787043 0.123490 0.066426 0.579766 0.004868 0.296873 0.118493 0.303862 0.042931 0.290151 0.363055 0.099672 0.237431 0.262301 0.400597 0.217788 0.163908 0.367628 0.250676 0.450783 0.141108 0.226137 0.181972 0.485086 0.102553 0.242662 0.169700 0.109057 0.454222 0.145665 0.291056 Consensus sequence: HVBDAGCGBGGGTGGCRDBDDDB Reverse complement motif 0.109057 0.145665 0.454222 0.291056 0.169700 0.102553 0.242662 0.485086 0.181972 0.141108 0.226137 0.450783 0.217788 0.367628 0.163908 0.250676 0.400597 0.237431 0.262301 0.099672 0.363055 0.042931 0.290151 0.303862 0.118493 0.004868 0.296873 0.579766 0.023041 0.123490 0.787043 0.066426 0.026113 0.879744 0.048113 0.046030 0.017757 0.895222 0.057598 0.029423 0.780037 0.092645 0.090591 0.036727 0.029001 0.918900 0.023938 0.028160 0.048852 0.852458 0.015134 0.083556 0.054943 0.722992 0.079034 0.143031 0.498967 0.186896 0.170528 0.143608 0.073372 0.525014 0.163548 0.238066 0.117072 0.130919 0.553013 0.198996 0.159477 0.561119 0.126524 0.152879 0.113296 0.257658 0.111673 0.517372 0.339587 0.119645 0.310500 0.230268 0.176807 0.193903 0.338888 0.290402 0.269358 0.346909 0.196600 0.187133 0.370865 0.171199 0.138099 0.319838 Consensus sequence: BDDHVDKGCCACCCVCGCTDBVH Alignment: BDDHVDKGCCACCCVCGCTDBVH VDBHMAGGTCACCCTGACCY--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00098 Rfx3_secondary Original Motif Reverse Complement Forward 1 20 0.068975 Species: Mus musculus Original motif 0.314514 0.275352 0.257617 0.152518 0.126939 0.598294 0.130576 0.144192 0.102265 0.155334 0.177957 0.564445 0.129288 0.282678 0.326990 0.261044 0.318166 0.227823 0.175681 0.278330 0.109019 0.380838 0.278328 0.231815 0.226145 0.289206 0.291300 0.193348 0.035863 0.844339 0.072582 0.047216 0.223793 0.187244 0.088092 0.500871 0.039800 0.029681 0.026201 0.904317 0.298298 0.032147 0.654746 0.014809 0.014729 0.022023 0.944826 0.018422 0.485114 0.004925 0.013785 0.496176 0.035708 0.020381 0.240804 0.703108 0.951152 0.012738 0.017886 0.018224 0.023713 0.944394 0.009538 0.022355 0.291067 0.385205 0.232388 0.091339 0.340334 0.199588 0.311526 0.148552 0.198713 0.472138 0.178319 0.150830 0.321155 0.269932 0.311301 0.097612 0.412646 0.195252 0.231950 0.160152 0.297134 0.180928 0.250400 0.271538 0.151169 0.305386 0.358574 0.184871 Consensus sequence: VCTBHBVCTTGGWTACVVVVVDB Reverse complement motif 0.151169 0.358574 0.305386 0.184871 0.271538 0.180928 0.250400 0.297134 0.160152 0.195252 0.231950 0.412646 0.097612 0.269932 0.311301 0.321155 0.198713 0.178319 0.472138 0.150830 0.148552 0.199588 0.311526 0.340334 0.291067 0.232388 0.385205 0.091339 0.023713 0.009538 0.944394 0.022355 0.018224 0.012738 0.017886 0.951152 0.703108 0.020381 0.240804 0.035708 0.496176 0.004925 0.013785 0.485114 0.014729 0.944826 0.022023 0.018422 0.298298 0.654746 0.032147 0.014809 0.904317 0.029681 0.026201 0.039800 0.500871 0.187244 0.088092 0.223793 0.035863 0.072582 0.844339 0.047216 0.226145 0.291300 0.289206 0.193348 0.109019 0.278328 0.380838 0.231815 0.278330 0.227823 0.175681 0.318166 0.129288 0.326990 0.282678 0.261044 0.564445 0.155334 0.177957 0.102265 0.126939 0.130576 0.598294 0.144192 0.152518 0.275352 0.257617 0.314514 Consensus sequence: BDBBVBVGTAWCCAAGVBHBAGB Alignment: BDBBVBVGTAWCCAAGVBHBAGB VDBHMAGGTCACCCTGACCY--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v015681_primary Reverse Complement Reverse Complement Backward 3 20 0.070125 Species: Mus musculus Original motif 0.472795 0.179227 0.091251 0.256726 0.036521 0.159743 0.204840 0.598896 0.164582 0.312805 0.221324 0.301289 0.237069 0.249050 0.293048 0.220833 0.401949 0.225181 0.229401 0.143469 0.161422 0.494334 0.252207 0.092036 0.252940 0.177721 0.369400 0.199939 0.119630 0.024651 0.849920 0.005798 0.000962 0.002398 0.990616 0.006023 0.937852 0.027016 0.034535 0.000597 0.008963 0.987756 0.000629 0.002652 0.001584 0.992898 0.002349 0.003169 0.956822 0.027342 0.002484 0.013352 0.009873 0.987759 0.000988 0.001381 0.016397 0.980856 0.000369 0.002378 0.081761 0.758555 0.038572 0.121112 0.371713 0.091838 0.448027 0.088423 0.111617 0.121913 0.683885 0.082585 0.334562 0.102916 0.436488 0.126034 0.210362 0.101261 0.238339 0.450037 0.169041 0.271583 0.320799 0.238576 0.140316 0.049885 0.735236 0.074563 Consensus sequence: HTBVVVDGGACCACCCRGRDBG Reverse complement motif 0.140316 0.735236 0.049885 0.074563 0.169041 0.320799 0.271583 0.238576 0.450037 0.101261 0.238339 0.210362 0.334562 0.436488 0.102916 0.126034 0.111617 0.683885 0.121913 0.082585 0.371713 0.448027 0.091838 0.088423 0.081761 0.038572 0.758555 0.121112 0.016397 0.000369 0.980856 0.002378 0.009873 0.000988 0.987759 0.001381 0.013352 0.027342 0.002484 0.956822 0.001584 0.002349 0.992898 0.003169 0.008963 0.000629 0.987756 0.002652 0.000597 0.027016 0.034535 0.937852 0.000962 0.990616 0.002398 0.006023 0.119630 0.849920 0.024651 0.005798 0.252940 0.369400 0.177721 0.199939 0.161422 0.252207 0.494334 0.092036 0.143469 0.225181 0.229401 0.401949 0.237069 0.293048 0.249050 0.220833 0.164582 0.221324 0.312805 0.301289 0.598896 0.159743 0.204840 0.036521 0.256726 0.179227 0.091251 0.472795 Consensus sequence: CBDMCMGGGTGGTCCHVBVBAH Alignment: CBDMCMGGGTGGTCCHVBVBAH MGGTCAGGGTGACCTRDBHV-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v015681_secondary Reverse Complement Original Motif Backward 3 20 0.071127 Species: Mus musculus Original motif 0.331499 0.188505 0.182841 0.297156 0.328961 0.213025 0.273530 0.184484 0.197213 0.129292 0.524914 0.148581 0.274491 0.226406 0.312118 0.186986 0.103231 0.393726 0.364988 0.138055 0.552594 0.166422 0.186262 0.094722 0.157618 0.064773 0.616497 0.161112 0.139166 0.176098 0.621185 0.063551 0.748420 0.062398 0.012447 0.176735 0.116584 0.009438 0.860326 0.013653 0.005030 0.003646 0.974877 0.016447 0.055257 0.007181 0.921760 0.015802 0.032748 0.058249 0.052709 0.856293 0.105606 0.872231 0.014370 0.007793 0.019480 0.497379 0.125899 0.357242 0.478582 0.269713 0.061464 0.190242 0.253985 0.287006 0.201320 0.257689 0.319384 0.210231 0.175842 0.294543 0.222123 0.287802 0.201294 0.288782 0.139951 0.376041 0.081133 0.402875 0.213450 0.343835 0.383676 0.059039 0.322294 0.355918 0.148062 0.173725 Consensus sequence: HVGVSAGGAGGGTCYHHHHYVH Reverse complement motif 0.322294 0.148062 0.355918 0.173725 0.213450 0.383676 0.343835 0.059039 0.402875 0.376041 0.081133 0.139951 0.288782 0.287802 0.201294 0.222123 0.294543 0.210231 0.175842 0.319384 0.253985 0.201320 0.287006 0.257689 0.190242 0.269713 0.061464 0.478582 0.019480 0.125899 0.497379 0.357242 0.105606 0.014370 0.872231 0.007793 0.856293 0.058249 0.052709 0.032748 0.055257 0.921760 0.007181 0.015802 0.005030 0.974877 0.003646 0.016447 0.116584 0.860326 0.009438 0.013653 0.176735 0.062398 0.012447 0.748420 0.139166 0.621185 0.176098 0.063551 0.157618 0.616497 0.064773 0.161112 0.094722 0.166422 0.186262 0.552594 0.103231 0.364988 0.393726 0.138055 0.274491 0.312118 0.226406 0.186986 0.197213 0.524914 0.129292 0.148581 0.184484 0.213025 0.273530 0.328961 0.297156 0.188505 0.182841 0.331499 Consensus sequence: DVMHHDHKGACCCTCCTSVCBH Alignment: HVGVSAGGAGGGTCYHHHHYVH MGGTCAGGGTGACCTRDBHV-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v016060_primary Original Motif Reverse Complement Forward 2 20 0.074243 Species: Mus musculus Original motif 0.180868 0.321661 0.134642 0.362829 0.232215 0.134289 0.315356 0.318141 0.065068 0.093681 0.569842 0.271408 0.370822 0.229680 0.154738 0.244759 0.323039 0.182873 0.173588 0.320500 0.175039 0.266898 0.276080 0.281984 0.412669 0.147730 0.146326 0.293275 0.325953 0.028805 0.629596 0.015646 0.003017 0.001766 0.979711 0.015507 0.888973 0.040666 0.069420 0.000941 0.017309 0.979155 0.000899 0.002637 0.001732 0.988816 0.004856 0.004596 0.889763 0.078125 0.010384 0.021729 0.007566 0.987081 0.001421 0.003932 0.027797 0.966593 0.000878 0.004731 0.025816 0.867003 0.065749 0.041433 0.220658 0.075256 0.582904 0.121182 0.088946 0.283695 0.565345 0.062015 0.328012 0.241332 0.305901 0.124755 0.307302 0.137589 0.375928 0.179181 0.298752 0.231470 0.315255 0.154524 0.094565 0.142901 0.705696 0.056838 Consensus sequence: HDGHHBHRGACCACCCGSVDVG Reverse complement motif 0.094565 0.705696 0.142901 0.056838 0.298752 0.315255 0.231470 0.154524 0.307302 0.375928 0.137589 0.179181 0.124755 0.241332 0.305901 0.328012 0.088946 0.565345 0.283695 0.062015 0.220658 0.582904 0.075256 0.121182 0.025816 0.065749 0.867003 0.041433 0.027797 0.000878 0.966593 0.004731 0.007566 0.001421 0.987081 0.003932 0.021729 0.078125 0.010384 0.889763 0.001732 0.004856 0.988816 0.004596 0.017309 0.000899 0.979155 0.002637 0.000941 0.040666 0.069420 0.888973 0.003017 0.979711 0.001766 0.015507 0.325953 0.629596 0.028805 0.015646 0.293275 0.147730 0.146326 0.412669 0.281984 0.266898 0.276080 0.175039 0.320500 0.182873 0.173588 0.323039 0.244759 0.229680 0.154738 0.370822 0.065068 0.569842 0.093681 0.271408 0.318141 0.134289 0.315356 0.232215 0.362829 0.321661 0.134642 0.180868 Consensus sequence: CVHBSCGGGTGGTCMHVHHCDH Alignment: CVHBSCGGGTGGTCMHVHHCDH -VDBHMAGGTCACCCTGACCY- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v015681_primary Original Motif Original Motif Backward 2 20 0.074705 Species: Mus musculus Original motif 0.641428 0.180211 0.044767 0.133594 0.171696 0.262981 0.334148 0.231174 0.129726 0.322735 0.243462 0.304077 0.165713 0.175735 0.256108 0.402445 0.146090 0.171890 0.412753 0.269266 0.212837 0.439192 0.280990 0.066980 0.251088 0.275516 0.374380 0.099015 0.575438 0.079656 0.338201 0.006704 0.005634 0.003422 0.972597 0.018348 0.890447 0.077034 0.031851 0.000668 0.007128 0.986862 0.000496 0.005515 0.001445 0.991564 0.001925 0.005066 0.738761 0.190157 0.026399 0.044684 0.013384 0.983783 0.000896 0.001937 0.068077 0.929549 0.000773 0.001602 0.040830 0.933742 0.005283 0.020145 0.730274 0.029225 0.145689 0.094812 0.165032 0.572838 0.162001 0.100129 0.383584 0.129942 0.429497 0.056977 0.455959 0.071959 0.208204 0.263878 0.134271 0.262985 0.222626 0.380117 0.071193 0.346594 0.346081 0.236132 0.445661 0.405278 0.053901 0.095160 Consensus sequence: ABBBBVVRGACCACCCACRDBBM Reverse complement motif 0.095160 0.405278 0.053901 0.445661 0.071193 0.346081 0.346594 0.236132 0.380117 0.262985 0.222626 0.134271 0.263878 0.071959 0.208204 0.455959 0.383584 0.429497 0.129942 0.056977 0.165032 0.162001 0.572838 0.100129 0.094812 0.029225 0.145689 0.730274 0.040830 0.005283 0.933742 0.020145 0.068077 0.000773 0.929549 0.001602 0.013384 0.000896 0.983783 0.001937 0.044684 0.190157 0.026399 0.738761 0.001445 0.001925 0.991564 0.005066 0.007128 0.000496 0.986862 0.005515 0.000668 0.077034 0.031851 0.890447 0.005634 0.972597 0.003422 0.018348 0.006704 0.079656 0.338201 0.575438 0.251088 0.374380 0.275516 0.099015 0.212837 0.280990 0.439192 0.066980 0.146090 0.412753 0.171890 0.269266 0.402445 0.175735 0.256108 0.165713 0.129726 0.243462 0.322735 0.304077 0.171696 0.334148 0.262981 0.231174 0.133594 0.180211 0.044767 0.641428 Consensus sequence: YBVDMGTGGGTGGTCKVVBVBBT Alignment: ABBBBVVRGACCACCCACRDBBM --VDBHMAGGTCACCCTGACCY- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v016060_primary Original Motif Original Motif Forward 4 20 0.074917 Species: Mus musculus Original motif 0.204923 0.208846 0.365383 0.220848 0.294304 0.300143 0.167287 0.238266 0.109711 0.619514 0.117379 0.153396 0.178979 0.378580 0.230177 0.212264 0.159594 0.542602 0.118178 0.179627 0.125206 0.430074 0.151826 0.292894 0.097692 0.709845 0.116956 0.075506 0.148292 0.565912 0.037632 0.248164 0.077951 0.034190 0.855503 0.032356 0.001657 0.001061 0.971877 0.025405 0.001926 0.001084 0.991712 0.005278 0.033031 0.012001 0.057796 0.897171 0.002723 0.002647 0.993348 0.001281 0.003261 0.000963 0.987199 0.008577 0.000611 0.090925 0.074857 0.833608 0.015299 0.978878 0.004949 0.000874 0.013368 0.600902 0.033485 0.352245 0.231949 0.149575 0.118804 0.499672 0.267580 0.186002 0.371242 0.175176 0.264884 0.223483 0.110082 0.401551 0.221365 0.170121 0.179559 0.428955 0.112997 0.692930 0.139981 0.054092 0.460305 0.207883 0.155111 0.176702 Consensus sequence: BHCBCBCCGGGTGGTCYHVHDCH Reverse complement motif 0.176702 0.207883 0.155111 0.460305 0.112997 0.139981 0.692930 0.054092 0.428955 0.170121 0.179559 0.221365 0.401551 0.223483 0.110082 0.264884 0.267580 0.371242 0.186002 0.175176 0.499672 0.149575 0.118804 0.231949 0.013368 0.033485 0.600902 0.352245 0.015299 0.004949 0.978878 0.000874 0.833608 0.090925 0.074857 0.000611 0.003261 0.987199 0.000963 0.008577 0.002723 0.993348 0.002647 0.001281 0.897171 0.012001 0.057796 0.033031 0.001926 0.991712 0.001084 0.005278 0.001657 0.971877 0.001061 0.025405 0.077951 0.855503 0.034190 0.032356 0.148292 0.037632 0.565912 0.248164 0.097692 0.116956 0.709845 0.075506 0.125206 0.151826 0.430074 0.292894 0.159594 0.118178 0.542602 0.179627 0.178979 0.230177 0.378580 0.212264 0.109711 0.117379 0.619514 0.153396 0.294304 0.167287 0.300143 0.238266 0.204923 0.365383 0.208846 0.220848 Consensus sequence: HGDHVHKGACCACCCGGBGBGDB Alignment: BHCBCBCCGGGTGGTCYHVHDCH ---VDBHMAGGTCACCCTGACCY ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v015681_primary Original Motif Original Motif Forward 2 20 0.075931 Species: Mus musculus Original motif 0.183797 0.268049 0.330111 0.218043 0.127599 0.330310 0.243614 0.298477 0.143199 0.188046 0.268593 0.400162 0.214690 0.205230 0.247090 0.332990 0.294688 0.299104 0.327152 0.079056 0.221909 0.193223 0.480155 0.104712 0.444072 0.068239 0.481838 0.005852 0.006182 0.015429 0.901278 0.077111 0.766535 0.111138 0.121632 0.000696 0.014848 0.973961 0.000298 0.010893 0.001807 0.992200 0.002669 0.003324 0.795344 0.140510 0.018576 0.045571 0.006990 0.988200 0.002510 0.002299 0.154898 0.842296 0.000998 0.001808 0.029577 0.919262 0.006935 0.044226 0.677987 0.032075 0.185065 0.104874 0.195132 0.364580 0.319321 0.120967 0.225412 0.115034 0.612849 0.046705 0.548628 0.058900 0.162857 0.229616 0.112531 0.340331 0.165910 0.381227 0.073029 0.303078 0.363896 0.259997 0.561485 0.260567 0.092979 0.084969 0.132283 0.457691 0.140159 0.269867 Consensus sequence: BBBDVVRGACCACCCAVGABBAB Reverse complement motif 0.132283 0.140159 0.457691 0.269867 0.084969 0.260567 0.092979 0.561485 0.073029 0.363896 0.303078 0.259997 0.381227 0.340331 0.165910 0.112531 0.229616 0.058900 0.162857 0.548628 0.225412 0.612849 0.115034 0.046705 0.195132 0.319321 0.364580 0.120967 0.104874 0.032075 0.185065 0.677987 0.029577 0.006935 0.919262 0.044226 0.154898 0.000998 0.842296 0.001808 0.006990 0.002510 0.988200 0.002299 0.045571 0.140510 0.018576 0.795344 0.001807 0.002669 0.992200 0.003324 0.014848 0.000298 0.973961 0.010893 0.000696 0.111138 0.121632 0.766535 0.006182 0.901278 0.015429 0.077111 0.444072 0.481838 0.068239 0.005852 0.221909 0.480155 0.193223 0.104712 0.294688 0.327152 0.299104 0.079056 0.332990 0.205230 0.247090 0.214690 0.400162 0.188046 0.268593 0.143199 0.127599 0.243614 0.330310 0.298477 0.183797 0.330111 0.268049 0.218043 Consensus sequence: BTBVTCVTGGGTGGTCMVVDVBB Alignment: BBBDVVRGACCACCCAVGABBAB -VDBHMAGGTCACCCTGACCY-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00400 Zif268 Reverse Complement Reverse Complement Backward 3 20 0.076269 Species: Mus musculus Original motif 0.104824 0.412716 0.254506 0.227955 0.644922 0.065476 0.140479 0.149122 0.201205 0.166164 0.347131 0.285501 0.360606 0.256316 0.150766 0.232313 0.199831 0.240681 0.279350 0.280137 0.234308 0.204076 0.321306 0.240310 0.274112 0.462435 0.111425 0.152028 0.067070 0.717501 0.073934 0.141496 0.106745 0.084442 0.658566 0.150247 0.025128 0.967053 0.003585 0.004234 0.006412 0.982989 0.003227 0.007371 0.009588 0.877620 0.002571 0.110221 0.621521 0.355443 0.015669 0.007366 0.002600 0.980275 0.004191 0.012934 0.118773 0.026658 0.783843 0.070725 0.022358 0.822101 0.024684 0.130857 0.713212 0.080912 0.128793 0.077084 0.166568 0.250955 0.107934 0.474544 0.225040 0.222494 0.163301 0.389166 0.268976 0.223206 0.265314 0.242504 0.137052 0.229058 0.148439 0.485451 0.135819 0.304550 0.141994 0.417637 0.272440 0.319501 0.230580 0.177478 Consensus sequence: BADHBDHCGCCCMCGCAHHDBBV Reverse complement motif 0.272440 0.230580 0.319501 0.177478 0.417637 0.304550 0.141994 0.135819 0.485451 0.229058 0.148439 0.137052 0.242504 0.223206 0.265314 0.268976 0.389166 0.222494 0.163301 0.225040 0.474544 0.250955 0.107934 0.166568 0.077084 0.080912 0.128793 0.713212 0.022358 0.024684 0.822101 0.130857 0.118773 0.783843 0.026658 0.070725 0.002600 0.004191 0.980275 0.012934 0.007366 0.355443 0.015669 0.621521 0.009588 0.002571 0.877620 0.110221 0.006412 0.003227 0.982989 0.007371 0.025128 0.003585 0.967053 0.004234 0.106745 0.658566 0.084442 0.150247 0.067070 0.073934 0.717501 0.141496 0.274112 0.111425 0.462435 0.152028 0.234308 0.321306 0.204076 0.240310 0.280137 0.240681 0.279350 0.199831 0.232313 0.256316 0.150766 0.360606 0.201205 0.347131 0.166164 0.285501 0.149122 0.065476 0.140479 0.644922 0.104824 0.254506 0.412716 0.227955 Consensus sequence: VVVDHHTGCGYGGGCGDHVHHTB Alignment: VVVDHHTGCGYGGGCGDHVHHTB -MGGTCAGGGTGACCTRDBHV-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00034 Sox7_secondary Original Motif Original Motif Forward 1 20 0.078011 Species: Mus musculus Original motif 0.067627 0.131333 0.654425 0.146615 0.156488 0.114442 0.145630 0.583441 0.206450 0.265630 0.358017 0.169903 0.090729 0.460713 0.274712 0.173847 0.285994 0.099998 0.154485 0.459523 0.635908 0.184787 0.072982 0.106323 0.748421 0.039204 0.092605 0.119769 0.081342 0.061327 0.044532 0.812799 0.143120 0.043879 0.024216 0.788785 0.247544 0.092102 0.621453 0.038901 0.295531 0.036295 0.027594 0.640580 0.194561 0.305468 0.339916 0.160055 0.175038 0.193568 0.101212 0.530182 0.145226 0.167488 0.559871 0.127415 0.271501 0.237429 0.206701 0.284369 0.216834 0.109191 0.569605 0.104370 0.182624 0.177160 0.300475 0.339742 0.331737 0.198645 0.265137 0.204482 0.230155 0.359365 0.183450 0.227029 0.056581 0.067297 0.463052 0.413070 0.198891 0.324626 0.304424 0.172059 0.181968 0.287547 0.202419 0.328066 Consensus sequence: GTVBDAATTGTVTGHGDDHKVB Reverse complement motif 0.328066 0.287547 0.202419 0.181968 0.198891 0.304424 0.324626 0.172059 0.056581 0.463052 0.067297 0.413070 0.230155 0.183450 0.359365 0.227029 0.204482 0.198645 0.265137 0.331737 0.339742 0.177160 0.300475 0.182624 0.216834 0.569605 0.109191 0.104370 0.284369 0.237429 0.206701 0.271501 0.145226 0.559871 0.167488 0.127415 0.530182 0.193568 0.101212 0.175038 0.194561 0.339916 0.305468 0.160055 0.640580 0.036295 0.027594 0.295531 0.247544 0.621453 0.092102 0.038901 0.788785 0.043879 0.024216 0.143120 0.812799 0.061327 0.044532 0.081342 0.119769 0.039204 0.092605 0.748421 0.106323 0.184787 0.072982 0.635908 0.459523 0.099998 0.154485 0.285994 0.090729 0.274712 0.460713 0.173847 0.206450 0.358017 0.265630 0.169903 0.583441 0.114442 0.145630 0.156488 0.067627 0.654425 0.131333 0.146615 Consensus sequence: VVYDDDCHCAVACAATTDBVAC Alignment: GTVBDAATTGTVTGHGDDHKVB VDBHMAGGTCACCCTGACCY-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 4 Motif name: Esrrb Original motif 0.290198 0.220264 0.271200 0.218337 0.184941 0.227810 0.376477 0.210772 0.115226 0.332236 0.331687 0.220850 0.070959 0.342466 0.122740 0.463836 0.084862 0.729264 0.171640 0.014235 0.909737 0.008753 0.067834 0.013676 0.975656 0.000547 0.016411 0.007385 0.008758 0.001368 0.981390 0.008484 0.005750 0.003286 0.986309 0.004655 0.049904 0.012613 0.066904 0.870579 0.002473 0.927473 0.046703 0.023352 0.951569 0.005504 0.035498 0.007430 Consensus sequence: VBBYCAAGGTCA Reserve complement motif 0.007430 0.005504 0.035498 0.951569 0.002473 0.046703 0.927473 0.023352 0.870579 0.012613 0.066904 0.049904 0.005750 0.986309 0.003286 0.004655 0.008758 0.981390 0.001368 0.008484 0.007385 0.000547 0.016411 0.975656 0.013676 0.008753 0.067834 0.909737 0.084862 0.171640 0.729264 0.014235 0.463836 0.342466 0.122740 0.070959 0.115226 0.331687 0.332236 0.220850 0.184941 0.376477 0.227810 0.210772 0.218337 0.220264 0.271200 0.290198 Consensus sequence: TGACCTTGMBBB ************************************************************************ Best Matches for Motif ID 4 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00079 Esrra_primary Reverse Complement Reverse Complement Forward 6 12 0.000000 Species: Mus musculus Original motif 0.212524 0.177958 0.293723 0.315796 0.420838 0.283140 0.144938 0.151084 0.198119 0.196347 0.260353 0.345181 0.117752 0.282184 0.137207 0.462857 0.070125 0.781439 0.138093 0.010344 0.965989 0.000956 0.023828 0.009227 0.977263 0.003066 0.019255 0.000416 0.007404 0.000267 0.938934 0.053395 0.007147 0.000287 0.983377 0.009190 0.039608 0.000730 0.040682 0.918981 0.000685 0.905345 0.021930 0.072040 0.800961 0.001126 0.195791 0.002121 0.245039 0.241263 0.038084 0.475614 0.265397 0.238316 0.304963 0.191325 0.203742 0.286208 0.231002 0.279048 0.194132 0.188854 0.346693 0.270322 0.310711 0.263840 0.184317 0.241132 Consensus sequence: DHDBCAAGGTCAHVBDH Reverse complement motif 0.241132 0.263840 0.184317 0.310711 0.194132 0.346693 0.188854 0.270322 0.203742 0.231002 0.286208 0.279048 0.265397 0.304963 0.238316 0.191325 0.475614 0.241263 0.038084 0.245039 0.002121 0.001126 0.195791 0.800961 0.000685 0.021930 0.905345 0.072040 0.918981 0.000730 0.040682 0.039608 0.007147 0.983377 0.000287 0.009190 0.007404 0.938934 0.000267 0.053395 0.000416 0.003066 0.019255 0.977263 0.009227 0.000956 0.023828 0.965989 0.070125 0.138093 0.781439 0.010344 0.462857 0.282184 0.137207 0.117752 0.345181 0.196347 0.260353 0.198119 0.151084 0.283140 0.144938 0.420838 0.315796 0.177958 0.293723 0.212524 Consensus sequence: HHBVHTGACCTTGVDHD Alignment: HHBVHTGACCTTGVDHD -----TGACCTTGMBBB ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00009 Nr2f2_primary Original Motif Original Motif Backward 5 12 0.020547 Species: Mus musculus Original motif 0.253408 0.181904 0.273186 0.291502 0.262827 0.381870 0.153734 0.201569 0.143383 0.243233 0.242562 0.370823 0.247498 0.336892 0.176114 0.239496 0.856654 0.037068 0.049492 0.056786 0.797369 0.012935 0.176463 0.013233 0.808222 0.001309 0.189796 0.000674 0.002583 0.000536 0.989167 0.007714 0.002421 0.000283 0.972777 0.024519 0.000270 0.003650 0.019038 0.977041 0.000184 0.956654 0.005329 0.037833 0.925587 0.000706 0.072434 0.001273 0.307028 0.327297 0.079126 0.286549 0.238576 0.245847 0.384025 0.131552 0.281599 0.234987 0.226211 0.257204 0.211511 0.212695 0.363980 0.211815 Consensus sequence: DHBHAAAGGTCAHVHB Reverse complement motif 0.211511 0.363980 0.212695 0.211815 0.257204 0.234987 0.226211 0.281599 0.238576 0.384025 0.245847 0.131552 0.307028 0.079126 0.327297 0.286549 0.001273 0.000706 0.072434 0.925587 0.000184 0.005329 0.956654 0.037833 0.977041 0.003650 0.019038 0.000270 0.002421 0.972777 0.000283 0.024519 0.002583 0.989167 0.000536 0.007714 0.000674 0.001309 0.189796 0.808222 0.013233 0.012935 0.176463 0.797369 0.056786 0.037068 0.049492 0.856654 0.247498 0.176114 0.336892 0.239496 0.370823 0.243233 0.242562 0.143383 0.262827 0.153734 0.381870 0.201569 0.291502 0.181904 0.273186 0.253408 Consensus sequence: BHVDTGACCTTTDVDD Alignment: DHBHAAAGGTCAHVHB VBBYCAAGGTCA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00048 Rara Original Motif Original Motif Backward 5 12 0.021437 Species: Mus musculus Original motif 0.222478 0.177331 0.266395 0.333797 0.276222 0.360097 0.118354 0.245327 0.106047 0.268455 0.234217 0.391281 0.244163 0.407141 0.146864 0.201832 0.852083 0.050643 0.039941 0.057332 0.814108 0.012894 0.165984 0.007015 0.905198 0.005648 0.088378 0.000776 0.002783 0.000555 0.988205 0.008457 0.001289 0.000626 0.898209 0.099877 0.002878 0.001631 0.008910 0.986582 0.000499 0.975550 0.005264 0.018687 0.963627 0.000883 0.034432 0.001058 0.181490 0.517766 0.077094 0.223650 0.183789 0.384790 0.308350 0.123071 0.229801 0.228801 0.224468 0.316930 0.218244 0.170273 0.366746 0.244736 Consensus sequence: DHBHAAAGGTCACVHD Reverse complement motif 0.218244 0.366746 0.170273 0.244736 0.316930 0.228801 0.224468 0.229801 0.183789 0.308350 0.384790 0.123071 0.181490 0.077094 0.517766 0.223650 0.001058 0.000883 0.034432 0.963627 0.000499 0.005264 0.975550 0.018687 0.986582 0.001631 0.008910 0.002878 0.001289 0.898209 0.000626 0.099877 0.002783 0.988205 0.000555 0.008457 0.000776 0.005648 0.088378 0.905198 0.007015 0.012894 0.165984 0.814108 0.057332 0.050643 0.039941 0.852083 0.244163 0.146864 0.407141 0.201832 0.391281 0.268455 0.234217 0.106047 0.276222 0.118354 0.360097 0.245327 0.333797 0.177331 0.266395 0.222478 Consensus sequence: HHVGTGACCTTTDVDD Alignment: DHBHAAAGGTCACVHD VBBYCAAGGTCA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00009 Nr2f2_secondary Reverse Complement Reverse Complement Forward 5 12 0.043076 Species: Mus musculus Original motif 0.195749 0.435700 0.196915 0.171636 0.131070 0.131912 0.417834 0.319184 0.238959 0.441529 0.174973 0.144539 0.187749 0.189727 0.405849 0.216675 0.006751 0.541370 0.182092 0.269787 0.005388 0.590608 0.339869 0.064135 0.088153 0.004666 0.902351 0.004830 0.002459 0.004278 0.982637 0.010626 0.003618 0.002504 0.985275 0.008602 0.003325 0.004017 0.009244 0.983414 0.002547 0.972864 0.005345 0.019244 0.940260 0.002927 0.053632 0.003181 0.222459 0.390569 0.251497 0.135475 0.151824 0.258444 0.332866 0.256865 0.175811 0.290583 0.232086 0.301520 0.356690 0.198973 0.136050 0.308287 Consensus sequence: VBVBCSGGGTCAVBBH Reverse complement motif 0.308287 0.198973 0.136050 0.356690 0.301520 0.290583 0.232086 0.175811 0.151824 0.332866 0.258444 0.256865 0.222459 0.251497 0.390569 0.135475 0.003181 0.002927 0.053632 0.940260 0.002547 0.005345 0.972864 0.019244 0.983414 0.004017 0.009244 0.003325 0.003618 0.985275 0.002504 0.008602 0.002459 0.982637 0.004278 0.010626 0.088153 0.902351 0.004666 0.004830 0.005388 0.339869 0.590608 0.064135 0.006751 0.182092 0.541370 0.269787 0.187749 0.405849 0.189727 0.216675 0.238959 0.174973 0.441529 0.144539 0.131070 0.417834 0.131912 0.319184 0.195749 0.196915 0.435700 0.171636 Consensus sequence: HVBVTGACCCSGBVBV Alignment: HVBVTGACCCSGBVBV ----TGACCTTGMBBB ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00066 Hnf4a_primary Original Motif Original Motif Forward 1 12 0.045178 Species: Mus musculus Original motif 0.223704 0.280688 0.251889 0.243719 0.198683 0.190981 0.267970 0.342366 0.150012 0.319579 0.206063 0.324347 0.274896 0.302572 0.238597 0.183935 0.438853 0.331148 0.021186 0.208812 0.133937 0.027342 0.832490 0.006231 0.141462 0.002336 0.854359 0.001843 0.003464 0.000753 0.987433 0.008349 0.004388 0.000692 0.884494 0.110426 0.003808 0.001605 0.016793 0.977794 0.001992 0.976605 0.003739 0.017664 0.881237 0.089981 0.026017 0.002764 0.735041 0.106592 0.083260 0.075107 0.164419 0.315518 0.181031 0.339032 0.228285 0.176364 0.157583 0.437768 0.233407 0.193567 0.327076 0.245951 0.320479 0.312566 0.195701 0.171254 Consensus sequence: BDBVMGGGGTCAABHDV Reverse complement motif 0.171254 0.312566 0.195701 0.320479 0.233407 0.327076 0.193567 0.245951 0.437768 0.176364 0.157583 0.228285 0.339032 0.315518 0.181031 0.164419 0.075107 0.106592 0.083260 0.735041 0.002764 0.089981 0.026017 0.881237 0.001992 0.003739 0.976605 0.017664 0.977794 0.001605 0.016793 0.003808 0.004388 0.884494 0.000692 0.110426 0.003464 0.987433 0.000753 0.008349 0.141462 0.854359 0.002336 0.001843 0.133937 0.832490 0.027342 0.006231 0.208812 0.331148 0.021186 0.438853 0.274896 0.238597 0.302572 0.183935 0.324347 0.319579 0.206063 0.150012 0.342366 0.190981 0.267970 0.198683 0.223704 0.251889 0.280688 0.243719 Consensus sequence: BHHVTTGACCCCYVVDB Alignment: BDBVMGGGGTCAABHDV VBBYCAAGGTCA----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00079 Esrra_secondary Original Motif Original Motif Backward 6 12 0.048250 Species: Mus musculus Original motif 0.252126 0.268706 0.351590 0.127578 0.158171 0.083434 0.389646 0.368749 0.180010 0.290882 0.279192 0.249916 0.206905 0.249360 0.275438 0.268296 0.756588 0.046202 0.023921 0.173289 0.018262 0.022596 0.949143 0.010000 0.206468 0.046491 0.745475 0.001566 0.005511 0.001141 0.983152 0.010196 0.004791 0.001893 0.985951 0.007365 0.027643 0.001133 0.008565 0.962659 0.002459 0.970934 0.007826 0.018780 0.924387 0.003164 0.071225 0.001224 0.419387 0.230189 0.111588 0.238836 0.290954 0.163823 0.341233 0.203991 0.196768 0.281307 0.313868 0.208056 0.128428 0.260428 0.378607 0.232537 0.269305 0.378895 0.123480 0.228320 Consensus sequence: VKBBAGGGGTCAHDBBH Reverse complement motif 0.269305 0.123480 0.378895 0.228320 0.128428 0.378607 0.260428 0.232537 0.196768 0.313868 0.281307 0.208056 0.290954 0.341233 0.163823 0.203991 0.238836 0.230189 0.111588 0.419387 0.001224 0.003164 0.071225 0.924387 0.002459 0.007826 0.970934 0.018780 0.962659 0.001133 0.008565 0.027643 0.004791 0.985951 0.001893 0.007365 0.005511 0.983152 0.001141 0.010196 0.206468 0.745475 0.046491 0.001566 0.018262 0.949143 0.022596 0.010000 0.173289 0.046202 0.023921 0.756588 0.206905 0.275438 0.249360 0.268296 0.180010 0.279192 0.290882 0.249916 0.158171 0.389646 0.083434 0.368749 0.252126 0.351590 0.268706 0.127578 Consensus sequence: DBBHHTGACCCCTBBYV Alignment: VKBBAGGGGTCAHDBBH VBBYCAAGGTCA----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00053 Rxra_primary Reverse Complement Original Motif Backward 1 12 0.049902 Species: Mus musculus Original motif 0.235299 0.222264 0.237416 0.305021 0.144778 0.278902 0.341673 0.234648 0.261127 0.261904 0.191591 0.285378 0.119943 0.410774 0.218940 0.250343 0.222672 0.075554 0.365253 0.336521 0.001838 0.046904 0.002828 0.948430 0.030410 0.006359 0.960821 0.002410 0.987391 0.007562 0.002810 0.002237 0.105188 0.888650 0.001163 0.004998 0.006475 0.987074 0.001793 0.004659 0.001816 0.765138 0.003092 0.229953 0.010354 0.846496 0.029899 0.113251 0.328732 0.039382 0.265510 0.366377 0.209638 0.262628 0.145613 0.382121 0.385390 0.177695 0.299828 0.137087 0.403452 0.268924 0.096028 0.231595 0.203082 0.231812 0.213520 0.351585 Consensus sequence: DBHBDTGACCCCDHVHB Reverse complement motif 0.351585 0.231812 0.213520 0.203082 0.231595 0.268924 0.096028 0.403452 0.137087 0.177695 0.299828 0.385390 0.382121 0.262628 0.145613 0.209638 0.366377 0.039382 0.265510 0.328732 0.010354 0.029899 0.846496 0.113251 0.001816 0.003092 0.765138 0.229953 0.006475 0.001793 0.987074 0.004659 0.105188 0.001163 0.888650 0.004998 0.002237 0.007562 0.002810 0.987391 0.030410 0.960821 0.006359 0.002410 0.948430 0.046904 0.002828 0.001838 0.222672 0.365253 0.075554 0.336521 0.119943 0.218940 0.410774 0.250343 0.285378 0.261904 0.191591 0.261127 0.144778 0.341673 0.278902 0.234648 0.305021 0.222264 0.237416 0.235299 Consensus sequence: VHBHDGGGGTCAHBHBD Alignment: DBHBDTGACCCCDHVHB -----TGACCTTGMBBB ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v015681_secondary Reverse Complement Reverse Complement Forward 8 12 0.052535 Species: Mus musculus Original motif 0.331499 0.188505 0.182841 0.297156 0.328961 0.213025 0.273530 0.184484 0.197213 0.129292 0.524914 0.148581 0.274491 0.226406 0.312118 0.186986 0.103231 0.393726 0.364988 0.138055 0.552594 0.166422 0.186262 0.094722 0.157618 0.064773 0.616497 0.161112 0.139166 0.176098 0.621185 0.063551 0.748420 0.062398 0.012447 0.176735 0.116584 0.009438 0.860326 0.013653 0.005030 0.003646 0.974877 0.016447 0.055257 0.007181 0.921760 0.015802 0.032748 0.058249 0.052709 0.856293 0.105606 0.872231 0.014370 0.007793 0.019480 0.497379 0.125899 0.357242 0.478582 0.269713 0.061464 0.190242 0.253985 0.287006 0.201320 0.257689 0.319384 0.210231 0.175842 0.294543 0.222123 0.287802 0.201294 0.288782 0.139951 0.376041 0.081133 0.402875 0.213450 0.343835 0.383676 0.059039 0.322294 0.355918 0.148062 0.173725 Consensus sequence: HVGVSAGGAGGGTCYHHHHYVH Reverse complement motif 0.322294 0.148062 0.355918 0.173725 0.213450 0.383676 0.343835 0.059039 0.402875 0.376041 0.081133 0.139951 0.288782 0.287802 0.201294 0.222123 0.294543 0.210231 0.175842 0.319384 0.253985 0.201320 0.287006 0.257689 0.190242 0.269713 0.061464 0.478582 0.019480 0.125899 0.497379 0.357242 0.105606 0.014370 0.872231 0.007793 0.856293 0.058249 0.052709 0.032748 0.055257 0.921760 0.007181 0.015802 0.005030 0.974877 0.003646 0.016447 0.116584 0.860326 0.009438 0.013653 0.176735 0.062398 0.012447 0.748420 0.139166 0.621185 0.176098 0.063551 0.157618 0.616497 0.064773 0.161112 0.094722 0.166422 0.186262 0.552594 0.103231 0.364988 0.393726 0.138055 0.274491 0.312118 0.226406 0.186986 0.197213 0.524914 0.129292 0.148581 0.184484 0.213025 0.273530 0.328961 0.297156 0.188505 0.182841 0.331499 Consensus sequence: DVMHHDHKGACCCTCCTSVCBH Alignment: DVMHHDHKGACCCTCCTSVCBH -------TGACCTTGMBBB--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00066 Hnf4a_secondary Reverse Complement Reverse Complement Backward 1 12 0.058055 Species: Mus musculus Original motif 0.131680 0.169949 0.346277 0.352094 0.109910 0.144258 0.373681 0.372151 0.196671 0.411335 0.159689 0.232305 0.311086 0.307077 0.122332 0.259505 0.895155 0.013238 0.038874 0.052733 0.779629 0.018399 0.171269 0.030703 0.950546 0.002649 0.041825 0.004980 0.004769 0.002646 0.985847 0.006739 0.004458 0.002117 0.012011 0.981414 0.016789 0.969626 0.003890 0.009695 0.002468 0.982852 0.004754 0.009926 0.891448 0.003193 0.097548 0.007811 0.513330 0.308971 0.070467 0.107232 0.179371 0.115514 0.130898 0.574217 0.285826 0.277536 0.166982 0.269655 0.319407 0.227783 0.129020 0.323790 Consensus sequence: BBHHAAAGTCCAMTHH Reverse complement motif 0.323790 0.227783 0.129020 0.319407 0.269655 0.277536 0.166982 0.285826 0.574217 0.115514 0.130898 0.179371 0.107232 0.308971 0.070467 0.513330 0.007811 0.003193 0.097548 0.891448 0.002468 0.004754 0.982852 0.009926 0.016789 0.003890 0.969626 0.009695 0.981414 0.002117 0.012011 0.004458 0.004769 0.985847 0.002646 0.006739 0.004980 0.002649 0.041825 0.950546 0.030703 0.018399 0.171269 0.779629 0.052733 0.013238 0.038874 0.895155 0.259505 0.307077 0.122332 0.311086 0.196671 0.159689 0.411335 0.232305 0.109910 0.373681 0.144258 0.372151 0.352094 0.169949 0.346277 0.131680 Consensus sequence: HHAYTGGACTTTHDBV Alignment: HHAYTGGACTTTHDBV ----TGACCTTGMBBB ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00098 Rfx3_secondary Reverse Complement Reverse Complement Forward 9 12 0.060974 Species: Mus musculus Original motif 0.314514 0.275352 0.257617 0.152518 0.126939 0.598294 0.130576 0.144192 0.102265 0.155334 0.177957 0.564445 0.129288 0.282678 0.326990 0.261044 0.318166 0.227823 0.175681 0.278330 0.109019 0.380838 0.278328 0.231815 0.226145 0.289206 0.291300 0.193348 0.035863 0.844339 0.072582 0.047216 0.223793 0.187244 0.088092 0.500871 0.039800 0.029681 0.026201 0.904317 0.298298 0.032147 0.654746 0.014809 0.014729 0.022023 0.944826 0.018422 0.485114 0.004925 0.013785 0.496176 0.035708 0.020381 0.240804 0.703108 0.951152 0.012738 0.017886 0.018224 0.023713 0.944394 0.009538 0.022355 0.291067 0.385205 0.232388 0.091339 0.340334 0.199588 0.311526 0.148552 0.198713 0.472138 0.178319 0.150830 0.321155 0.269932 0.311301 0.097612 0.412646 0.195252 0.231950 0.160152 0.297134 0.180928 0.250400 0.271538 0.151169 0.305386 0.358574 0.184871 Consensus sequence: VCTBHBVCTTGGWTACVVVVVDB Reverse complement motif 0.151169 0.358574 0.305386 0.184871 0.271538 0.180928 0.250400 0.297134 0.160152 0.195252 0.231950 0.412646 0.097612 0.269932 0.311301 0.321155 0.198713 0.178319 0.472138 0.150830 0.148552 0.199588 0.311526 0.340334 0.291067 0.232388 0.385205 0.091339 0.023713 0.009538 0.944394 0.022355 0.018224 0.012738 0.017886 0.951152 0.703108 0.020381 0.240804 0.035708 0.496176 0.004925 0.013785 0.485114 0.014729 0.944826 0.022023 0.018422 0.298298 0.654746 0.032147 0.014809 0.904317 0.029681 0.026201 0.039800 0.500871 0.187244 0.088092 0.223793 0.035863 0.072582 0.844339 0.047216 0.226145 0.291300 0.289206 0.193348 0.109019 0.278328 0.380838 0.231815 0.278330 0.227823 0.175681 0.318166 0.129288 0.326990 0.282678 0.261044 0.564445 0.155334 0.177957 0.102265 0.126939 0.130576 0.598294 0.144192 0.152518 0.275352 0.257617 0.314514 Consensus sequence: BDBBVBVGTAWCCAAGVBHBAGB Alignment: BDBBVBVGTAWCCAAGVBHBAGB --------TGACCTTGMBBB--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 5 Motif name: ZEB1 Original motif 0.024390 0.829268 0.024390 0.121951 0.926829 0.000000 0.048780 0.024390 0.000000 0.975610 0.024390 0.000000 0.000000 0.926829 0.073171 0.000000 0.000000 0.024390 0.000000 0.975610 0.243902 0.024390 0.390244 0.341463 Consensus sequence: CACCTD Reserve complement motif 0.243902 0.390244 0.024390 0.341463 0.975610 0.024390 0.000000 0.000000 0.000000 0.073171 0.926829 0.000000 0.000000 0.024390 0.975610 0.000000 0.024390 0.000000 0.048780 0.926829 0.024390 0.024390 0.829268 0.121951 Consensus sequence: HAGGTG ************************************************************************ Best Matches for Motif ID 5 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00068 Eomes_secondary Original Motif Reverse Complement Backward 4 6 0.000000 Species: Mus musculus Original motif 0.253642 0.252604 0.298295 0.195458 0.112892 0.341342 0.341061 0.204704 0.297430 0.215095 0.343350 0.144125 0.241098 0.129378 0.421448 0.208076 0.894201 0.007299 0.061032 0.037468 0.052259 0.054303 0.856609 0.036829 0.005074 0.015048 0.966734 0.013144 0.003258 0.061529 0.002368 0.932845 0.017531 0.005025 0.973155 0.004289 0.116022 0.030172 0.047139 0.806667 0.027749 0.602513 0.009946 0.359792 0.018763 0.048982 0.794648 0.137608 0.177116 0.459591 0.284833 0.078460 0.121483 0.491485 0.148745 0.238287 0.152590 0.245835 0.214717 0.386857 0.221040 0.320773 0.249918 0.208270 Consensus sequence: VBVDAGGTGTYGVBBV Reverse complement motif 0.221040 0.249918 0.320773 0.208270 0.386857 0.245835 0.214717 0.152590 0.121483 0.148745 0.491485 0.238287 0.177116 0.284833 0.459591 0.078460 0.018763 0.794648 0.048982 0.137608 0.027749 0.009946 0.602513 0.359792 0.806667 0.030172 0.047139 0.116022 0.017531 0.973155 0.005025 0.004289 0.932845 0.061529 0.002368 0.003258 0.005074 0.966734 0.015048 0.013144 0.052259 0.856609 0.054303 0.036829 0.037468 0.007299 0.061032 0.894201 0.241098 0.421448 0.129378 0.208076 0.297430 0.343350 0.215095 0.144125 0.112892 0.341061 0.341342 0.204704 0.253642 0.298295 0.252604 0.195458 Consensus sequence: VVBVCKACACCTHVBV Alignment: VVBVCKACACCTHVBV -------CACCTD--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00199 Six4 Reverse Complement Reverse Complement Forward 4 6 0.004331 Species: Mus musculus Original motif 0.523054 0.168817 0.140331 0.167798 0.187385 0.177009 0.246164 0.389442 0.414492 0.118547 0.308876 0.158085 0.345234 0.289795 0.130249 0.234723 0.611522 0.116948 0.098944 0.172586 0.016342 0.029436 0.015062 0.939161 0.014351 0.004796 0.962435 0.018418 0.987454 0.005228 0.002590 0.004727 0.007431 0.812214 0.005849 0.174506 0.969354 0.025386 0.002362 0.002898 0.005123 0.989068 0.003362 0.002447 0.001424 0.969981 0.012011 0.016585 0.209729 0.227411 0.210523 0.352337 0.341679 0.297940 0.104590 0.255792 0.126190 0.288862 0.245018 0.339930 0.173008 0.295896 0.252422 0.278674 0.409639 0.210750 0.296197 0.083415 Consensus sequence: ADDHATGACACCBHBBV Reverse complement motif 0.083415 0.210750 0.296197 0.409639 0.173008 0.252422 0.295896 0.278674 0.339930 0.288862 0.245018 0.126190 0.255792 0.297940 0.104590 0.341679 0.352337 0.227411 0.210523 0.209729 0.001424 0.012011 0.969981 0.016585 0.005123 0.003362 0.989068 0.002447 0.002898 0.025386 0.002362 0.969354 0.007431 0.005849 0.812214 0.174506 0.004727 0.005228 0.002590 0.987454 0.014351 0.962435 0.004796 0.018418 0.939161 0.029436 0.015062 0.016342 0.172586 0.116948 0.098944 0.611522 0.234723 0.289795 0.130249 0.345234 0.158085 0.118547 0.308876 0.414492 0.389442 0.177009 0.246164 0.187385 0.167798 0.168817 0.140331 0.523054 Consensus sequence: BBVHVGGTGTCATHDDT Alignment: BBVHVGGTGTCATHDDT ---HAGGTG-------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00068 Eomes_primary Original Motif Reverse Complement Forward 9 6 0.005241 Species: Mus musculus Original motif 0.186316 0.215541 0.297644 0.300499 0.300381 0.234276 0.266283 0.199061 0.317841 0.211418 0.183235 0.287507 0.482598 0.095323 0.245062 0.177017 0.654197 0.008988 0.261951 0.074864 0.095656 0.022883 0.843364 0.038097 0.002655 0.008355 0.976390 0.012600 0.003287 0.080755 0.001057 0.914900 0.006753 0.001517 0.989917 0.001813 0.039940 0.098800 0.003305 0.857955 0.009015 0.039036 0.844029 0.107921 0.984070 0.002369 0.008852 0.004709 0.789505 0.101528 0.029294 0.079672 0.649685 0.139882 0.090466 0.119966 0.421759 0.205595 0.073074 0.299573 0.214779 0.290522 0.134050 0.360649 0.202141 0.270323 0.176798 0.350738 Consensus sequence: BVHDAGGTGTGAAAHHH Reverse complement motif 0.350738 0.270323 0.176798 0.202141 0.360649 0.290522 0.134050 0.214779 0.299573 0.205595 0.073074 0.421759 0.119966 0.139882 0.090466 0.649685 0.079672 0.101528 0.029294 0.789505 0.004709 0.002369 0.008852 0.984070 0.009015 0.844029 0.039036 0.107921 0.857955 0.098800 0.003305 0.039940 0.006753 0.989917 0.001517 0.001813 0.914900 0.080755 0.001057 0.003287 0.002655 0.976390 0.008355 0.012600 0.095656 0.843364 0.022883 0.038097 0.074864 0.008988 0.261951 0.654197 0.177017 0.095323 0.245062 0.482598 0.287507 0.211418 0.183235 0.317841 0.199061 0.234276 0.266283 0.300381 0.300499 0.215541 0.297644 0.186316 Consensus sequence: HHHTTTCACACCTDHBV Alignment: HHHTTTCACACCTDHBV --------CACCTD--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00046 Tcfe2a_primary Original Motif Reverse Complement Forward 7 6 0.009113 Species: Mus musculus Original motif 0.306209 0.232705 0.244475 0.216611 0.165668 0.171480 0.222584 0.440269 0.213008 0.429038 0.156385 0.201569 0.283226 0.329518 0.160795 0.226461 0.439156 0.283517 0.251270 0.026056 0.014994 0.980987 0.000714 0.003304 0.975741 0.020182 0.002909 0.001168 0.000926 0.191353 0.801648 0.006073 0.015382 0.090853 0.893043 0.000721 0.001549 0.005912 0.001713 0.990826 0.004000 0.000857 0.989667 0.005475 0.016957 0.663726 0.148127 0.171190 0.299047 0.091156 0.448649 0.161148 0.354701 0.214677 0.236757 0.193865 0.399446 0.174508 0.200036 0.226009 0.303545 0.277435 0.200094 0.218926 0.380242 0.148876 0.163367 0.307514 Consensus sequence: VBHHVCAGGTGCDVDHD Reverse complement motif 0.307514 0.148876 0.163367 0.380242 0.218926 0.277435 0.200094 0.303545 0.226009 0.174508 0.200036 0.399446 0.193865 0.214677 0.236757 0.354701 0.299047 0.448649 0.091156 0.161148 0.016957 0.148127 0.663726 0.171190 0.004000 0.989667 0.000857 0.005475 0.990826 0.005912 0.001713 0.001549 0.015382 0.893043 0.090853 0.000721 0.000926 0.801648 0.191353 0.006073 0.001168 0.020182 0.002909 0.975741 0.014994 0.000714 0.980987 0.003304 0.026056 0.283517 0.251270 0.439156 0.283226 0.160795 0.329518 0.226461 0.213008 0.156385 0.429038 0.201569 0.440269 0.171480 0.222584 0.165668 0.216611 0.232705 0.244475 0.306209 Consensus sequence: DHDBHGCACCTGBDDVB Alignment: DHDBHGCACCTGBDDVB ------CACCTD----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00047 Zbtb7b_secondary Original Motif Original Motif Backward 4 6 0.023356 Species: Mus musculus Original motif 0.203365 0.307129 0.203712 0.285795 0.306328 0.182359 0.203143 0.308170 0.220878 0.174035 0.265341 0.339746 0.475421 0.085294 0.281054 0.158231 0.395971 0.330114 0.260810 0.013104 0.001970 0.006366 0.962058 0.029606 0.907785 0.081900 0.001279 0.009036 0.008745 0.981422 0.002970 0.006863 0.006791 0.966163 0.017605 0.009441 0.894233 0.081139 0.004949 0.019679 0.007553 0.970771 0.004892 0.016783 0.016719 0.797465 0.011842 0.173974 0.415678 0.189952 0.165207 0.229163 0.092707 0.182206 0.346121 0.378967 0.175722 0.130498 0.215118 0.478662 0.365762 0.163282 0.315788 0.155168 0.214734 0.272805 0.243194 0.269267 Consensus sequence: BDDRVGACCACCHBDVB Reverse complement motif 0.214734 0.243194 0.272805 0.269267 0.155168 0.163282 0.315788 0.365762 0.478662 0.130498 0.215118 0.175722 0.378967 0.182206 0.346121 0.092707 0.229163 0.189952 0.165207 0.415678 0.016719 0.011842 0.797465 0.173974 0.007553 0.004892 0.970771 0.016783 0.019679 0.081139 0.004949 0.894233 0.006791 0.017605 0.966163 0.009441 0.008745 0.002970 0.981422 0.006863 0.009036 0.081900 0.001279 0.907785 0.001970 0.962058 0.006366 0.029606 0.013104 0.330114 0.260810 0.395971 0.158231 0.085294 0.281054 0.475421 0.339746 0.174035 0.265341 0.220878 0.308170 0.182359 0.203143 0.306328 0.203365 0.203712 0.307129 0.285795 Consensus sequence: BBDVHGGTGGTCBKDDB Alignment: BDDRVGACCACCHBDVB --------CACCTD--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v016060_primary Reverse Complement Original Motif Backward 11 6 0.023393 Species: Mus musculus Original motif 0.204923 0.208846 0.365383 0.220848 0.294304 0.300143 0.167287 0.238266 0.109711 0.619514 0.117379 0.153396 0.178979 0.378580 0.230177 0.212264 0.159594 0.542602 0.118178 0.179627 0.125206 0.430074 0.151826 0.292894 0.097692 0.709845 0.116956 0.075506 0.148292 0.565912 0.037632 0.248164 0.077951 0.034190 0.855503 0.032356 0.001657 0.001061 0.971877 0.025405 0.001926 0.001084 0.991712 0.005278 0.033031 0.012001 0.057796 0.897171 0.002723 0.002647 0.993348 0.001281 0.003261 0.000963 0.987199 0.008577 0.000611 0.090925 0.074857 0.833608 0.015299 0.978878 0.004949 0.000874 0.013368 0.600902 0.033485 0.352245 0.231949 0.149575 0.118804 0.499672 0.267580 0.186002 0.371242 0.175176 0.264884 0.223483 0.110082 0.401551 0.221365 0.170121 0.179559 0.428955 0.112997 0.692930 0.139981 0.054092 0.460305 0.207883 0.155111 0.176702 Consensus sequence: BHCBCBCCGGGTGGTCYHVHDCH Reverse complement motif 0.176702 0.207883 0.155111 0.460305 0.112997 0.139981 0.692930 0.054092 0.428955 0.170121 0.179559 0.221365 0.401551 0.223483 0.110082 0.264884 0.267580 0.371242 0.186002 0.175176 0.499672 0.149575 0.118804 0.231949 0.013368 0.033485 0.600902 0.352245 0.015299 0.004949 0.978878 0.000874 0.833608 0.090925 0.074857 0.000611 0.003261 0.987199 0.000963 0.008577 0.002723 0.993348 0.002647 0.001281 0.897171 0.012001 0.057796 0.033031 0.001926 0.991712 0.001084 0.005278 0.001657 0.971877 0.001061 0.025405 0.077951 0.855503 0.034190 0.032356 0.148292 0.037632 0.565912 0.248164 0.097692 0.116956 0.709845 0.075506 0.125206 0.151826 0.430074 0.292894 0.159594 0.118178 0.542602 0.179627 0.178979 0.230177 0.378580 0.212264 0.109711 0.117379 0.619514 0.153396 0.294304 0.167287 0.300143 0.238266 0.204923 0.365383 0.208846 0.220848 Consensus sequence: HGDHVHKGACCACCCGGBGBGDB Alignment: BHCBCBCCGGGTGGTCYHVHDCH -------HAGGTG---------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v015681_primary Original Motif Original Motif Backward 6 6 0.025434 Species: Mus musculus Original motif 0.472795 0.179227 0.091251 0.256726 0.036521 0.159743 0.204840 0.598896 0.164582 0.312805 0.221324 0.301289 0.237069 0.249050 0.293048 0.220833 0.401949 0.225181 0.229401 0.143469 0.161422 0.494334 0.252207 0.092036 0.252940 0.177721 0.369400 0.199939 0.119630 0.024651 0.849920 0.005798 0.000962 0.002398 0.990616 0.006023 0.937852 0.027016 0.034535 0.000597 0.008963 0.987756 0.000629 0.002652 0.001584 0.992898 0.002349 0.003169 0.956822 0.027342 0.002484 0.013352 0.009873 0.987759 0.000988 0.001381 0.016397 0.980856 0.000369 0.002378 0.081761 0.758555 0.038572 0.121112 0.371713 0.091838 0.448027 0.088423 0.111617 0.121913 0.683885 0.082585 0.334562 0.102916 0.436488 0.126034 0.210362 0.101261 0.238339 0.450037 0.169041 0.271583 0.320799 0.238576 0.140316 0.049885 0.735236 0.074563 Consensus sequence: HTBVVVDGGACCACCCRGRDBG Reverse complement motif 0.140316 0.735236 0.049885 0.074563 0.169041 0.320799 0.271583 0.238576 0.450037 0.101261 0.238339 0.210362 0.334562 0.436488 0.102916 0.126034 0.111617 0.683885 0.121913 0.082585 0.371713 0.448027 0.091838 0.088423 0.081761 0.038572 0.758555 0.121112 0.016397 0.000369 0.980856 0.002378 0.009873 0.000988 0.987759 0.001381 0.013352 0.027342 0.002484 0.956822 0.001584 0.002349 0.992898 0.003169 0.008963 0.000629 0.987756 0.002652 0.000597 0.027016 0.034535 0.937852 0.000962 0.990616 0.002398 0.006023 0.119630 0.849920 0.024651 0.005798 0.252940 0.369400 0.177721 0.199939 0.161422 0.252207 0.494334 0.092036 0.143469 0.225181 0.229401 0.401949 0.237069 0.293048 0.249050 0.220833 0.164582 0.221324 0.312805 0.301289 0.598896 0.159743 0.204840 0.036521 0.256726 0.179227 0.091251 0.472795 Consensus sequence: CBDMCMGGGTGGTCCHVBVBAH Alignment: HTBVVVDGGACCACCCRGRDBG -----------CACCTD----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v016060_primary Original Motif Original Motif Backward 6 6 0.029014 Species: Mus musculus Original motif 0.180868 0.321661 0.134642 0.362829 0.232215 0.134289 0.315356 0.318141 0.065068 0.093681 0.569842 0.271408 0.370822 0.229680 0.154738 0.244759 0.323039 0.182873 0.173588 0.320500 0.175039 0.266898 0.276080 0.281984 0.412669 0.147730 0.146326 0.293275 0.325953 0.028805 0.629596 0.015646 0.003017 0.001766 0.979711 0.015507 0.888973 0.040666 0.069420 0.000941 0.017309 0.979155 0.000899 0.002637 0.001732 0.988816 0.004856 0.004596 0.889763 0.078125 0.010384 0.021729 0.007566 0.987081 0.001421 0.003932 0.027797 0.966593 0.000878 0.004731 0.025816 0.867003 0.065749 0.041433 0.220658 0.075256 0.582904 0.121182 0.088946 0.283695 0.565345 0.062015 0.328012 0.241332 0.305901 0.124755 0.307302 0.137589 0.375928 0.179181 0.298752 0.231470 0.315255 0.154524 0.094565 0.142901 0.705696 0.056838 Consensus sequence: HDGHHBHRGACCACCCGSVDVG Reverse complement motif 0.094565 0.705696 0.142901 0.056838 0.298752 0.315255 0.231470 0.154524 0.307302 0.375928 0.137589 0.179181 0.124755 0.241332 0.305901 0.328012 0.088946 0.565345 0.283695 0.062015 0.220658 0.582904 0.075256 0.121182 0.025816 0.065749 0.867003 0.041433 0.027797 0.000878 0.966593 0.004731 0.007566 0.001421 0.987081 0.003932 0.021729 0.078125 0.010384 0.889763 0.001732 0.004856 0.988816 0.004596 0.017309 0.000899 0.979155 0.002637 0.000941 0.040666 0.069420 0.888973 0.003017 0.979711 0.001766 0.015507 0.325953 0.629596 0.028805 0.015646 0.293275 0.147730 0.146326 0.412669 0.281984 0.266898 0.276080 0.175039 0.320500 0.182873 0.173588 0.323039 0.244759 0.229680 0.154738 0.370822 0.065068 0.569842 0.093681 0.271408 0.318141 0.134289 0.315356 0.232215 0.362829 0.321661 0.134642 0.180868 Consensus sequence: CVHBSCGGGTGGTCMHVHHCDH Alignment: HDGHHBHRGACCACCCGSVDVG -----------CACCTD----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00036 Myf6_primary Reverse Complement Original Motif Backward 5 6 0.030967 Species: Mus musculus Original motif 0.249543 0.203739 0.394131 0.152587 0.349361 0.204136 0.321767 0.124736 0.386930 0.174655 0.250284 0.188131 0.173937 0.233501 0.412360 0.180201 0.663624 0.037653 0.264216 0.034507 0.717265 0.040761 0.206656 0.035318 0.004176 0.985948 0.003219 0.006657 0.967612 0.005543 0.008604 0.018241 0.080781 0.089857 0.746009 0.083354 0.019831 0.270961 0.409808 0.299401 0.019877 0.026996 0.014022 0.939105 0.005169 0.007980 0.978334 0.008518 0.115710 0.200514 0.226485 0.457291 0.032392 0.527196 0.128372 0.312041 0.202049 0.384912 0.106488 0.306551 0.181994 0.192975 0.425582 0.199448 Consensus sequence: VVDBAACAGBTGBYHB Reverse complement motif 0.181994 0.425582 0.192975 0.199448 0.202049 0.106488 0.384912 0.306551 0.032392 0.128372 0.527196 0.312041 0.457291 0.200514 0.226485 0.115710 0.005169 0.978334 0.007980 0.008518 0.939105 0.026996 0.014022 0.019877 0.019831 0.409808 0.270961 0.299401 0.080781 0.746009 0.089857 0.083354 0.018241 0.005543 0.008604 0.967612 0.004176 0.003219 0.985948 0.006657 0.035318 0.040761 0.206656 0.717265 0.034507 0.037653 0.264216 0.663624 0.173937 0.412360 0.233501 0.180201 0.188131 0.174655 0.250284 0.386930 0.124736 0.204136 0.321767 0.349361 0.249543 0.394131 0.203739 0.152587 Consensus sequence: BDKVCABCTGTTBDBV Alignment: VVDBAACAGBTGBYHB ------HAGGTG---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00249 Nkx2-5 Original Motif Original Motif Forward 6 6 0.031502 Species: Mus musculus Original motif 0.284346 0.280937 0.138180 0.296538 0.399663 0.110464 0.327481 0.162392 0.637560 0.029806 0.218321 0.114314 0.184898 0.144379 0.370828 0.299895 0.017459 0.862111 0.118223 0.002207 0.001004 0.958164 0.000888 0.039945 0.947796 0.011499 0.000413 0.040291 0.024268 0.973476 0.000709 0.001546 0.002616 0.001901 0.003337 0.992147 0.006742 0.071290 0.000276 0.921691 0.393078 0.093424 0.490620 0.022879 0.870162 0.007294 0.051952 0.070591 0.632449 0.156278 0.172644 0.038628 0.362798 0.126579 0.085796 0.424828 0.132810 0.206405 0.025084 0.635702 0.094708 0.272324 0.087702 0.545267 Consensus sequence: HDADCCACTTRAAWTT Reverse complement motif 0.545267 0.272324 0.087702 0.094708 0.635702 0.206405 0.025084 0.132810 0.424828 0.126579 0.085796 0.362798 0.038628 0.156278 0.172644 0.632449 0.070591 0.007294 0.051952 0.870162 0.393078 0.490620 0.093424 0.022879 0.921691 0.071290 0.000276 0.006742 0.992147 0.001901 0.003337 0.002616 0.024268 0.000709 0.973476 0.001546 0.040291 0.011499 0.000413 0.947796 0.001004 0.000888 0.958164 0.039945 0.017459 0.118223 0.862111 0.002207 0.184898 0.370828 0.144379 0.299895 0.114314 0.029806 0.218321 0.637560 0.162392 0.110464 0.327481 0.399663 0.296538 0.280937 0.138180 0.284346 Consensus sequence: AAWTTMAAGTGGHTDH Alignment: HDADCCACTTRAAWTT -----CACCTD----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 6 Motif name: Mycn Original motif 0.349315 0.363014 0.143836 0.143836 0.089041 0.388128 0.447489 0.075342 0.015982 0.984018 0.000000 0.000000 0.945205 0.000000 0.041096 0.013699 0.000000 0.961187 0.018265 0.020548 0.070776 0.002283 0.924658 0.002283 0.054795 0.221461 0.004566 0.719178 0.000000 0.000000 0.938356 0.061644 0.061644 0.111872 0.739726 0.086758 0.139269 0.605023 0.091324 0.164384 Consensus sequence: HSCACGTGGC Reserve complement motif 0.139269 0.091324 0.605023 0.164384 0.061644 0.739726 0.111872 0.086758 0.000000 0.938356 0.000000 0.061644 0.719178 0.221461 0.004566 0.054795 0.070776 0.924658 0.002283 0.002283 0.000000 0.018265 0.961187 0.020548 0.013699 0.000000 0.041096 0.945205 0.015982 0.000000 0.984018 0.000000 0.089041 0.447489 0.388128 0.075342 0.349315 0.143836 0.363014 0.143836 Consensus sequence: GCCACGTGSD ************************************************************************ Best Matches for Motif ID 6 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00060 Max_primary Original Motif Original Motif Forward 3 10 0.000000 Species: Mus musculus Original motif 0.234855 0.152539 0.301720 0.310886 0.199226 0.147959 0.439250 0.213565 0.582926 0.274768 0.075866 0.066440 0.138829 0.475428 0.305884 0.079859 0.024979 0.969691 0.001811 0.003520 0.966345 0.003728 0.022320 0.007607 0.000598 0.907006 0.008160 0.084236 0.084236 0.008160 0.907006 0.000598 0.007607 0.022320 0.003728 0.966345 0.003520 0.001811 0.969691 0.024979 0.149140 0.241218 0.389598 0.220044 0.066440 0.075866 0.274768 0.582926 0.186990 0.346199 0.250066 0.216745 0.273437 0.225889 0.300738 0.199936 0.160893 0.111177 0.477963 0.249968 0.171790 0.101256 0.424580 0.302375 Consensus sequence: DDASCACGTGBTBVDD Reverse complement motif 0.171790 0.424580 0.101256 0.302375 0.160893 0.477963 0.111177 0.249968 0.273437 0.300738 0.225889 0.199936 0.186990 0.250066 0.346199 0.216745 0.582926 0.075866 0.274768 0.066440 0.149140 0.389598 0.241218 0.220044 0.003520 0.969691 0.001811 0.024979 0.966345 0.022320 0.003728 0.007607 0.084236 0.907006 0.008160 0.000598 0.000598 0.008160 0.907006 0.084236 0.007607 0.003728 0.022320 0.966345 0.024979 0.001811 0.969691 0.003520 0.138829 0.305884 0.475428 0.079859 0.066440 0.274768 0.075866 0.582926 0.199226 0.439250 0.147959 0.213565 0.310886 0.152539 0.301720 0.234855 Consensus sequence: HHVBABCACGTGSTHD Alignment: DDASCACGTGBTBVDD --HSCACGTGGC---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00050 Bhlhb2_secondary Reverse Complement Reverse Complement Backward 7 10 0.007838 Species: Mus musculus Original motif 0.120938 0.344851 0.124072 0.410138 0.220931 0.169844 0.422396 0.186829 0.127752 0.260812 0.103811 0.507625 0.140641 0.405473 0.287668 0.166218 0.296957 0.155579 0.301094 0.246370 0.219647 0.287193 0.154072 0.339087 0.049294 0.026059 0.121789 0.802859 0.520042 0.289284 0.173423 0.017251 0.049190 0.943472 0.004308 0.003030 0.902609 0.006767 0.074770 0.015854 0.003221 0.971329 0.005512 0.019937 0.019937 0.005512 0.971329 0.003221 0.015854 0.074770 0.006767 0.902609 0.003030 0.004308 0.943472 0.049190 0.003497 0.088920 0.685942 0.221641 0.802859 0.121789 0.026059 0.049294 0.334544 0.155170 0.275193 0.235092 0.275957 0.132104 0.454982 0.136957 0.134097 0.254352 0.422940 0.188611 0.396163 0.432784 0.051281 0.119772 0.276474 0.115627 0.419844 0.188056 0.160759 0.088061 0.649863 0.101318 0.203314 0.166595 0.106821 0.523270 Consensus sequence: YDYBDHTMCACGTGGADDBMDGT Reverse complement motif 0.523270 0.166595 0.106821 0.203314 0.160759 0.649863 0.088061 0.101318 0.276474 0.419844 0.115627 0.188056 0.396163 0.051281 0.432784 0.119772 0.134097 0.422940 0.254352 0.188611 0.275957 0.454982 0.132104 0.136957 0.235092 0.155170 0.275193 0.334544 0.049294 0.121789 0.026059 0.802859 0.003497 0.685942 0.088920 0.221641 0.003030 0.943472 0.004308 0.049190 0.902609 0.074770 0.006767 0.015854 0.019937 0.971329 0.005512 0.003221 0.003221 0.005512 0.971329 0.019937 0.015854 0.006767 0.074770 0.902609 0.049190 0.004308 0.943472 0.003030 0.017251 0.289284 0.173423 0.520042 0.802859 0.026059 0.121789 0.049294 0.339087 0.287193 0.154072 0.219647 0.296957 0.301094 0.155579 0.246370 0.140641 0.287668 0.405473 0.166218 0.507625 0.260812 0.103811 0.127752 0.220931 0.422396 0.169844 0.186829 0.410138 0.344851 0.124072 0.120938 Consensus sequence: ACHRBHDTCCACGTGYAHHBMHM Alignment: ACHRBHDTCCACGTGYAHHBMHM -------GCCACGTGSD------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00050 Bhlhb2_primary Reverse Complement Reverse Complement Backward 7 10 0.013286 Species: Mus musculus Original motif 0.347837 0.112349 0.403713 0.136102 0.298329 0.175329 0.324534 0.201809 0.421791 0.222553 0.113615 0.242041 0.387506 0.130670 0.161435 0.320389 0.197183 0.244864 0.304611 0.253342 0.345884 0.188786 0.278290 0.187041 0.228203 0.142148 0.408269 0.221381 0.037126 0.006772 0.231775 0.724328 0.055214 0.942800 0.001192 0.000794 0.974119 0.004466 0.015535 0.005880 0.000300 0.958145 0.007498 0.034056 0.034056 0.007498 0.958145 0.000300 0.005880 0.015535 0.004466 0.974119 0.000794 0.001192 0.942800 0.055214 0.724328 0.231775 0.006772 0.037126 0.015720 0.466476 0.315208 0.202596 0.173670 0.355170 0.210710 0.260449 0.407419 0.261539 0.134430 0.196612 0.351478 0.209698 0.262426 0.176399 0.207869 0.284582 0.198951 0.308598 0.434482 0.113724 0.184408 0.267386 0.211144 0.363745 0.173978 0.251133 Consensus sequence: RDHDBVDTCACGTGASBHVHDH Reverse complement motif 0.211144 0.173978 0.363745 0.251133 0.267386 0.113724 0.184408 0.434482 0.308598 0.284582 0.198951 0.207869 0.176399 0.209698 0.262426 0.351478 0.196612 0.261539 0.134430 0.407419 0.173670 0.210710 0.355170 0.260449 0.015720 0.315208 0.466476 0.202596 0.037126 0.231775 0.006772 0.724328 0.000794 0.942800 0.001192 0.055214 0.974119 0.015535 0.004466 0.005880 0.034056 0.958145 0.007498 0.000300 0.000300 0.007498 0.958145 0.034056 0.005880 0.004466 0.015535 0.974119 0.055214 0.001192 0.942800 0.000794 0.724328 0.006772 0.231775 0.037126 0.228203 0.408269 0.142148 0.221381 0.187041 0.188786 0.278290 0.345884 0.197183 0.304611 0.244864 0.253342 0.320389 0.130670 0.161435 0.387506 0.242041 0.222553 0.113615 0.421791 0.298329 0.324534 0.175329 0.201809 0.347837 0.403713 0.112349 0.136102 Consensus sequence: DDHBHBSTCACGTGAHBBDHHM Alignment: DDHBHBSTCACGTGAHBBDHHM ------GCCACGTGSD------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00046 Tcfe2a_primary Reverse Complement Original Motif Backward 5 10 0.022793 Species: Mus musculus Original motif 0.306209 0.232705 0.244475 0.216611 0.165668 0.171480 0.222584 0.440269 0.213008 0.429038 0.156385 0.201569 0.283226 0.329518 0.160795 0.226461 0.439156 0.283517 0.251270 0.026056 0.014994 0.980987 0.000714 0.003304 0.975741 0.020182 0.002909 0.001168 0.000926 0.191353 0.801648 0.006073 0.015382 0.090853 0.893043 0.000721 0.001549 0.005912 0.001713 0.990826 0.004000 0.000857 0.989667 0.005475 0.016957 0.663726 0.148127 0.171190 0.299047 0.091156 0.448649 0.161148 0.354701 0.214677 0.236757 0.193865 0.399446 0.174508 0.200036 0.226009 0.303545 0.277435 0.200094 0.218926 0.380242 0.148876 0.163367 0.307514 Consensus sequence: VBHHVCAGGTGCDVDHD Reverse complement motif 0.307514 0.148876 0.163367 0.380242 0.218926 0.277435 0.200094 0.303545 0.226009 0.174508 0.200036 0.399446 0.193865 0.214677 0.236757 0.354701 0.299047 0.448649 0.091156 0.161148 0.016957 0.148127 0.663726 0.171190 0.004000 0.989667 0.000857 0.005475 0.990826 0.005912 0.001713 0.001549 0.015382 0.893043 0.090853 0.000721 0.000926 0.801648 0.191353 0.006073 0.001168 0.020182 0.002909 0.975741 0.014994 0.000714 0.980987 0.003304 0.026056 0.283517 0.251270 0.439156 0.283226 0.160795 0.329518 0.226461 0.213008 0.156385 0.429038 0.201569 0.440269 0.171480 0.222584 0.165668 0.216611 0.232705 0.244475 0.306209 Consensus sequence: DHDBHGCACCTGBDDVB Alignment: VBHHVCAGGTGCDVDHD ---GCCACGTGSD---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00060 Max_secondary Original Motif Original Motif Forward 3 10 0.025701 Species: Mus musculus Original motif 0.127991 0.202889 0.399822 0.269298 0.156940 0.244015 0.182364 0.416681 0.046494 0.050598 0.744311 0.158596 0.196142 0.365183 0.183389 0.255286 0.019306 0.946805 0.015210 0.018680 0.924839 0.022113 0.027620 0.025428 0.007478 0.672138 0.027789 0.292595 0.046702 0.026044 0.906146 0.021107 0.117335 0.610863 0.025132 0.246670 0.044431 0.053581 0.722748 0.179240 0.543713 0.149809 0.190030 0.116447 0.241148 0.722386 0.022547 0.013919 0.265412 0.113032 0.270602 0.350954 0.226186 0.143504 0.332746 0.297564 Consensus sequence: BBGHCACGCGACDD Reverse complement motif 0.226186 0.332746 0.143504 0.297564 0.350954 0.113032 0.270602 0.265412 0.241148 0.022547 0.722386 0.013919 0.116447 0.149809 0.190030 0.543713 0.044431 0.722748 0.053581 0.179240 0.117335 0.025132 0.610863 0.246670 0.046702 0.906146 0.026044 0.021107 0.007478 0.027789 0.672138 0.292595 0.025428 0.022113 0.027620 0.924839 0.019306 0.015210 0.946805 0.018680 0.196142 0.183389 0.365183 0.255286 0.046494 0.744311 0.050598 0.158596 0.416681 0.244015 0.182364 0.156940 0.127991 0.399822 0.202889 0.269298 Consensus sequence: HDGTCGCGTGDCVB Alignment: BBGHCACGCGACDD --HSCACGTGGC-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00165 Titf1 Reverse Complement Original Motif Backward 4 10 0.034483 Species: Mus musculus Original motif 0.142834 0.324493 0.147276 0.385397 0.404842 0.233186 0.227659 0.134313 0.677580 0.044952 0.178774 0.098695 0.137761 0.202622 0.469728 0.189889 0.069301 0.825888 0.093549 0.011262 0.003882 0.876858 0.000966 0.118295 0.904355 0.015154 0.001043 0.079449 0.018912 0.977464 0.001207 0.002417 0.003517 0.004393 0.002428 0.989662 0.007151 0.162279 0.000584 0.829986 0.192074 0.120883 0.670840 0.016203 0.881358 0.002039 0.013253 0.103349 0.450016 0.333144 0.184121 0.032719 0.342018 0.321148 0.066945 0.269889 0.209486 0.122118 0.046367 0.622029 0.174564 0.145894 0.048004 0.631539 Consensus sequence: BVABCCACTTGAMHTT Reverse complement motif 0.631539 0.145894 0.048004 0.174564 0.622029 0.122118 0.046367 0.209486 0.269889 0.321148 0.066945 0.342018 0.032719 0.333144 0.184121 0.450016 0.103349 0.002039 0.013253 0.881358 0.192074 0.670840 0.120883 0.016203 0.829986 0.162279 0.000584 0.007151 0.989662 0.004393 0.002428 0.003517 0.018912 0.001207 0.977464 0.002417 0.079449 0.015154 0.001043 0.904355 0.003882 0.000966 0.876858 0.118295 0.069301 0.093549 0.825888 0.011262 0.137761 0.469728 0.202622 0.189889 0.098695 0.044952 0.178774 0.677580 0.134313 0.233186 0.227659 0.404842 0.385397 0.324493 0.147276 0.142834 Consensus sequence: AAHYTCAAGTGGBTBV Alignment: BVABCCACTTGAMHTT ---GCCACGTGSD--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00231 Nkx2-2 Reverse Complement Original Motif Backward 5 10 0.035228 Species: Mus musculus Original motif 0.299323 0.258429 0.141957 0.300291 0.267631 0.143882 0.146933 0.441554 0.482614 0.212022 0.233631 0.071733 0.430836 0.073912 0.334439 0.160813 0.124944 0.704331 0.166815 0.003910 0.001941 0.876479 0.000828 0.120752 0.920202 0.005985 0.000456 0.073357 0.023544 0.974093 0.000859 0.001505 0.005010 0.003098 0.001328 0.990564 0.003250 0.198149 0.000490 0.798110 0.134659 0.104976 0.753464 0.006901 0.932490 0.000724 0.006140 0.060646 0.504530 0.106203 0.360995 0.028271 0.673257 0.074893 0.106536 0.145314 0.356324 0.097610 0.230142 0.315924 0.129483 0.188353 0.203623 0.478542 0.289071 0.157675 0.231909 0.321345 Consensus sequence: HDVRCCACTTGARADBD Reverse complement motif 0.321345 0.157675 0.231909 0.289071 0.478542 0.188353 0.203623 0.129483 0.315924 0.097610 0.230142 0.356324 0.145314 0.074893 0.106536 0.673257 0.028271 0.106203 0.360995 0.504530 0.060646 0.000724 0.006140 0.932490 0.134659 0.753464 0.104976 0.006901 0.798110 0.198149 0.000490 0.003250 0.990564 0.003098 0.001328 0.005010 0.023544 0.000859 0.974093 0.001505 0.073357 0.005985 0.000456 0.920202 0.001941 0.000828 0.876479 0.120752 0.124944 0.166815 0.704331 0.003910 0.160813 0.073912 0.334439 0.430836 0.071733 0.212022 0.233631 0.482614 0.441554 0.143882 0.146933 0.267631 0.300291 0.258429 0.141957 0.299323 Consensus sequence: DVDTKTCAAGTGGKBDH Alignment: HDVRCCACTTGARADBD ---GCCACGTGSD---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00084 Gmeb1_primary Reverse Complement Reverse Complement Backward 4 10 0.035858 Species: Mus musculus Original motif 0.166569 0.264627 0.345569 0.223235 0.335599 0.314451 0.153336 0.196615 0.105350 0.231839 0.348018 0.314793 0.131274 0.215623 0.291288 0.361815 0.125570 0.072341 0.404848 0.397242 0.049879 0.039110 0.325167 0.585844 0.705098 0.009202 0.284757 0.000943 0.003535 0.986983 0.004275 0.005207 0.005207 0.004275 0.986983 0.003535 0.000943 0.284757 0.009202 0.705098 0.585844 0.325167 0.039110 0.049879 0.397242 0.404848 0.072341 0.125570 0.206857 0.234555 0.371731 0.186857 0.435957 0.145115 0.181033 0.237896 0.176104 0.260127 0.230770 0.333000 0.272102 0.213365 0.312032 0.202501 0.237402 0.250982 0.266977 0.244639 Consensus sequence: BHBBKKACGTMMVDBVB Reverse complement motif 0.237402 0.266977 0.250982 0.244639 0.272102 0.312032 0.213365 0.202501 0.333000 0.260127 0.230770 0.176104 0.237896 0.145115 0.181033 0.435957 0.206857 0.371731 0.234555 0.186857 0.397242 0.072341 0.404848 0.125570 0.049879 0.325167 0.039110 0.585844 0.705098 0.284757 0.009202 0.000943 0.005207 0.986983 0.004275 0.003535 0.003535 0.004275 0.986983 0.005207 0.000943 0.009202 0.284757 0.705098 0.585844 0.039110 0.325167 0.049879 0.125570 0.404848 0.072341 0.397242 0.361815 0.215623 0.291288 0.131274 0.105350 0.348018 0.231839 0.314793 0.196615 0.314451 0.153336 0.335599 0.166569 0.345569 0.264627 0.223235 Consensus sequence: BVVDVRYACGTRYVBHB Alignment: BVVDVRYACGTRYVBHB ----GCCACGTGSD--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00084 Gmeb1_secondary Original Motif Reverse Complement Backward 4 10 0.037250 Species: Mus musculus Original motif 0.171801 0.139045 0.265726 0.423428 0.146597 0.118316 0.577770 0.157317 0.247220 0.191958 0.432935 0.127887 0.119277 0.232191 0.394786 0.253747 0.227546 0.664338 0.016991 0.091125 0.271290 0.146819 0.518707 0.063184 0.693351 0.120942 0.066863 0.118844 0.041459 0.895990 0.042253 0.020298 0.020298 0.042253 0.895990 0.041459 0.118844 0.066863 0.120942 0.693351 0.063184 0.518707 0.146819 0.271290 0.091125 0.016991 0.664338 0.227546 0.122589 0.186959 0.078274 0.612178 0.103039 0.274719 0.113320 0.508922 0.375945 0.289040 0.127861 0.207153 0.429989 0.189120 0.110127 0.270765 Consensus sequence: DGVBCRACGTYGTYHH Reverse complement motif 0.270765 0.189120 0.110127 0.429989 0.207153 0.289040 0.127861 0.375945 0.508922 0.274719 0.113320 0.103039 0.612178 0.186959 0.078274 0.122589 0.091125 0.664338 0.016991 0.227546 0.063184 0.146819 0.518707 0.271290 0.693351 0.066863 0.120942 0.118844 0.020298 0.895990 0.042253 0.041459 0.041459 0.042253 0.895990 0.020298 0.118844 0.120942 0.066863 0.693351 0.271290 0.518707 0.146819 0.063184 0.227546 0.016991 0.664338 0.091125 0.119277 0.394786 0.232191 0.253747 0.247220 0.432935 0.191958 0.127887 0.146597 0.577770 0.118316 0.157317 0.423428 0.139045 0.265726 0.171801 Consensus sequence: HHMACKACGTMGBVCD Alignment: HHMACKACGTMGBVCD ---HSCACGTGGC--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00526 Foxn1_primary Original Motif Original Motif Forward 7 10 0.038319 Species: Mus musculus Original motif 0.456612 0.057181 0.078281 0.407926 0.460529 0.185506 0.083106 0.270859 0.445717 0.179510 0.239355 0.135417 0.116339 0.145186 0.275331 0.463144 0.239398 0.142078 0.480004 0.138520 0.355157 0.217877 0.284296 0.142670 0.318602 0.444835 0.153321 0.083243 0.609569 0.055866 0.280349 0.054216 0.062297 0.769824 0.027844 0.140035 0.151868 0.019245 0.803188 0.025699 0.011842 0.952534 0.017959 0.017665 0.017665 0.017959 0.952534 0.011842 0.025699 0.803188 0.019245 0.151868 0.140035 0.027844 0.769824 0.062297 0.054216 0.280349 0.055866 0.609569 0.013084 0.624655 0.177956 0.184305 0.287647 0.183527 0.295753 0.233074 0.042309 0.345931 0.198458 0.413301 0.338138 0.266033 0.045367 0.350462 0.302850 0.155320 0.074662 0.467168 0.240926 0.068901 0.283055 0.407118 0.409954 0.183157 0.154186 0.252704 Consensus sequence: WHVBVVMACGCGCGTCDYHWDH Reverse complement motif 0.252704 0.183157 0.154186 0.409954 0.407118 0.068901 0.283055 0.240926 0.467168 0.155320 0.074662 0.302850 0.350462 0.266033 0.045367 0.338138 0.413301 0.345931 0.198458 0.042309 0.287647 0.295753 0.183527 0.233074 0.013084 0.177956 0.624655 0.184305 0.609569 0.280349 0.055866 0.054216 0.140035 0.769824 0.027844 0.062297 0.025699 0.019245 0.803188 0.151868 0.017665 0.952534 0.017959 0.011842 0.011842 0.017959 0.952534 0.017665 0.151868 0.803188 0.019245 0.025699 0.062297 0.027844 0.769824 0.140035 0.054216 0.055866 0.280349 0.609569 0.318602 0.153321 0.444835 0.083243 0.142670 0.217877 0.284296 0.355157 0.239398 0.480004 0.142078 0.138520 0.463144 0.145186 0.275331 0.116339 0.135417 0.179510 0.239355 0.445717 0.270859 0.185506 0.083106 0.460529 0.407926 0.057181 0.078281 0.456612 Consensus sequence: HDWHMHGACGCGCGTRBVVBHW Alignment: WHVBVVMACGCGCGTCDYHWDH ------HSCACGTGGC------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 7 Motif name: REST Original motif 0.132621 0.109365 0.230044 0.527970 0.036318 0.168441 0.091421 0.703820 0.047589 0.855354 0.031309 0.065748 0.906367 0.018727 0.058677 0.016230 0.021197 0.027431 0.945137 0.006234 0.076012 0.609346 0.201246 0.113396 0.980697 0.004359 0.007472 0.007472 0.001868 0.987547 0.007472 0.003113 0.021793 0.922167 0.012453 0.043587 0.568847 0.125234 0.100935 0.204984 0.136534 0.233791 0.077307 0.552369 0.024314 0.004364 0.966958 0.004364 0.012469 0.003117 0.983167 0.001247 0.877105 0.069869 0.021210 0.031815 0.008125 0.800000 0.145625 0.046250 0.983750 0.005625 0.004375 0.006250 0.026349 0.008156 0.959849 0.005646 0.128688 0.632141 0.114878 0.124294 0.229899 0.019472 0.432161 0.318467 0.133962 0.586792 0.200629 0.078616 0.112579 0.700629 0.023270 0.163522 Consensus sequence: TTCAGCACCATGGACAGCKCC Reserve complement motif 0.112579 0.023270 0.700629 0.163522 0.133962 0.200629 0.586792 0.078616 0.229899 0.432161 0.019472 0.318467 0.128688 0.114878 0.632141 0.124294 0.026349 0.959849 0.008156 0.005646 0.006250 0.005625 0.004375 0.983750 0.008125 0.145625 0.800000 0.046250 0.031815 0.069869 0.021210 0.877105 0.012469 0.983167 0.003117 0.001247 0.024314 0.966958 0.004364 0.004364 0.552369 0.233791 0.077307 0.136534 0.204984 0.125234 0.100935 0.568847 0.021793 0.012453 0.922167 0.043587 0.001868 0.007472 0.987547 0.003113 0.007472 0.004359 0.007472 0.980697 0.076012 0.201246 0.609346 0.113396 0.021197 0.945137 0.027431 0.006234 0.016230 0.018727 0.058677 0.906367 0.047589 0.031309 0.855354 0.065748 0.703820 0.168441 0.091421 0.036318 0.527970 0.109365 0.230044 0.132621 Consensus sequence: GGYGCTGTCCATGGTGCTGAA ************************************************************************ Best Matches for Motif ID 7 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v015681_primary Original Motif Original Motif Forward 3 21 0.069918 Species: Mus musculus Original motif 0.183797 0.268049 0.330111 0.218043 0.127599 0.330310 0.243614 0.298477 0.143199 0.188046 0.268593 0.400162 0.214690 0.205230 0.247090 0.332990 0.294688 0.299104 0.327152 0.079056 0.221909 0.193223 0.480155 0.104712 0.444072 0.068239 0.481838 0.005852 0.006182 0.015429 0.901278 0.077111 0.766535 0.111138 0.121632 0.000696 0.014848 0.973961 0.000298 0.010893 0.001807 0.992200 0.002669 0.003324 0.795344 0.140510 0.018576 0.045571 0.006990 0.988200 0.002510 0.002299 0.154898 0.842296 0.000998 0.001808 0.029577 0.919262 0.006935 0.044226 0.677987 0.032075 0.185065 0.104874 0.195132 0.364580 0.319321 0.120967 0.225412 0.115034 0.612849 0.046705 0.548628 0.058900 0.162857 0.229616 0.112531 0.340331 0.165910 0.381227 0.073029 0.303078 0.363896 0.259997 0.561485 0.260567 0.092979 0.084969 0.132283 0.457691 0.140159 0.269867 Consensus sequence: BBBDVVRGACCACCCAVGABBAB Reverse complement motif 0.132283 0.140159 0.457691 0.269867 0.084969 0.260567 0.092979 0.561485 0.073029 0.363896 0.303078 0.259997 0.381227 0.340331 0.165910 0.112531 0.229616 0.058900 0.162857 0.548628 0.225412 0.612849 0.115034 0.046705 0.195132 0.319321 0.364580 0.120967 0.104874 0.032075 0.185065 0.677987 0.029577 0.006935 0.919262 0.044226 0.154898 0.000998 0.842296 0.001808 0.006990 0.002510 0.988200 0.002299 0.045571 0.140510 0.018576 0.795344 0.001807 0.002669 0.992200 0.003324 0.014848 0.000298 0.973961 0.010893 0.000696 0.111138 0.121632 0.766535 0.006182 0.901278 0.015429 0.077111 0.444072 0.481838 0.068239 0.005852 0.221909 0.480155 0.193223 0.104712 0.294688 0.327152 0.299104 0.079056 0.332990 0.205230 0.247090 0.214690 0.400162 0.188046 0.268593 0.143199 0.127599 0.243614 0.330310 0.298477 0.183797 0.330111 0.268049 0.218043 Consensus sequence: BTBVTCVTGGGTGGTCMVVDVBB Alignment: BBBDVVRGACCACCCAVGABBAB --TTCAGCACCATGGACAGCKCC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v015681_secondary Reverse Complement Reverse Complement Forward 1 21 0.073468 Species: Mus musculus Original motif 0.214165 0.143436 0.372522 0.269876 0.314445 0.406003 0.160351 0.119201 0.137147 0.092924 0.042921 0.727007 0.044121 0.072843 0.051741 0.831295 0.261292 0.324124 0.298498 0.116086 0.258125 0.323243 0.263362 0.155271 0.204557 0.589399 0.107153 0.098891 0.371021 0.244027 0.291102 0.093849 0.096327 0.572718 0.011797 0.319159 0.027282 0.046183 0.844519 0.082016 0.018921 0.012887 0.915917 0.052275 0.364793 0.166722 0.084229 0.384256 0.028216 0.011233 0.951056 0.009495 0.054974 0.004738 0.890377 0.049911 0.006802 0.312915 0.134247 0.546036 0.241289 0.628210 0.104788 0.025713 0.237863 0.302807 0.213018 0.246311 0.349399 0.203220 0.086635 0.360746 0.386634 0.144693 0.246895 0.221779 0.425101 0.354676 0.093374 0.126849 0.060272 0.391320 0.104905 0.443503 0.162090 0.190233 0.227433 0.420244 Consensus sequence: DVTTVVCVYGGHGGYCHHDMYB Reverse complement motif 0.420244 0.190233 0.227433 0.162090 0.443503 0.391320 0.104905 0.060272 0.126849 0.354676 0.093374 0.425101 0.221779 0.144693 0.246895 0.386634 0.360746 0.203220 0.086635 0.349399 0.237863 0.213018 0.302807 0.246311 0.241289 0.104788 0.628210 0.025713 0.546036 0.312915 0.134247 0.006802 0.054974 0.890377 0.004738 0.049911 0.028216 0.951056 0.011233 0.009495 0.384256 0.166722 0.084229 0.364793 0.018921 0.915917 0.012887 0.052275 0.027282 0.844519 0.046183 0.082016 0.096327 0.011797 0.572718 0.319159 0.093849 0.244027 0.291102 0.371021 0.204557 0.107153 0.589399 0.098891 0.258125 0.263362 0.323243 0.155271 0.261292 0.298498 0.324124 0.116086 0.831295 0.072843 0.051741 0.044121 0.727007 0.092924 0.042921 0.137147 0.314445 0.160351 0.406003 0.119201 0.214165 0.372522 0.143436 0.269876 Consensus sequence: VMYDHDGMCCHCCKBGVVAAVH Alignment: VMYDHDGMCCHCCKBGVVAAVH GGYGCTGTCCATGGTGCTGAA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v016060_secondary Original Motif Original Motif Forward 2 21 0.074065 Species: Mus musculus Original motif 0.168550 0.345968 0.396524 0.088958 0.038113 0.360882 0.114042 0.486963 0.349356 0.180599 0.051416 0.418629 0.258773 0.332518 0.244932 0.163778 0.371663 0.208591 0.263136 0.156609 0.225440 0.321741 0.175932 0.276887 0.100827 0.656850 0.018644 0.223679 0.494140 0.155427 0.327424 0.023009 0.105642 0.805846 0.027712 0.060800 0.065110 0.845072 0.058046 0.031772 0.649343 0.110180 0.180680 0.059797 0.064269 0.853604 0.066860 0.015268 0.437421 0.533797 0.016833 0.011948 0.121694 0.787708 0.016177 0.074421 0.625382 0.066925 0.266070 0.041623 0.117819 0.608153 0.165139 0.108889 0.145639 0.102001 0.604926 0.147434 0.521188 0.184986 0.064607 0.229219 0.180371 0.274237 0.096591 0.448801 0.071055 0.455813 0.332817 0.140315 0.084503 0.199982 0.448293 0.267222 0.389451 0.169545 0.155507 0.285497 0.424314 0.227621 0.101210 0.246855 Consensus sequence: VYWVVHCRCCACMCACGAHSBHH Reverse complement motif 0.246855 0.227621 0.101210 0.424314 0.285497 0.169545 0.155507 0.389451 0.084503 0.448293 0.199982 0.267222 0.071055 0.332817 0.455813 0.140315 0.448801 0.274237 0.096591 0.180371 0.229219 0.184986 0.064607 0.521188 0.145639 0.604926 0.102001 0.147434 0.117819 0.165139 0.608153 0.108889 0.041623 0.066925 0.266070 0.625382 0.121694 0.016177 0.787708 0.074421 0.437421 0.016833 0.533797 0.011948 0.064269 0.066860 0.853604 0.015268 0.059797 0.110180 0.180680 0.649343 0.065110 0.058046 0.845072 0.031772 0.105642 0.027712 0.805846 0.060800 0.023009 0.155427 0.327424 0.494140 0.100827 0.018644 0.656850 0.223679 0.225440 0.175932 0.321741 0.276887 0.156609 0.208591 0.263136 0.371663 0.258773 0.244932 0.332518 0.163778 0.418629 0.180599 0.051416 0.349356 0.486963 0.360882 0.114042 0.038113 0.168550 0.396524 0.345968 0.088958 Consensus sequence: HHBSHTCGTGRGTGGKGDBVWMV Alignment: VYWVVHCRCCACMCACGAHSBHH -TTCAGCACCATGGACAGCKCC- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v015681_secondary Original Motif Original Motif Backward 1 21 0.075015 Species: Mus musculus Original motif 0.404007 0.395873 0.173319 0.026801 0.305977 0.215534 0.215359 0.263130 0.370148 0.250957 0.113088 0.265808 0.324336 0.229498 0.174679 0.271487 0.263563 0.137896 0.079217 0.519324 0.265762 0.222582 0.082555 0.429102 0.206721 0.288405 0.017851 0.487023 0.164361 0.236500 0.061051 0.538088 0.593344 0.348446 0.050304 0.007906 0.031328 0.947050 0.007032 0.014590 0.010428 0.956605 0.029142 0.003825 0.459636 0.207616 0.155368 0.177380 0.014573 0.964608 0.012209 0.008610 0.066291 0.918196 0.008729 0.006784 0.019488 0.866774 0.018897 0.094841 0.767405 0.104198 0.029234 0.099164 0.052494 0.772531 0.039832 0.135142 0.296085 0.243498 0.350935 0.109482 0.518843 0.226659 0.124784 0.129714 0.647901 0.019721 0.159901 0.172477 0.113912 0.231511 0.214864 0.439713 0.223117 0.310596 0.293328 0.172959 0.185557 0.487662 0.136321 0.190459 Consensus sequence: MHHHWHYTMCCHCCCACVAABVH Reverse complement motif 0.185557 0.136321 0.487662 0.190459 0.223117 0.293328 0.310596 0.172959 0.439713 0.231511 0.214864 0.113912 0.172477 0.019721 0.159901 0.647901 0.129714 0.226659 0.124784 0.518843 0.296085 0.350935 0.243498 0.109482 0.052494 0.039832 0.772531 0.135142 0.099164 0.104198 0.029234 0.767405 0.019488 0.018897 0.866774 0.094841 0.066291 0.008729 0.918196 0.006784 0.014573 0.012209 0.964608 0.008610 0.177380 0.207616 0.155368 0.459636 0.010428 0.029142 0.956605 0.003825 0.031328 0.007032 0.947050 0.014590 0.007906 0.348446 0.050304 0.593344 0.538088 0.236500 0.061051 0.164361 0.487023 0.288405 0.017851 0.206721 0.429102 0.222582 0.082555 0.265762 0.519324 0.137896 0.079217 0.263563 0.271487 0.229498 0.174679 0.324336 0.265808 0.250957 0.113088 0.370148 0.263130 0.215534 0.215359 0.305977 0.026801 0.395873 0.173319 0.404007 Consensus sequence: DVVTTVGTGGGHGGYAMHWHHHY Alignment: MHHHWHYTMCCHCCCACVAABVH --TTCAGCACCATGGACAGCKCC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v016060_primary Reverse Complement Original Motif Backward 3 21 0.075145 Species: Mus musculus Original motif 0.204923 0.208846 0.365383 0.220848 0.294304 0.300143 0.167287 0.238266 0.109711 0.619514 0.117379 0.153396 0.178979 0.378580 0.230177 0.212264 0.159594 0.542602 0.118178 0.179627 0.125206 0.430074 0.151826 0.292894 0.097692 0.709845 0.116956 0.075506 0.148292 0.565912 0.037632 0.248164 0.077951 0.034190 0.855503 0.032356 0.001657 0.001061 0.971877 0.025405 0.001926 0.001084 0.991712 0.005278 0.033031 0.012001 0.057796 0.897171 0.002723 0.002647 0.993348 0.001281 0.003261 0.000963 0.987199 0.008577 0.000611 0.090925 0.074857 0.833608 0.015299 0.978878 0.004949 0.000874 0.013368 0.600902 0.033485 0.352245 0.231949 0.149575 0.118804 0.499672 0.267580 0.186002 0.371242 0.175176 0.264884 0.223483 0.110082 0.401551 0.221365 0.170121 0.179559 0.428955 0.112997 0.692930 0.139981 0.054092 0.460305 0.207883 0.155111 0.176702 Consensus sequence: BHCBCBCCGGGTGGTCYHVHDCH Reverse complement motif 0.176702 0.207883 0.155111 0.460305 0.112997 0.139981 0.692930 0.054092 0.428955 0.170121 0.179559 0.221365 0.401551 0.223483 0.110082 0.264884 0.267580 0.371242 0.186002 0.175176 0.499672 0.149575 0.118804 0.231949 0.013368 0.033485 0.600902 0.352245 0.015299 0.004949 0.978878 0.000874 0.833608 0.090925 0.074857 0.000611 0.003261 0.987199 0.000963 0.008577 0.002723 0.993348 0.002647 0.001281 0.897171 0.012001 0.057796 0.033031 0.001926 0.991712 0.001084 0.005278 0.001657 0.971877 0.001061 0.025405 0.077951 0.855503 0.034190 0.032356 0.148292 0.037632 0.565912 0.248164 0.097692 0.116956 0.709845 0.075506 0.125206 0.151826 0.430074 0.292894 0.159594 0.118178 0.542602 0.179627 0.178979 0.230177 0.378580 0.212264 0.109711 0.117379 0.619514 0.153396 0.294304 0.167287 0.300143 0.238266 0.204923 0.365383 0.208846 0.220848 Consensus sequence: HGDHVHKGACCACCCGGBGBGDB Alignment: BHCBCBCCGGGTGGTCYHVHDCH GGYGCTGTCCATGGTGCTGAA-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v016060_secondary Original Motif Reverse Complement Backward 2 21 0.075832 Species: Mus musculus Original motif 0.319838 0.171199 0.138099 0.370865 0.269358 0.196600 0.346909 0.187133 0.176807 0.338888 0.193903 0.290402 0.230268 0.119645 0.310500 0.339587 0.517372 0.257658 0.111673 0.113296 0.159477 0.126524 0.561119 0.152879 0.117072 0.553013 0.130919 0.198996 0.073372 0.163548 0.525014 0.238066 0.143608 0.186896 0.170528 0.498967 0.054943 0.079034 0.722992 0.143031 0.048852 0.015134 0.852458 0.083556 0.029001 0.023938 0.918900 0.028160 0.036727 0.092645 0.090591 0.780037 0.017757 0.057598 0.895222 0.029423 0.026113 0.048113 0.879744 0.046030 0.023041 0.787043 0.123490 0.066426 0.579766 0.004868 0.296873 0.118493 0.303862 0.042931 0.290151 0.363055 0.099672 0.237431 0.262301 0.400597 0.217788 0.163908 0.367628 0.250676 0.450783 0.141108 0.226137 0.181972 0.485086 0.102553 0.242662 0.169700 0.109057 0.454222 0.145665 0.291056 Consensus sequence: HVBDAGCGBGGGTGGCRDBDDDB Reverse complement motif 0.109057 0.145665 0.454222 0.291056 0.169700 0.102553 0.242662 0.485086 0.181972 0.141108 0.226137 0.450783 0.217788 0.367628 0.163908 0.250676 0.400597 0.237431 0.262301 0.099672 0.363055 0.042931 0.290151 0.303862 0.118493 0.004868 0.296873 0.579766 0.023041 0.123490 0.787043 0.066426 0.026113 0.879744 0.048113 0.046030 0.017757 0.895222 0.057598 0.029423 0.780037 0.092645 0.090591 0.036727 0.029001 0.918900 0.023938 0.028160 0.048852 0.852458 0.015134 0.083556 0.054943 0.722992 0.079034 0.143031 0.498967 0.186896 0.170528 0.143608 0.073372 0.525014 0.163548 0.238066 0.117072 0.130919 0.553013 0.198996 0.159477 0.561119 0.126524 0.152879 0.113296 0.257658 0.111673 0.517372 0.339587 0.119645 0.310500 0.230268 0.176807 0.193903 0.338888 0.290402 0.269358 0.346909 0.196600 0.187133 0.370865 0.171199 0.138099 0.319838 Consensus sequence: BDDHVDKGCCACCCVCGCTDBVH Alignment: BDDHVDKGCCACCCVCGCTDBVH -TTCAGCACCATGGACAGCKCC- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v016060_primary Original Motif Original Motif Backward 1 21 0.077345 Species: Mus musculus Original motif 0.137831 0.118922 0.394177 0.349070 0.190108 0.163633 0.138507 0.507753 0.346002 0.332315 0.228621 0.093063 0.113254 0.287554 0.373285 0.225908 0.272578 0.125402 0.328963 0.273057 0.333973 0.115165 0.194267 0.356595 0.381054 0.086215 0.501679 0.031052 0.002232 0.007405 0.966087 0.024276 0.834741 0.112115 0.052053 0.001091 0.009034 0.983239 0.000766 0.006960 0.002054 0.988103 0.003138 0.006705 0.805772 0.171299 0.008415 0.014515 0.020076 0.976846 0.000894 0.002183 0.079914 0.917273 0.001179 0.001634 0.013983 0.950545 0.004205 0.031267 0.789407 0.039441 0.108645 0.062507 0.055453 0.161271 0.595249 0.188028 0.333424 0.128169 0.373270 0.165136 0.536103 0.109520 0.062980 0.291397 0.346477 0.090909 0.279533 0.283081 0.045892 0.190183 0.584314 0.179611 0.088294 0.406148 0.251647 0.253912 0.202467 0.447159 0.162802 0.187571 Consensus sequence: DTVBDDRGACCACCCAGDWDGBH Reverse complement motif 0.202467 0.162802 0.447159 0.187571 0.088294 0.251647 0.406148 0.253912 0.045892 0.584314 0.190183 0.179611 0.283081 0.090909 0.279533 0.346477 0.291397 0.109520 0.062980 0.536103 0.333424 0.373270 0.128169 0.165136 0.055453 0.595249 0.161271 0.188028 0.062507 0.039441 0.108645 0.789407 0.013983 0.004205 0.950545 0.031267 0.079914 0.001179 0.917273 0.001634 0.020076 0.000894 0.976846 0.002183 0.014515 0.171299 0.008415 0.805772 0.002054 0.003138 0.988103 0.006705 0.009034 0.000766 0.983239 0.006960 0.001091 0.112115 0.052053 0.834741 0.002232 0.966087 0.007405 0.024276 0.381054 0.501679 0.086215 0.031052 0.356595 0.115165 0.194267 0.333973 0.272578 0.328963 0.125402 0.273057 0.113254 0.373285 0.287554 0.225908 0.093063 0.332315 0.228621 0.346002 0.507753 0.163633 0.138507 0.190108 0.137831 0.394177 0.118922 0.349070 Consensus sequence: DBCDWHCTGGGTGGTCMDHBBAH Alignment: DTVBDDRGACCACCCAGDWDGBH --TTCAGCACCATGGACAGCKCC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00050 Bhlhb2_secondary Original Motif Original Motif Forward 3 21 0.077537 Species: Mus musculus Original motif 0.120938 0.344851 0.124072 0.410138 0.220931 0.169844 0.422396 0.186829 0.127752 0.260812 0.103811 0.507625 0.140641 0.405473 0.287668 0.166218 0.296957 0.155579 0.301094 0.246370 0.219647 0.287193 0.154072 0.339087 0.049294 0.026059 0.121789 0.802859 0.520042 0.289284 0.173423 0.017251 0.049190 0.943472 0.004308 0.003030 0.902609 0.006767 0.074770 0.015854 0.003221 0.971329 0.005512 0.019937 0.019937 0.005512 0.971329 0.003221 0.015854 0.074770 0.006767 0.902609 0.003030 0.004308 0.943472 0.049190 0.003497 0.088920 0.685942 0.221641 0.802859 0.121789 0.026059 0.049294 0.334544 0.155170 0.275193 0.235092 0.275957 0.132104 0.454982 0.136957 0.134097 0.254352 0.422940 0.188611 0.396163 0.432784 0.051281 0.119772 0.276474 0.115627 0.419844 0.188056 0.160759 0.088061 0.649863 0.101318 0.203314 0.166595 0.106821 0.523270 Consensus sequence: YDYBDHTMCACGTGGADDBMDGT Reverse complement motif 0.523270 0.166595 0.106821 0.203314 0.160759 0.649863 0.088061 0.101318 0.276474 0.419844 0.115627 0.188056 0.396163 0.051281 0.432784 0.119772 0.134097 0.422940 0.254352 0.188611 0.275957 0.454982 0.132104 0.136957 0.235092 0.155170 0.275193 0.334544 0.049294 0.121789 0.026059 0.802859 0.003497 0.685942 0.088920 0.221641 0.003030 0.943472 0.004308 0.049190 0.902609 0.074770 0.006767 0.015854 0.019937 0.971329 0.005512 0.003221 0.003221 0.005512 0.971329 0.019937 0.015854 0.006767 0.074770 0.902609 0.049190 0.004308 0.943472 0.003030 0.017251 0.289284 0.173423 0.520042 0.802859 0.026059 0.121789 0.049294 0.339087 0.287193 0.154072 0.219647 0.296957 0.301094 0.155579 0.246370 0.140641 0.287668 0.405473 0.166218 0.507625 0.260812 0.103811 0.127752 0.220931 0.422396 0.169844 0.186829 0.410138 0.344851 0.124072 0.120938 Consensus sequence: ACHRBHDTCCACGTGYAHHBMHM Alignment: YDYBDHTMCACGTGGADDBMDGT --TTCAGCACCATGGACAGCKCC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00528 Foxm1_secondary Reverse Complement Reverse Complement Backward 1 21 0.077977 Species: Mus musculus Original motif 0.399785 0.446658 0.111435 0.042122 0.535175 0.103991 0.089706 0.271128 0.078171 0.387987 0.375083 0.158759 0.309001 0.519142 0.070618 0.101239 0.201844 0.255818 0.323149 0.219190 0.534101 0.109845 0.235026 0.121028 0.656038 0.037473 0.261484 0.045006 0.315713 0.164290 0.471815 0.048182 0.651960 0.009412 0.328237 0.010391 0.937365 0.017313 0.007516 0.037807 0.019983 0.044238 0.012387 0.923392 0.061195 0.021485 0.881645 0.035675 0.017521 0.952998 0.013139 0.016342 0.254160 0.029735 0.493023 0.223082 0.239200 0.593324 0.114503 0.052973 0.610822 0.071539 0.099169 0.218470 0.166610 0.389712 0.204400 0.239278 0.227752 0.361626 0.178497 0.232125 0.537030 0.182466 0.026035 0.254470 0.235902 0.151006 0.043788 0.569304 0.081851 0.250397 0.590059 0.077693 0.340417 0.189613 0.272075 0.197895 Consensus sequence: MWSMBAARRATGCDCABHATGD Reverse complement motif 0.197895 0.189613 0.272075 0.340417 0.081851 0.590059 0.250397 0.077693 0.569304 0.151006 0.043788 0.235902 0.254470 0.182466 0.026035 0.537030 0.227752 0.178497 0.361626 0.232125 0.166610 0.204400 0.389712 0.239278 0.218470 0.071539 0.099169 0.610822 0.239200 0.114503 0.593324 0.052973 0.254160 0.493023 0.029735 0.223082 0.017521 0.013139 0.952998 0.016342 0.061195 0.881645 0.021485 0.035675 0.923392 0.044238 0.012387 0.019983 0.037807 0.017313 0.007516 0.937365 0.010391 0.009412 0.328237 0.651960 0.315713 0.471815 0.164290 0.048182 0.045006 0.037473 0.261484 0.656038 0.121028 0.109845 0.235026 0.534101 0.201844 0.323149 0.255818 0.219190 0.309001 0.070618 0.519142 0.101239 0.078171 0.375083 0.387987 0.158759 0.271128 0.103991 0.089706 0.535175 0.399785 0.111435 0.446658 0.042122 Consensus sequence: DCATDBTGHGCATKMTTBRSWR Alignment: DCATDBTGHGCATKMTTBRSWR -GGYGCTGTCCATGGTGCTGAA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00400 Zif268 Reverse Complement Original Motif Backward 1 21 0.078597 Species: Mus musculus Original motif 0.104824 0.412716 0.254506 0.227955 0.644922 0.065476 0.140479 0.149122 0.201205 0.166164 0.347131 0.285501 0.360606 0.256316 0.150766 0.232313 0.199831 0.240681 0.279350 0.280137 0.234308 0.204076 0.321306 0.240310 0.274112 0.462435 0.111425 0.152028 0.067070 0.717501 0.073934 0.141496 0.106745 0.084442 0.658566 0.150247 0.025128 0.967053 0.003585 0.004234 0.006412 0.982989 0.003227 0.007371 0.009588 0.877620 0.002571 0.110221 0.621521 0.355443 0.015669 0.007366 0.002600 0.980275 0.004191 0.012934 0.118773 0.026658 0.783843 0.070725 0.022358 0.822101 0.024684 0.130857 0.713212 0.080912 0.128793 0.077084 0.166568 0.250955 0.107934 0.474544 0.225040 0.222494 0.163301 0.389166 0.268976 0.223206 0.265314 0.242504 0.137052 0.229058 0.148439 0.485451 0.135819 0.304550 0.141994 0.417637 0.272440 0.319501 0.230580 0.177478 Consensus sequence: BADHBDHCGCCCMCGCAHHDBBV Reverse complement motif 0.272440 0.230580 0.319501 0.177478 0.417637 0.304550 0.141994 0.135819 0.485451 0.229058 0.148439 0.137052 0.242504 0.223206 0.265314 0.268976 0.389166 0.222494 0.163301 0.225040 0.474544 0.250955 0.107934 0.166568 0.077084 0.080912 0.128793 0.713212 0.022358 0.024684 0.822101 0.130857 0.118773 0.783843 0.026658 0.070725 0.002600 0.004191 0.980275 0.012934 0.007366 0.355443 0.015669 0.621521 0.009588 0.002571 0.877620 0.110221 0.006412 0.003227 0.982989 0.007371 0.025128 0.003585 0.967053 0.004234 0.106745 0.658566 0.084442 0.150247 0.067070 0.073934 0.717501 0.141496 0.274112 0.111425 0.462435 0.152028 0.234308 0.321306 0.204076 0.240310 0.280137 0.240681 0.279350 0.199831 0.232313 0.256316 0.150766 0.360606 0.201205 0.347131 0.166164 0.285501 0.149122 0.065476 0.140479 0.644922 0.104824 0.254506 0.412716 0.227955 Consensus sequence: VVVDHHTGCGYGGGCGDHVHHTB Alignment: BADHBDHCGCCCMCGCAHHDBBV --GGYGCTGTCCATGGTGCTGAA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 8 Motif name: Myc Original motif 0.295154 0.422907 0.158590 0.123348 0.149780 0.233480 0.572687 0.044053 0.035242 0.964758 0.000000 0.000000 0.955947 0.017621 0.022026 0.004405 0.000000 0.933921 0.013216 0.052863 0.083700 0.008811 0.898678 0.008811 0.039648 0.193833 0.000000 0.766520 0.000000 0.008811 0.951542 0.039648 0.000000 0.074890 0.806167 0.118943 0.198238 0.471366 0.105727 0.224670 Consensus sequence: VGCACGTGGH Reserve complement motif 0.198238 0.105727 0.471366 0.224670 0.000000 0.806167 0.074890 0.118943 0.000000 0.951542 0.008811 0.039648 0.766520 0.193833 0.000000 0.039648 0.083700 0.898678 0.008811 0.008811 0.000000 0.013216 0.933921 0.052863 0.004405 0.017621 0.022026 0.955947 0.035242 0.000000 0.964758 0.000000 0.149780 0.572687 0.233480 0.044053 0.295154 0.158590 0.422907 0.123348 Consensus sequence: DCCACGTGCV ************************************************************************ Best Matches for Motif ID 8 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00060 Max_primary Original Motif Original Motif Forward 3 10 0.000000 Species: Mus musculus Original motif 0.234855 0.152539 0.301720 0.310886 0.199226 0.147959 0.439250 0.213565 0.582926 0.274768 0.075866 0.066440 0.138829 0.475428 0.305884 0.079859 0.024979 0.969691 0.001811 0.003520 0.966345 0.003728 0.022320 0.007607 0.000598 0.907006 0.008160 0.084236 0.084236 0.008160 0.907006 0.000598 0.007607 0.022320 0.003728 0.966345 0.003520 0.001811 0.969691 0.024979 0.149140 0.241218 0.389598 0.220044 0.066440 0.075866 0.274768 0.582926 0.186990 0.346199 0.250066 0.216745 0.273437 0.225889 0.300738 0.199936 0.160893 0.111177 0.477963 0.249968 0.171790 0.101256 0.424580 0.302375 Consensus sequence: DDASCACGTGBTBVDD Reverse complement motif 0.171790 0.424580 0.101256 0.302375 0.160893 0.477963 0.111177 0.249968 0.273437 0.300738 0.225889 0.199936 0.186990 0.250066 0.346199 0.216745 0.582926 0.075866 0.274768 0.066440 0.149140 0.389598 0.241218 0.220044 0.003520 0.969691 0.001811 0.024979 0.966345 0.022320 0.003728 0.007607 0.084236 0.907006 0.008160 0.000598 0.000598 0.008160 0.907006 0.084236 0.007607 0.003728 0.022320 0.966345 0.024979 0.001811 0.969691 0.003520 0.138829 0.305884 0.475428 0.079859 0.066440 0.274768 0.075866 0.582926 0.199226 0.439250 0.147959 0.213565 0.310886 0.152539 0.301720 0.234855 Consensus sequence: HHVBABCACGTGSTHD Alignment: DDASCACGTGBTBVDD --VGCACGTGGH---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00050 Bhlhb2_secondary Reverse Complement Reverse Complement Forward 8 10 0.006319 Species: Mus musculus Original motif 0.120938 0.344851 0.124072 0.410138 0.220931 0.169844 0.422396 0.186829 0.127752 0.260812 0.103811 0.507625 0.140641 0.405473 0.287668 0.166218 0.296957 0.155579 0.301094 0.246370 0.219647 0.287193 0.154072 0.339087 0.049294 0.026059 0.121789 0.802859 0.520042 0.289284 0.173423 0.017251 0.049190 0.943472 0.004308 0.003030 0.902609 0.006767 0.074770 0.015854 0.003221 0.971329 0.005512 0.019937 0.019937 0.005512 0.971329 0.003221 0.015854 0.074770 0.006767 0.902609 0.003030 0.004308 0.943472 0.049190 0.003497 0.088920 0.685942 0.221641 0.802859 0.121789 0.026059 0.049294 0.334544 0.155170 0.275193 0.235092 0.275957 0.132104 0.454982 0.136957 0.134097 0.254352 0.422940 0.188611 0.396163 0.432784 0.051281 0.119772 0.276474 0.115627 0.419844 0.188056 0.160759 0.088061 0.649863 0.101318 0.203314 0.166595 0.106821 0.523270 Consensus sequence: YDYBDHTMCACGTGGADDBMDGT Reverse complement motif 0.523270 0.166595 0.106821 0.203314 0.160759 0.649863 0.088061 0.101318 0.276474 0.419844 0.115627 0.188056 0.396163 0.051281 0.432784 0.119772 0.134097 0.422940 0.254352 0.188611 0.275957 0.454982 0.132104 0.136957 0.235092 0.155170 0.275193 0.334544 0.049294 0.121789 0.026059 0.802859 0.003497 0.685942 0.088920 0.221641 0.003030 0.943472 0.004308 0.049190 0.902609 0.074770 0.006767 0.015854 0.019937 0.971329 0.005512 0.003221 0.003221 0.005512 0.971329 0.019937 0.015854 0.006767 0.074770 0.902609 0.049190 0.004308 0.943472 0.003030 0.017251 0.289284 0.173423 0.520042 0.802859 0.026059 0.121789 0.049294 0.339087 0.287193 0.154072 0.219647 0.296957 0.301094 0.155579 0.246370 0.140641 0.287668 0.405473 0.166218 0.507625 0.260812 0.103811 0.127752 0.220931 0.422396 0.169844 0.186829 0.410138 0.344851 0.124072 0.120938 Consensus sequence: ACHRBHDTCCACGTGYAHHBMHM Alignment: ACHRBHDTCCACGTGYAHHBMHM -------DCCACGTGCV------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00050 Bhlhb2_primary Reverse Complement Reverse Complement Backward 7 10 0.008217 Species: Mus musculus Original motif 0.347837 0.112349 0.403713 0.136102 0.298329 0.175329 0.324534 0.201809 0.421791 0.222553 0.113615 0.242041 0.387506 0.130670 0.161435 0.320389 0.197183 0.244864 0.304611 0.253342 0.345884 0.188786 0.278290 0.187041 0.228203 0.142148 0.408269 0.221381 0.037126 0.006772 0.231775 0.724328 0.055214 0.942800 0.001192 0.000794 0.974119 0.004466 0.015535 0.005880 0.000300 0.958145 0.007498 0.034056 0.034056 0.007498 0.958145 0.000300 0.005880 0.015535 0.004466 0.974119 0.000794 0.001192 0.942800 0.055214 0.724328 0.231775 0.006772 0.037126 0.015720 0.466476 0.315208 0.202596 0.173670 0.355170 0.210710 0.260449 0.407419 0.261539 0.134430 0.196612 0.351478 0.209698 0.262426 0.176399 0.207869 0.284582 0.198951 0.308598 0.434482 0.113724 0.184408 0.267386 0.211144 0.363745 0.173978 0.251133 Consensus sequence: RDHDBVDTCACGTGASBHVHDH Reverse complement motif 0.211144 0.173978 0.363745 0.251133 0.267386 0.113724 0.184408 0.434482 0.308598 0.284582 0.198951 0.207869 0.176399 0.209698 0.262426 0.351478 0.196612 0.261539 0.134430 0.407419 0.173670 0.210710 0.355170 0.260449 0.015720 0.315208 0.466476 0.202596 0.037126 0.231775 0.006772 0.724328 0.000794 0.942800 0.001192 0.055214 0.974119 0.015535 0.004466 0.005880 0.034056 0.958145 0.007498 0.000300 0.000300 0.007498 0.958145 0.034056 0.005880 0.004466 0.015535 0.974119 0.055214 0.001192 0.942800 0.000794 0.724328 0.006772 0.231775 0.037126 0.228203 0.408269 0.142148 0.221381 0.187041 0.188786 0.278290 0.345884 0.197183 0.304611 0.244864 0.253342 0.320389 0.130670 0.161435 0.387506 0.242041 0.222553 0.113615 0.421791 0.298329 0.324534 0.175329 0.201809 0.347837 0.403713 0.112349 0.136102 Consensus sequence: DDHBHBSTCACGTGAHBBDHHM Alignment: DDHBHBSTCACGTGAHBBDHHM ------DCCACGTGCV------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00046 Tcfe2a_primary Original Motif Reverse Complement Backward 4 10 0.014001 Species: Mus musculus Original motif 0.306209 0.232705 0.244475 0.216611 0.165668 0.171480 0.222584 0.440269 0.213008 0.429038 0.156385 0.201569 0.283226 0.329518 0.160795 0.226461 0.439156 0.283517 0.251270 0.026056 0.014994 0.980987 0.000714 0.003304 0.975741 0.020182 0.002909 0.001168 0.000926 0.191353 0.801648 0.006073 0.015382 0.090853 0.893043 0.000721 0.001549 0.005912 0.001713 0.990826 0.004000 0.000857 0.989667 0.005475 0.016957 0.663726 0.148127 0.171190 0.299047 0.091156 0.448649 0.161148 0.354701 0.214677 0.236757 0.193865 0.399446 0.174508 0.200036 0.226009 0.303545 0.277435 0.200094 0.218926 0.380242 0.148876 0.163367 0.307514 Consensus sequence: VBHHVCAGGTGCDVDHD Reverse complement motif 0.307514 0.148876 0.163367 0.380242 0.218926 0.277435 0.200094 0.303545 0.226009 0.174508 0.200036 0.399446 0.193865 0.214677 0.236757 0.354701 0.299047 0.448649 0.091156 0.161148 0.016957 0.148127 0.663726 0.171190 0.004000 0.989667 0.000857 0.005475 0.990826 0.005912 0.001713 0.001549 0.015382 0.893043 0.090853 0.000721 0.000926 0.801648 0.191353 0.006073 0.001168 0.020182 0.002909 0.975741 0.014994 0.000714 0.980987 0.003304 0.026056 0.283517 0.251270 0.439156 0.283226 0.160795 0.329518 0.226461 0.213008 0.156385 0.429038 0.201569 0.440269 0.171480 0.222584 0.165668 0.216611 0.232705 0.244475 0.306209 Consensus sequence: DHDBHGCACCTGBDDVB Alignment: DHDBHGCACCTGBDDVB ----VGCACGTGGH--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00060 Max_secondary Original Motif Original Motif Backward 3 10 0.030891 Species: Mus musculus Original motif 0.127991 0.202889 0.399822 0.269298 0.156940 0.244015 0.182364 0.416681 0.046494 0.050598 0.744311 0.158596 0.196142 0.365183 0.183389 0.255286 0.019306 0.946805 0.015210 0.018680 0.924839 0.022113 0.027620 0.025428 0.007478 0.672138 0.027789 0.292595 0.046702 0.026044 0.906146 0.021107 0.117335 0.610863 0.025132 0.246670 0.044431 0.053581 0.722748 0.179240 0.543713 0.149809 0.190030 0.116447 0.241148 0.722386 0.022547 0.013919 0.265412 0.113032 0.270602 0.350954 0.226186 0.143504 0.332746 0.297564 Consensus sequence: BBGHCACGCGACDD Reverse complement motif 0.226186 0.332746 0.143504 0.297564 0.350954 0.113032 0.270602 0.265412 0.241148 0.022547 0.722386 0.013919 0.116447 0.149809 0.190030 0.543713 0.044431 0.722748 0.053581 0.179240 0.117335 0.025132 0.610863 0.246670 0.046702 0.906146 0.026044 0.021107 0.007478 0.027789 0.672138 0.292595 0.025428 0.022113 0.027620 0.924839 0.019306 0.015210 0.946805 0.018680 0.196142 0.183389 0.365183 0.255286 0.046494 0.744311 0.050598 0.158596 0.416681 0.244015 0.182364 0.156940 0.127991 0.399822 0.202889 0.269298 Consensus sequence: HDGTCGCGTGDCVB Alignment: BBGHCACGCGACDD --VGCACGTGGH-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00165 Titf1 Reverse Complement Original Motif Forward 4 10 0.031172 Species: Mus musculus Original motif 0.142834 0.324493 0.147276 0.385397 0.404842 0.233186 0.227659 0.134313 0.677580 0.044952 0.178774 0.098695 0.137761 0.202622 0.469728 0.189889 0.069301 0.825888 0.093549 0.011262 0.003882 0.876858 0.000966 0.118295 0.904355 0.015154 0.001043 0.079449 0.018912 0.977464 0.001207 0.002417 0.003517 0.004393 0.002428 0.989662 0.007151 0.162279 0.000584 0.829986 0.192074 0.120883 0.670840 0.016203 0.881358 0.002039 0.013253 0.103349 0.450016 0.333144 0.184121 0.032719 0.342018 0.321148 0.066945 0.269889 0.209486 0.122118 0.046367 0.622029 0.174564 0.145894 0.048004 0.631539 Consensus sequence: BVABCCACTTGAMHTT Reverse complement motif 0.631539 0.145894 0.048004 0.174564 0.622029 0.122118 0.046367 0.209486 0.269889 0.321148 0.066945 0.342018 0.032719 0.333144 0.184121 0.450016 0.103349 0.002039 0.013253 0.881358 0.192074 0.670840 0.120883 0.016203 0.829986 0.162279 0.000584 0.007151 0.989662 0.004393 0.002428 0.003517 0.018912 0.001207 0.977464 0.002417 0.079449 0.015154 0.001043 0.904355 0.003882 0.000966 0.876858 0.118295 0.069301 0.093549 0.825888 0.011262 0.137761 0.469728 0.202622 0.189889 0.098695 0.044952 0.178774 0.677580 0.134313 0.233186 0.227659 0.404842 0.385397 0.324493 0.147276 0.142834 Consensus sequence: AAHYTCAAGTGGBTBV Alignment: BVABCCACTTGAMHTT ---DCCACGTGCV--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00249 Nkx2-5 Reverse Complement Original Motif Backward 4 10 0.031308 Species: Mus musculus Original motif 0.284346 0.280937 0.138180 0.296538 0.399663 0.110464 0.327481 0.162392 0.637560 0.029806 0.218321 0.114314 0.184898 0.144379 0.370828 0.299895 0.017459 0.862111 0.118223 0.002207 0.001004 0.958164 0.000888 0.039945 0.947796 0.011499 0.000413 0.040291 0.024268 0.973476 0.000709 0.001546 0.002616 0.001901 0.003337 0.992147 0.006742 0.071290 0.000276 0.921691 0.393078 0.093424 0.490620 0.022879 0.870162 0.007294 0.051952 0.070591 0.632449 0.156278 0.172644 0.038628 0.362798 0.126579 0.085796 0.424828 0.132810 0.206405 0.025084 0.635702 0.094708 0.272324 0.087702 0.545267 Consensus sequence: HDADCCACTTRAAWTT Reverse complement motif 0.545267 0.272324 0.087702 0.094708 0.635702 0.206405 0.025084 0.132810 0.424828 0.126579 0.085796 0.362798 0.038628 0.156278 0.172644 0.632449 0.070591 0.007294 0.051952 0.870162 0.393078 0.490620 0.093424 0.022879 0.921691 0.071290 0.000276 0.006742 0.992147 0.001901 0.003337 0.002616 0.024268 0.000709 0.973476 0.001546 0.040291 0.011499 0.000413 0.947796 0.001004 0.000888 0.958164 0.039945 0.017459 0.118223 0.862111 0.002207 0.184898 0.370828 0.144379 0.299895 0.114314 0.029806 0.218321 0.637560 0.162392 0.110464 0.327481 0.399663 0.296538 0.280937 0.138180 0.284346 Consensus sequence: AAWTTMAAGTGGHTDH Alignment: HDADCCACTTRAAWTT ---DCCACGTGCV--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00231 Nkx2-2 Reverse Complement Original Motif Forward 4 10 0.033485 Species: Mus musculus Original motif 0.299323 0.258429 0.141957 0.300291 0.267631 0.143882 0.146933 0.441554 0.482614 0.212022 0.233631 0.071733 0.430836 0.073912 0.334439 0.160813 0.124944 0.704331 0.166815 0.003910 0.001941 0.876479 0.000828 0.120752 0.920202 0.005985 0.000456 0.073357 0.023544 0.974093 0.000859 0.001505 0.005010 0.003098 0.001328 0.990564 0.003250 0.198149 0.000490 0.798110 0.134659 0.104976 0.753464 0.006901 0.932490 0.000724 0.006140 0.060646 0.504530 0.106203 0.360995 0.028271 0.673257 0.074893 0.106536 0.145314 0.356324 0.097610 0.230142 0.315924 0.129483 0.188353 0.203623 0.478542 0.289071 0.157675 0.231909 0.321345 Consensus sequence: HDVRCCACTTGARADBD Reverse complement motif 0.321345 0.157675 0.231909 0.289071 0.478542 0.188353 0.203623 0.129483 0.315924 0.097610 0.230142 0.356324 0.145314 0.074893 0.106536 0.673257 0.028271 0.106203 0.360995 0.504530 0.060646 0.000724 0.006140 0.932490 0.134659 0.753464 0.104976 0.006901 0.798110 0.198149 0.000490 0.003250 0.990564 0.003098 0.001328 0.005010 0.023544 0.000859 0.974093 0.001505 0.073357 0.005985 0.000456 0.920202 0.001941 0.000828 0.876479 0.120752 0.124944 0.166815 0.704331 0.003910 0.160813 0.073912 0.334439 0.430836 0.071733 0.212022 0.233631 0.482614 0.441554 0.143882 0.146933 0.267631 0.300291 0.258429 0.141957 0.299323 Consensus sequence: DVDTKTCAAGTGGKBDH Alignment: HDVRCCACTTGARADBD ---DCCACGTGCV---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00147 Nkx2-6 Reverse Complement Original Motif Backward 4 10 0.034555 Species: Mus musculus Original motif 0.217416 0.196318 0.223786 0.362479 0.398508 0.155537 0.270546 0.175410 0.791392 0.022106 0.126944 0.059558 0.211671 0.145452 0.349401 0.293476 0.023830 0.847357 0.127125 0.001688 0.001426 0.942475 0.000495 0.055604 0.969354 0.001012 0.000987 0.028646 0.017358 0.980969 0.000778 0.000894 0.001816 0.004181 0.001573 0.992430 0.000925 0.059099 0.000431 0.939544 0.670672 0.011130 0.312570 0.005628 0.757147 0.010903 0.032137 0.199813 0.335600 0.359053 0.277277 0.028070 0.440449 0.199116 0.111993 0.248442 0.126577 0.210049 0.039661 0.623714 0.088481 0.233166 0.032706 0.645647 Consensus sequence: DDADCCACTTAAVHTT Reverse complement motif 0.645647 0.233166 0.032706 0.088481 0.623714 0.210049 0.039661 0.126577 0.248442 0.199116 0.111993 0.440449 0.335600 0.277277 0.359053 0.028070 0.199813 0.010903 0.032137 0.757147 0.005628 0.011130 0.312570 0.670672 0.939544 0.059099 0.000431 0.000925 0.992430 0.004181 0.001573 0.001816 0.017358 0.000778 0.980969 0.000894 0.028646 0.001012 0.000987 0.969354 0.001426 0.000495 0.942475 0.055604 0.023830 0.127125 0.847357 0.001688 0.211671 0.349401 0.145452 0.293476 0.059558 0.022106 0.126944 0.791392 0.175410 0.155537 0.270546 0.398508 0.362479 0.196318 0.223786 0.217416 Consensus sequence: AAHVTTAAGTGGHTDD Alignment: DDADCCACTTAAVHTT ---DCCACGTGCV--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00527 Foxn4_secondary Original Motif Original Motif Forward 6 10 0.036382 Species: Mus musculus Original motif 0.298336 0.418632 0.208054 0.074978 0.289907 0.015608 0.457100 0.237385 0.273583 0.077889 0.107860 0.540668 0.184954 0.161611 0.384390 0.269045 0.521826 0.156340 0.089019 0.232815 0.356716 0.131104 0.394857 0.117323 0.266669 0.108765 0.505273 0.119293 0.020778 0.047199 0.919524 0.012500 0.948536 0.018775 0.008113 0.024576 0.010822 0.964042 0.014701 0.010434 0.007428 0.019505 0.966351 0.006717 0.010025 0.975678 0.008648 0.005649 0.043796 0.120935 0.742979 0.092289 0.008252 0.250704 0.541132 0.199913 0.474428 0.044681 0.134430 0.346461 0.146597 0.421317 0.143166 0.288920 0.020540 0.181479 0.553811 0.244170 0.129612 0.173360 0.535219 0.161808 0.506084 0.158156 0.130983 0.204776 0.054872 0.103043 0.545792 0.296293 0.389882 0.171037 0.164162 0.274918 0.225861 0.314031 0.288872 0.171237 Consensus sequence: VDWDARRGACGCGGWHGGAKHV Reverse complement motif 0.225861 0.288872 0.314031 0.171237 0.274918 0.171037 0.164162 0.389882 0.054872 0.545792 0.103043 0.296293 0.204776 0.158156 0.130983 0.506084 0.129612 0.535219 0.173360 0.161808 0.020540 0.553811 0.181479 0.244170 0.146597 0.143166 0.421317 0.288920 0.346461 0.044681 0.134430 0.474428 0.008252 0.541132 0.250704 0.199913 0.043796 0.742979 0.120935 0.092289 0.010025 0.008648 0.975678 0.005649 0.007428 0.966351 0.019505 0.006717 0.010822 0.014701 0.964042 0.010434 0.024576 0.018775 0.008113 0.948536 0.020778 0.919524 0.047199 0.012500 0.266669 0.505273 0.108765 0.119293 0.356716 0.394857 0.131104 0.117323 0.232815 0.156340 0.089019 0.521826 0.184954 0.384390 0.161611 0.269045 0.540668 0.077889 0.107860 0.273583 0.289907 0.457100 0.015608 0.237385 0.298336 0.208054 0.418632 0.074978 Consensus sequence: VHYTCCDWCCGCGTCMMTHWHV Alignment: VDWDARRGACGCGGWHGGAKHV -----VGCACGTGGH------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 9 Motif name: ESR2 Original motif 0.218487 0.450980 0.176471 0.154062 0.442577 0.142857 0.114846 0.299720 0.521008 0.042017 0.431373 0.005602 0.075630 0.000000 0.770308 0.154062 0.050420 0.056022 0.893557 0.000000 0.036415 0.053221 0.092437 0.817927 0.000000 1.000000 0.000000 0.000000 0.943978 0.002801 0.000000 0.053221 0.137255 0.344538 0.316527 0.201681 0.179272 0.176471 0.417367 0.226891 0.145658 0.170868 0.411765 0.271709 0.058824 0.092437 0.067227 0.781513 0.176471 0.070028 0.742297 0.011204 0.498599 0.277311 0.053221 0.170868 0.095238 0.750700 0.005602 0.148459 0.128852 0.809524 0.000000 0.061625 0.075630 0.252101 0.000000 0.672269 0.168067 0.263305 0.380952 0.187675 Consensus sequence: VHRGGTCABDBTGMCCTB Reserve complement motif 0.168067 0.380952 0.263305 0.187675 0.672269 0.252101 0.000000 0.075630 0.128852 0.000000 0.809524 0.061625 0.095238 0.005602 0.750700 0.148459 0.170868 0.277311 0.053221 0.498599 0.176471 0.742297 0.070028 0.011204 0.781513 0.092437 0.067227 0.058824 0.145658 0.411765 0.170868 0.271709 0.179272 0.417367 0.176471 0.226891 0.137255 0.316527 0.344538 0.201681 0.053221 0.002801 0.000000 0.943978 0.000000 0.000000 1.000000 0.000000 0.817927 0.053221 0.092437 0.036415 0.050420 0.893557 0.056022 0.000000 0.075630 0.770308 0.000000 0.154062 0.005602 0.042017 0.431373 0.521008 0.299720 0.142857 0.114846 0.442577 0.218487 0.176471 0.450980 0.154062 Consensus sequence: BAGGYCABHBTGACCKHV ************************************************************************ Best Matches for Motif ID 9 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00034 Sox7_secondary Original Motif Original Motif Forward 4 18 0.044389 Species: Mus musculus Original motif 0.067627 0.131333 0.654425 0.146615 0.156488 0.114442 0.145630 0.583441 0.206450 0.265630 0.358017 0.169903 0.090729 0.460713 0.274712 0.173847 0.285994 0.099998 0.154485 0.459523 0.635908 0.184787 0.072982 0.106323 0.748421 0.039204 0.092605 0.119769 0.081342 0.061327 0.044532 0.812799 0.143120 0.043879 0.024216 0.788785 0.247544 0.092102 0.621453 0.038901 0.295531 0.036295 0.027594 0.640580 0.194561 0.305468 0.339916 0.160055 0.175038 0.193568 0.101212 0.530182 0.145226 0.167488 0.559871 0.127415 0.271501 0.237429 0.206701 0.284369 0.216834 0.109191 0.569605 0.104370 0.182624 0.177160 0.300475 0.339742 0.331737 0.198645 0.265137 0.204482 0.230155 0.359365 0.183450 0.227029 0.056581 0.067297 0.463052 0.413070 0.198891 0.324626 0.304424 0.172059 0.181968 0.287547 0.202419 0.328066 Consensus sequence: GTVBDAATTGTVTGHGDDHKVB Reverse complement motif 0.328066 0.287547 0.202419 0.181968 0.198891 0.304424 0.324626 0.172059 0.056581 0.463052 0.067297 0.413070 0.230155 0.183450 0.359365 0.227029 0.204482 0.198645 0.265137 0.331737 0.339742 0.177160 0.300475 0.182624 0.216834 0.569605 0.109191 0.104370 0.284369 0.237429 0.206701 0.271501 0.145226 0.559871 0.167488 0.127415 0.530182 0.193568 0.101212 0.175038 0.194561 0.339916 0.305468 0.160055 0.640580 0.036295 0.027594 0.295531 0.247544 0.621453 0.092102 0.038901 0.788785 0.043879 0.024216 0.143120 0.812799 0.061327 0.044532 0.081342 0.119769 0.039204 0.092605 0.748421 0.106323 0.184787 0.072982 0.635908 0.459523 0.099998 0.154485 0.285994 0.090729 0.274712 0.460713 0.173847 0.206450 0.358017 0.265630 0.169903 0.583441 0.114442 0.145630 0.156488 0.067627 0.654425 0.131333 0.146615 Consensus sequence: VVYDDDCHCAVACAATTDBVAC Alignment: GTVBDAATTGTVTGHGDDHKVB ---VHRGGTCABDBTGMCCTB- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v016060_secondary Original Motif Reverse Complement Forward 4 18 0.049219 Species: Mus musculus Original motif 0.319838 0.171199 0.138099 0.370865 0.269358 0.196600 0.346909 0.187133 0.176807 0.338888 0.193903 0.290402 0.230268 0.119645 0.310500 0.339587 0.517372 0.257658 0.111673 0.113296 0.159477 0.126524 0.561119 0.152879 0.117072 0.553013 0.130919 0.198996 0.073372 0.163548 0.525014 0.238066 0.143608 0.186896 0.170528 0.498967 0.054943 0.079034 0.722992 0.143031 0.048852 0.015134 0.852458 0.083556 0.029001 0.023938 0.918900 0.028160 0.036727 0.092645 0.090591 0.780037 0.017757 0.057598 0.895222 0.029423 0.026113 0.048113 0.879744 0.046030 0.023041 0.787043 0.123490 0.066426 0.579766 0.004868 0.296873 0.118493 0.303862 0.042931 0.290151 0.363055 0.099672 0.237431 0.262301 0.400597 0.217788 0.163908 0.367628 0.250676 0.450783 0.141108 0.226137 0.181972 0.485086 0.102553 0.242662 0.169700 0.109057 0.454222 0.145665 0.291056 Consensus sequence: HVBDAGCGBGGGTGGCRDBDDDB Reverse complement motif 0.109057 0.145665 0.454222 0.291056 0.169700 0.102553 0.242662 0.485086 0.181972 0.141108 0.226137 0.450783 0.217788 0.367628 0.163908 0.250676 0.400597 0.237431 0.262301 0.099672 0.363055 0.042931 0.290151 0.303862 0.118493 0.004868 0.296873 0.579766 0.023041 0.123490 0.787043 0.066426 0.026113 0.879744 0.048113 0.046030 0.017757 0.895222 0.057598 0.029423 0.780037 0.092645 0.090591 0.036727 0.029001 0.918900 0.023938 0.028160 0.048852 0.852458 0.015134 0.083556 0.054943 0.722992 0.079034 0.143031 0.498967 0.186896 0.170528 0.143608 0.073372 0.525014 0.163548 0.238066 0.117072 0.130919 0.553013 0.198996 0.159477 0.561119 0.126524 0.152879 0.113296 0.257658 0.111673 0.517372 0.339587 0.119645 0.310500 0.230268 0.176807 0.193903 0.338888 0.290402 0.269358 0.346909 0.196600 0.187133 0.370865 0.171199 0.138099 0.319838 Consensus sequence: BDDHVDKGCCACCCVCGCTDBVH Alignment: BDDHVDKGCCACCCVCGCTDBVH ---VHRGGTCABDBTGMCCTB-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00050 Bhlhb2_primary Original Motif Reverse Complement Backward 3 18 0.050918 Species: Mus musculus Original motif 0.347837 0.112349 0.403713 0.136102 0.298329 0.175329 0.324534 0.201809 0.421791 0.222553 0.113615 0.242041 0.387506 0.130670 0.161435 0.320389 0.197183 0.244864 0.304611 0.253342 0.345884 0.188786 0.278290 0.187041 0.228203 0.142148 0.408269 0.221381 0.037126 0.006772 0.231775 0.724328 0.055214 0.942800 0.001192 0.000794 0.974119 0.004466 0.015535 0.005880 0.000300 0.958145 0.007498 0.034056 0.034056 0.007498 0.958145 0.000300 0.005880 0.015535 0.004466 0.974119 0.000794 0.001192 0.942800 0.055214 0.724328 0.231775 0.006772 0.037126 0.015720 0.466476 0.315208 0.202596 0.173670 0.355170 0.210710 0.260449 0.407419 0.261539 0.134430 0.196612 0.351478 0.209698 0.262426 0.176399 0.207869 0.284582 0.198951 0.308598 0.434482 0.113724 0.184408 0.267386 0.211144 0.363745 0.173978 0.251133 Consensus sequence: RDHDBVDTCACGTGASBHVHDH Reverse complement motif 0.211144 0.173978 0.363745 0.251133 0.267386 0.113724 0.184408 0.434482 0.308598 0.284582 0.198951 0.207869 0.176399 0.209698 0.262426 0.351478 0.196612 0.261539 0.134430 0.407419 0.173670 0.210710 0.355170 0.260449 0.015720 0.315208 0.466476 0.202596 0.037126 0.231775 0.006772 0.724328 0.000794 0.942800 0.001192 0.055214 0.974119 0.015535 0.004466 0.005880 0.034056 0.958145 0.007498 0.000300 0.000300 0.007498 0.958145 0.034056 0.005880 0.004466 0.015535 0.974119 0.055214 0.001192 0.942800 0.000794 0.724328 0.006772 0.231775 0.037126 0.228203 0.408269 0.142148 0.221381 0.187041 0.188786 0.278290 0.345884 0.197183 0.304611 0.244864 0.253342 0.320389 0.130670 0.161435 0.387506 0.242041 0.222553 0.113615 0.421791 0.298329 0.324534 0.175329 0.201809 0.347837 0.403713 0.112349 0.136102 Consensus sequence: DDHBHBSTCACGTGAHBBDHHM Alignment: DDHBHBSTCACGTGAHBBDHHM --VHRGGTCABDBTGMCCTB-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v015681_secondary Reverse Complement Original Motif Forward 2 18 0.052708 Species: Mus musculus Original motif 0.214165 0.143436 0.372522 0.269876 0.314445 0.406003 0.160351 0.119201 0.137147 0.092924 0.042921 0.727007 0.044121 0.072843 0.051741 0.831295 0.261292 0.324124 0.298498 0.116086 0.258125 0.323243 0.263362 0.155271 0.204557 0.589399 0.107153 0.098891 0.371021 0.244027 0.291102 0.093849 0.096327 0.572718 0.011797 0.319159 0.027282 0.046183 0.844519 0.082016 0.018921 0.012887 0.915917 0.052275 0.364793 0.166722 0.084229 0.384256 0.028216 0.011233 0.951056 0.009495 0.054974 0.004738 0.890377 0.049911 0.006802 0.312915 0.134247 0.546036 0.241289 0.628210 0.104788 0.025713 0.237863 0.302807 0.213018 0.246311 0.349399 0.203220 0.086635 0.360746 0.386634 0.144693 0.246895 0.221779 0.425101 0.354676 0.093374 0.126849 0.060272 0.391320 0.104905 0.443503 0.162090 0.190233 0.227433 0.420244 Consensus sequence: DVTTVVCVYGGHGGYCHHDMYB Reverse complement motif 0.420244 0.190233 0.227433 0.162090 0.443503 0.391320 0.104905 0.060272 0.126849 0.354676 0.093374 0.425101 0.221779 0.144693 0.246895 0.386634 0.360746 0.203220 0.086635 0.349399 0.237863 0.213018 0.302807 0.246311 0.241289 0.104788 0.628210 0.025713 0.546036 0.312915 0.134247 0.006802 0.054974 0.890377 0.004738 0.049911 0.028216 0.951056 0.011233 0.009495 0.384256 0.166722 0.084229 0.364793 0.018921 0.915917 0.012887 0.052275 0.027282 0.844519 0.046183 0.082016 0.096327 0.011797 0.572718 0.319159 0.093849 0.244027 0.291102 0.371021 0.204557 0.107153 0.589399 0.098891 0.258125 0.263362 0.323243 0.155271 0.261292 0.298498 0.324124 0.116086 0.831295 0.072843 0.051741 0.044121 0.727007 0.092924 0.042921 0.137147 0.314445 0.160351 0.406003 0.119201 0.214165 0.372522 0.143436 0.269876 Consensus sequence: VMYDHDGMCCHCCKBGVVAAVH Alignment: DVTTVVCVYGGHGGYCHHDMYB -BAGGYCABHBTGACCKHV--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00034 Sox7_primary Reverse Complement Reverse Complement Forward 2 18 0.054104 Species: Mus musculus Original motif 0.360997 0.300272 0.115555 0.223177 0.309749 0.228429 0.166233 0.295589 0.149419 0.176868 0.240155 0.433558 0.379704 0.095791 0.276373 0.248133 0.394549 0.174184 0.130641 0.300626 0.443749 0.070776 0.211081 0.274393 0.364301 0.074356 0.370406 0.190936 0.791976 0.038475 0.093390 0.076159 0.963721 0.001826 0.002456 0.031997 0.004516 0.954596 0.008092 0.032796 0.981080 0.002062 0.002161 0.014697 0.986185 0.001846 0.006976 0.004992 0.059567 0.003649 0.002189 0.934595 0.495328 0.024257 0.240450 0.239965 0.305027 0.094878 0.526069 0.074025 0.418442 0.196237 0.158323 0.226998 0.336713 0.220452 0.191155 0.251680 0.192296 0.300342 0.169047 0.338315 0.240387 0.144634 0.128513 0.486465 0.290763 0.271259 0.116600 0.321377 0.224825 0.296233 0.229255 0.249687 0.493240 0.171285 0.075148 0.260326 Consensus sequence: HHBDHDDAACAATDRHHHHHBW Reverse complement motif 0.260326 0.171285 0.075148 0.493240 0.224825 0.229255 0.296233 0.249687 0.321377 0.271259 0.116600 0.290763 0.486465 0.144634 0.128513 0.240387 0.338315 0.300342 0.169047 0.192296 0.251680 0.220452 0.191155 0.336713 0.226998 0.196237 0.158323 0.418442 0.305027 0.526069 0.094878 0.074025 0.239965 0.024257 0.240450 0.495328 0.934595 0.003649 0.002189 0.059567 0.004992 0.001846 0.006976 0.986185 0.014697 0.002062 0.002161 0.981080 0.004516 0.008092 0.954596 0.032796 0.031997 0.001826 0.002456 0.963721 0.076159 0.038475 0.093390 0.791976 0.364301 0.370406 0.074356 0.190936 0.274393 0.070776 0.211081 0.443749 0.300626 0.174184 0.130641 0.394549 0.248133 0.095791 0.276373 0.379704 0.433558 0.176868 0.240155 0.149419 0.295589 0.228429 0.166233 0.309749 0.223177 0.300272 0.115555 0.360997 Consensus sequence: WBHHHHHMDATTGTTHDHDVHH Alignment: WBHHHHHMDATTGTTHDHDVHH -BAGGYCABHBTGACCKHV--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00098 Rfx3_secondary Reverse Complement Original Motif Forward 3 18 0.054111 Species: Mus musculus Original motif 0.314514 0.275352 0.257617 0.152518 0.126939 0.598294 0.130576 0.144192 0.102265 0.155334 0.177957 0.564445 0.129288 0.282678 0.326990 0.261044 0.318166 0.227823 0.175681 0.278330 0.109019 0.380838 0.278328 0.231815 0.226145 0.289206 0.291300 0.193348 0.035863 0.844339 0.072582 0.047216 0.223793 0.187244 0.088092 0.500871 0.039800 0.029681 0.026201 0.904317 0.298298 0.032147 0.654746 0.014809 0.014729 0.022023 0.944826 0.018422 0.485114 0.004925 0.013785 0.496176 0.035708 0.020381 0.240804 0.703108 0.951152 0.012738 0.017886 0.018224 0.023713 0.944394 0.009538 0.022355 0.291067 0.385205 0.232388 0.091339 0.340334 0.199588 0.311526 0.148552 0.198713 0.472138 0.178319 0.150830 0.321155 0.269932 0.311301 0.097612 0.412646 0.195252 0.231950 0.160152 0.297134 0.180928 0.250400 0.271538 0.151169 0.305386 0.358574 0.184871 Consensus sequence: VCTBHBVCTTGGWTACVVVVVDB Reverse complement motif 0.151169 0.358574 0.305386 0.184871 0.271538 0.180928 0.250400 0.297134 0.160152 0.195252 0.231950 0.412646 0.097612 0.269932 0.311301 0.321155 0.198713 0.178319 0.472138 0.150830 0.148552 0.199588 0.311526 0.340334 0.291067 0.232388 0.385205 0.091339 0.023713 0.009538 0.944394 0.022355 0.018224 0.012738 0.017886 0.951152 0.703108 0.020381 0.240804 0.035708 0.496176 0.004925 0.013785 0.485114 0.014729 0.944826 0.022023 0.018422 0.298298 0.654746 0.032147 0.014809 0.904317 0.029681 0.026201 0.039800 0.500871 0.187244 0.088092 0.223793 0.035863 0.072582 0.844339 0.047216 0.226145 0.291300 0.289206 0.193348 0.109019 0.278328 0.380838 0.231815 0.278330 0.227823 0.175681 0.318166 0.129288 0.326990 0.282678 0.261044 0.564445 0.155334 0.177957 0.102265 0.126939 0.130576 0.598294 0.144192 0.152518 0.275352 0.257617 0.314514 Consensus sequence: BDBBVBVGTAWCCAAGVBHBAGB Alignment: VCTBHBVCTTGGWTACVVVVVDB --BAGGYCABHBTGACCKHV--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00527 Foxn4_secondary Original Motif Original Motif Backward 2 18 0.054373 Species: Mus musculus Original motif 0.298336 0.418632 0.208054 0.074978 0.289907 0.015608 0.457100 0.237385 0.273583 0.077889 0.107860 0.540668 0.184954 0.161611 0.384390 0.269045 0.521826 0.156340 0.089019 0.232815 0.356716 0.131104 0.394857 0.117323 0.266669 0.108765 0.505273 0.119293 0.020778 0.047199 0.919524 0.012500 0.948536 0.018775 0.008113 0.024576 0.010822 0.964042 0.014701 0.010434 0.007428 0.019505 0.966351 0.006717 0.010025 0.975678 0.008648 0.005649 0.043796 0.120935 0.742979 0.092289 0.008252 0.250704 0.541132 0.199913 0.474428 0.044681 0.134430 0.346461 0.146597 0.421317 0.143166 0.288920 0.020540 0.181479 0.553811 0.244170 0.129612 0.173360 0.535219 0.161808 0.506084 0.158156 0.130983 0.204776 0.054872 0.103043 0.545792 0.296293 0.389882 0.171037 0.164162 0.274918 0.225861 0.314031 0.288872 0.171237 Consensus sequence: VDWDARRGACGCGGWHGGAKHV Reverse complement motif 0.225861 0.288872 0.314031 0.171237 0.274918 0.171037 0.164162 0.389882 0.054872 0.545792 0.103043 0.296293 0.204776 0.158156 0.130983 0.506084 0.129612 0.535219 0.173360 0.161808 0.020540 0.553811 0.181479 0.244170 0.146597 0.143166 0.421317 0.288920 0.346461 0.044681 0.134430 0.474428 0.008252 0.541132 0.250704 0.199913 0.043796 0.742979 0.120935 0.092289 0.010025 0.008648 0.975678 0.005649 0.007428 0.966351 0.019505 0.006717 0.010822 0.014701 0.964042 0.010434 0.024576 0.018775 0.008113 0.948536 0.020778 0.919524 0.047199 0.012500 0.266669 0.505273 0.108765 0.119293 0.356716 0.394857 0.131104 0.117323 0.232815 0.156340 0.089019 0.521826 0.184954 0.384390 0.161611 0.269045 0.540668 0.077889 0.107860 0.273583 0.289907 0.457100 0.015608 0.237385 0.298336 0.208054 0.418632 0.074978 Consensus sequence: VHYTCCDWCCGCGTCMMTHWHV Alignment: VDWDARRGACGCGGWHGGAKHV ---VHRGGTCABDBTGMCCTB- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v016060_primary Reverse Complement Original Motif Backward 5 18 0.054809 Species: Mus musculus Original motif 0.204923 0.208846 0.365383 0.220848 0.294304 0.300143 0.167287 0.238266 0.109711 0.619514 0.117379 0.153396 0.178979 0.378580 0.230177 0.212264 0.159594 0.542602 0.118178 0.179627 0.125206 0.430074 0.151826 0.292894 0.097692 0.709845 0.116956 0.075506 0.148292 0.565912 0.037632 0.248164 0.077951 0.034190 0.855503 0.032356 0.001657 0.001061 0.971877 0.025405 0.001926 0.001084 0.991712 0.005278 0.033031 0.012001 0.057796 0.897171 0.002723 0.002647 0.993348 0.001281 0.003261 0.000963 0.987199 0.008577 0.000611 0.090925 0.074857 0.833608 0.015299 0.978878 0.004949 0.000874 0.013368 0.600902 0.033485 0.352245 0.231949 0.149575 0.118804 0.499672 0.267580 0.186002 0.371242 0.175176 0.264884 0.223483 0.110082 0.401551 0.221365 0.170121 0.179559 0.428955 0.112997 0.692930 0.139981 0.054092 0.460305 0.207883 0.155111 0.176702 Consensus sequence: BHCBCBCCGGGTGGTCYHVHDCH Reverse complement motif 0.176702 0.207883 0.155111 0.460305 0.112997 0.139981 0.692930 0.054092 0.428955 0.170121 0.179559 0.221365 0.401551 0.223483 0.110082 0.264884 0.267580 0.371242 0.186002 0.175176 0.499672 0.149575 0.118804 0.231949 0.013368 0.033485 0.600902 0.352245 0.015299 0.004949 0.978878 0.000874 0.833608 0.090925 0.074857 0.000611 0.003261 0.987199 0.000963 0.008577 0.002723 0.993348 0.002647 0.001281 0.897171 0.012001 0.057796 0.033031 0.001926 0.991712 0.001084 0.005278 0.001657 0.971877 0.001061 0.025405 0.077951 0.855503 0.034190 0.032356 0.148292 0.037632 0.565912 0.248164 0.097692 0.116956 0.709845 0.075506 0.125206 0.151826 0.430074 0.292894 0.159594 0.118178 0.542602 0.179627 0.178979 0.230177 0.378580 0.212264 0.109711 0.117379 0.619514 0.153396 0.294304 0.167287 0.300143 0.238266 0.204923 0.365383 0.208846 0.220848 Consensus sequence: HGDHVHKGACCACCCGGBGBGDB Alignment: BHCBCBCCGGGTGGTCYHVHDCH -BAGGYCABHBTGACCKHV---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00528 Foxm1_secondary Original Motif Reverse Complement Forward 5 18 0.055453 Species: Mus musculus Original motif 0.399785 0.446658 0.111435 0.042122 0.535175 0.103991 0.089706 0.271128 0.078171 0.387987 0.375083 0.158759 0.309001 0.519142 0.070618 0.101239 0.201844 0.255818 0.323149 0.219190 0.534101 0.109845 0.235026 0.121028 0.656038 0.037473 0.261484 0.045006 0.315713 0.164290 0.471815 0.048182 0.651960 0.009412 0.328237 0.010391 0.937365 0.017313 0.007516 0.037807 0.019983 0.044238 0.012387 0.923392 0.061195 0.021485 0.881645 0.035675 0.017521 0.952998 0.013139 0.016342 0.254160 0.029735 0.493023 0.223082 0.239200 0.593324 0.114503 0.052973 0.610822 0.071539 0.099169 0.218470 0.166610 0.389712 0.204400 0.239278 0.227752 0.361626 0.178497 0.232125 0.537030 0.182466 0.026035 0.254470 0.235902 0.151006 0.043788 0.569304 0.081851 0.250397 0.590059 0.077693 0.340417 0.189613 0.272075 0.197895 Consensus sequence: MWSMBAARRATGCDCABHATGD Reverse complement motif 0.197895 0.189613 0.272075 0.340417 0.081851 0.590059 0.250397 0.077693 0.569304 0.151006 0.043788 0.235902 0.254470 0.182466 0.026035 0.537030 0.227752 0.178497 0.361626 0.232125 0.166610 0.204400 0.389712 0.239278 0.218470 0.071539 0.099169 0.610822 0.239200 0.114503 0.593324 0.052973 0.254160 0.493023 0.029735 0.223082 0.017521 0.013139 0.952998 0.016342 0.061195 0.881645 0.021485 0.035675 0.923392 0.044238 0.012387 0.019983 0.037807 0.017313 0.007516 0.937365 0.010391 0.009412 0.328237 0.651960 0.315713 0.471815 0.164290 0.048182 0.045006 0.037473 0.261484 0.656038 0.121028 0.109845 0.235026 0.534101 0.201844 0.323149 0.255818 0.219190 0.309001 0.070618 0.519142 0.101239 0.078171 0.375083 0.387987 0.158759 0.271128 0.103991 0.089706 0.535175 0.399785 0.111435 0.446658 0.042122 Consensus sequence: DCATDBTGHGCATKMTTBRSWR Alignment: DCATDBTGHGCATKMTTBRSWR ----VHRGGTCABDBTGMCCTB ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00032 Gata3_secondary Original Motif Original Motif Backward 4 18 0.056643 Species: Mus musculus Original motif 0.177641 0.319872 0.115137 0.387350 0.136644 0.182137 0.205873 0.475347 0.254263 0.244280 0.165207 0.336250 0.240415 0.207557 0.237497 0.314530 0.271041 0.214702 0.364395 0.149863 0.095475 0.320104 0.191738 0.392682 0.500902 0.142722 0.026556 0.329820 0.051221 0.023698 0.897245 0.027836 0.922410 0.027509 0.024058 0.026023 0.030735 0.070903 0.024248 0.874114 0.242120 0.231992 0.225143 0.300745 0.106956 0.220471 0.283490 0.389083 0.152079 0.165830 0.135066 0.547025 0.839205 0.051581 0.060119 0.049095 0.041204 0.069147 0.070830 0.818819 0.051861 0.848177 0.027599 0.072363 0.383793 0.016807 0.397470 0.201931 0.381899 0.215846 0.255908 0.146347 0.094792 0.358651 0.280905 0.265652 0.296132 0.181545 0.178433 0.343890 0.301997 0.254722 0.108566 0.334714 0.349481 0.270693 0.137507 0.242319 Consensus sequence: HBHDVBWGATHBTATCRVBHHH Reverse complement motif 0.242319 0.270693 0.137507 0.349481 0.334714 0.254722 0.108566 0.301997 0.343890 0.181545 0.178433 0.296132 0.094792 0.280905 0.358651 0.265652 0.146347 0.215846 0.255908 0.381899 0.383793 0.397470 0.016807 0.201931 0.051861 0.027599 0.848177 0.072363 0.818819 0.069147 0.070830 0.041204 0.049095 0.051581 0.060119 0.839205 0.547025 0.165830 0.135066 0.152079 0.389083 0.220471 0.283490 0.106956 0.300745 0.231992 0.225143 0.242120 0.874114 0.070903 0.024248 0.030735 0.026023 0.027509 0.024058 0.922410 0.051221 0.897245 0.023698 0.027836 0.329820 0.142722 0.026556 0.500902 0.392682 0.320104 0.191738 0.095475 0.271041 0.364395 0.214702 0.149863 0.314530 0.207557 0.237497 0.240415 0.336250 0.244280 0.165207 0.254263 0.475347 0.182137 0.205873 0.136644 0.387350 0.319872 0.115137 0.177641 Consensus sequence: HHHBBMGATAVHATCWVVDHVH Alignment: HBHDVBWGATHBTATCRVBHHH -VHRGGTCABDBTGMCCTB--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 10 Motif name: NR1H2RXRA Original motif 0.680000 0.200000 0.000000 0.120000 0.680000 0.040000 0.200000 0.080000 0.800000 0.000000 0.200000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.040000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.000000 0.040000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.800000 0.040000 0.080000 0.080000 0.000000 0.600000 0.240000 0.160000 Consensus sequence: AAAGGTCAAAGGTCAAC Reserve complement motif 0.000000 0.240000 0.600000 0.160000 0.080000 0.040000 0.080000 0.800000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.040000 0.000000 0.000000 0.960000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.040000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.200000 0.800000 0.080000 0.040000 0.200000 0.680000 0.120000 0.200000 0.000000 0.680000 Consensus sequence: GTTGACCTTTGACCTTT ************************************************************************ Best Matches for Motif ID 10 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v015681_secondary Reverse Complement Reverse Complement Backward 1 17 0.053845 Species: Mus musculus Original motif 0.331499 0.188505 0.182841 0.297156 0.328961 0.213025 0.273530 0.184484 0.197213 0.129292 0.524914 0.148581 0.274491 0.226406 0.312118 0.186986 0.103231 0.393726 0.364988 0.138055 0.552594 0.166422 0.186262 0.094722 0.157618 0.064773 0.616497 0.161112 0.139166 0.176098 0.621185 0.063551 0.748420 0.062398 0.012447 0.176735 0.116584 0.009438 0.860326 0.013653 0.005030 0.003646 0.974877 0.016447 0.055257 0.007181 0.921760 0.015802 0.032748 0.058249 0.052709 0.856293 0.105606 0.872231 0.014370 0.007793 0.019480 0.497379 0.125899 0.357242 0.478582 0.269713 0.061464 0.190242 0.253985 0.287006 0.201320 0.257689 0.319384 0.210231 0.175842 0.294543 0.222123 0.287802 0.201294 0.288782 0.139951 0.376041 0.081133 0.402875 0.213450 0.343835 0.383676 0.059039 0.322294 0.355918 0.148062 0.173725 Consensus sequence: HVGVSAGGAGGGTCYHHHHYVH Reverse complement motif 0.322294 0.148062 0.355918 0.173725 0.213450 0.383676 0.343835 0.059039 0.402875 0.376041 0.081133 0.139951 0.288782 0.287802 0.201294 0.222123 0.294543 0.210231 0.175842 0.319384 0.253985 0.201320 0.287006 0.257689 0.190242 0.269713 0.061464 0.478582 0.019480 0.125899 0.497379 0.357242 0.105606 0.014370 0.872231 0.007793 0.856293 0.058249 0.052709 0.032748 0.055257 0.921760 0.007181 0.015802 0.005030 0.974877 0.003646 0.016447 0.116584 0.860326 0.009438 0.013653 0.176735 0.062398 0.012447 0.748420 0.139166 0.621185 0.176098 0.063551 0.157618 0.616497 0.064773 0.161112 0.094722 0.166422 0.186262 0.552594 0.103231 0.364988 0.393726 0.138055 0.274491 0.312118 0.226406 0.186986 0.197213 0.524914 0.129292 0.148581 0.184484 0.213025 0.273530 0.328961 0.297156 0.188505 0.182841 0.331499 Consensus sequence: DVMHHDHKGACCCTCCTSVCBH Alignment: DVMHHDHKGACCCTCCTSVCBH -----GTTGACCTTTGACCTTT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00032 Gata3_primary Original Motif Original Motif Backward 1 17 0.054510 Species: Mus musculus Original motif 0.151572 0.262753 0.258275 0.327401 0.221834 0.113385 0.275380 0.389400 0.297769 0.136928 0.134678 0.430625 0.270099 0.110415 0.271106 0.348380 0.265471 0.090253 0.223340 0.420936 0.616582 0.090091 0.171960 0.121367 0.197318 0.107541 0.406904 0.288237 0.798258 0.046950 0.001406 0.153385 0.003195 0.002516 0.989707 0.004582 0.991503 0.002748 0.002617 0.003132 0.005015 0.002764 0.003026 0.989195 0.948394 0.008932 0.001344 0.041330 0.973109 0.004100 0.004081 0.018710 0.040365 0.113905 0.828185 0.017545 0.736608 0.130524 0.113464 0.019404 0.415921 0.106101 0.316613 0.161365 0.376582 0.170927 0.155572 0.296919 0.137731 0.197151 0.211055 0.454064 0.324853 0.122747 0.246107 0.306293 0.462490 0.207311 0.159392 0.170807 0.380420 0.188972 0.311990 0.118618 0.222178 0.157873 0.380486 0.239463 Consensus sequence: BDHDDADAGATAAGADHBDHVD Reverse complement motif 0.222178 0.380486 0.157873 0.239463 0.118618 0.188972 0.311990 0.380420 0.170807 0.207311 0.159392 0.462490 0.306293 0.122747 0.246107 0.324853 0.454064 0.197151 0.211055 0.137731 0.296919 0.170927 0.155572 0.376582 0.161365 0.106101 0.316613 0.415921 0.019404 0.130524 0.113464 0.736608 0.040365 0.828185 0.113905 0.017545 0.018710 0.004100 0.004081 0.973109 0.041330 0.008932 0.001344 0.948394 0.989195 0.002764 0.003026 0.005015 0.003132 0.002748 0.002617 0.991503 0.003195 0.989707 0.002516 0.004582 0.153385 0.046950 0.001406 0.798258 0.197318 0.406904 0.107541 0.288237 0.121367 0.090091 0.171960 0.616582 0.420936 0.090253 0.223340 0.265471 0.348380 0.110415 0.271106 0.270099 0.430625 0.136928 0.134678 0.297769 0.389400 0.113385 0.275380 0.221834 0.327401 0.262753 0.258275 0.151572 Consensus sequence: HBHDVHDTCTTATCTHTDDHDV Alignment: BDHDDADAGATAAGADHBDHVD -----AAAGGTCAAAGGTCAAC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00067 Lef1_primary Original Motif Reverse Complement Forward 2 16 0.521114 Species: Mus musculus Original motif 0.281920 0.214207 0.278077 0.225796 0.325566 0.151435 0.298797 0.224202 0.290253 0.145824 0.243443 0.320480 0.069286 0.404645 0.141614 0.384454 0.070044 0.621448 0.142647 0.165862 0.007295 0.907657 0.038110 0.046938 0.015587 0.018273 0.000658 0.965482 0.005527 0.005886 0.001905 0.986682 0.024512 0.001189 0.001344 0.972955 0.007384 0.025221 0.952270 0.015125 0.966438 0.000630 0.002693 0.030239 0.082252 0.001173 0.001495 0.915080 0.030255 0.677155 0.275323 0.017267 0.199467 0.118815 0.056814 0.624905 0.345445 0.169597 0.216831 0.268127 0.278106 0.150864 0.173693 0.397336 0.251834 0.339733 0.219703 0.188730 Consensus sequence: DDDYCCTTTGATCTDDV Reverse complement motif 0.251834 0.219703 0.339733 0.188730 0.397336 0.150864 0.173693 0.278106 0.268127 0.169597 0.216831 0.345445 0.624905 0.118815 0.056814 0.199467 0.030255 0.275323 0.677155 0.017267 0.915080 0.001173 0.001495 0.082252 0.030239 0.000630 0.002693 0.966438 0.007384 0.952270 0.025221 0.015125 0.972955 0.001189 0.001344 0.024512 0.986682 0.005886 0.001905 0.005527 0.965482 0.018273 0.000658 0.015587 0.007295 0.038110 0.907657 0.046938 0.070044 0.142647 0.621448 0.165862 0.069286 0.141614 0.404645 0.384454 0.320480 0.145824 0.243443 0.290253 0.224202 0.151435 0.298797 0.325566 0.225796 0.214207 0.278077 0.281920 Consensus sequence: VDDAGATCAAAGGKDDD Alignment: VDDAGATCAAAGGKDDD- -AAAGGTCAAAGGTCAAC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00083 Tcf7l2_primary Reverse Complement Original Motif Backward 2 16 0.527825 Species: Mus musculus Original motif 0.285725 0.187143 0.254855 0.272277 0.276264 0.157893 0.258178 0.307665 0.238788 0.161120 0.254018 0.346074 0.076041 0.333901 0.150903 0.439156 0.093376 0.526578 0.180529 0.199517 0.010827 0.880320 0.034150 0.074703 0.016546 0.023834 0.000940 0.958680 0.007166 0.008215 0.001941 0.982678 0.029634 0.001363 0.001379 0.967625 0.010872 0.031751 0.926186 0.031190 0.949407 0.000760 0.002581 0.047253 0.109203 0.001362 0.002094 0.887341 0.044198 0.567994 0.353059 0.034749 0.222623 0.142360 0.041281 0.593736 0.358872 0.167597 0.220534 0.252997 0.233072 0.141480 0.230985 0.394463 0.350703 0.243129 0.233961 0.172207 Consensus sequence: DDDYCCTTTGATSTDDV Reverse complement motif 0.172207 0.243129 0.233961 0.350703 0.394463 0.141480 0.230985 0.233072 0.252997 0.167597 0.220534 0.358872 0.593736 0.142360 0.041281 0.222623 0.044198 0.353059 0.567994 0.034749 0.887341 0.001362 0.002094 0.109203 0.047253 0.000760 0.002581 0.949407 0.010872 0.926186 0.031751 0.031190 0.967625 0.001363 0.001379 0.029634 0.982678 0.008215 0.001941 0.007166 0.958680 0.023834 0.000940 0.016546 0.010827 0.034150 0.880320 0.074703 0.093376 0.180529 0.526578 0.199517 0.439156 0.333901 0.150903 0.076041 0.346074 0.161120 0.254018 0.238788 0.307665 0.157893 0.258178 0.276264 0.272277 0.187143 0.254855 0.285725 Consensus sequence: BDDASATCAAAGGMDDD Alignment: -DDDYCCTTTGATSTDDV GTTGACCTTTGACCTTT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00054 Tcf7_primary Original Motif Original Motif Forward 2 16 0.531154 Species: Mus musculus Original motif 0.170811 0.196976 0.220503 0.411710 0.337231 0.228482 0.140137 0.294150 0.299312 0.173780 0.143426 0.383481 0.603957 0.053557 0.128214 0.214271 0.036338 0.377925 0.534647 0.051091 0.725865 0.010314 0.008501 0.255320 0.067855 0.007849 0.004559 0.919737 0.049387 0.815496 0.098330 0.036787 0.960514 0.005036 0.005137 0.029313 0.960631 0.004550 0.018815 0.016004 0.935245 0.005169 0.023866 0.035720 0.159760 0.060340 0.761341 0.018559 0.228534 0.153897 0.523052 0.094517 0.557984 0.123512 0.254154 0.064350 0.490252 0.211976 0.124557 0.173215 0.310463 0.250279 0.132612 0.306646 0.332720 0.248937 0.120633 0.297711 Consensus sequence: BHHASATCAAAGGAHHH Reverse complement motif 0.297711 0.248937 0.120633 0.332720 0.306646 0.250279 0.132612 0.310463 0.173215 0.211976 0.124557 0.490252 0.064350 0.123512 0.254154 0.557984 0.228534 0.523052 0.153897 0.094517 0.159760 0.761341 0.060340 0.018559 0.035720 0.005169 0.023866 0.935245 0.016004 0.004550 0.018815 0.960631 0.029313 0.005036 0.005137 0.960514 0.049387 0.098330 0.815496 0.036787 0.919737 0.007849 0.004559 0.067855 0.255320 0.010314 0.008501 0.725865 0.036338 0.534647 0.377925 0.051091 0.214271 0.053557 0.128214 0.603957 0.383481 0.173780 0.143426 0.299312 0.294150 0.228482 0.140137 0.337231 0.411710 0.196976 0.220503 0.170811 Consensus sequence: HHHTCCTTTGATSTHHV Alignment: BHHASATCAAAGGAHHH- -AAAGGTCAAAGGTCAAC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00058 Tcf3_primary Original Motif Original Motif Backward 2 16 0.531876 Species: Mus musculus Original motif 0.185864 0.201179 0.183663 0.429294 0.371100 0.233868 0.122934 0.272098 0.249563 0.171285 0.128851 0.450301 0.582940 0.043382 0.129099 0.244578 0.041400 0.395349 0.497087 0.066163 0.759123 0.009670 0.005936 0.225270 0.056579 0.008662 0.003986 0.930772 0.043968 0.865783 0.056001 0.034249 0.962748 0.003731 0.003265 0.030256 0.971318 0.003542 0.012299 0.012841 0.937558 0.003991 0.020195 0.038256 0.125931 0.057976 0.798081 0.018012 0.209401 0.172342 0.483980 0.134277 0.485703 0.129227 0.309936 0.075134 0.397027 0.195902 0.152395 0.254676 0.311636 0.231510 0.157732 0.299122 0.320965 0.206031 0.164299 0.308705 Consensus sequence: HHHASATCAAAGVRHHH Reverse complement motif 0.308705 0.206031 0.164299 0.320965 0.299122 0.231510 0.157732 0.311636 0.254676 0.195902 0.152395 0.397027 0.075134 0.129227 0.309936 0.485703 0.209401 0.483980 0.172342 0.134277 0.125931 0.798081 0.057976 0.018012 0.038256 0.003991 0.020195 0.937558 0.012841 0.003542 0.012299 0.971318 0.030256 0.003731 0.003265 0.962748 0.043968 0.056001 0.865783 0.034249 0.930772 0.008662 0.003986 0.056579 0.225270 0.009670 0.005936 0.759123 0.041400 0.497087 0.395349 0.066163 0.244578 0.043382 0.129099 0.582940 0.450301 0.171285 0.128851 0.249563 0.272098 0.233868 0.122934 0.371100 0.429294 0.201179 0.183663 0.185864 Consensus sequence: HHHKVCTTTGATSTHHH Alignment: -HHHASATCAAAGVRHHH AAAGGTCAAAGGTCAAC- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00030 Sox11_primary Original Motif Original Motif Forward 2 16 0.544403 Species: Mus musculus Original motif 0.351812 0.238467 0.143954 0.265768 0.195246 0.235838 0.281473 0.287443 0.349478 0.172616 0.210739 0.267167 0.484061 0.110438 0.173131 0.232370 0.276692 0.070713 0.479604 0.172991 0.859124 0.044167 0.083951 0.012758 0.975608 0.002029 0.002285 0.020079 0.006422 0.978485 0.007124 0.007969 0.987489 0.003025 0.002868 0.006617 0.987739 0.005463 0.002730 0.004067 0.693013 0.004067 0.002445 0.300475 0.189100 0.003677 0.801408 0.005814 0.352090 0.072517 0.567737 0.007656 0.542316 0.176545 0.192768 0.088371 0.196382 0.304176 0.205985 0.293457 0.289415 0.201358 0.182937 0.326290 0.385801 0.216362 0.152363 0.245475 Consensus sequence: HBDDRAACAAAGRABHH Reverse complement motif 0.245475 0.216362 0.152363 0.385801 0.326290 0.201358 0.182937 0.289415 0.196382 0.205985 0.304176 0.293457 0.088371 0.176545 0.192768 0.542316 0.352090 0.567737 0.072517 0.007656 0.189100 0.801408 0.003677 0.005814 0.300475 0.004067 0.002445 0.693013 0.004067 0.005463 0.002730 0.987739 0.006617 0.003025 0.002868 0.987489 0.006422 0.007124 0.978485 0.007969 0.020079 0.002029 0.002285 0.975608 0.012758 0.044167 0.083951 0.859124 0.276692 0.479604 0.070713 0.172991 0.232370 0.110438 0.173131 0.484061 0.267167 0.172616 0.210739 0.349478 0.287443 0.235838 0.281473 0.195246 0.265768 0.238467 0.143954 0.351812 Consensus sequence: HHBTMCTTTGTTMDDVH Alignment: HBDDRAACAAAGRABHH- -AAAGGTCAAAGGTCAAC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00062 Sox4_primary Reverse Complement Reverse Complement Backward 2 16 0.544565 Species: Mus musculus Original motif 0.427843 0.231210 0.119424 0.221523 0.196506 0.239531 0.304906 0.259057 0.302488 0.156922 0.290190 0.250401 0.433872 0.149126 0.196496 0.220506 0.258426 0.076511 0.475100 0.189963 0.841714 0.046453 0.099915 0.011918 0.983853 0.001612 0.001362 0.013174 0.003460 0.982032 0.005728 0.008780 0.989743 0.002253 0.002020 0.005984 0.990761 0.003397 0.002843 0.003000 0.770864 0.003540 0.001549 0.224048 0.235342 0.002598 0.757383 0.004677 0.371426 0.089574 0.529959 0.009040 0.480804 0.196949 0.240413 0.081833 0.187158 0.355102 0.216599 0.241142 0.248006 0.232182 0.157452 0.362360 0.403367 0.177684 0.164649 0.254300 Consensus sequence: HBDDDAACAAAGRVBHH Reverse complement motif 0.254300 0.177684 0.164649 0.403367 0.362360 0.232182 0.157452 0.248006 0.187158 0.216599 0.355102 0.241142 0.081833 0.196949 0.240413 0.480804 0.371426 0.529959 0.089574 0.009040 0.235342 0.757383 0.002598 0.004677 0.224048 0.003540 0.001549 0.770864 0.003000 0.003397 0.002843 0.990761 0.005984 0.002253 0.002020 0.989743 0.003460 0.005728 0.982032 0.008780 0.013174 0.001612 0.001362 0.983853 0.011918 0.046453 0.099915 0.841714 0.258426 0.475100 0.076511 0.189963 0.220506 0.149126 0.196496 0.433872 0.250401 0.156922 0.290190 0.302488 0.196506 0.304906 0.239531 0.259057 0.221523 0.231210 0.119424 0.427843 Consensus sequence: HHBBMCTTTGTTHDDBH Alignment: -HHBBMCTTTGTTHDDBH GTTGACCTTTGACCTTT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00019 Zbtb12_primary Reverse Complement Reverse Complement Backward 2 16 0.550511 Species: Mus musculus Original motif 0.163348 0.349811 0.273573 0.213268 0.212612 0.211975 0.220400 0.355012 0.325879 0.220972 0.186720 0.266430 0.510632 0.041115 0.419323 0.028930 0.067550 0.203499 0.411224 0.317727 0.023546 0.002038 0.972278 0.002138 0.017818 0.006841 0.006478 0.968864 0.019791 0.001443 0.009338 0.969428 0.003084 0.992130 0.002654 0.002131 0.001031 0.039768 0.003588 0.955613 0.980811 0.006260 0.008964 0.003965 0.013624 0.002796 0.979716 0.003863 0.841198 0.016422 0.129217 0.013163 0.169265 0.145424 0.085753 0.599558 0.068235 0.584950 0.065758 0.281057 0.378189 0.252218 0.209355 0.160238 0.167389 0.305726 0.229730 0.297156 Consensus sequence: BDHRBGTTCTAGATCVB Reverse complement motif 0.167389 0.229730 0.305726 0.297156 0.160238 0.252218 0.209355 0.378189 0.068235 0.065758 0.584950 0.281057 0.599558 0.145424 0.085753 0.169265 0.013163 0.016422 0.129217 0.841198 0.013624 0.979716 0.002796 0.003863 0.003965 0.006260 0.008964 0.980811 0.955613 0.039768 0.003588 0.001031 0.003084 0.002654 0.992130 0.002131 0.969428 0.001443 0.009338 0.019791 0.968864 0.006841 0.006478 0.017818 0.023546 0.972278 0.002038 0.002138 0.067550 0.411224 0.203499 0.317727 0.028930 0.041115 0.419323 0.510632 0.266430 0.220972 0.186720 0.325879 0.355012 0.211975 0.220400 0.212612 0.163348 0.273573 0.349811 0.213268 Consensus sequence: BBGATCTAGAACBKHDB Alignment: -BBGATCTAGAACBKHDB GTTGACCTTTGACCTTT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00046 Tcfe2a_secondary Original Motif Original Motif Backward 2 16 0.552064 Species: Mus musculus Original motif 0.296417 0.247522 0.206749 0.249312 0.410113 0.201959 0.303149 0.084779 0.267313 0.132645 0.452057 0.147985 0.187929 0.136827 0.427628 0.247616 0.198671 0.425254 0.234160 0.141915 0.029244 0.953929 0.004092 0.012734 0.954570 0.014314 0.018695 0.012421 0.010025 0.055055 0.845504 0.089415 0.874802 0.040849 0.069178 0.015172 0.015084 0.010551 0.008736 0.965628 0.012981 0.007192 0.965036 0.014791 0.037724 0.016891 0.495632 0.449753 0.021685 0.438927 0.056118 0.483270 0.209872 0.365671 0.139706 0.284751 0.151815 0.336912 0.289382 0.221891 0.152995 0.262354 0.416434 0.168217 0.227567 0.187603 0.447892 0.136938 Consensus sequence: HVDDVCAGATGKYHBBV Reverse complement motif 0.227567 0.447892 0.187603 0.136938 0.152995 0.416434 0.262354 0.168217 0.151815 0.289382 0.336912 0.221891 0.209872 0.139706 0.365671 0.284751 0.483270 0.438927 0.056118 0.021685 0.037724 0.495632 0.016891 0.449753 0.012981 0.965036 0.007192 0.014791 0.965628 0.010551 0.008736 0.015084 0.015172 0.040849 0.069178 0.874802 0.010025 0.845504 0.055055 0.089415 0.012421 0.014314 0.018695 0.954570 0.029244 0.004092 0.953929 0.012734 0.198671 0.234160 0.425254 0.141915 0.187929 0.427628 0.136827 0.247616 0.267313 0.452057 0.132645 0.147985 0.084779 0.201959 0.303149 0.410113 0.249312 0.247522 0.206749 0.296417 Consensus sequence: VBBDMYCATCTGVHHBH Alignment: -HVDDVCAGATGKYHBBV AAAGGTCAAAGGTCAAC- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 11 Motif name: NR4A2 Original motif 0.615385 0.076923 0.230769 0.076923 0.928571 0.000000 0.071429 0.000000 0.000000 0.000000 0.928571 0.071429 0.214286 0.000000 0.785714 0.000000 0.142857 0.142857 0.000000 0.714286 0.000000 0.928571 0.000000 0.071429 1.000000 0.000000 0.000000 0.000000 0.230769 0.615385 0.153846 0.000000 Consensus sequence: AAGGTCAC Reserve complement motif 0.230769 0.153846 0.615385 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.928571 0.071429 0.714286 0.142857 0.000000 0.142857 0.214286 0.785714 0.000000 0.000000 0.000000 0.928571 0.000000 0.071429 0.000000 0.000000 0.071429 0.928571 0.076923 0.076923 0.230769 0.615385 Consensus sequence: GTGACCTT ************************************************************************ Best Matches for Motif ID 11 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00048 Rara Reverse Complement Reverse Complement Forward 4 8 0.000000 Species: Mus musculus Original motif 0.222478 0.177331 0.266395 0.333797 0.276222 0.360097 0.118354 0.245327 0.106047 0.268455 0.234217 0.391281 0.244163 0.407141 0.146864 0.201832 0.852083 0.050643 0.039941 0.057332 0.814108 0.012894 0.165984 0.007015 0.905198 0.005648 0.088378 0.000776 0.002783 0.000555 0.988205 0.008457 0.001289 0.000626 0.898209 0.099877 0.002878 0.001631 0.008910 0.986582 0.000499 0.975550 0.005264 0.018687 0.963627 0.000883 0.034432 0.001058 0.181490 0.517766 0.077094 0.223650 0.183789 0.384790 0.308350 0.123071 0.229801 0.228801 0.224468 0.316930 0.218244 0.170273 0.366746 0.244736 Consensus sequence: DHBHAAAGGTCACVHD Reverse complement motif 0.218244 0.366746 0.170273 0.244736 0.316930 0.228801 0.224468 0.229801 0.183789 0.308350 0.384790 0.123071 0.181490 0.077094 0.517766 0.223650 0.001058 0.000883 0.034432 0.963627 0.000499 0.005264 0.975550 0.018687 0.986582 0.001631 0.008910 0.002878 0.001289 0.898209 0.000626 0.099877 0.002783 0.988205 0.000555 0.008457 0.000776 0.005648 0.088378 0.905198 0.007015 0.012894 0.165984 0.814108 0.057332 0.050643 0.039941 0.852083 0.244163 0.146864 0.407141 0.201832 0.391281 0.268455 0.234217 0.106047 0.276222 0.118354 0.360097 0.245327 0.333797 0.177331 0.266395 0.222478 Consensus sequence: HHVGTGACCTTTDVDD Alignment: HHVGTGACCTTTDVDD ---GTGACCTT----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00009 Nr2f2_primary Original Motif Original Motif Backward 4 8 0.007453 Species: Mus musculus Original motif 0.253408 0.181904 0.273186 0.291502 0.262827 0.381870 0.153734 0.201569 0.143383 0.243233 0.242562 0.370823 0.247498 0.336892 0.176114 0.239496 0.856654 0.037068 0.049492 0.056786 0.797369 0.012935 0.176463 0.013233 0.808222 0.001309 0.189796 0.000674 0.002583 0.000536 0.989167 0.007714 0.002421 0.000283 0.972777 0.024519 0.000270 0.003650 0.019038 0.977041 0.000184 0.956654 0.005329 0.037833 0.925587 0.000706 0.072434 0.001273 0.307028 0.327297 0.079126 0.286549 0.238576 0.245847 0.384025 0.131552 0.281599 0.234987 0.226211 0.257204 0.211511 0.212695 0.363980 0.211815 Consensus sequence: DHBHAAAGGTCAHVHB Reverse complement motif 0.211511 0.363980 0.212695 0.211815 0.257204 0.234987 0.226211 0.281599 0.238576 0.384025 0.245847 0.131552 0.307028 0.079126 0.327297 0.286549 0.001273 0.000706 0.072434 0.925587 0.000184 0.005329 0.956654 0.037833 0.977041 0.003650 0.019038 0.000270 0.002421 0.972777 0.000283 0.024519 0.002583 0.989167 0.000536 0.007714 0.000674 0.001309 0.189796 0.808222 0.013233 0.012935 0.176463 0.797369 0.056786 0.037068 0.049492 0.856654 0.247498 0.176114 0.336892 0.239496 0.370823 0.243233 0.242562 0.143383 0.262827 0.153734 0.381870 0.201569 0.291502 0.181904 0.273186 0.253408 Consensus sequence: BHVDTGACCTTTDVDD Alignment: DHBHAAAGGTCAHVHB -----AAGGTCAC--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00079 Esrra_primary Original Motif Original Motif Forward 6 8 0.015420 Species: Mus musculus Original motif 0.212524 0.177958 0.293723 0.315796 0.420838 0.283140 0.144938 0.151084 0.198119 0.196347 0.260353 0.345181 0.117752 0.282184 0.137207 0.462857 0.070125 0.781439 0.138093 0.010344 0.965989 0.000956 0.023828 0.009227 0.977263 0.003066 0.019255 0.000416 0.007404 0.000267 0.938934 0.053395 0.007147 0.000287 0.983377 0.009190 0.039608 0.000730 0.040682 0.918981 0.000685 0.905345 0.021930 0.072040 0.800961 0.001126 0.195791 0.002121 0.245039 0.241263 0.038084 0.475614 0.265397 0.238316 0.304963 0.191325 0.203742 0.286208 0.231002 0.279048 0.194132 0.188854 0.346693 0.270322 0.310711 0.263840 0.184317 0.241132 Consensus sequence: DHDBCAAGGTCAHVBDH Reverse complement motif 0.241132 0.263840 0.184317 0.310711 0.194132 0.346693 0.188854 0.270322 0.203742 0.231002 0.286208 0.279048 0.265397 0.304963 0.238316 0.191325 0.475614 0.241263 0.038084 0.245039 0.002121 0.001126 0.195791 0.800961 0.000685 0.021930 0.905345 0.072040 0.918981 0.000730 0.040682 0.039608 0.007147 0.983377 0.000287 0.009190 0.007404 0.938934 0.000267 0.053395 0.000416 0.003066 0.019255 0.977263 0.009227 0.000956 0.023828 0.965989 0.070125 0.138093 0.781439 0.010344 0.462857 0.282184 0.137207 0.117752 0.345181 0.196347 0.260353 0.198119 0.151084 0.283140 0.144938 0.420838 0.315796 0.177958 0.293723 0.212524 Consensus sequence: HHBVHTGACCTTGVDHD Alignment: DHDBCAAGGTCAHVBDH -----AAGGTCAC---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00009 Nr2f2_secondary Original Motif Original Motif Forward 6 8 0.039564 Species: Mus musculus Original motif 0.195749 0.435700 0.196915 0.171636 0.131070 0.131912 0.417834 0.319184 0.238959 0.441529 0.174973 0.144539 0.187749 0.189727 0.405849 0.216675 0.006751 0.541370 0.182092 0.269787 0.005388 0.590608 0.339869 0.064135 0.088153 0.004666 0.902351 0.004830 0.002459 0.004278 0.982637 0.010626 0.003618 0.002504 0.985275 0.008602 0.003325 0.004017 0.009244 0.983414 0.002547 0.972864 0.005345 0.019244 0.940260 0.002927 0.053632 0.003181 0.222459 0.390569 0.251497 0.135475 0.151824 0.258444 0.332866 0.256865 0.175811 0.290583 0.232086 0.301520 0.356690 0.198973 0.136050 0.308287 Consensus sequence: VBVBCSGGGTCAVBBH Reverse complement motif 0.308287 0.198973 0.136050 0.356690 0.301520 0.290583 0.232086 0.175811 0.151824 0.332866 0.258444 0.256865 0.222459 0.251497 0.390569 0.135475 0.003181 0.002927 0.053632 0.940260 0.002547 0.005345 0.972864 0.019244 0.983414 0.004017 0.009244 0.003325 0.003618 0.985275 0.002504 0.008602 0.002459 0.982637 0.004278 0.010626 0.088153 0.902351 0.004666 0.004830 0.005388 0.339869 0.590608 0.064135 0.006751 0.182092 0.541370 0.269787 0.187749 0.405849 0.189727 0.216675 0.238959 0.174973 0.441529 0.144539 0.131070 0.417834 0.131912 0.319184 0.195749 0.196915 0.435700 0.171636 Consensus sequence: HVBVTGACCCSGBVBV Alignment: VBVBCSGGGTCAVBBH -----AAGGTCAC--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00082 Zfp187_secondary Reverse Complement Original Motif Forward 1 8 0.040787 Species: Mus musculus Original motif 0.173063 0.169680 0.440836 0.216421 0.353277 0.179996 0.249403 0.217325 0.307337 0.038055 0.616380 0.038228 0.316636 0.564670 0.023732 0.094962 0.015484 0.923764 0.019439 0.041313 0.011243 0.956300 0.009443 0.023014 0.062273 0.107531 0.010739 0.819456 0.126670 0.201521 0.192005 0.479803 0.093090 0.045924 0.835792 0.025194 0.020165 0.015483 0.009567 0.954786 0.010873 0.672448 0.004559 0.312121 0.018002 0.846860 0.017605 0.117533 0.335703 0.408170 0.104095 0.152031 0.150308 0.362296 0.067408 0.419988 0.286490 0.242211 0.176532 0.294767 0.265022 0.249655 0.272219 0.213104 Consensus sequence: DDGMCCTBGTCCHYHV Reverse complement motif 0.265022 0.272219 0.249655 0.213104 0.294767 0.242211 0.176532 0.286490 0.419988 0.362296 0.067408 0.150308 0.335703 0.104095 0.408170 0.152031 0.018002 0.017605 0.846860 0.117533 0.010873 0.004559 0.672448 0.312121 0.954786 0.015483 0.009567 0.020165 0.093090 0.835792 0.045924 0.025194 0.479803 0.201521 0.192005 0.126670 0.819456 0.107531 0.010739 0.062273 0.011243 0.009443 0.956300 0.023014 0.015484 0.019439 0.923764 0.041313 0.316636 0.023732 0.564670 0.094962 0.307337 0.616380 0.038055 0.038228 0.217325 0.179996 0.249403 0.353277 0.173063 0.440836 0.169680 0.216421 Consensus sequence: VHMDGGACVAGGRCDH Alignment: DDGMCCTBGTCCHYHV GTGACCTT-------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00053 Rxra_primary Reverse Complement Original Motif Forward 5 8 0.042293 Species: Mus musculus Original motif 0.235299 0.222264 0.237416 0.305021 0.144778 0.278902 0.341673 0.234648 0.261127 0.261904 0.191591 0.285378 0.119943 0.410774 0.218940 0.250343 0.222672 0.075554 0.365253 0.336521 0.001838 0.046904 0.002828 0.948430 0.030410 0.006359 0.960821 0.002410 0.987391 0.007562 0.002810 0.002237 0.105188 0.888650 0.001163 0.004998 0.006475 0.987074 0.001793 0.004659 0.001816 0.765138 0.003092 0.229953 0.010354 0.846496 0.029899 0.113251 0.328732 0.039382 0.265510 0.366377 0.209638 0.262628 0.145613 0.382121 0.385390 0.177695 0.299828 0.137087 0.403452 0.268924 0.096028 0.231595 0.203082 0.231812 0.213520 0.351585 Consensus sequence: DBHBDTGACCCCDHVHB Reverse complement motif 0.351585 0.231812 0.213520 0.203082 0.231595 0.268924 0.096028 0.403452 0.137087 0.177695 0.299828 0.385390 0.382121 0.262628 0.145613 0.209638 0.366377 0.039382 0.265510 0.328732 0.010354 0.029899 0.846496 0.113251 0.001816 0.003092 0.765138 0.229953 0.006475 0.001793 0.987074 0.004659 0.105188 0.001163 0.888650 0.004998 0.002237 0.007562 0.002810 0.987391 0.030410 0.960821 0.006359 0.002410 0.948430 0.046904 0.002828 0.001838 0.222672 0.365253 0.075554 0.336521 0.119943 0.218940 0.410774 0.250343 0.285378 0.261904 0.191591 0.261127 0.144778 0.341673 0.278902 0.234648 0.305021 0.222264 0.237416 0.235299 Consensus sequence: VHBHDGGGGTCAHBHBD Alignment: DBHBDTGACCCCDHVHB ----GTGACCTT----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00079 Esrra_secondary Original Motif Original Motif Backward 5 8 0.044744 Species: Mus musculus Original motif 0.252126 0.268706 0.351590 0.127578 0.158171 0.083434 0.389646 0.368749 0.180010 0.290882 0.279192 0.249916 0.206905 0.249360 0.275438 0.268296 0.756588 0.046202 0.023921 0.173289 0.018262 0.022596 0.949143 0.010000 0.206468 0.046491 0.745475 0.001566 0.005511 0.001141 0.983152 0.010196 0.004791 0.001893 0.985951 0.007365 0.027643 0.001133 0.008565 0.962659 0.002459 0.970934 0.007826 0.018780 0.924387 0.003164 0.071225 0.001224 0.419387 0.230189 0.111588 0.238836 0.290954 0.163823 0.341233 0.203991 0.196768 0.281307 0.313868 0.208056 0.128428 0.260428 0.378607 0.232537 0.269305 0.378895 0.123480 0.228320 Consensus sequence: VKBBAGGGGTCAHDBBH Reverse complement motif 0.269305 0.123480 0.378895 0.228320 0.128428 0.378607 0.260428 0.232537 0.196768 0.313868 0.281307 0.208056 0.290954 0.341233 0.163823 0.203991 0.238836 0.230189 0.111588 0.419387 0.001224 0.003164 0.071225 0.924387 0.002459 0.007826 0.970934 0.018780 0.962659 0.001133 0.008565 0.027643 0.004791 0.985951 0.001893 0.007365 0.005511 0.983152 0.001141 0.010196 0.206468 0.745475 0.046491 0.001566 0.018262 0.949143 0.022596 0.010000 0.173289 0.046202 0.023921 0.756588 0.206905 0.275438 0.249360 0.268296 0.180010 0.279192 0.290882 0.249916 0.158171 0.389646 0.083434 0.368749 0.252126 0.351590 0.268706 0.127578 Consensus sequence: DBBHHTGACCCCTBBYV Alignment: VKBBAGGGGTCAHDBBH -----AAGGTCAC---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00066 Hnf4a_secondary Original Motif Original Motif Forward 6 8 0.048142 Species: Mus musculus Original motif 0.131680 0.169949 0.346277 0.352094 0.109910 0.144258 0.373681 0.372151 0.196671 0.411335 0.159689 0.232305 0.311086 0.307077 0.122332 0.259505 0.895155 0.013238 0.038874 0.052733 0.779629 0.018399 0.171269 0.030703 0.950546 0.002649 0.041825 0.004980 0.004769 0.002646 0.985847 0.006739 0.004458 0.002117 0.012011 0.981414 0.016789 0.969626 0.003890 0.009695 0.002468 0.982852 0.004754 0.009926 0.891448 0.003193 0.097548 0.007811 0.513330 0.308971 0.070467 0.107232 0.179371 0.115514 0.130898 0.574217 0.285826 0.277536 0.166982 0.269655 0.319407 0.227783 0.129020 0.323790 Consensus sequence: BBHHAAAGTCCAMTHH Reverse complement motif 0.323790 0.227783 0.129020 0.319407 0.269655 0.277536 0.166982 0.285826 0.574217 0.115514 0.130898 0.179371 0.107232 0.308971 0.070467 0.513330 0.007811 0.003193 0.097548 0.891448 0.002468 0.004754 0.982852 0.009926 0.016789 0.003890 0.969626 0.009695 0.981414 0.002117 0.012011 0.004458 0.004769 0.985847 0.002646 0.006739 0.004980 0.002649 0.041825 0.950546 0.030703 0.018399 0.171269 0.779629 0.052733 0.013238 0.038874 0.895155 0.259505 0.307077 0.122332 0.311086 0.196671 0.159689 0.411335 0.232305 0.109910 0.373681 0.144258 0.372151 0.352094 0.169949 0.346277 0.131680 Consensus sequence: HHAYTGGACTTTHDBV Alignment: BBHHAAAGTCCAMTHH -----AAGGTCAC--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00197 Hoxc9 Reverse Complement Reverse Complement Forward 8 8 0.049768 Species: Mus musculus Original motif 0.279588 0.205946 0.337877 0.176588 0.212819 0.121136 0.376165 0.289881 0.371836 0.224291 0.240111 0.163762 0.200999 0.056254 0.589311 0.153436 0.141203 0.048864 0.796449 0.013484 0.026376 0.197045 0.009146 0.767433 0.286968 0.688278 0.011985 0.012769 0.890619 0.006181 0.098071 0.005129 0.019680 0.011114 0.002539 0.966668 0.287238 0.007432 0.002166 0.703164 0.975510 0.006204 0.005667 0.012620 0.949137 0.017111 0.006224 0.027528 0.241729 0.296577 0.052768 0.408926 0.212400 0.269675 0.090007 0.427918 0.333376 0.091783 0.259582 0.315259 0.182024 0.203528 0.245531 0.368917 Consensus sequence: VDVGGTCATTAAHHDB Reverse complement motif 0.368917 0.203528 0.245531 0.182024 0.315259 0.091783 0.259582 0.333376 0.427918 0.269675 0.090007 0.212400 0.408926 0.296577 0.052768 0.241729 0.027528 0.017111 0.006224 0.949137 0.012620 0.006204 0.005667 0.975510 0.703164 0.007432 0.002166 0.287238 0.966668 0.011114 0.002539 0.019680 0.005129 0.006181 0.098071 0.890619 0.286968 0.011985 0.688278 0.012769 0.767433 0.197045 0.009146 0.026376 0.141203 0.796449 0.048864 0.013484 0.200999 0.589311 0.056254 0.153436 0.163762 0.224291 0.240111 0.371836 0.212819 0.376165 0.121136 0.289881 0.279588 0.337877 0.205946 0.176588 Consensus sequence: VDHHTTAATGACCBHV Alignment: VDHHTTAATGACCBHV -------GTGACCTT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00035 Hic1_secondary Reverse Complement Original Motif Forward 5 8 0.050006 Species: Mus musculus Original motif 0.204898 0.149951 0.363373 0.281778 0.112946 0.243700 0.437938 0.205417 0.205232 0.182319 0.383143 0.229305 0.242063 0.152491 0.296426 0.309020 0.312922 0.028523 0.585026 0.073529 0.006754 0.011178 0.005346 0.976723 0.127589 0.005562 0.859436 0.007414 0.010046 0.974694 0.007001 0.008259 0.010262 0.974769 0.006069 0.008899 0.015122 0.966101 0.007970 0.010807 0.556511 0.167389 0.114635 0.161465 0.586459 0.044786 0.073450 0.295305 0.297710 0.194666 0.223655 0.283969 0.303202 0.250809 0.206475 0.239514 0.279338 0.160655 0.314457 0.245550 0.266477 0.266890 0.299970 0.166662 Consensus sequence: DBDDRTGCCCAWDHDV Reverse complement motif 0.266477 0.299970 0.266890 0.166662 0.279338 0.314457 0.160655 0.245550 0.239514 0.250809 0.206475 0.303202 0.283969 0.194666 0.223655 0.297710 0.295305 0.044786 0.073450 0.586459 0.161465 0.167389 0.114635 0.556511 0.015122 0.007970 0.966101 0.010807 0.010262 0.006069 0.974769 0.008899 0.010046 0.007001 0.974694 0.008259 0.127589 0.859436 0.005562 0.007414 0.976723 0.011178 0.005346 0.006754 0.312922 0.585026 0.028523 0.073529 0.309020 0.152491 0.296426 0.242063 0.205232 0.383143 0.182319 0.229305 0.112946 0.437938 0.243700 0.205417 0.204898 0.363373 0.149951 0.281778 Consensus sequence: VHHDWTGGGCAMDHBH Alignment: DBDDRTGCCCAWDHDV ----GTGACCTT---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 12 Motif name: RORA_1 Original motif 0.600000 0.040000 0.080000 0.280000 0.360000 0.040000 0.000000 0.600000 0.240000 0.480000 0.160000 0.120000 0.440000 0.080000 0.200000 0.280000 0.840000 0.000000 0.160000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 Consensus sequence: AWVDAGGTCA Reserve complement motif 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.160000 0.840000 0.280000 0.080000 0.200000 0.440000 0.240000 0.160000 0.480000 0.120000 0.600000 0.040000 0.000000 0.360000 0.280000 0.040000 0.080000 0.600000 Consensus sequence: TGACCTDVWT ************************************************************************ Best Matches for Motif ID 12 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00009 Nr2f2_primary Original Motif Original Motif Backward 5 10 0.015475 Species: Mus musculus Original motif 0.253408 0.181904 0.273186 0.291502 0.262827 0.381870 0.153734 0.201569 0.143383 0.243233 0.242562 0.370823 0.247498 0.336892 0.176114 0.239496 0.856654 0.037068 0.049492 0.056786 0.797369 0.012935 0.176463 0.013233 0.808222 0.001309 0.189796 0.000674 0.002583 0.000536 0.989167 0.007714 0.002421 0.000283 0.972777 0.024519 0.000270 0.003650 0.019038 0.977041 0.000184 0.956654 0.005329 0.037833 0.925587 0.000706 0.072434 0.001273 0.307028 0.327297 0.079126 0.286549 0.238576 0.245847 0.384025 0.131552 0.281599 0.234987 0.226211 0.257204 0.211511 0.212695 0.363980 0.211815 Consensus sequence: DHBHAAAGGTCAHVHB Reverse complement motif 0.211511 0.363980 0.212695 0.211815 0.257204 0.234987 0.226211 0.281599 0.238576 0.384025 0.245847 0.131552 0.307028 0.079126 0.327297 0.286549 0.001273 0.000706 0.072434 0.925587 0.000184 0.005329 0.956654 0.037833 0.977041 0.003650 0.019038 0.000270 0.002421 0.972777 0.000283 0.024519 0.002583 0.989167 0.000536 0.007714 0.000674 0.001309 0.189796 0.808222 0.013233 0.012935 0.176463 0.797369 0.056786 0.037068 0.049492 0.856654 0.247498 0.176114 0.336892 0.239496 0.370823 0.243233 0.242562 0.143383 0.262827 0.153734 0.381870 0.201569 0.291502 0.181904 0.273186 0.253408 Consensus sequence: BHVDTGACCTTTDVDD Alignment: DHBHAAAGGTCAHVHB --AWVDAGGTCA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00079 Esrra_primary Reverse Complement Reverse Complement Forward 6 10 0.017666 Species: Mus musculus Original motif 0.212524 0.177958 0.293723 0.315796 0.420838 0.283140 0.144938 0.151084 0.198119 0.196347 0.260353 0.345181 0.117752 0.282184 0.137207 0.462857 0.070125 0.781439 0.138093 0.010344 0.965989 0.000956 0.023828 0.009227 0.977263 0.003066 0.019255 0.000416 0.007404 0.000267 0.938934 0.053395 0.007147 0.000287 0.983377 0.009190 0.039608 0.000730 0.040682 0.918981 0.000685 0.905345 0.021930 0.072040 0.800961 0.001126 0.195791 0.002121 0.245039 0.241263 0.038084 0.475614 0.265397 0.238316 0.304963 0.191325 0.203742 0.286208 0.231002 0.279048 0.194132 0.188854 0.346693 0.270322 0.310711 0.263840 0.184317 0.241132 Consensus sequence: DHDBCAAGGTCAHVBDH Reverse complement motif 0.241132 0.263840 0.184317 0.310711 0.194132 0.346693 0.188854 0.270322 0.203742 0.231002 0.286208 0.279048 0.265397 0.304963 0.238316 0.191325 0.475614 0.241263 0.038084 0.245039 0.002121 0.001126 0.195791 0.800961 0.000685 0.021930 0.905345 0.072040 0.918981 0.000730 0.040682 0.039608 0.007147 0.983377 0.000287 0.009190 0.007404 0.938934 0.000267 0.053395 0.000416 0.003066 0.019255 0.977263 0.009227 0.000956 0.023828 0.965989 0.070125 0.138093 0.781439 0.010344 0.462857 0.282184 0.137207 0.117752 0.345181 0.196347 0.260353 0.198119 0.151084 0.283140 0.144938 0.420838 0.315796 0.177958 0.293723 0.212524 Consensus sequence: HHBVHTGACCTTGVDHD Alignment: HHBVHTGACCTTGVDHD -----TGACCTDVWT-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00048 Rara Original Motif Original Motif Forward 3 10 0.018960 Species: Mus musculus Original motif 0.222478 0.177331 0.266395 0.333797 0.276222 0.360097 0.118354 0.245327 0.106047 0.268455 0.234217 0.391281 0.244163 0.407141 0.146864 0.201832 0.852083 0.050643 0.039941 0.057332 0.814108 0.012894 0.165984 0.007015 0.905198 0.005648 0.088378 0.000776 0.002783 0.000555 0.988205 0.008457 0.001289 0.000626 0.898209 0.099877 0.002878 0.001631 0.008910 0.986582 0.000499 0.975550 0.005264 0.018687 0.963627 0.000883 0.034432 0.001058 0.181490 0.517766 0.077094 0.223650 0.183789 0.384790 0.308350 0.123071 0.229801 0.228801 0.224468 0.316930 0.218244 0.170273 0.366746 0.244736 Consensus sequence: DHBHAAAGGTCACVHD Reverse complement motif 0.218244 0.366746 0.170273 0.244736 0.316930 0.228801 0.224468 0.229801 0.183789 0.308350 0.384790 0.123071 0.181490 0.077094 0.517766 0.223650 0.001058 0.000883 0.034432 0.963627 0.000499 0.005264 0.975550 0.018687 0.986582 0.001631 0.008910 0.002878 0.001289 0.898209 0.000626 0.099877 0.002783 0.988205 0.000555 0.008457 0.000776 0.005648 0.088378 0.905198 0.007015 0.012894 0.165984 0.814108 0.057332 0.050643 0.039941 0.852083 0.244163 0.146864 0.407141 0.201832 0.391281 0.268455 0.234217 0.106047 0.276222 0.118354 0.360097 0.245327 0.333797 0.177331 0.266395 0.222478 Consensus sequence: HHVGTGACCTTTDVDD Alignment: DHBHAAAGGTCACVHD --AWVDAGGTCA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00009 Nr2f2_secondary Original Motif Original Motif Backward 5 10 0.033200 Species: Mus musculus Original motif 0.195749 0.435700 0.196915 0.171636 0.131070 0.131912 0.417834 0.319184 0.238959 0.441529 0.174973 0.144539 0.187749 0.189727 0.405849 0.216675 0.006751 0.541370 0.182092 0.269787 0.005388 0.590608 0.339869 0.064135 0.088153 0.004666 0.902351 0.004830 0.002459 0.004278 0.982637 0.010626 0.003618 0.002504 0.985275 0.008602 0.003325 0.004017 0.009244 0.983414 0.002547 0.972864 0.005345 0.019244 0.940260 0.002927 0.053632 0.003181 0.222459 0.390569 0.251497 0.135475 0.151824 0.258444 0.332866 0.256865 0.175811 0.290583 0.232086 0.301520 0.356690 0.198973 0.136050 0.308287 Consensus sequence: VBVBCSGGGTCAVBBH Reverse complement motif 0.308287 0.198973 0.136050 0.356690 0.301520 0.290583 0.232086 0.175811 0.151824 0.332866 0.258444 0.256865 0.222459 0.251497 0.390569 0.135475 0.003181 0.002927 0.053632 0.940260 0.002547 0.005345 0.972864 0.019244 0.983414 0.004017 0.009244 0.003325 0.003618 0.985275 0.002504 0.008602 0.002459 0.982637 0.004278 0.010626 0.088153 0.902351 0.004666 0.004830 0.005388 0.339869 0.590608 0.064135 0.006751 0.182092 0.541370 0.269787 0.187749 0.405849 0.189727 0.216675 0.238959 0.174973 0.441529 0.144539 0.131070 0.417834 0.131912 0.319184 0.195749 0.196915 0.435700 0.171636 Consensus sequence: HVBVTGACCCSGBVBV Alignment: VBVBCSGGGTCAVBBH --AWVDAGGTCA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00066 Hnf4a_primary Original Motif Original Motif Forward 3 10 0.034177 Species: Mus musculus Original motif 0.223704 0.280688 0.251889 0.243719 0.198683 0.190981 0.267970 0.342366 0.150012 0.319579 0.206063 0.324347 0.274896 0.302572 0.238597 0.183935 0.438853 0.331148 0.021186 0.208812 0.133937 0.027342 0.832490 0.006231 0.141462 0.002336 0.854359 0.001843 0.003464 0.000753 0.987433 0.008349 0.004388 0.000692 0.884494 0.110426 0.003808 0.001605 0.016793 0.977794 0.001992 0.976605 0.003739 0.017664 0.881237 0.089981 0.026017 0.002764 0.735041 0.106592 0.083260 0.075107 0.164419 0.315518 0.181031 0.339032 0.228285 0.176364 0.157583 0.437768 0.233407 0.193567 0.327076 0.245951 0.320479 0.312566 0.195701 0.171254 Consensus sequence: BDBVMGGGGTCAABHDV Reverse complement motif 0.171254 0.312566 0.195701 0.320479 0.233407 0.327076 0.193567 0.245951 0.437768 0.176364 0.157583 0.228285 0.339032 0.315518 0.181031 0.164419 0.075107 0.106592 0.083260 0.735041 0.002764 0.089981 0.026017 0.881237 0.001992 0.003739 0.976605 0.017664 0.977794 0.001605 0.016793 0.003808 0.004388 0.884494 0.000692 0.110426 0.003464 0.987433 0.000753 0.008349 0.141462 0.854359 0.002336 0.001843 0.133937 0.832490 0.027342 0.006231 0.208812 0.331148 0.021186 0.438853 0.274896 0.238597 0.302572 0.183935 0.324347 0.319579 0.206063 0.150012 0.342366 0.190981 0.267970 0.198683 0.223704 0.251889 0.280688 0.243719 Consensus sequence: BHHVTTGACCCCYVVDB Alignment: BDBVMGGGGTCAABHDV --AWVDAGGTCA----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00053 Rxra_primary Reverse Complement Original Motif Forward 6 10 0.036357 Species: Mus musculus Original motif 0.235299 0.222264 0.237416 0.305021 0.144778 0.278902 0.341673 0.234648 0.261127 0.261904 0.191591 0.285378 0.119943 0.410774 0.218940 0.250343 0.222672 0.075554 0.365253 0.336521 0.001838 0.046904 0.002828 0.948430 0.030410 0.006359 0.960821 0.002410 0.987391 0.007562 0.002810 0.002237 0.105188 0.888650 0.001163 0.004998 0.006475 0.987074 0.001793 0.004659 0.001816 0.765138 0.003092 0.229953 0.010354 0.846496 0.029899 0.113251 0.328732 0.039382 0.265510 0.366377 0.209638 0.262628 0.145613 0.382121 0.385390 0.177695 0.299828 0.137087 0.403452 0.268924 0.096028 0.231595 0.203082 0.231812 0.213520 0.351585 Consensus sequence: DBHBDTGACCCCDHVHB Reverse complement motif 0.351585 0.231812 0.213520 0.203082 0.231595 0.268924 0.096028 0.403452 0.137087 0.177695 0.299828 0.385390 0.382121 0.262628 0.145613 0.209638 0.366377 0.039382 0.265510 0.328732 0.010354 0.029899 0.846496 0.113251 0.001816 0.003092 0.765138 0.229953 0.006475 0.001793 0.987074 0.004659 0.105188 0.001163 0.888650 0.004998 0.002237 0.007562 0.002810 0.987391 0.030410 0.960821 0.006359 0.002410 0.948430 0.046904 0.002828 0.001838 0.222672 0.365253 0.075554 0.336521 0.119943 0.218940 0.410774 0.250343 0.285378 0.261904 0.191591 0.261127 0.144778 0.341673 0.278902 0.234648 0.305021 0.222264 0.237416 0.235299 Consensus sequence: VHBHDGGGGTCAHBHBD Alignment: DBHBDTGACCCCDHVHB -----TGACCTDVWT-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00079 Esrra_secondary Original Motif Original Motif Forward 3 10 0.039128 Species: Mus musculus Original motif 0.252126 0.268706 0.351590 0.127578 0.158171 0.083434 0.389646 0.368749 0.180010 0.290882 0.279192 0.249916 0.206905 0.249360 0.275438 0.268296 0.756588 0.046202 0.023921 0.173289 0.018262 0.022596 0.949143 0.010000 0.206468 0.046491 0.745475 0.001566 0.005511 0.001141 0.983152 0.010196 0.004791 0.001893 0.985951 0.007365 0.027643 0.001133 0.008565 0.962659 0.002459 0.970934 0.007826 0.018780 0.924387 0.003164 0.071225 0.001224 0.419387 0.230189 0.111588 0.238836 0.290954 0.163823 0.341233 0.203991 0.196768 0.281307 0.313868 0.208056 0.128428 0.260428 0.378607 0.232537 0.269305 0.378895 0.123480 0.228320 Consensus sequence: VKBBAGGGGTCAHDBBH Reverse complement motif 0.269305 0.123480 0.378895 0.228320 0.128428 0.378607 0.260428 0.232537 0.196768 0.313868 0.281307 0.208056 0.290954 0.341233 0.163823 0.203991 0.238836 0.230189 0.111588 0.419387 0.001224 0.003164 0.071225 0.924387 0.002459 0.007826 0.970934 0.018780 0.962659 0.001133 0.008565 0.027643 0.004791 0.985951 0.001893 0.007365 0.005511 0.983152 0.001141 0.010196 0.206468 0.745475 0.046491 0.001566 0.018262 0.949143 0.022596 0.010000 0.173289 0.046202 0.023921 0.756588 0.206905 0.275438 0.249360 0.268296 0.180010 0.279192 0.290882 0.249916 0.158171 0.389646 0.083434 0.368749 0.252126 0.351590 0.268706 0.127578 Consensus sequence: DBBHHTGACCCCTBBYV Alignment: VKBBAGGGGTCAHDBBH --AWVDAGGTCA----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00035 Hic1_secondary Reverse Complement Original Motif Backward 2 10 0.044421 Species: Mus musculus Original motif 0.204898 0.149951 0.363373 0.281778 0.112946 0.243700 0.437938 0.205417 0.205232 0.182319 0.383143 0.229305 0.242063 0.152491 0.296426 0.309020 0.312922 0.028523 0.585026 0.073529 0.006754 0.011178 0.005346 0.976723 0.127589 0.005562 0.859436 0.007414 0.010046 0.974694 0.007001 0.008259 0.010262 0.974769 0.006069 0.008899 0.015122 0.966101 0.007970 0.010807 0.556511 0.167389 0.114635 0.161465 0.586459 0.044786 0.073450 0.295305 0.297710 0.194666 0.223655 0.283969 0.303202 0.250809 0.206475 0.239514 0.279338 0.160655 0.314457 0.245550 0.266477 0.266890 0.299970 0.166662 Consensus sequence: DBDDRTGCCCAWDHDV Reverse complement motif 0.266477 0.299970 0.266890 0.166662 0.279338 0.314457 0.160655 0.245550 0.239514 0.250809 0.206475 0.303202 0.283969 0.194666 0.223655 0.297710 0.295305 0.044786 0.073450 0.586459 0.161465 0.167389 0.114635 0.556511 0.015122 0.007970 0.966101 0.010807 0.010262 0.006069 0.974769 0.008899 0.010046 0.007001 0.974694 0.008259 0.127589 0.859436 0.005562 0.007414 0.976723 0.011178 0.005346 0.006754 0.312922 0.585026 0.028523 0.073529 0.309020 0.152491 0.296426 0.242063 0.205232 0.383143 0.182319 0.229305 0.112946 0.437938 0.243700 0.205417 0.204898 0.363373 0.149951 0.281778 Consensus sequence: VHHDWTGGGCAMDHBH Alignment: DBDDRTGCCCAWDHDV -----TGACCTDVWT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00050 Bhlhb2_primary Original Motif Reverse Complement Forward 1 10 0.046143 Species: Mus musculus Original motif 0.347837 0.112349 0.403713 0.136102 0.298329 0.175329 0.324534 0.201809 0.421791 0.222553 0.113615 0.242041 0.387506 0.130670 0.161435 0.320389 0.197183 0.244864 0.304611 0.253342 0.345884 0.188786 0.278290 0.187041 0.228203 0.142148 0.408269 0.221381 0.037126 0.006772 0.231775 0.724328 0.055214 0.942800 0.001192 0.000794 0.974119 0.004466 0.015535 0.005880 0.000300 0.958145 0.007498 0.034056 0.034056 0.007498 0.958145 0.000300 0.005880 0.015535 0.004466 0.974119 0.000794 0.001192 0.942800 0.055214 0.724328 0.231775 0.006772 0.037126 0.015720 0.466476 0.315208 0.202596 0.173670 0.355170 0.210710 0.260449 0.407419 0.261539 0.134430 0.196612 0.351478 0.209698 0.262426 0.176399 0.207869 0.284582 0.198951 0.308598 0.434482 0.113724 0.184408 0.267386 0.211144 0.363745 0.173978 0.251133 Consensus sequence: RDHDBVDTCACGTGASBHVHDH Reverse complement motif 0.211144 0.173978 0.363745 0.251133 0.267386 0.113724 0.184408 0.434482 0.308598 0.284582 0.198951 0.207869 0.176399 0.209698 0.262426 0.351478 0.196612 0.261539 0.134430 0.407419 0.173670 0.210710 0.355170 0.260449 0.015720 0.315208 0.466476 0.202596 0.037126 0.231775 0.006772 0.724328 0.000794 0.942800 0.001192 0.055214 0.974119 0.015535 0.004466 0.005880 0.034056 0.958145 0.007498 0.000300 0.000300 0.007498 0.958145 0.034056 0.005880 0.004466 0.015535 0.974119 0.055214 0.001192 0.942800 0.000794 0.724328 0.006772 0.231775 0.037126 0.228203 0.408269 0.142148 0.221381 0.187041 0.188786 0.278290 0.345884 0.197183 0.304611 0.244864 0.253342 0.320389 0.130670 0.161435 0.387506 0.242041 0.222553 0.113615 0.421791 0.298329 0.324534 0.175329 0.201809 0.347837 0.403713 0.112349 0.136102 Consensus sequence: DDHBHBSTCACGTGAHBBDHHM Alignment: RDHDBVDTCACGTGASBHVHDH AWVDAGGTCA------------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v016060_primary Reverse Complement Original Motif Backward 3 10 0.048957 Species: Mus musculus Original motif 0.204923 0.208846 0.365383 0.220848 0.294304 0.300143 0.167287 0.238266 0.109711 0.619514 0.117379 0.153396 0.178979 0.378580 0.230177 0.212264 0.159594 0.542602 0.118178 0.179627 0.125206 0.430074 0.151826 0.292894 0.097692 0.709845 0.116956 0.075506 0.148292 0.565912 0.037632 0.248164 0.077951 0.034190 0.855503 0.032356 0.001657 0.001061 0.971877 0.025405 0.001926 0.001084 0.991712 0.005278 0.033031 0.012001 0.057796 0.897171 0.002723 0.002647 0.993348 0.001281 0.003261 0.000963 0.987199 0.008577 0.000611 0.090925 0.074857 0.833608 0.015299 0.978878 0.004949 0.000874 0.013368 0.600902 0.033485 0.352245 0.231949 0.149575 0.118804 0.499672 0.267580 0.186002 0.371242 0.175176 0.264884 0.223483 0.110082 0.401551 0.221365 0.170121 0.179559 0.428955 0.112997 0.692930 0.139981 0.054092 0.460305 0.207883 0.155111 0.176702 Consensus sequence: BHCBCBCCGGGTGGTCYHVHDCH Reverse complement motif 0.176702 0.207883 0.155111 0.460305 0.112997 0.139981 0.692930 0.054092 0.428955 0.170121 0.179559 0.221365 0.401551 0.223483 0.110082 0.264884 0.267580 0.371242 0.186002 0.175176 0.499672 0.149575 0.118804 0.231949 0.013368 0.033485 0.600902 0.352245 0.015299 0.004949 0.978878 0.000874 0.833608 0.090925 0.074857 0.000611 0.003261 0.987199 0.000963 0.008577 0.002723 0.993348 0.002647 0.001281 0.897171 0.012001 0.057796 0.033031 0.001926 0.991712 0.001084 0.005278 0.001657 0.971877 0.001061 0.025405 0.077951 0.855503 0.034190 0.032356 0.148292 0.037632 0.565912 0.248164 0.097692 0.116956 0.709845 0.075506 0.125206 0.151826 0.430074 0.292894 0.159594 0.118178 0.542602 0.179627 0.178979 0.230177 0.378580 0.212264 0.109711 0.117379 0.619514 0.153396 0.294304 0.167287 0.300143 0.238266 0.204923 0.365383 0.208846 0.220848 Consensus sequence: HGDHVHKGACCACCCGGBGBGDB Alignment: BHCBCBCCGGGTGGTCYHVHDCH -----------TGACCTDVWT-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 13 Motif name: MIZF Original motif 0.100000 0.300000 0.250000 0.350000 0.650000 0.050000 0.000000 0.300000 1.000000 0.000000 0.000000 0.000000 0.100000 0.850000 0.050000 0.000000 0.000000 0.000000 0.950000 0.050000 0.000000 0.050000 0.000000 0.950000 0.000000 0.950000 0.000000 0.050000 0.000000 0.900000 0.100000 0.000000 0.000000 0.000000 0.950000 0.050000 0.100000 0.650000 0.050000 0.200000 Consensus sequence: BAACGTCCGC Reserve complement motif 0.100000 0.050000 0.650000 0.200000 0.000000 0.950000 0.000000 0.050000 0.000000 0.100000 0.900000 0.000000 0.000000 0.000000 0.950000 0.050000 0.950000 0.050000 0.000000 0.000000 0.000000 0.950000 0.000000 0.050000 0.100000 0.050000 0.850000 0.000000 0.000000 0.000000 0.000000 1.000000 0.300000 0.050000 0.000000 0.650000 0.350000 0.300000 0.250000 0.100000 Consensus sequence: GCGGACGTTV ************************************************************************ Best Matches for Motif ID 13 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00419 Spic Original Motif Reverse Complement Forward 1 10 0.000000 Species: Mus musculus Original motif 0.372554 0.181557 0.296001 0.149888 0.734552 0.057250 0.044752 0.163446 0.707604 0.045049 0.110341 0.137006 0.637848 0.057252 0.071934 0.232966 0.125449 0.108933 0.689441 0.076176 0.266215 0.517339 0.207018 0.009428 0.015016 0.002582 0.979670 0.002732 0.004303 0.002322 0.989973 0.003401 0.982327 0.003552 0.003393 0.010727 0.974155 0.001662 0.003294 0.020889 0.040023 0.128522 0.821560 0.009894 0.027635 0.045828 0.016297 0.910239 0.317500 0.045635 0.172234 0.464631 0.342838 0.107812 0.284775 0.264576 Consensus sequence: VAAAGMGGAAGTWD Reverse complement motif 0.264576 0.107812 0.284775 0.342838 0.464631 0.045635 0.172234 0.317500 0.910239 0.045828 0.016297 0.027635 0.040023 0.821560 0.128522 0.009894 0.020889 0.001662 0.003294 0.974155 0.010727 0.003552 0.003393 0.982327 0.004303 0.989973 0.002322 0.003401 0.015016 0.979670 0.002582 0.002732 0.266215 0.207018 0.517339 0.009428 0.125449 0.689441 0.108933 0.076176 0.232966 0.057252 0.071934 0.637848 0.137006 0.045049 0.110341 0.707604 0.163446 0.057250 0.044752 0.734552 0.149888 0.181557 0.296001 0.372554 Consensus sequence: DWACTTCCRCTTTB Alignment: DWACTTCCRCTTTB BAACGTCCGC---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00409 Elf5 Original Motif Reverse Complement Forward 1 10 0.003800 Species: Mus musculus Original motif 0.179167 0.229135 0.279326 0.312372 0.421239 0.102900 0.145609 0.330252 0.791978 0.009721 0.028951 0.169350 0.237609 0.375543 0.161526 0.225321 0.145845 0.325411 0.516045 0.012699 0.431007 0.516333 0.051679 0.000982 0.005750 0.001408 0.990928 0.001915 0.002025 0.001886 0.992021 0.004068 0.986405 0.001705 0.001039 0.010851 0.950652 0.003619 0.000482 0.045248 0.165221 0.013897 0.819076 0.001805 0.032042 0.049374 0.014632 0.903953 0.285325 0.108010 0.127373 0.479292 0.366131 0.141246 0.290661 0.201963 Consensus sequence: BWAHSMGGAAGTWD Reverse complement motif 0.201963 0.141246 0.290661 0.366131 0.479292 0.108010 0.127373 0.285325 0.903953 0.049374 0.014632 0.032042 0.165221 0.819076 0.013897 0.001805 0.045248 0.003619 0.000482 0.950652 0.010851 0.001705 0.001039 0.986405 0.002025 0.992021 0.001886 0.004068 0.005750 0.990928 0.001408 0.001915 0.431007 0.051679 0.516333 0.000982 0.145845 0.516045 0.325411 0.012699 0.237609 0.161526 0.375543 0.225321 0.169350 0.009721 0.028951 0.791978 0.330252 0.102900 0.145609 0.421239 0.312372 0.229135 0.279326 0.179167 Consensus sequence: DWACTTCCRSDTWV Alignment: BWAHSMGGAAGTWD BAACGTCCGC---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00413 Elf4 Original Motif Original Motif Backward 5 10 0.012410 Species: Mus musculus Original motif 0.349744 0.139466 0.209326 0.301464 0.080478 0.359482 0.307083 0.252956 0.145756 0.213763 0.350557 0.289924 0.317307 0.199359 0.096089 0.387245 0.868576 0.009724 0.088821 0.032878 0.001975 0.827004 0.014159 0.156862 0.045494 0.000985 0.001907 0.951615 0.011012 0.001203 0.002186 0.985599 0.002743 0.992908 0.002226 0.002123 0.001498 0.990840 0.001556 0.006106 0.000951 0.005138 0.880591 0.113319 0.003127 0.107962 0.867980 0.020930 0.156602 0.055355 0.396563 0.391480 0.421246 0.049379 0.084495 0.444880 0.223879 0.068063 0.203809 0.504249 0.144100 0.323579 0.131544 0.400777 Consensus sequence: DBBHACTTCCGGKWTH Reverse complement motif 0.400777 0.323579 0.131544 0.144100 0.504249 0.068063 0.203809 0.223879 0.444880 0.049379 0.084495 0.421246 0.156602 0.396563 0.055355 0.391480 0.003127 0.867980 0.107962 0.020930 0.000951 0.880591 0.005138 0.113319 0.001498 0.001556 0.990840 0.006106 0.002743 0.002226 0.992908 0.002123 0.985599 0.001203 0.002186 0.011012 0.951615 0.000985 0.001907 0.045494 0.001975 0.014159 0.827004 0.156862 0.032878 0.009724 0.088821 0.868576 0.387245 0.199359 0.096089 0.317307 0.145756 0.350557 0.213763 0.289924 0.080478 0.307083 0.359482 0.252956 0.301464 0.139466 0.209326 0.349744 Consensus sequence: HAWYCCGGAAGTHBBD Alignment: DBBHACTTCCGGKWTH --BAACGTCCGC---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00404 Elf2 Original Motif Original Motif Forward 3 10 0.012835 Species: Mus musculus Original motif 0.381592 0.198656 0.201326 0.218426 0.091509 0.331644 0.302830 0.274017 0.165404 0.272650 0.352528 0.209418 0.322145 0.255685 0.129399 0.292771 0.853490 0.012857 0.078563 0.055090 0.002655 0.792907 0.026436 0.178002 0.058923 0.001063 0.002976 0.937038 0.014944 0.001369 0.002865 0.980822 0.003786 0.992305 0.002102 0.001807 0.001365 0.988969 0.001554 0.008111 0.001527 0.009592 0.891056 0.097824 0.003671 0.143708 0.836117 0.016503 0.242982 0.061527 0.305342 0.390148 0.426709 0.117673 0.096260 0.359357 0.202520 0.113885 0.262005 0.421589 0.137957 0.359367 0.163919 0.338758 Consensus sequence: DBBHACTTCCGGDWDB Reverse complement motif 0.137957 0.163919 0.359367 0.338758 0.421589 0.113885 0.262005 0.202520 0.359357 0.117673 0.096260 0.426709 0.390148 0.061527 0.305342 0.242982 0.003671 0.836117 0.143708 0.016503 0.001527 0.891056 0.009592 0.097824 0.001365 0.001554 0.988969 0.008111 0.003786 0.002102 0.992305 0.001807 0.980822 0.001369 0.002865 0.014944 0.937038 0.001063 0.002976 0.058923 0.002655 0.026436 0.792907 0.178002 0.055090 0.012857 0.078563 0.853490 0.292771 0.255685 0.129399 0.322145 0.165404 0.352528 0.272650 0.209418 0.091509 0.302830 0.331644 0.274017 0.218426 0.198656 0.201326 0.381592 Consensus sequence: BDWDCCGGAAGTHBBD Alignment: DBBHACTTCCGGDWDB --BAACGTCCGC---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00085 Sfpi1_primary Original Motif Reverse Complement Forward 1 10 0.014152 Species: Mus musculus Original motif 0.211586 0.273653 0.234763 0.279998 0.298032 0.104818 0.290385 0.306764 0.593467 0.048056 0.154602 0.203875 0.459746 0.052697 0.169949 0.317608 0.188623 0.155357 0.591543 0.064477 0.402746 0.286227 0.290285 0.020742 0.048569 0.001240 0.946397 0.003793 0.004354 0.001387 0.990819 0.003441 0.974272 0.001416 0.001466 0.022847 0.938748 0.003090 0.000833 0.057329 0.045831 0.270321 0.674644 0.009204 0.055664 0.092552 0.026061 0.825722 0.301235 0.122653 0.267039 0.309073 0.278680 0.276099 0.219159 0.226061 Consensus sequence: BDAWGVGGAAGTDH Reverse complement motif 0.226061 0.276099 0.219159 0.278680 0.309073 0.122653 0.267039 0.301235 0.825722 0.092552 0.026061 0.055664 0.045831 0.674644 0.270321 0.009204 0.057329 0.003090 0.000833 0.938748 0.022847 0.001416 0.001466 0.974272 0.004354 0.990819 0.001387 0.003441 0.048569 0.946397 0.001240 0.003793 0.020742 0.286227 0.290285 0.402746 0.188623 0.591543 0.155357 0.064477 0.317608 0.052697 0.169949 0.459746 0.203875 0.048056 0.154602 0.593467 0.306764 0.104818 0.290385 0.298032 0.279998 0.273653 0.234763 0.211586 Consensus sequence: HDACTTCCBCWTDV Alignment: BDAWGVGGAAGTDH BAACGTCCGC---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00423 Gm5454 Reverse Complement Reverse Complement Backward 3 10 0.014467 Species: Mus musculus Original motif 0.189373 0.396200 0.238705 0.175722 0.271321 0.176458 0.265627 0.286594 0.266229 0.324575 0.201073 0.208123 0.468162 0.220280 0.143160 0.168399 0.828556 0.009006 0.155963 0.006475 0.000965 0.820477 0.022769 0.155789 0.259255 0.001186 0.002221 0.737339 0.006364 0.001548 0.002346 0.989741 0.002267 0.993010 0.002221 0.002502 0.002365 0.993176 0.001987 0.002473 0.000528 0.001790 0.953300 0.044382 0.002238 0.032836 0.958384 0.006542 0.230236 0.143256 0.029199 0.597309 0.285226 0.282789 0.207699 0.224286 0.271642 0.251065 0.289590 0.187703 0.219881 0.390525 0.157704 0.231890 Consensus sequence: VDHHACTTCCGGTHVH Reverse complement motif 0.219881 0.157704 0.390525 0.231890 0.271642 0.289590 0.251065 0.187703 0.224286 0.282789 0.207699 0.285226 0.597309 0.143256 0.029199 0.230236 0.002238 0.958384 0.032836 0.006542 0.000528 0.953300 0.001790 0.044382 0.002365 0.001987 0.993176 0.002473 0.002267 0.002221 0.993010 0.002502 0.989741 0.001548 0.002346 0.006364 0.737339 0.001186 0.002221 0.259255 0.000965 0.022769 0.820477 0.155789 0.006475 0.009006 0.155963 0.828556 0.168399 0.220280 0.143160 0.468162 0.266229 0.201073 0.324575 0.208123 0.286594 0.176458 0.265627 0.271321 0.189373 0.238705 0.396200 0.175722 Consensus sequence: DVHACCGGAAGTHDDV Alignment: DVHACCGGAAGTHDDV ----GCGGACGTTV-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00412 Etv5 Reverse Complement Reverse Complement Backward 3 10 0.015583 Species: Mus musculus Original motif 0.163863 0.478739 0.234818 0.122579 0.298203 0.128058 0.250907 0.322832 0.304907 0.352627 0.141386 0.201081 0.505689 0.209260 0.108917 0.176133 0.755659 0.019470 0.214957 0.009914 0.001392 0.808267 0.034638 0.155703 0.341720 0.002244 0.003969 0.652068 0.011512 0.000955 0.002369 0.985163 0.003522 0.992404 0.002813 0.001261 0.002303 0.993216 0.002157 0.002324 0.000502 0.002139 0.938005 0.059354 0.004246 0.041666 0.947484 0.006604 0.177758 0.143265 0.023436 0.655542 0.278473 0.235398 0.218872 0.267257 0.225212 0.275898 0.211908 0.286982 0.193184 0.385135 0.190634 0.231048 Consensus sequence: VDHAACWTCCGGTHHH Reverse complement motif 0.193184 0.190634 0.385135 0.231048 0.286982 0.275898 0.211908 0.225212 0.267257 0.235398 0.218872 0.278473 0.655542 0.143265 0.023436 0.177758 0.004246 0.947484 0.041666 0.006604 0.000502 0.938005 0.002139 0.059354 0.002303 0.002157 0.993216 0.002324 0.003522 0.002813 0.992404 0.001261 0.985163 0.000955 0.002369 0.011512 0.652068 0.002244 0.003969 0.341720 0.001392 0.034638 0.808267 0.155703 0.009914 0.019470 0.214957 0.755659 0.176133 0.209260 0.108917 0.505689 0.304907 0.141386 0.352627 0.201081 0.322832 0.128058 0.250907 0.298203 0.163863 0.234818 0.478739 0.122579 Consensus sequence: DHHACCGGAWGTTDDV Alignment: DHHACCGGAWGTTDDV ----GCGGACGTTV-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00015 Ehf_primary Reverse Complement Original Motif Forward 6 10 0.016202 Species: Mus musculus Original motif 0.327238 0.304037 0.232174 0.136551 0.198306 0.222758 0.316421 0.262515 0.252373 0.217079 0.267210 0.263337 0.633781 0.039800 0.036914 0.289504 0.160405 0.384709 0.220671 0.234215 0.134205 0.590541 0.266074 0.009179 0.210933 0.755978 0.030378 0.002710 0.011856 0.001472 0.984138 0.002533 0.003235 0.001605 0.989465 0.005695 0.984189 0.002418 0.002842 0.010551 0.884492 0.002651 0.002095 0.110762 0.249047 0.054607 0.690939 0.005407 0.124602 0.154669 0.047597 0.673132 0.375217 0.110561 0.230374 0.283848 0.402951 0.186789 0.219551 0.190710 Consensus sequence: VBDABCCGGAAGTDD Reverse complement motif 0.190710 0.186789 0.219551 0.402951 0.283848 0.110561 0.230374 0.375217 0.673132 0.154669 0.047597 0.124602 0.249047 0.690939 0.054607 0.005407 0.110762 0.002651 0.002095 0.884492 0.010551 0.002418 0.002842 0.984189 0.003235 0.989465 0.001605 0.005695 0.011856 0.984138 0.001472 0.002533 0.210933 0.030378 0.755978 0.002710 0.134205 0.266074 0.590541 0.009179 0.160405 0.220671 0.384709 0.234215 0.289504 0.039800 0.036914 0.633781 0.252373 0.267210 0.217079 0.263337 0.198306 0.316421 0.222758 0.262515 0.136551 0.304037 0.232174 0.327238 Consensus sequence: DDACTTCCGGBTHBB Alignment: VBDABCCGGAAGTDD -----GCGGACGTTV ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00418 Etv6 Original Motif Original Motif Forward 4 10 0.017123 Species: Mus musculus Original motif 0.354972 0.069107 0.299350 0.276571 0.209701 0.408003 0.227382 0.154914 0.284336 0.375266 0.162604 0.177794 0.176569 0.181438 0.342172 0.299820 0.106551 0.204378 0.060299 0.628772 0.884088 0.003252 0.103113 0.009546 0.001110 0.704391 0.006294 0.288205 0.014992 0.000892 0.001401 0.982714 0.004842 0.001887 0.002470 0.990801 0.002724 0.992864 0.002206 0.002206 0.001792 0.991200 0.001615 0.005393 0.005151 0.010157 0.940259 0.044433 0.017780 0.199839 0.761921 0.020459 0.230834 0.269936 0.119652 0.379577 0.233019 0.093692 0.034743 0.638546 0.194739 0.181763 0.175340 0.448159 0.145452 0.293709 0.335917 0.224922 Consensus sequence: DVHBTACTTCCGGHTHB Reverse complement motif 0.145452 0.335917 0.293709 0.224922 0.448159 0.181763 0.175340 0.194739 0.638546 0.093692 0.034743 0.233019 0.379577 0.269936 0.119652 0.230834 0.017780 0.761921 0.199839 0.020459 0.005151 0.940259 0.010157 0.044433 0.001792 0.001615 0.991200 0.005393 0.002724 0.002206 0.992864 0.002206 0.990801 0.001887 0.002470 0.004842 0.982714 0.000892 0.001401 0.014992 0.001110 0.006294 0.704391 0.288205 0.009546 0.003252 0.103113 0.884088 0.628772 0.204378 0.060299 0.106551 0.176569 0.342172 0.181438 0.299820 0.284336 0.162604 0.375266 0.177794 0.209701 0.227382 0.408003 0.154914 0.276571 0.069107 0.299350 0.354972 Consensus sequence: BHAHCCGGAAGTABDVD Alignment: DVHBTACTTCCGGHTHB ---BAACGTCCGC---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00421 Etv1 Reverse Complement Original Motif Backward 3 10 0.018415 Species: Mus musculus Original motif 0.481848 0.274378 0.165047 0.078727 0.153123 0.322109 0.385794 0.138974 0.257711 0.198309 0.118559 0.425422 0.102329 0.255032 0.373097 0.269542 0.655995 0.027594 0.168796 0.147615 0.012836 0.906067 0.077134 0.003962 0.079806 0.917232 0.002438 0.000524 0.005217 0.001765 0.991859 0.001159 0.001691 0.002097 0.993588 0.002624 0.991087 0.001016 0.001937 0.005961 0.751484 0.005147 0.002324 0.241044 0.112494 0.076460 0.805095 0.005951 0.012019 0.198497 0.022413 0.767071 0.482843 0.140306 0.249898 0.126953 0.298792 0.191769 0.286874 0.222565 0.395216 0.302575 0.172247 0.129961 0.364642 0.219734 0.190320 0.225304 Consensus sequence: MVHBACCGGAAGTVDVH Reverse complement motif 0.225304 0.219734 0.190320 0.364642 0.129961 0.302575 0.172247 0.395216 0.222565 0.191769 0.286874 0.298792 0.126953 0.140306 0.249898 0.482843 0.767071 0.198497 0.022413 0.012019 0.112494 0.805095 0.076460 0.005951 0.241044 0.005147 0.002324 0.751484 0.005961 0.001016 0.001937 0.991087 0.001691 0.993588 0.002097 0.002624 0.005217 0.991859 0.001765 0.001159 0.079806 0.002438 0.917232 0.000524 0.012836 0.077134 0.906067 0.003962 0.147615 0.027594 0.168796 0.655995 0.102329 0.373097 0.255032 0.269542 0.425422 0.198309 0.118559 0.257711 0.153123 0.385794 0.322109 0.138974 0.078727 0.274378 0.165047 0.481848 Consensus sequence: HBDBACTTCCGGTBHVY Alignment: MVHBACCGGAAGTVDVH -----GCGGACGTTV-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 14 Motif name: PPARGRXRA Original motif 0.109685 0.369895 0.373396 0.147025 0.117716 0.193473 0.148019 0.540793 0.453488 0.026744 0.427907 0.091860 0.116144 0.003484 0.779326 0.101045 0.161253 0.017401 0.781903 0.039443 0.168213 0.149652 0.458237 0.223898 0.082271 0.633835 0.207416 0.076477 0.949015 0.024334 0.017381 0.009270 0.604867 0.055620 0.312862 0.026651 0.825231 0.005787 0.158565 0.010417 0.095017 0.002317 0.888760 0.013905 0.047509 0.010429 0.803013 0.139050 0.025492 0.114716 0.304751 0.555041 0.062645 0.643852 0.167053 0.126450 0.784223 0.067285 0.054524 0.093968 Consensus sequence: BTRGGDCARAGGKCA Reserve complement motif 0.093968 0.067285 0.054524 0.784223 0.062645 0.167053 0.643852 0.126450 0.555041 0.114716 0.304751 0.025492 0.047509 0.803013 0.010429 0.139050 0.095017 0.888760 0.002317 0.013905 0.010417 0.005787 0.158565 0.825231 0.026651 0.055620 0.312862 0.604867 0.009270 0.024334 0.017381 0.949015 0.082271 0.207416 0.633835 0.076477 0.168213 0.458237 0.149652 0.223898 0.161253 0.781903 0.017401 0.039443 0.116144 0.779326 0.003484 0.101045 0.091860 0.026744 0.427907 0.453488 0.540793 0.193473 0.148019 0.117716 0.109685 0.373396 0.369895 0.147025 Consensus sequence: TGRCCTKTGHCCKAB ************************************************************************ Best Matches for Motif ID 14 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00067 Lef1_primary Original Motif Reverse Complement Backward 2 15 0.030495 Species: Mus musculus Original motif 0.281920 0.214207 0.278077 0.225796 0.325566 0.151435 0.298797 0.224202 0.290253 0.145824 0.243443 0.320480 0.069286 0.404645 0.141614 0.384454 0.070044 0.621448 0.142647 0.165862 0.007295 0.907657 0.038110 0.046938 0.015587 0.018273 0.000658 0.965482 0.005527 0.005886 0.001905 0.986682 0.024512 0.001189 0.001344 0.972955 0.007384 0.025221 0.952270 0.015125 0.966438 0.000630 0.002693 0.030239 0.082252 0.001173 0.001495 0.915080 0.030255 0.677155 0.275323 0.017267 0.199467 0.118815 0.056814 0.624905 0.345445 0.169597 0.216831 0.268127 0.278106 0.150864 0.173693 0.397336 0.251834 0.339733 0.219703 0.188730 Consensus sequence: DDDYCCTTTGATCTDDV Reverse complement motif 0.251834 0.219703 0.339733 0.188730 0.397336 0.150864 0.173693 0.278106 0.268127 0.169597 0.216831 0.345445 0.624905 0.118815 0.056814 0.199467 0.030255 0.275323 0.677155 0.017267 0.915080 0.001173 0.001495 0.082252 0.030239 0.000630 0.002693 0.966438 0.007384 0.952270 0.025221 0.015125 0.972955 0.001189 0.001344 0.024512 0.986682 0.005886 0.001905 0.005527 0.965482 0.018273 0.000658 0.015587 0.007295 0.038110 0.907657 0.046938 0.070044 0.142647 0.621448 0.165862 0.069286 0.141614 0.404645 0.384454 0.320480 0.145824 0.243443 0.290253 0.224202 0.151435 0.298797 0.325566 0.225796 0.214207 0.278077 0.281920 Consensus sequence: VDDAGATCAAAGGKDDD Alignment: VDDAGATCAAAGGKDDD -BTRGGDCARAGGKCA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00058 Tcf3_primary Original Motif Original Motif Forward 2 15 0.031947 Species: Mus musculus Original motif 0.185864 0.201179 0.183663 0.429294 0.371100 0.233868 0.122934 0.272098 0.249563 0.171285 0.128851 0.450301 0.582940 0.043382 0.129099 0.244578 0.041400 0.395349 0.497087 0.066163 0.759123 0.009670 0.005936 0.225270 0.056579 0.008662 0.003986 0.930772 0.043968 0.865783 0.056001 0.034249 0.962748 0.003731 0.003265 0.030256 0.971318 0.003542 0.012299 0.012841 0.937558 0.003991 0.020195 0.038256 0.125931 0.057976 0.798081 0.018012 0.209401 0.172342 0.483980 0.134277 0.485703 0.129227 0.309936 0.075134 0.397027 0.195902 0.152395 0.254676 0.311636 0.231510 0.157732 0.299122 0.320965 0.206031 0.164299 0.308705 Consensus sequence: HHHASATCAAAGVRHHH Reverse complement motif 0.308705 0.206031 0.164299 0.320965 0.299122 0.231510 0.157732 0.311636 0.254676 0.195902 0.152395 0.397027 0.075134 0.129227 0.309936 0.485703 0.209401 0.483980 0.172342 0.134277 0.125931 0.798081 0.057976 0.018012 0.038256 0.003991 0.020195 0.937558 0.012841 0.003542 0.012299 0.971318 0.030256 0.003731 0.003265 0.962748 0.043968 0.056001 0.865783 0.034249 0.930772 0.008662 0.003986 0.056579 0.225270 0.009670 0.005936 0.759123 0.041400 0.497087 0.395349 0.066163 0.244578 0.043382 0.129099 0.582940 0.450301 0.171285 0.128851 0.249563 0.272098 0.233868 0.122934 0.371100 0.429294 0.201179 0.183663 0.185864 Consensus sequence: HHHKVCTTTGATSTHHH Alignment: HHHASATCAAAGVRHHH -BTRGGDCARAGGKCA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00054 Tcf7_primary Original Motif Original Motif Backward 2 15 0.032779 Species: Mus musculus Original motif 0.170811 0.196976 0.220503 0.411710 0.337231 0.228482 0.140137 0.294150 0.299312 0.173780 0.143426 0.383481 0.603957 0.053557 0.128214 0.214271 0.036338 0.377925 0.534647 0.051091 0.725865 0.010314 0.008501 0.255320 0.067855 0.007849 0.004559 0.919737 0.049387 0.815496 0.098330 0.036787 0.960514 0.005036 0.005137 0.029313 0.960631 0.004550 0.018815 0.016004 0.935245 0.005169 0.023866 0.035720 0.159760 0.060340 0.761341 0.018559 0.228534 0.153897 0.523052 0.094517 0.557984 0.123512 0.254154 0.064350 0.490252 0.211976 0.124557 0.173215 0.310463 0.250279 0.132612 0.306646 0.332720 0.248937 0.120633 0.297711 Consensus sequence: BHHASATCAAAGGAHHH Reverse complement motif 0.297711 0.248937 0.120633 0.332720 0.306646 0.250279 0.132612 0.310463 0.173215 0.211976 0.124557 0.490252 0.064350 0.123512 0.254154 0.557984 0.228534 0.523052 0.153897 0.094517 0.159760 0.761341 0.060340 0.018559 0.035720 0.005169 0.023866 0.935245 0.016004 0.004550 0.018815 0.960631 0.029313 0.005036 0.005137 0.960514 0.049387 0.098330 0.815496 0.036787 0.919737 0.007849 0.004559 0.067855 0.255320 0.010314 0.008501 0.725865 0.036338 0.534647 0.377925 0.051091 0.214271 0.053557 0.128214 0.603957 0.383481 0.173780 0.143426 0.299312 0.294150 0.228482 0.140137 0.337231 0.411710 0.196976 0.220503 0.170811 Consensus sequence: HHHTCCTTTGATSTHHV Alignment: BHHASATCAAAGGAHHH -BTRGGDCARAGGKCA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00082 Zfp187_secondary Original Motif Reverse Complement Backward 2 15 0.033418 Species: Mus musculus Original motif 0.173063 0.169680 0.440836 0.216421 0.353277 0.179996 0.249403 0.217325 0.307337 0.038055 0.616380 0.038228 0.316636 0.564670 0.023732 0.094962 0.015484 0.923764 0.019439 0.041313 0.011243 0.956300 0.009443 0.023014 0.062273 0.107531 0.010739 0.819456 0.126670 0.201521 0.192005 0.479803 0.093090 0.045924 0.835792 0.025194 0.020165 0.015483 0.009567 0.954786 0.010873 0.672448 0.004559 0.312121 0.018002 0.846860 0.017605 0.117533 0.335703 0.408170 0.104095 0.152031 0.150308 0.362296 0.067408 0.419988 0.286490 0.242211 0.176532 0.294767 0.265022 0.249655 0.272219 0.213104 Consensus sequence: DDGMCCTBGTCCHYHV Reverse complement motif 0.265022 0.272219 0.249655 0.213104 0.294767 0.242211 0.176532 0.286490 0.419988 0.362296 0.067408 0.150308 0.335703 0.104095 0.408170 0.152031 0.018002 0.017605 0.846860 0.117533 0.010873 0.004559 0.672448 0.312121 0.954786 0.015483 0.009567 0.020165 0.093090 0.835792 0.045924 0.025194 0.479803 0.201521 0.192005 0.126670 0.819456 0.107531 0.010739 0.062273 0.011243 0.009443 0.956300 0.023014 0.015484 0.019439 0.923764 0.041313 0.316636 0.023732 0.564670 0.094962 0.307337 0.616380 0.038055 0.038228 0.217325 0.179996 0.249403 0.353277 0.173063 0.440836 0.169680 0.216421 Consensus sequence: VHMDGGACVAGGRCDH Alignment: VHMDGGACVAGGRCDH BTRGGDCARAGGKCA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00062 Sox4_primary Original Motif Original Motif Backward 2 15 0.035254 Species: Mus musculus Original motif 0.427843 0.231210 0.119424 0.221523 0.196506 0.239531 0.304906 0.259057 0.302488 0.156922 0.290190 0.250401 0.433872 0.149126 0.196496 0.220506 0.258426 0.076511 0.475100 0.189963 0.841714 0.046453 0.099915 0.011918 0.983853 0.001612 0.001362 0.013174 0.003460 0.982032 0.005728 0.008780 0.989743 0.002253 0.002020 0.005984 0.990761 0.003397 0.002843 0.003000 0.770864 0.003540 0.001549 0.224048 0.235342 0.002598 0.757383 0.004677 0.371426 0.089574 0.529959 0.009040 0.480804 0.196949 0.240413 0.081833 0.187158 0.355102 0.216599 0.241142 0.248006 0.232182 0.157452 0.362360 0.403367 0.177684 0.164649 0.254300 Consensus sequence: HBDDDAACAAAGRVBHH Reverse complement motif 0.254300 0.177684 0.164649 0.403367 0.362360 0.232182 0.157452 0.248006 0.187158 0.216599 0.355102 0.241142 0.081833 0.196949 0.240413 0.480804 0.371426 0.529959 0.089574 0.009040 0.235342 0.757383 0.002598 0.004677 0.224048 0.003540 0.001549 0.770864 0.003000 0.003397 0.002843 0.990761 0.005984 0.002253 0.002020 0.989743 0.003460 0.005728 0.982032 0.008780 0.013174 0.001612 0.001362 0.983853 0.011918 0.046453 0.099915 0.841714 0.258426 0.475100 0.076511 0.189963 0.220506 0.149126 0.196496 0.433872 0.250401 0.156922 0.290190 0.302488 0.196506 0.304906 0.239531 0.259057 0.221523 0.231210 0.119424 0.427843 Consensus sequence: HHBBMCTTTGTTHDDBH Alignment: HBDDDAACAAAGRVBHH -BTRGGDCARAGGKCA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00030 Sox11_primary Original Motif Original Motif Backward 2 15 0.035878 Species: Mus musculus Original motif 0.351812 0.238467 0.143954 0.265768 0.195246 0.235838 0.281473 0.287443 0.349478 0.172616 0.210739 0.267167 0.484061 0.110438 0.173131 0.232370 0.276692 0.070713 0.479604 0.172991 0.859124 0.044167 0.083951 0.012758 0.975608 0.002029 0.002285 0.020079 0.006422 0.978485 0.007124 0.007969 0.987489 0.003025 0.002868 0.006617 0.987739 0.005463 0.002730 0.004067 0.693013 0.004067 0.002445 0.300475 0.189100 0.003677 0.801408 0.005814 0.352090 0.072517 0.567737 0.007656 0.542316 0.176545 0.192768 0.088371 0.196382 0.304176 0.205985 0.293457 0.289415 0.201358 0.182937 0.326290 0.385801 0.216362 0.152363 0.245475 Consensus sequence: HBDDRAACAAAGRABHH Reverse complement motif 0.245475 0.216362 0.152363 0.385801 0.326290 0.201358 0.182937 0.289415 0.196382 0.205985 0.304176 0.293457 0.088371 0.176545 0.192768 0.542316 0.352090 0.567737 0.072517 0.007656 0.189100 0.801408 0.003677 0.005814 0.300475 0.004067 0.002445 0.693013 0.004067 0.005463 0.002730 0.987739 0.006617 0.003025 0.002868 0.987489 0.006422 0.007124 0.978485 0.007969 0.020079 0.002029 0.002285 0.975608 0.012758 0.044167 0.083951 0.859124 0.276692 0.479604 0.070713 0.172991 0.232370 0.110438 0.173131 0.484061 0.267167 0.172616 0.210739 0.349478 0.287443 0.235838 0.281473 0.195246 0.265768 0.238467 0.143954 0.351812 Consensus sequence: HHBTMCTTTGTTMDDVH Alignment: HBDDRAACAAAGRABHH -BTRGGDCARAGGKCA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00101 Sox12_secondary Reverse Complement Reverse Complement Backward 2 15 0.037473 Species: Mus musculus Original motif 0.378898 0.318901 0.205859 0.096341 0.352524 0.321236 0.224504 0.101736 0.323551 0.182056 0.210897 0.283496 0.135539 0.325230 0.208031 0.331200 0.663106 0.055471 0.154459 0.126963 0.051748 0.292567 0.537307 0.118378 0.886489 0.042361 0.035742 0.035408 0.043647 0.688744 0.094358 0.173252 0.882052 0.039818 0.018899 0.059231 0.864171 0.036011 0.068363 0.031455 0.790158 0.046868 0.041594 0.121379 0.087447 0.143905 0.707798 0.060849 0.295919 0.132479 0.485703 0.085899 0.653156 0.133004 0.110012 0.103828 0.351764 0.131771 0.217730 0.298736 0.203977 0.196773 0.099958 0.499292 Consensus sequence: VVDBASACAAAGRADH Reverse complement motif 0.499292 0.196773 0.099958 0.203977 0.298736 0.131771 0.217730 0.351764 0.103828 0.133004 0.110012 0.653156 0.295919 0.485703 0.132479 0.085899 0.087447 0.707798 0.143905 0.060849 0.121379 0.046868 0.041594 0.790158 0.031455 0.036011 0.068363 0.864171 0.059231 0.039818 0.018899 0.882052 0.043647 0.094358 0.688744 0.173252 0.035408 0.042361 0.035742 0.886489 0.051748 0.537307 0.292567 0.118378 0.126963 0.055471 0.154459 0.663106 0.331200 0.325230 0.208031 0.135539 0.283496 0.182056 0.210897 0.323551 0.101736 0.321236 0.224504 0.352524 0.096341 0.318901 0.205859 0.378898 Consensus sequence: HDTMCTTTGTSTVDBB Alignment: HDTMCTTTGTSTVDBB TGRCCTKTGHCCKAB- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00083 Tcf7l2_primary Original Motif Reverse Complement Forward 2 15 0.037976 Species: Mus musculus Original motif 0.285725 0.187143 0.254855 0.272277 0.276264 0.157893 0.258178 0.307665 0.238788 0.161120 0.254018 0.346074 0.076041 0.333901 0.150903 0.439156 0.093376 0.526578 0.180529 0.199517 0.010827 0.880320 0.034150 0.074703 0.016546 0.023834 0.000940 0.958680 0.007166 0.008215 0.001941 0.982678 0.029634 0.001363 0.001379 0.967625 0.010872 0.031751 0.926186 0.031190 0.949407 0.000760 0.002581 0.047253 0.109203 0.001362 0.002094 0.887341 0.044198 0.567994 0.353059 0.034749 0.222623 0.142360 0.041281 0.593736 0.358872 0.167597 0.220534 0.252997 0.233072 0.141480 0.230985 0.394463 0.350703 0.243129 0.233961 0.172207 Consensus sequence: DDDYCCTTTGATSTDDV Reverse complement motif 0.172207 0.243129 0.233961 0.350703 0.394463 0.141480 0.230985 0.233072 0.252997 0.167597 0.220534 0.358872 0.593736 0.142360 0.041281 0.222623 0.044198 0.353059 0.567994 0.034749 0.887341 0.001362 0.002094 0.109203 0.047253 0.000760 0.002581 0.949407 0.010872 0.926186 0.031751 0.031190 0.967625 0.001363 0.001379 0.029634 0.982678 0.008215 0.001941 0.007166 0.958680 0.023834 0.000940 0.016546 0.010827 0.034150 0.880320 0.074703 0.093376 0.180529 0.526578 0.199517 0.439156 0.333901 0.150903 0.076041 0.346074 0.161120 0.254018 0.238788 0.307665 0.157893 0.258178 0.276264 0.272277 0.187143 0.254855 0.285725 Consensus sequence: BDDASATCAAAGGMDDD Alignment: BDDASATCAAAGGMDDD -BTRGGDCARAGGKCA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00093 Klf7_primary Original Motif Reverse Complement Backward 2 15 0.038273 Species: Mus musculus Original motif 0.204514 0.198353 0.171218 0.425915 0.167188 0.296785 0.246082 0.289946 0.267330 0.148001 0.398674 0.185994 0.549386 0.060167 0.337100 0.053347 0.050746 0.900013 0.022169 0.027073 0.037905 0.920332 0.008360 0.033403 0.410356 0.566702 0.016267 0.006675 0.009526 0.982354 0.001060 0.007060 0.204292 0.001084 0.748567 0.046056 0.003955 0.988490 0.002821 0.004735 0.004264 0.988826 0.004311 0.002598 0.002758 0.929549 0.001244 0.066448 0.260332 0.421683 0.024720 0.293265 0.184798 0.247697 0.085237 0.482268 0.347537 0.197344 0.139961 0.315159 0.255281 0.166620 0.242297 0.335802 Consensus sequence: HBDRCCMCGCCCHHHD Reverse complement motif 0.335802 0.166620 0.242297 0.255281 0.315159 0.197344 0.139961 0.347537 0.482268 0.247697 0.085237 0.184798 0.260332 0.024720 0.421683 0.293265 0.002758 0.001244 0.929549 0.066448 0.004264 0.004311 0.988826 0.002598 0.003955 0.002821 0.988490 0.004735 0.204292 0.748567 0.001084 0.046056 0.009526 0.001060 0.982354 0.007060 0.410356 0.016267 0.566702 0.006675 0.037905 0.008360 0.920332 0.033403 0.050746 0.022169 0.900013 0.027073 0.053347 0.060167 0.337100 0.549386 0.267330 0.398674 0.148001 0.185994 0.167188 0.246082 0.296785 0.289946 0.425915 0.198353 0.171218 0.204514 Consensus sequence: DHHDGGGCGRGGKHBH Alignment: DHHDGGGCGRGGKHBH BTRGGDCARAGGKCA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00055 Hbp1_secondary Original Motif Reverse Complement Forward 1 15 0.039717 Species: Mus musculus Original motif 0.313621 0.149049 0.200899 0.336432 0.262644 0.147616 0.334882 0.254859 0.175848 0.137857 0.292272 0.394023 0.045910 0.364107 0.180535 0.409448 0.093235 0.718630 0.093516 0.094619 0.095552 0.724866 0.044589 0.134993 0.058227 0.785149 0.029814 0.126810 0.897368 0.023735 0.019064 0.059832 0.043826 0.041750 0.020731 0.893692 0.044268 0.013557 0.014689 0.927487 0.102208 0.026005 0.709573 0.162214 0.058404 0.046118 0.135257 0.760221 0.303689 0.280676 0.320259 0.095375 0.258633 0.262177 0.197029 0.282161 0.564761 0.122466 0.194691 0.118082 0.104738 0.358061 0.310533 0.226668 0.267450 0.230099 0.197859 0.304593 Consensus sequence: DDDYCCCATTGTVHABH Reverse complement motif 0.304593 0.230099 0.197859 0.267450 0.104738 0.310533 0.358061 0.226668 0.118082 0.122466 0.194691 0.564761 0.282161 0.262177 0.197029 0.258633 0.303689 0.320259 0.280676 0.095375 0.760221 0.046118 0.135257 0.058404 0.102208 0.709573 0.026005 0.162214 0.927487 0.013557 0.014689 0.044268 0.893692 0.041750 0.020731 0.043826 0.059832 0.023735 0.019064 0.897368 0.058227 0.029814 0.785149 0.126810 0.095552 0.044589 0.724866 0.134993 0.093235 0.093516 0.718630 0.094619 0.409448 0.364107 0.180535 0.045910 0.394023 0.137857 0.292272 0.175848 0.262644 0.334882 0.147616 0.254859 0.336432 0.149049 0.200899 0.313621 Consensus sequence: HBTHVACAATGGGMDHD Alignment: DDDYCCCATTGTVHABH BTRGGDCARAGGKCA-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 15 Motif name: Tcfcp2l1 Original motif 0.001968 0.925480 0.062715 0.009838 0.069973 0.807513 0.005401 0.117113 0.594508 0.005148 0.275803 0.124540 0.005884 0.023780 0.967149 0.003187 0.175477 0.336270 0.025698 0.462555 0.098385 0.289280 0.062163 0.550171 0.173924 0.397260 0.151174 0.277642 0.357213 0.224939 0.252323 0.165526 0.631540 0.069682 0.190954 0.107824 0.394421 0.051382 0.310497 0.243700 0.003669 0.933219 0.054795 0.008317 0.061719 0.812148 0.002939 0.123194 0.536555 0.007360 0.305937 0.150147 0.012039 0.028993 0.954791 0.004177 Consensus sequence: CCAGYYHVADCCRG Reserve complement motif 0.012039 0.954791 0.028993 0.004177 0.150147 0.007360 0.305937 0.536555 0.061719 0.002939 0.812148 0.123194 0.003669 0.054795 0.933219 0.008317 0.243700 0.051382 0.310497 0.394421 0.107824 0.069682 0.190954 0.631540 0.165526 0.224939 0.252323 0.357213 0.173924 0.151174 0.397260 0.277642 0.550171 0.289280 0.062163 0.098385 0.462555 0.336270 0.025698 0.175477 0.005884 0.967149 0.023780 0.003187 0.124540 0.005148 0.275803 0.594508 0.069973 0.005401 0.807513 0.117113 0.001968 0.062715 0.925480 0.009838 Consensus sequence: CKGGDTBDMMCTGG ************************************************************************ Best Matches for Motif ID 15 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00032 Gata3_secondary Original Motif Original Motif Backward 5 14 0.052725 Species: Mus musculus Original motif 0.177641 0.319872 0.115137 0.387350 0.136644 0.182137 0.205873 0.475347 0.254263 0.244280 0.165207 0.336250 0.240415 0.207557 0.237497 0.314530 0.271041 0.214702 0.364395 0.149863 0.095475 0.320104 0.191738 0.392682 0.500902 0.142722 0.026556 0.329820 0.051221 0.023698 0.897245 0.027836 0.922410 0.027509 0.024058 0.026023 0.030735 0.070903 0.024248 0.874114 0.242120 0.231992 0.225143 0.300745 0.106956 0.220471 0.283490 0.389083 0.152079 0.165830 0.135066 0.547025 0.839205 0.051581 0.060119 0.049095 0.041204 0.069147 0.070830 0.818819 0.051861 0.848177 0.027599 0.072363 0.383793 0.016807 0.397470 0.201931 0.381899 0.215846 0.255908 0.146347 0.094792 0.358651 0.280905 0.265652 0.296132 0.181545 0.178433 0.343890 0.301997 0.254722 0.108566 0.334714 0.349481 0.270693 0.137507 0.242319 Consensus sequence: HBHDVBWGATHBTATCRVBHHH Reverse complement motif 0.242319 0.270693 0.137507 0.349481 0.334714 0.254722 0.108566 0.301997 0.343890 0.181545 0.178433 0.296132 0.094792 0.280905 0.358651 0.265652 0.146347 0.215846 0.255908 0.381899 0.383793 0.397470 0.016807 0.201931 0.051861 0.027599 0.848177 0.072363 0.818819 0.069147 0.070830 0.041204 0.049095 0.051581 0.060119 0.839205 0.547025 0.165830 0.135066 0.152079 0.389083 0.220471 0.283490 0.106956 0.300745 0.231992 0.225143 0.242120 0.874114 0.070903 0.024248 0.030735 0.026023 0.027509 0.024058 0.922410 0.051221 0.897245 0.023698 0.027836 0.329820 0.142722 0.026556 0.500902 0.392682 0.320104 0.191738 0.095475 0.271041 0.364395 0.214702 0.149863 0.314530 0.207557 0.237497 0.240415 0.336250 0.244280 0.165207 0.254263 0.475347 0.182137 0.205873 0.136644 0.387350 0.319872 0.115137 0.177641 Consensus sequence: HHHBBMGATAVHATCWVVDHVH Alignment: HBHDVBWGATHBTATCRVBHHH ----CCAGYYHVADCCRG---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v016060_secondary Original Motif Original Motif Backward 1 14 0.055169 Species: Mus musculus Original motif 0.533199 0.080715 0.330435 0.055650 0.152031 0.212841 0.110234 0.524893 0.223934 0.264217 0.087037 0.424811 0.115097 0.339994 0.343861 0.201048 0.124993 0.418259 0.365642 0.091106 0.158365 0.292428 0.088361 0.460847 0.165479 0.561778 0.022254 0.250489 0.136873 0.259822 0.579763 0.023543 0.109570 0.747495 0.055128 0.087807 0.061912 0.792986 0.109031 0.036071 0.508703 0.267806 0.169766 0.053725 0.040912 0.838888 0.057470 0.062730 0.330554 0.606077 0.016192 0.047177 0.068079 0.563969 0.029742 0.338209 0.388799 0.291667 0.191284 0.128249 0.183283 0.578079 0.171100 0.067538 0.165163 0.097206 0.631377 0.106253 0.128564 0.435496 0.253275 0.182665 0.103395 0.088222 0.234758 0.573625 0.432879 0.276641 0.155895 0.134585 0.339199 0.148928 0.311036 0.200836 0.211958 0.298526 0.158443 0.331072 Consensus sequence: RTHBSYCGCCMCMYVCGBTVDH Reverse complement motif 0.331072 0.298526 0.158443 0.211958 0.200836 0.148928 0.311036 0.339199 0.134585 0.276641 0.155895 0.432879 0.573625 0.088222 0.234758 0.103395 0.128564 0.253275 0.435496 0.182665 0.165163 0.631377 0.097206 0.106253 0.183283 0.171100 0.578079 0.067538 0.128249 0.291667 0.191284 0.388799 0.068079 0.029742 0.563969 0.338209 0.330554 0.016192 0.606077 0.047177 0.040912 0.057470 0.838888 0.062730 0.053725 0.267806 0.169766 0.508703 0.061912 0.109031 0.792986 0.036071 0.109570 0.055128 0.747495 0.087807 0.136873 0.579763 0.259822 0.023543 0.165479 0.022254 0.561778 0.250489 0.460847 0.292428 0.088361 0.158365 0.124993 0.365642 0.418259 0.091106 0.115097 0.343861 0.339994 0.201048 0.424811 0.264217 0.087037 0.223934 0.524893 0.212841 0.110234 0.152031 0.055650 0.080715 0.330435 0.533199 Consensus sequence: HDBABCGBKRGYGGCGMSBHAK Alignment: RTHBSYCGCCMCMYVCGBTVDH --------CCAGYYHVADCCRG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00005 Tcfap2a_secondary Original Motif Original Motif Backward 1 14 0.056098 Species: Mus musculus Original motif 0.198427 0.243196 0.159241 0.399136 0.267754 0.388187 0.116811 0.227248 0.448284 0.056403 0.414623 0.080691 0.031469 0.826323 0.055436 0.086772 0.035527 0.756642 0.022985 0.184845 0.127338 0.316078 0.155806 0.400778 0.135021 0.313650 0.287760 0.263570 0.418892 0.082297 0.068352 0.430460 0.201062 0.044735 0.711358 0.042845 0.038934 0.022320 0.903763 0.034982 0.201790 0.065554 0.460526 0.272130 0.006890 0.786923 0.061853 0.144334 0.460666 0.103658 0.196452 0.239224 0.092272 0.204611 0.390375 0.312742 Consensus sequence: HHRCCBBWGGDCDB Reverse complement motif 0.092272 0.390375 0.204611 0.312742 0.239224 0.103658 0.196452 0.460666 0.006890 0.061853 0.786923 0.144334 0.201790 0.460526 0.065554 0.272130 0.038934 0.903763 0.022320 0.034982 0.201062 0.711358 0.044735 0.042845 0.430460 0.082297 0.068352 0.418892 0.135021 0.287760 0.313650 0.263570 0.400778 0.316078 0.155806 0.127338 0.035527 0.022985 0.756642 0.184845 0.031469 0.055436 0.826323 0.086772 0.080691 0.056403 0.414623 0.448284 0.267754 0.116811 0.388187 0.227248 0.399136 0.243196 0.159241 0.198427 Consensus sequence: BDGHCCWBVGGKDH Alignment: HHRCCBBWGGDCDB CCAGYYHVADCCRG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00013 Gabpa_secondary Original Motif Original Motif Backward 3 14 0.056647 Species: Mus musculus Original motif 0.233133 0.551828 0.139009 0.076030 0.100085 0.525562 0.101688 0.272665 0.252996 0.198121 0.299171 0.249711 0.141471 0.195290 0.234560 0.428679 0.160993 0.442765 0.082653 0.313590 0.307890 0.127950 0.071713 0.492448 0.093453 0.148935 0.080288 0.677324 0.083535 0.634212 0.074652 0.207601 0.098119 0.639328 0.099957 0.162596 0.067430 0.451776 0.357188 0.123606 0.286259 0.466975 0.063013 0.183753 0.203211 0.422637 0.133368 0.240783 0.111206 0.315595 0.192833 0.380366 0.199462 0.324652 0.305491 0.170395 0.347919 0.292387 0.230724 0.128970 0.254648 0.294196 0.194942 0.256214 Consensus sequence: CYDBYWTCCSMHBVVH Reverse complement motif 0.254648 0.194942 0.294196 0.256214 0.128970 0.292387 0.230724 0.347919 0.199462 0.305491 0.324652 0.170395 0.380366 0.315595 0.192833 0.111206 0.203211 0.133368 0.422637 0.240783 0.286259 0.063013 0.466975 0.183753 0.067430 0.357188 0.451776 0.123606 0.098119 0.099957 0.639328 0.162596 0.083535 0.074652 0.634212 0.207601 0.677324 0.148935 0.080288 0.093453 0.492448 0.127950 0.071713 0.307890 0.160993 0.082653 0.442765 0.313590 0.428679 0.195290 0.234560 0.141471 0.252996 0.299171 0.198121 0.249711 0.100085 0.101688 0.525562 0.272665 0.233133 0.139009 0.551828 0.076030 Consensus sequence: DBVVDRSGGAWKVHKG Alignment: CYDBYWTCCSMHBVVH CCAGYYHVADCCRG-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00075 Sox15_secondary Original Motif Reverse Complement Backward 1 14 0.057764 Species: Mus musculus Original motif 0.110714 0.252497 0.291511 0.345278 0.164622 0.184062 0.190197 0.461119 0.287350 0.199874 0.330362 0.182414 0.616693 0.089218 0.166132 0.127957 0.525717 0.258234 0.059744 0.156305 0.083274 0.096411 0.076805 0.743510 0.049512 0.096815 0.691840 0.161833 0.410479 0.121470 0.156168 0.311883 0.522715 0.308171 0.070073 0.099041 0.708200 0.050818 0.138346 0.102635 0.095092 0.056144 0.158664 0.690100 0.126419 0.145616 0.080224 0.647741 0.167179 0.424187 0.154592 0.254042 0.222121 0.318065 0.377920 0.081893 0.532720 0.168320 0.257188 0.041771 Consensus sequence: BBVAATGDMATTHVA Reverse complement motif 0.041771 0.168320 0.257188 0.532720 0.222121 0.377920 0.318065 0.081893 0.167179 0.154592 0.424187 0.254042 0.647741 0.145616 0.080224 0.126419 0.690100 0.056144 0.158664 0.095092 0.102635 0.050818 0.138346 0.708200 0.099041 0.308171 0.070073 0.522715 0.311883 0.121470 0.156168 0.410479 0.049512 0.691840 0.096815 0.161833 0.743510 0.096411 0.076805 0.083274 0.156305 0.258234 0.059744 0.525717 0.127957 0.089218 0.166132 0.616693 0.287350 0.330362 0.199874 0.182414 0.461119 0.184062 0.190197 0.164622 0.345278 0.252497 0.291511 0.110714 Consensus sequence: TVDAATYDCATTVVV Alignment: BBVAATGDMATTHVA -CCAGYYHVADCCRG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00096 Sox13_secondary Reverse Complement Original Motif Forward 4 14 0.058789 Species: Mus musculus Original motif 0.262581 0.115233 0.405525 0.216661 0.246681 0.142854 0.145056 0.465409 0.341041 0.154355 0.306628 0.197976 0.242211 0.263918 0.113187 0.380684 0.119326 0.241913 0.117198 0.521563 0.054120 0.036135 0.784219 0.125525 0.076634 0.048399 0.788586 0.086381 0.215316 0.044119 0.663927 0.076638 0.248538 0.159141 0.015452 0.576869 0.047049 0.083570 0.788798 0.080583 0.071948 0.035098 0.768849 0.124105 0.123777 0.030383 0.713425 0.132415 0.294760 0.182119 0.181553 0.341567 0.516589 0.129377 0.116698 0.237336 0.350326 0.186505 0.112598 0.350571 0.311469 0.198085 0.147986 0.342460 0.185126 0.130721 0.242572 0.441582 Consensus sequence: DDDHTGGGTGGGHAHHD Reverse complement motif 0.441582 0.130721 0.242572 0.185126 0.342460 0.198085 0.147986 0.311469 0.350571 0.186505 0.112598 0.350326 0.237336 0.129377 0.116698 0.516589 0.341567 0.182119 0.181553 0.294760 0.123777 0.713425 0.030383 0.132415 0.071948 0.768849 0.035098 0.124105 0.047049 0.788798 0.083570 0.080583 0.576869 0.159141 0.015452 0.248538 0.215316 0.663927 0.044119 0.076638 0.076634 0.788586 0.048399 0.086381 0.054120 0.784219 0.036135 0.125525 0.521563 0.241913 0.117198 0.119326 0.380684 0.263918 0.113187 0.242211 0.197976 0.154355 0.306628 0.341041 0.465409 0.142854 0.145056 0.246681 0.262581 0.405525 0.115233 0.216661 Consensus sequence: DHHTHCCCACCCAHDDH Alignment: DDDHTGGGTGGGHAHHD ---CKGGDTBDMMCTGG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00034 Sox7_secondary Original Motif Reverse Complement Forward 3 14 0.059024 Species: Mus musculus Original motif 0.067627 0.131333 0.654425 0.146615 0.156488 0.114442 0.145630 0.583441 0.206450 0.265630 0.358017 0.169903 0.090729 0.460713 0.274712 0.173847 0.285994 0.099998 0.154485 0.459523 0.635908 0.184787 0.072982 0.106323 0.748421 0.039204 0.092605 0.119769 0.081342 0.061327 0.044532 0.812799 0.143120 0.043879 0.024216 0.788785 0.247544 0.092102 0.621453 0.038901 0.295531 0.036295 0.027594 0.640580 0.194561 0.305468 0.339916 0.160055 0.175038 0.193568 0.101212 0.530182 0.145226 0.167488 0.559871 0.127415 0.271501 0.237429 0.206701 0.284369 0.216834 0.109191 0.569605 0.104370 0.182624 0.177160 0.300475 0.339742 0.331737 0.198645 0.265137 0.204482 0.230155 0.359365 0.183450 0.227029 0.056581 0.067297 0.463052 0.413070 0.198891 0.324626 0.304424 0.172059 0.181968 0.287547 0.202419 0.328066 Consensus sequence: GTVBDAATTGTVTGHGDDHKVB Reverse complement motif 0.328066 0.287547 0.202419 0.181968 0.198891 0.304424 0.324626 0.172059 0.056581 0.463052 0.067297 0.413070 0.230155 0.183450 0.359365 0.227029 0.204482 0.198645 0.265137 0.331737 0.339742 0.177160 0.300475 0.182624 0.216834 0.569605 0.109191 0.104370 0.284369 0.237429 0.206701 0.271501 0.145226 0.559871 0.167488 0.127415 0.530182 0.193568 0.101212 0.175038 0.194561 0.339916 0.305468 0.160055 0.640580 0.036295 0.027594 0.295531 0.247544 0.621453 0.092102 0.038901 0.788785 0.043879 0.024216 0.143120 0.812799 0.061327 0.044532 0.081342 0.119769 0.039204 0.092605 0.748421 0.106323 0.184787 0.072982 0.635908 0.459523 0.099998 0.154485 0.285994 0.090729 0.274712 0.460713 0.173847 0.206450 0.358017 0.265630 0.169903 0.583441 0.114442 0.145630 0.156488 0.067627 0.654425 0.131333 0.146615 Consensus sequence: VVYDDDCHCAVACAATTDBVAC Alignment: VVYDDDCHCAVACAATTDBVAC --CCAGYYHVADCCRG------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v016060_secondary Original Motif Original Motif Forward 9 14 0.059690 Species: Mus musculus Original motif 0.168550 0.345968 0.396524 0.088958 0.038113 0.360882 0.114042 0.486963 0.349356 0.180599 0.051416 0.418629 0.258773 0.332518 0.244932 0.163778 0.371663 0.208591 0.263136 0.156609 0.225440 0.321741 0.175932 0.276887 0.100827 0.656850 0.018644 0.223679 0.494140 0.155427 0.327424 0.023009 0.105642 0.805846 0.027712 0.060800 0.065110 0.845072 0.058046 0.031772 0.649343 0.110180 0.180680 0.059797 0.064269 0.853604 0.066860 0.015268 0.437421 0.533797 0.016833 0.011948 0.121694 0.787708 0.016177 0.074421 0.625382 0.066925 0.266070 0.041623 0.117819 0.608153 0.165139 0.108889 0.145639 0.102001 0.604926 0.147434 0.521188 0.184986 0.064607 0.229219 0.180371 0.274237 0.096591 0.448801 0.071055 0.455813 0.332817 0.140315 0.084503 0.199982 0.448293 0.267222 0.389451 0.169545 0.155507 0.285497 0.424314 0.227621 0.101210 0.246855 Consensus sequence: VYWVVHCRCCACMCACGAHSBHH Reverse complement motif 0.246855 0.227621 0.101210 0.424314 0.285497 0.169545 0.155507 0.389451 0.084503 0.448293 0.199982 0.267222 0.071055 0.332817 0.455813 0.140315 0.448801 0.274237 0.096591 0.180371 0.229219 0.184986 0.064607 0.521188 0.145639 0.604926 0.102001 0.147434 0.117819 0.165139 0.608153 0.108889 0.041623 0.066925 0.266070 0.625382 0.121694 0.016177 0.787708 0.074421 0.437421 0.016833 0.533797 0.011948 0.064269 0.066860 0.853604 0.015268 0.059797 0.110180 0.180680 0.649343 0.065110 0.058046 0.845072 0.031772 0.105642 0.027712 0.805846 0.060800 0.023009 0.155427 0.327424 0.494140 0.100827 0.018644 0.656850 0.223679 0.225440 0.175932 0.321741 0.276887 0.156609 0.208591 0.263136 0.371663 0.258773 0.244932 0.332518 0.163778 0.418629 0.180599 0.051416 0.349356 0.486963 0.360882 0.114042 0.038113 0.168550 0.396524 0.345968 0.088958 Consensus sequence: HHBSHTCGTGRGTGGKGDBVWMV Alignment: VYWVVHCRCCACMCACGAHSBHH --------CCAGYYHVADCCRG- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v015681_primary Original Motif Original Motif Backward 1 14 0.059769 Species: Mus musculus Original motif 0.183797 0.268049 0.330111 0.218043 0.127599 0.330310 0.243614 0.298477 0.143199 0.188046 0.268593 0.400162 0.214690 0.205230 0.247090 0.332990 0.294688 0.299104 0.327152 0.079056 0.221909 0.193223 0.480155 0.104712 0.444072 0.068239 0.481838 0.005852 0.006182 0.015429 0.901278 0.077111 0.766535 0.111138 0.121632 0.000696 0.014848 0.973961 0.000298 0.010893 0.001807 0.992200 0.002669 0.003324 0.795344 0.140510 0.018576 0.045571 0.006990 0.988200 0.002510 0.002299 0.154898 0.842296 0.000998 0.001808 0.029577 0.919262 0.006935 0.044226 0.677987 0.032075 0.185065 0.104874 0.195132 0.364580 0.319321 0.120967 0.225412 0.115034 0.612849 0.046705 0.548628 0.058900 0.162857 0.229616 0.112531 0.340331 0.165910 0.381227 0.073029 0.303078 0.363896 0.259997 0.561485 0.260567 0.092979 0.084969 0.132283 0.457691 0.140159 0.269867 Consensus sequence: BBBDVVRGACCACCCAVGABBAB Reverse complement motif 0.132283 0.140159 0.457691 0.269867 0.084969 0.260567 0.092979 0.561485 0.073029 0.363896 0.303078 0.259997 0.381227 0.340331 0.165910 0.112531 0.229616 0.058900 0.162857 0.548628 0.225412 0.612849 0.115034 0.046705 0.195132 0.319321 0.364580 0.120967 0.104874 0.032075 0.185065 0.677987 0.029577 0.006935 0.919262 0.044226 0.154898 0.000998 0.842296 0.001808 0.006990 0.002510 0.988200 0.002299 0.045571 0.140510 0.018576 0.795344 0.001807 0.002669 0.992200 0.003324 0.014848 0.000298 0.973961 0.010893 0.000696 0.111138 0.121632 0.766535 0.006182 0.901278 0.015429 0.077111 0.444072 0.481838 0.068239 0.005852 0.221909 0.480155 0.193223 0.104712 0.294688 0.327152 0.299104 0.079056 0.332990 0.205230 0.247090 0.214690 0.400162 0.188046 0.268593 0.143199 0.127599 0.243614 0.330310 0.298477 0.183797 0.330111 0.268049 0.218043 Consensus sequence: BTBVTCVTGGGTGGTCMVVDVBB Alignment: BBBDVVRGACCACCCAVGABBAB ---------CCAGYYHVADCCRG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v015681_secondary Reverse Complement Original Motif Backward 2 14 0.059836 Species: Mus musculus Original motif 0.331499 0.188505 0.182841 0.297156 0.328961 0.213025 0.273530 0.184484 0.197213 0.129292 0.524914 0.148581 0.274491 0.226406 0.312118 0.186986 0.103231 0.393726 0.364988 0.138055 0.552594 0.166422 0.186262 0.094722 0.157618 0.064773 0.616497 0.161112 0.139166 0.176098 0.621185 0.063551 0.748420 0.062398 0.012447 0.176735 0.116584 0.009438 0.860326 0.013653 0.005030 0.003646 0.974877 0.016447 0.055257 0.007181 0.921760 0.015802 0.032748 0.058249 0.052709 0.856293 0.105606 0.872231 0.014370 0.007793 0.019480 0.497379 0.125899 0.357242 0.478582 0.269713 0.061464 0.190242 0.253985 0.287006 0.201320 0.257689 0.319384 0.210231 0.175842 0.294543 0.222123 0.287802 0.201294 0.288782 0.139951 0.376041 0.081133 0.402875 0.213450 0.343835 0.383676 0.059039 0.322294 0.355918 0.148062 0.173725 Consensus sequence: HVGVSAGGAGGGTCYHHHHYVH Reverse complement motif 0.322294 0.148062 0.355918 0.173725 0.213450 0.383676 0.343835 0.059039 0.402875 0.376041 0.081133 0.139951 0.288782 0.287802 0.201294 0.222123 0.294543 0.210231 0.175842 0.319384 0.253985 0.201320 0.287006 0.257689 0.190242 0.269713 0.061464 0.478582 0.019480 0.125899 0.497379 0.357242 0.105606 0.014370 0.872231 0.007793 0.856293 0.058249 0.052709 0.032748 0.055257 0.921760 0.007181 0.015802 0.005030 0.974877 0.003646 0.016447 0.116584 0.860326 0.009438 0.013653 0.176735 0.062398 0.012447 0.748420 0.139166 0.621185 0.176098 0.063551 0.157618 0.616497 0.064773 0.161112 0.094722 0.166422 0.186262 0.552594 0.103231 0.364988 0.393726 0.138055 0.274491 0.312118 0.226406 0.186986 0.197213 0.524914 0.129292 0.148581 0.184484 0.213025 0.273530 0.328961 0.297156 0.188505 0.182841 0.331499 Consensus sequence: DVMHHDHKGACCCTCCTSVCBH Alignment: HVGVSAGGAGGGTCYHHHHYVH -------CKGGDTBDMMCTGG- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 16 Motif name: CTCF Original motif 0.095290 0.318729 0.083242 0.502738 0.182913 0.158817 0.453450 0.204819 0.307777 0.053669 0.491785 0.146769 0.061336 0.876232 0.023001 0.039430 0.008762 0.989047 0.000000 0.002191 0.814896 0.014239 0.071194 0.099671 0.043812 0.578313 0.365827 0.012048 0.117325 0.474781 0.052632 0.355263 0.933114 0.012061 0.035088 0.019737 0.005488 0.000000 0.991218 0.003293 0.365532 0.003293 0.621295 0.009879 0.059276 0.013172 0.553238 0.374314 0.013187 0.000000 0.978022 0.008791 0.061538 0.008791 0.851648 0.078022 0.114411 0.806381 0.005501 0.073707 0.409241 0.014301 0.557756 0.018702 0.090308 0.530837 0.338106 0.040749 0.128855 0.354626 0.080396 0.436123 0.442731 0.199339 0.292952 0.064978 Consensus sequence: YDRCCASYAGRKGGCRSYV Reserve complement motif 0.064978 0.199339 0.292952 0.442731 0.436123 0.354626 0.080396 0.128855 0.090308 0.338106 0.530837 0.040749 0.409241 0.557756 0.014301 0.018702 0.114411 0.005501 0.806381 0.073707 0.061538 0.851648 0.008791 0.078022 0.013187 0.978022 0.000000 0.008791 0.059276 0.553238 0.013172 0.374314 0.365532 0.621295 0.003293 0.009879 0.005488 0.991218 0.000000 0.003293 0.019737 0.012061 0.035088 0.933114 0.117325 0.052632 0.474781 0.355263 0.043812 0.365827 0.578313 0.012048 0.099671 0.014239 0.071194 0.814896 0.008762 0.000000 0.989047 0.002191 0.061336 0.023001 0.876232 0.039430 0.307777 0.491785 0.053669 0.146769 0.182913 0.453450 0.158817 0.204819 0.502738 0.318729 0.083242 0.095290 Consensus sequence: BMSMGCCYMCTKSTGGMHM ************************************************************************ Best Matches for Motif ID 16 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00400 Zif268 Reverse Complement Original Motif Backward 1 19 0.040937 Species: Mus musculus Original motif 0.104824 0.412716 0.254506 0.227955 0.644922 0.065476 0.140479 0.149122 0.201205 0.166164 0.347131 0.285501 0.360606 0.256316 0.150766 0.232313 0.199831 0.240681 0.279350 0.280137 0.234308 0.204076 0.321306 0.240310 0.274112 0.462435 0.111425 0.152028 0.067070 0.717501 0.073934 0.141496 0.106745 0.084442 0.658566 0.150247 0.025128 0.967053 0.003585 0.004234 0.006412 0.982989 0.003227 0.007371 0.009588 0.877620 0.002571 0.110221 0.621521 0.355443 0.015669 0.007366 0.002600 0.980275 0.004191 0.012934 0.118773 0.026658 0.783843 0.070725 0.022358 0.822101 0.024684 0.130857 0.713212 0.080912 0.128793 0.077084 0.166568 0.250955 0.107934 0.474544 0.225040 0.222494 0.163301 0.389166 0.268976 0.223206 0.265314 0.242504 0.137052 0.229058 0.148439 0.485451 0.135819 0.304550 0.141994 0.417637 0.272440 0.319501 0.230580 0.177478 Consensus sequence: BADHBDHCGCCCMCGCAHHDBBV Reverse complement motif 0.272440 0.230580 0.319501 0.177478 0.417637 0.304550 0.141994 0.135819 0.485451 0.229058 0.148439 0.137052 0.242504 0.223206 0.265314 0.268976 0.389166 0.222494 0.163301 0.225040 0.474544 0.250955 0.107934 0.166568 0.077084 0.080912 0.128793 0.713212 0.022358 0.024684 0.822101 0.130857 0.118773 0.783843 0.026658 0.070725 0.002600 0.004191 0.980275 0.012934 0.007366 0.355443 0.015669 0.621521 0.009588 0.002571 0.877620 0.110221 0.006412 0.003227 0.982989 0.007371 0.025128 0.003585 0.967053 0.004234 0.106745 0.658566 0.084442 0.150247 0.067070 0.073934 0.717501 0.141496 0.274112 0.111425 0.462435 0.152028 0.234308 0.321306 0.204076 0.240310 0.280137 0.240681 0.279350 0.199831 0.232313 0.256316 0.150766 0.360606 0.201205 0.347131 0.166164 0.285501 0.149122 0.065476 0.140479 0.644922 0.104824 0.254506 0.412716 0.227955 Consensus sequence: VVVDHHTGCGYGGGCGDHVHHTB Alignment: BADHBDHCGCCCMCGCAHHDBBV ----BMSMGCCYMCTKSTGGMHM ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v016060_secondary Original Motif Original Motif Backward 4 19 0.040982 Species: Mus musculus Original motif 0.319838 0.171199 0.138099 0.370865 0.269358 0.196600 0.346909 0.187133 0.176807 0.338888 0.193903 0.290402 0.230268 0.119645 0.310500 0.339587 0.517372 0.257658 0.111673 0.113296 0.159477 0.126524 0.561119 0.152879 0.117072 0.553013 0.130919 0.198996 0.073372 0.163548 0.525014 0.238066 0.143608 0.186896 0.170528 0.498967 0.054943 0.079034 0.722992 0.143031 0.048852 0.015134 0.852458 0.083556 0.029001 0.023938 0.918900 0.028160 0.036727 0.092645 0.090591 0.780037 0.017757 0.057598 0.895222 0.029423 0.026113 0.048113 0.879744 0.046030 0.023041 0.787043 0.123490 0.066426 0.579766 0.004868 0.296873 0.118493 0.303862 0.042931 0.290151 0.363055 0.099672 0.237431 0.262301 0.400597 0.217788 0.163908 0.367628 0.250676 0.450783 0.141108 0.226137 0.181972 0.485086 0.102553 0.242662 0.169700 0.109057 0.454222 0.145665 0.291056 Consensus sequence: HVBDAGCGBGGGTGGCRDBDDDB Reverse complement motif 0.109057 0.145665 0.454222 0.291056 0.169700 0.102553 0.242662 0.485086 0.181972 0.141108 0.226137 0.450783 0.217788 0.367628 0.163908 0.250676 0.400597 0.237431 0.262301 0.099672 0.363055 0.042931 0.290151 0.303862 0.118493 0.004868 0.296873 0.579766 0.023041 0.123490 0.787043 0.066426 0.026113 0.879744 0.048113 0.046030 0.017757 0.895222 0.057598 0.029423 0.780037 0.092645 0.090591 0.036727 0.029001 0.918900 0.023938 0.028160 0.048852 0.852458 0.015134 0.083556 0.054943 0.722992 0.079034 0.143031 0.498967 0.186896 0.170528 0.143608 0.073372 0.525014 0.163548 0.238066 0.117072 0.130919 0.553013 0.198996 0.159477 0.561119 0.126524 0.152879 0.113296 0.257658 0.111673 0.517372 0.339587 0.119645 0.310500 0.230268 0.176807 0.193903 0.338888 0.290402 0.269358 0.346909 0.196600 0.187133 0.370865 0.171199 0.138099 0.319838 Consensus sequence: BDDHVDKGCCACCCVCGCTDBVH Alignment: HVBDAGCGBGGGTGGCRDBDDDB -YDRCCASYAGRKGGCRSYV--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v015681_secondary Reverse Complement Reverse Complement Backward 1 19 0.043195 Species: Mus musculus Original motif 0.214165 0.143436 0.372522 0.269876 0.314445 0.406003 0.160351 0.119201 0.137147 0.092924 0.042921 0.727007 0.044121 0.072843 0.051741 0.831295 0.261292 0.324124 0.298498 0.116086 0.258125 0.323243 0.263362 0.155271 0.204557 0.589399 0.107153 0.098891 0.371021 0.244027 0.291102 0.093849 0.096327 0.572718 0.011797 0.319159 0.027282 0.046183 0.844519 0.082016 0.018921 0.012887 0.915917 0.052275 0.364793 0.166722 0.084229 0.384256 0.028216 0.011233 0.951056 0.009495 0.054974 0.004738 0.890377 0.049911 0.006802 0.312915 0.134247 0.546036 0.241289 0.628210 0.104788 0.025713 0.237863 0.302807 0.213018 0.246311 0.349399 0.203220 0.086635 0.360746 0.386634 0.144693 0.246895 0.221779 0.425101 0.354676 0.093374 0.126849 0.060272 0.391320 0.104905 0.443503 0.162090 0.190233 0.227433 0.420244 Consensus sequence: DVTTVVCVYGGHGGYCHHDMYB Reverse complement motif 0.420244 0.190233 0.227433 0.162090 0.443503 0.391320 0.104905 0.060272 0.126849 0.354676 0.093374 0.425101 0.221779 0.144693 0.246895 0.386634 0.360746 0.203220 0.086635 0.349399 0.237863 0.213018 0.302807 0.246311 0.241289 0.104788 0.628210 0.025713 0.546036 0.312915 0.134247 0.006802 0.054974 0.890377 0.004738 0.049911 0.028216 0.951056 0.011233 0.009495 0.384256 0.166722 0.084229 0.364793 0.018921 0.915917 0.012887 0.052275 0.027282 0.844519 0.046183 0.082016 0.096327 0.011797 0.572718 0.319159 0.093849 0.244027 0.291102 0.371021 0.204557 0.107153 0.589399 0.098891 0.258125 0.263362 0.323243 0.155271 0.261292 0.298498 0.324124 0.116086 0.831295 0.072843 0.051741 0.044121 0.727007 0.092924 0.042921 0.137147 0.314445 0.160351 0.406003 0.119201 0.214165 0.372522 0.143436 0.269876 Consensus sequence: VMYDHDGMCCHCCKBGVVAAVH Alignment: VMYDHDGMCCHCCKBGVVAAVH ---BMSMGCCYMCTKSTGGMHM ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v016060_secondary Reverse Complement Original Motif Forward 4 19 0.046979 Species: Mus musculus Original motif 0.533199 0.080715 0.330435 0.055650 0.152031 0.212841 0.110234 0.524893 0.223934 0.264217 0.087037 0.424811 0.115097 0.339994 0.343861 0.201048 0.124993 0.418259 0.365642 0.091106 0.158365 0.292428 0.088361 0.460847 0.165479 0.561778 0.022254 0.250489 0.136873 0.259822 0.579763 0.023543 0.109570 0.747495 0.055128 0.087807 0.061912 0.792986 0.109031 0.036071 0.508703 0.267806 0.169766 0.053725 0.040912 0.838888 0.057470 0.062730 0.330554 0.606077 0.016192 0.047177 0.068079 0.563969 0.029742 0.338209 0.388799 0.291667 0.191284 0.128249 0.183283 0.578079 0.171100 0.067538 0.165163 0.097206 0.631377 0.106253 0.128564 0.435496 0.253275 0.182665 0.103395 0.088222 0.234758 0.573625 0.432879 0.276641 0.155895 0.134585 0.339199 0.148928 0.311036 0.200836 0.211958 0.298526 0.158443 0.331072 Consensus sequence: RTHBSYCGCCMCMYVCGBTVDH Reverse complement motif 0.331072 0.298526 0.158443 0.211958 0.200836 0.148928 0.311036 0.339199 0.134585 0.276641 0.155895 0.432879 0.573625 0.088222 0.234758 0.103395 0.128564 0.253275 0.435496 0.182665 0.165163 0.631377 0.097206 0.106253 0.183283 0.171100 0.578079 0.067538 0.128249 0.291667 0.191284 0.388799 0.068079 0.029742 0.563969 0.338209 0.330554 0.016192 0.606077 0.047177 0.040912 0.057470 0.838888 0.062730 0.053725 0.267806 0.169766 0.508703 0.061912 0.109031 0.792986 0.036071 0.109570 0.055128 0.747495 0.087807 0.136873 0.579763 0.259822 0.023543 0.165479 0.022254 0.561778 0.250489 0.460847 0.292428 0.088361 0.158365 0.124993 0.365642 0.418259 0.091106 0.115097 0.343861 0.339994 0.201048 0.424811 0.264217 0.087037 0.223934 0.524893 0.212841 0.110234 0.152031 0.055650 0.080715 0.330435 0.533199 Consensus sequence: HDBABCGBKRGYGGCGMSBHAK Alignment: RTHBSYCGCCMCMYVCGBTVDH ---BMSMGCCYMCTKSTGGMHM ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v016060_primary Original Motif Original Motif Backward 5 19 0.048220 Species: Mus musculus Original motif 0.204923 0.208846 0.365383 0.220848 0.294304 0.300143 0.167287 0.238266 0.109711 0.619514 0.117379 0.153396 0.178979 0.378580 0.230177 0.212264 0.159594 0.542602 0.118178 0.179627 0.125206 0.430074 0.151826 0.292894 0.097692 0.709845 0.116956 0.075506 0.148292 0.565912 0.037632 0.248164 0.077951 0.034190 0.855503 0.032356 0.001657 0.001061 0.971877 0.025405 0.001926 0.001084 0.991712 0.005278 0.033031 0.012001 0.057796 0.897171 0.002723 0.002647 0.993348 0.001281 0.003261 0.000963 0.987199 0.008577 0.000611 0.090925 0.074857 0.833608 0.015299 0.978878 0.004949 0.000874 0.013368 0.600902 0.033485 0.352245 0.231949 0.149575 0.118804 0.499672 0.267580 0.186002 0.371242 0.175176 0.264884 0.223483 0.110082 0.401551 0.221365 0.170121 0.179559 0.428955 0.112997 0.692930 0.139981 0.054092 0.460305 0.207883 0.155111 0.176702 Consensus sequence: BHCBCBCCGGGTGGTCYHVHDCH Reverse complement motif 0.176702 0.207883 0.155111 0.460305 0.112997 0.139981 0.692930 0.054092 0.428955 0.170121 0.179559 0.221365 0.401551 0.223483 0.110082 0.264884 0.267580 0.371242 0.186002 0.175176 0.499672 0.149575 0.118804 0.231949 0.013368 0.033485 0.600902 0.352245 0.015299 0.004949 0.978878 0.000874 0.833608 0.090925 0.074857 0.000611 0.003261 0.987199 0.000963 0.008577 0.002723 0.993348 0.002647 0.001281 0.897171 0.012001 0.057796 0.033031 0.001926 0.991712 0.001084 0.005278 0.001657 0.971877 0.001061 0.025405 0.077951 0.855503 0.034190 0.032356 0.148292 0.037632 0.565912 0.248164 0.097692 0.116956 0.709845 0.075506 0.125206 0.151826 0.430074 0.292894 0.159594 0.118178 0.542602 0.179627 0.178979 0.230177 0.378580 0.212264 0.109711 0.117379 0.619514 0.153396 0.294304 0.167287 0.300143 0.238266 0.204923 0.365383 0.208846 0.220848 Consensus sequence: HGDHVHKGACCACCCGGBGBGDB Alignment: BHCBCBCCGGGTGGTCYHVHDCH YDRCCASYAGRKGGCRSYV---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v016060_secondary Original Motif Reverse Complement Backward 4 19 0.049160 Species: Mus musculus Original motif 0.168550 0.345968 0.396524 0.088958 0.038113 0.360882 0.114042 0.486963 0.349356 0.180599 0.051416 0.418629 0.258773 0.332518 0.244932 0.163778 0.371663 0.208591 0.263136 0.156609 0.225440 0.321741 0.175932 0.276887 0.100827 0.656850 0.018644 0.223679 0.494140 0.155427 0.327424 0.023009 0.105642 0.805846 0.027712 0.060800 0.065110 0.845072 0.058046 0.031772 0.649343 0.110180 0.180680 0.059797 0.064269 0.853604 0.066860 0.015268 0.437421 0.533797 0.016833 0.011948 0.121694 0.787708 0.016177 0.074421 0.625382 0.066925 0.266070 0.041623 0.117819 0.608153 0.165139 0.108889 0.145639 0.102001 0.604926 0.147434 0.521188 0.184986 0.064607 0.229219 0.180371 0.274237 0.096591 0.448801 0.071055 0.455813 0.332817 0.140315 0.084503 0.199982 0.448293 0.267222 0.389451 0.169545 0.155507 0.285497 0.424314 0.227621 0.101210 0.246855 Consensus sequence: VYWVVHCRCCACMCACGAHSBHH Reverse complement motif 0.246855 0.227621 0.101210 0.424314 0.285497 0.169545 0.155507 0.389451 0.084503 0.448293 0.199982 0.267222 0.071055 0.332817 0.455813 0.140315 0.448801 0.274237 0.096591 0.180371 0.229219 0.184986 0.064607 0.521188 0.145639 0.604926 0.102001 0.147434 0.117819 0.165139 0.608153 0.108889 0.041623 0.066925 0.266070 0.625382 0.121694 0.016177 0.787708 0.074421 0.437421 0.016833 0.533797 0.011948 0.064269 0.066860 0.853604 0.015268 0.059797 0.110180 0.180680 0.649343 0.065110 0.058046 0.845072 0.031772 0.105642 0.027712 0.805846 0.060800 0.023009 0.155427 0.327424 0.494140 0.100827 0.018644 0.656850 0.223679 0.225440 0.175932 0.321741 0.276887 0.156609 0.208591 0.263136 0.371663 0.258773 0.244932 0.332518 0.163778 0.418629 0.180599 0.051416 0.349356 0.486963 0.360882 0.114042 0.038113 0.168550 0.396524 0.345968 0.088958 Consensus sequence: HHBSHTCGTGRGTGGKGDBVWMV Alignment: HHBSHTCGTGRGTGGKGDBVWMV -YDRCCASYAGRKGGCRSYV--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v015681_primary Reverse Complement Original Motif Forward 4 19 0.051154 Species: Mus musculus Original motif 0.183797 0.268049 0.330111 0.218043 0.127599 0.330310 0.243614 0.298477 0.143199 0.188046 0.268593 0.400162 0.214690 0.205230 0.247090 0.332990 0.294688 0.299104 0.327152 0.079056 0.221909 0.193223 0.480155 0.104712 0.444072 0.068239 0.481838 0.005852 0.006182 0.015429 0.901278 0.077111 0.766535 0.111138 0.121632 0.000696 0.014848 0.973961 0.000298 0.010893 0.001807 0.992200 0.002669 0.003324 0.795344 0.140510 0.018576 0.045571 0.006990 0.988200 0.002510 0.002299 0.154898 0.842296 0.000998 0.001808 0.029577 0.919262 0.006935 0.044226 0.677987 0.032075 0.185065 0.104874 0.195132 0.364580 0.319321 0.120967 0.225412 0.115034 0.612849 0.046705 0.548628 0.058900 0.162857 0.229616 0.112531 0.340331 0.165910 0.381227 0.073029 0.303078 0.363896 0.259997 0.561485 0.260567 0.092979 0.084969 0.132283 0.457691 0.140159 0.269867 Consensus sequence: BBBDVVRGACCACCCAVGABBAB Reverse complement motif 0.132283 0.140159 0.457691 0.269867 0.084969 0.260567 0.092979 0.561485 0.073029 0.363896 0.303078 0.259997 0.381227 0.340331 0.165910 0.112531 0.229616 0.058900 0.162857 0.548628 0.225412 0.612849 0.115034 0.046705 0.195132 0.319321 0.364580 0.120967 0.104874 0.032075 0.185065 0.677987 0.029577 0.006935 0.919262 0.044226 0.154898 0.000998 0.842296 0.001808 0.006990 0.002510 0.988200 0.002299 0.045571 0.140510 0.018576 0.795344 0.001807 0.002669 0.992200 0.003324 0.014848 0.000298 0.973961 0.010893 0.000696 0.111138 0.121632 0.766535 0.006182 0.901278 0.015429 0.077111 0.444072 0.481838 0.068239 0.005852 0.221909 0.480155 0.193223 0.104712 0.294688 0.327152 0.299104 0.079056 0.332990 0.205230 0.247090 0.214690 0.400162 0.188046 0.268593 0.143199 0.127599 0.243614 0.330310 0.298477 0.183797 0.330111 0.268049 0.218043 Consensus sequence: BTBVTCVTGGGTGGTCMVVDVBB Alignment: BBBDVVRGACCACCCAVGABBAB ---BMSMGCCYMCTKSTGGMHM- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v015681_secondary Original Motif Original Motif Forward 1 19 0.052074 Species: Mus musculus Original motif 0.331499 0.188505 0.182841 0.297156 0.328961 0.213025 0.273530 0.184484 0.197213 0.129292 0.524914 0.148581 0.274491 0.226406 0.312118 0.186986 0.103231 0.393726 0.364988 0.138055 0.552594 0.166422 0.186262 0.094722 0.157618 0.064773 0.616497 0.161112 0.139166 0.176098 0.621185 0.063551 0.748420 0.062398 0.012447 0.176735 0.116584 0.009438 0.860326 0.013653 0.005030 0.003646 0.974877 0.016447 0.055257 0.007181 0.921760 0.015802 0.032748 0.058249 0.052709 0.856293 0.105606 0.872231 0.014370 0.007793 0.019480 0.497379 0.125899 0.357242 0.478582 0.269713 0.061464 0.190242 0.253985 0.287006 0.201320 0.257689 0.319384 0.210231 0.175842 0.294543 0.222123 0.287802 0.201294 0.288782 0.139951 0.376041 0.081133 0.402875 0.213450 0.343835 0.383676 0.059039 0.322294 0.355918 0.148062 0.173725 Consensus sequence: HVGVSAGGAGGGTCYHHHHYVH Reverse complement motif 0.322294 0.148062 0.355918 0.173725 0.213450 0.383676 0.343835 0.059039 0.402875 0.376041 0.081133 0.139951 0.288782 0.287802 0.201294 0.222123 0.294543 0.210231 0.175842 0.319384 0.253985 0.201320 0.287006 0.257689 0.190242 0.269713 0.061464 0.478582 0.019480 0.125899 0.497379 0.357242 0.105606 0.014370 0.872231 0.007793 0.856293 0.058249 0.052709 0.032748 0.055257 0.921760 0.007181 0.015802 0.005030 0.974877 0.003646 0.016447 0.116584 0.860326 0.009438 0.013653 0.176735 0.062398 0.012447 0.748420 0.139166 0.621185 0.176098 0.063551 0.157618 0.616497 0.064773 0.161112 0.094722 0.166422 0.186262 0.552594 0.103231 0.364988 0.393726 0.138055 0.274491 0.312118 0.226406 0.186986 0.197213 0.524914 0.129292 0.148581 0.184484 0.213025 0.273530 0.328961 0.297156 0.188505 0.182841 0.331499 Consensus sequence: DVMHHDHKGACCCTCCTSVCBH Alignment: HVGVSAGGAGGGTCYHHHHYVH YDRCCASYAGRKGGCRSYV--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v015681_secondary Original Motif Reverse Complement Backward 5 19 0.053233 Species: Mus musculus Original motif 0.404007 0.395873 0.173319 0.026801 0.305977 0.215534 0.215359 0.263130 0.370148 0.250957 0.113088 0.265808 0.324336 0.229498 0.174679 0.271487 0.263563 0.137896 0.079217 0.519324 0.265762 0.222582 0.082555 0.429102 0.206721 0.288405 0.017851 0.487023 0.164361 0.236500 0.061051 0.538088 0.593344 0.348446 0.050304 0.007906 0.031328 0.947050 0.007032 0.014590 0.010428 0.956605 0.029142 0.003825 0.459636 0.207616 0.155368 0.177380 0.014573 0.964608 0.012209 0.008610 0.066291 0.918196 0.008729 0.006784 0.019488 0.866774 0.018897 0.094841 0.767405 0.104198 0.029234 0.099164 0.052494 0.772531 0.039832 0.135142 0.296085 0.243498 0.350935 0.109482 0.518843 0.226659 0.124784 0.129714 0.647901 0.019721 0.159901 0.172477 0.113912 0.231511 0.214864 0.439713 0.223117 0.310596 0.293328 0.172959 0.185557 0.487662 0.136321 0.190459 Consensus sequence: MHHHWHYTMCCHCCCACVAABVH Reverse complement motif 0.185557 0.136321 0.487662 0.190459 0.223117 0.293328 0.310596 0.172959 0.439713 0.231511 0.214864 0.113912 0.172477 0.019721 0.159901 0.647901 0.129714 0.226659 0.124784 0.518843 0.296085 0.350935 0.243498 0.109482 0.052494 0.039832 0.772531 0.135142 0.099164 0.104198 0.029234 0.767405 0.019488 0.018897 0.866774 0.094841 0.066291 0.008729 0.918196 0.006784 0.014573 0.012209 0.964608 0.008610 0.177380 0.207616 0.155368 0.459636 0.010428 0.029142 0.956605 0.003825 0.031328 0.007032 0.947050 0.014590 0.007906 0.348446 0.050304 0.593344 0.538088 0.236500 0.061051 0.164361 0.487023 0.288405 0.017851 0.206721 0.429102 0.222582 0.082555 0.265762 0.519324 0.137896 0.079217 0.263563 0.271487 0.229498 0.174679 0.324336 0.265808 0.250957 0.113088 0.370148 0.263130 0.215534 0.215359 0.305977 0.026801 0.395873 0.173319 0.404007 Consensus sequence: DVVTTVGTGGGHGGYAMHWHHHY Alignment: DVVTTVGTGGGHGGYAMHWHHHY YDRCCASYAGRKGGCRSYV---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00050 Bhlhb2_secondary Reverse Complement Reverse Complement Forward 3 19 0.053568 Species: Mus musculus Original motif 0.120938 0.344851 0.124072 0.410138 0.220931 0.169844 0.422396 0.186829 0.127752 0.260812 0.103811 0.507625 0.140641 0.405473 0.287668 0.166218 0.296957 0.155579 0.301094 0.246370 0.219647 0.287193 0.154072 0.339087 0.049294 0.026059 0.121789 0.802859 0.520042 0.289284 0.173423 0.017251 0.049190 0.943472 0.004308 0.003030 0.902609 0.006767 0.074770 0.015854 0.003221 0.971329 0.005512 0.019937 0.019937 0.005512 0.971329 0.003221 0.015854 0.074770 0.006767 0.902609 0.003030 0.004308 0.943472 0.049190 0.003497 0.088920 0.685942 0.221641 0.802859 0.121789 0.026059 0.049294 0.334544 0.155170 0.275193 0.235092 0.275957 0.132104 0.454982 0.136957 0.134097 0.254352 0.422940 0.188611 0.396163 0.432784 0.051281 0.119772 0.276474 0.115627 0.419844 0.188056 0.160759 0.088061 0.649863 0.101318 0.203314 0.166595 0.106821 0.523270 Consensus sequence: YDYBDHTMCACGTGGADDBMDGT Reverse complement motif 0.523270 0.166595 0.106821 0.203314 0.160759 0.649863 0.088061 0.101318 0.276474 0.419844 0.115627 0.188056 0.396163 0.051281 0.432784 0.119772 0.134097 0.422940 0.254352 0.188611 0.275957 0.454982 0.132104 0.136957 0.235092 0.155170 0.275193 0.334544 0.049294 0.121789 0.026059 0.802859 0.003497 0.685942 0.088920 0.221641 0.003030 0.943472 0.004308 0.049190 0.902609 0.074770 0.006767 0.015854 0.019937 0.971329 0.005512 0.003221 0.003221 0.005512 0.971329 0.019937 0.015854 0.006767 0.074770 0.902609 0.049190 0.004308 0.943472 0.003030 0.017251 0.289284 0.173423 0.520042 0.802859 0.026059 0.121789 0.049294 0.339087 0.287193 0.154072 0.219647 0.296957 0.301094 0.155579 0.246370 0.140641 0.287668 0.405473 0.166218 0.507625 0.260812 0.103811 0.127752 0.220931 0.422396 0.169844 0.186829 0.410138 0.344851 0.124072 0.120938 Consensus sequence: ACHRBHDTCCACGTGYAHHBMHM Alignment: ACHRBHDTCCACGTGYAHHBMHM --BMSMGCCYMCTKSTGGMHM-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 2 Motif ID: 17 Motif name: TgTGgTGTCACAGTGCTCC Original motif 0.111111 0.083333 0.055556 0.750000 0.125000 0.097222 0.652778 0.125000 0.041667 0.097222 0.027778 0.833333 0.027778 0.027778 0.791667 0.152778 0.055556 0.166667 0.652778 0.125000 0.000000 0.041667 0.013889 0.944444 0.041667 0.000000 0.888889 0.069444 0.027778 0.027778 0.000000 0.944444 0.041667 0.944444 0.013889 0.000000 0.916667 0.027778 0.000000 0.055556 0.069444 0.875000 0.000000 0.055556 0.833333 0.013889 0.013889 0.138889 0.041667 0.069444 0.819444 0.069444 0.027778 0.027778 0.027778 0.916667 0.069444 0.013889 0.847222 0.069444 0.069444 0.777778 0.027778 0.125000 0.055556 0.041667 0.027778 0.875000 0.041667 0.708333 0.125000 0.125000 0.111111 0.819444 0.055556 0.013889 Consensus sequence: TGTGGTGTCACAGTGCTCC Reserve complement motif 0.111111 0.055556 0.819444 0.013889 0.041667 0.125000 0.708333 0.125000 0.875000 0.041667 0.027778 0.055556 0.069444 0.027778 0.777778 0.125000 0.069444 0.847222 0.013889 0.069444 0.916667 0.027778 0.027778 0.027778 0.041667 0.819444 0.069444 0.069444 0.138889 0.013889 0.013889 0.833333 0.069444 0.000000 0.875000 0.055556 0.055556 0.027778 0.000000 0.916667 0.041667 0.013889 0.944444 0.000000 0.944444 0.027778 0.000000 0.027778 0.041667 0.888889 0.000000 0.069444 0.944444 0.041667 0.013889 0.000000 0.055556 0.652778 0.166667 0.125000 0.027778 0.791667 0.027778 0.152778 0.833333 0.097222 0.027778 0.041667 0.125000 0.652778 0.097222 0.125000 0.750000 0.083333 0.055556 0.111111 Consensus sequence: GGAGCACTGTGACACCACA ************************************************************************ Best Matches for Motif ID 17 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00098 Rfx3_secondary Original Motif Reverse Complement Backward 2 19 0.043204 Species: Mus musculus Original motif 0.314514 0.275352 0.257617 0.152518 0.126939 0.598294 0.130576 0.144192 0.102265 0.155334 0.177957 0.564445 0.129288 0.282678 0.326990 0.261044 0.318166 0.227823 0.175681 0.278330 0.109019 0.380838 0.278328 0.231815 0.226145 0.289206 0.291300 0.193348 0.035863 0.844339 0.072582 0.047216 0.223793 0.187244 0.088092 0.500871 0.039800 0.029681 0.026201 0.904317 0.298298 0.032147 0.654746 0.014809 0.014729 0.022023 0.944826 0.018422 0.485114 0.004925 0.013785 0.496176 0.035708 0.020381 0.240804 0.703108 0.951152 0.012738 0.017886 0.018224 0.023713 0.944394 0.009538 0.022355 0.291067 0.385205 0.232388 0.091339 0.340334 0.199588 0.311526 0.148552 0.198713 0.472138 0.178319 0.150830 0.321155 0.269932 0.311301 0.097612 0.412646 0.195252 0.231950 0.160152 0.297134 0.180928 0.250400 0.271538 0.151169 0.305386 0.358574 0.184871 Consensus sequence: VCTBHBVCTTGGWTACVVVVVDB Reverse complement motif 0.151169 0.358574 0.305386 0.184871 0.271538 0.180928 0.250400 0.297134 0.160152 0.195252 0.231950 0.412646 0.097612 0.269932 0.311301 0.321155 0.198713 0.178319 0.472138 0.150830 0.148552 0.199588 0.311526 0.340334 0.291067 0.232388 0.385205 0.091339 0.023713 0.009538 0.944394 0.022355 0.018224 0.012738 0.017886 0.951152 0.703108 0.020381 0.240804 0.035708 0.496176 0.004925 0.013785 0.485114 0.014729 0.944826 0.022023 0.018422 0.298298 0.654746 0.032147 0.014809 0.904317 0.029681 0.026201 0.039800 0.500871 0.187244 0.088092 0.223793 0.035863 0.072582 0.844339 0.047216 0.226145 0.291300 0.289206 0.193348 0.109019 0.278328 0.380838 0.231815 0.278330 0.227823 0.175681 0.318166 0.129288 0.326990 0.282678 0.261044 0.564445 0.155334 0.177957 0.102265 0.126939 0.130576 0.598294 0.144192 0.152518 0.275352 0.257617 0.314514 Consensus sequence: BDBBVBVGTAWCCAAGVBHBAGB Alignment: BDBBVBVGTAWCCAAGVBHBAGB ---TGTGGTGTCACAGTGCTCC- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v016060_secondary Original Motif Original Motif Forward 6 18 0.553914 Species: Mus musculus Original motif 0.319838 0.171199 0.138099 0.370865 0.269358 0.196600 0.346909 0.187133 0.176807 0.338888 0.193903 0.290402 0.230268 0.119645 0.310500 0.339587 0.517372 0.257658 0.111673 0.113296 0.159477 0.126524 0.561119 0.152879 0.117072 0.553013 0.130919 0.198996 0.073372 0.163548 0.525014 0.238066 0.143608 0.186896 0.170528 0.498967 0.054943 0.079034 0.722992 0.143031 0.048852 0.015134 0.852458 0.083556 0.029001 0.023938 0.918900 0.028160 0.036727 0.092645 0.090591 0.780037 0.017757 0.057598 0.895222 0.029423 0.026113 0.048113 0.879744 0.046030 0.023041 0.787043 0.123490 0.066426 0.579766 0.004868 0.296873 0.118493 0.303862 0.042931 0.290151 0.363055 0.099672 0.237431 0.262301 0.400597 0.217788 0.163908 0.367628 0.250676 0.450783 0.141108 0.226137 0.181972 0.485086 0.102553 0.242662 0.169700 0.109057 0.454222 0.145665 0.291056 Consensus sequence: HVBDAGCGBGGGTGGCRDBDDDB Reverse complement motif 0.109057 0.145665 0.454222 0.291056 0.169700 0.102553 0.242662 0.485086 0.181972 0.141108 0.226137 0.450783 0.217788 0.367628 0.163908 0.250676 0.400597 0.237431 0.262301 0.099672 0.363055 0.042931 0.290151 0.303862 0.118493 0.004868 0.296873 0.579766 0.023041 0.123490 0.787043 0.066426 0.026113 0.879744 0.048113 0.046030 0.017757 0.895222 0.057598 0.029423 0.780037 0.092645 0.090591 0.036727 0.029001 0.918900 0.023938 0.028160 0.048852 0.852458 0.015134 0.083556 0.054943 0.722992 0.079034 0.143031 0.498967 0.186896 0.170528 0.143608 0.073372 0.525014 0.163548 0.238066 0.117072 0.130919 0.553013 0.198996 0.159477 0.561119 0.126524 0.152879 0.113296 0.257658 0.111673 0.517372 0.339587 0.119645 0.310500 0.230268 0.176807 0.193903 0.338888 0.290402 0.269358 0.346909 0.196600 0.187133 0.370865 0.171199 0.138099 0.319838 Consensus sequence: BDDHVDKGCCACCCVCGCTDBVH Alignment: HVBDAGCGBGGGTGGCRDBDDDB- -----TGTGGTGTCACAGTGCTCC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00192 Six1 Reverse Complement Reverse Complement Forward 3 17 1.045284 Species: Mus musculus Original motif 0.319306 0.130147 0.399309 0.151238 0.482636 0.211172 0.085871 0.220321 0.214292 0.085504 0.207353 0.492851 0.392819 0.136859 0.403883 0.066438 0.215886 0.049341 0.685932 0.048842 0.039793 0.053756 0.870240 0.036211 0.202525 0.005026 0.791396 0.001053 0.001092 0.001021 0.052968 0.944919 0.963185 0.001738 0.033596 0.001480 0.002017 0.001886 0.002847 0.993250 0.009914 0.974962 0.001987 0.013137 0.909252 0.021586 0.037899 0.031263 0.177851 0.274190 0.117998 0.429961 0.228906 0.159459 0.303955 0.307681 0.330938 0.158106 0.118706 0.392251 0.160453 0.267920 0.280244 0.291383 0.176707 0.068175 0.229538 0.525580 Consensus sequence: DHDRGGGTATCAHDHBT Reverse complement motif 0.525580 0.068175 0.229538 0.176707 0.291383 0.267920 0.280244 0.160453 0.392251 0.158106 0.118706 0.330938 0.307681 0.159459 0.303955 0.228906 0.429961 0.274190 0.117998 0.177851 0.031263 0.021586 0.037899 0.909252 0.009914 0.001987 0.974962 0.013137 0.993250 0.001886 0.002847 0.002017 0.001480 0.001738 0.033596 0.963185 0.944919 0.001021 0.052968 0.001092 0.202525 0.791396 0.005026 0.001053 0.039793 0.870240 0.053756 0.036211 0.215886 0.685932 0.049341 0.048842 0.392819 0.403883 0.136859 0.066438 0.492851 0.085504 0.207353 0.214292 0.220321 0.211172 0.085871 0.482636 0.319306 0.399309 0.130147 0.151238 Consensus sequence: AVHDHTGATACCCMDHH Alignment: AVHDHTGATACCCMDHH-- --GGAGCACTGTGACACCACA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00193 Rhox11_2205.1 Original Motif Reverse Complement Backward 1 17 1.045899 Species: Mus musculus Original motif 0.504898 0.140204 0.135418 0.219480 0.282348 0.244881 0.300572 0.172199 0.183939 0.100670 0.384783 0.330608 0.326709 0.269523 0.194043 0.209724 0.142989 0.557393 0.066826 0.232792 0.038356 0.014052 0.932450 0.015142 0.092102 0.778844 0.125082 0.003972 0.010254 0.001252 0.005231 0.983263 0.033486 0.000891 0.947486 0.018137 0.005360 0.007407 0.003729 0.983504 0.603485 0.007179 0.003482 0.385853 0.798026 0.029788 0.032370 0.139816 0.529622 0.100632 0.016507 0.353238 0.243581 0.126094 0.401402 0.228923 0.207484 0.285456 0.353715 0.153346 0.282413 0.188410 0.441463 0.087715 0.422774 0.152965 0.094106 0.330155 Consensus sequence: AVDHCGCTGTWAWDVVW Reverse complement motif 0.330155 0.152965 0.094106 0.422774 0.282413 0.441463 0.188410 0.087715 0.207484 0.353715 0.285456 0.153346 0.243581 0.401402 0.126094 0.228923 0.353238 0.100632 0.016507 0.529622 0.139816 0.029788 0.032370 0.798026 0.385853 0.007179 0.003482 0.603485 0.983504 0.007407 0.003729 0.005360 0.033486 0.947486 0.000891 0.018137 0.983263 0.001252 0.005231 0.010254 0.092102 0.125082 0.778844 0.003972 0.038356 0.932450 0.014052 0.015142 0.142989 0.066826 0.557393 0.232792 0.209724 0.269523 0.194043 0.326709 0.183939 0.384783 0.100670 0.330608 0.282348 0.300572 0.244881 0.172199 0.219480 0.140204 0.135418 0.504898 Consensus sequence: WVVHWTWACAGCGHHVT Alignment: --AVDHCGCTGTWAWDVVW TGTGGTGTCACAGTGCTCC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00193 Rhox11_1765.2 Original Motif Reverse Complement Backward 1 17 1.046201 Species: Mus musculus Original motif 0.538735 0.129821 0.147336 0.184107 0.331267 0.275123 0.227609 0.166001 0.174654 0.113319 0.383610 0.328417 0.296734 0.281670 0.230068 0.191527 0.128222 0.561296 0.062928 0.247554 0.027028 0.014676 0.949335 0.008962 0.087209 0.761581 0.147964 0.003246 0.006796 0.000741 0.006037 0.986427 0.039496 0.000533 0.943453 0.016517 0.005541 0.005164 0.002805 0.986489 0.561957 0.002761 0.004207 0.431075 0.780197 0.037155 0.031222 0.151425 0.518642 0.104220 0.012670 0.364468 0.314451 0.111366 0.333508 0.240676 0.236936 0.357992 0.280813 0.124259 0.314846 0.163774 0.426195 0.095185 0.408340 0.134111 0.102987 0.354562 Consensus sequence: AVDVCGCTGTWAWDVVW Reverse complement motif 0.354562 0.134111 0.102987 0.408340 0.314846 0.426195 0.163774 0.095185 0.236936 0.280813 0.357992 0.124259 0.314451 0.333508 0.111366 0.240676 0.364468 0.104220 0.012670 0.518642 0.151425 0.037155 0.031222 0.780197 0.431075 0.002761 0.004207 0.561957 0.986489 0.005164 0.002805 0.005541 0.039496 0.943453 0.000533 0.016517 0.986427 0.000741 0.006037 0.006796 0.087209 0.147964 0.761581 0.003246 0.027028 0.949335 0.014676 0.008962 0.128222 0.062928 0.561296 0.247554 0.191527 0.281670 0.230068 0.296734 0.174654 0.383610 0.113319 0.328417 0.166001 0.275123 0.227609 0.331267 0.184107 0.129821 0.147336 0.538735 Consensus sequence: WVVHWTWACAGCGBHBT Alignment: --WVVHWTWACAGCGBHBT TGTGGTGTCACAGTGCTCC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00068 Eomes_primary Reverse Complement Original Motif Backward 3 17 1.046309 Species: Mus musculus Original motif 0.186316 0.215541 0.297644 0.300499 0.300381 0.234276 0.266283 0.199061 0.317841 0.211418 0.183235 0.287507 0.482598 0.095323 0.245062 0.177017 0.654197 0.008988 0.261951 0.074864 0.095656 0.022883 0.843364 0.038097 0.002655 0.008355 0.976390 0.012600 0.003287 0.080755 0.001057 0.914900 0.006753 0.001517 0.989917 0.001813 0.039940 0.098800 0.003305 0.857955 0.009015 0.039036 0.844029 0.107921 0.984070 0.002369 0.008852 0.004709 0.789505 0.101528 0.029294 0.079672 0.649685 0.139882 0.090466 0.119966 0.421759 0.205595 0.073074 0.299573 0.214779 0.290522 0.134050 0.360649 0.202141 0.270323 0.176798 0.350738 Consensus sequence: BVHDAGGTGTGAAAHHH Reverse complement motif 0.350738 0.270323 0.176798 0.202141 0.360649 0.290522 0.134050 0.214779 0.299573 0.205595 0.073074 0.421759 0.119966 0.139882 0.090466 0.649685 0.079672 0.101528 0.029294 0.789505 0.004709 0.002369 0.008852 0.984070 0.009015 0.844029 0.039036 0.107921 0.857955 0.098800 0.003305 0.039940 0.006753 0.989917 0.001517 0.001813 0.914900 0.080755 0.001057 0.003287 0.002655 0.976390 0.008355 0.012600 0.095656 0.843364 0.022883 0.038097 0.074864 0.008988 0.261951 0.654197 0.177017 0.095323 0.245062 0.482598 0.287507 0.211418 0.183235 0.317841 0.199061 0.234276 0.266283 0.300381 0.300499 0.215541 0.297644 0.186316 Consensus sequence: HHHTTTCACACCTDHBV Alignment: --HHHTTTCACACCTDHBV GGAGCACTGTGACACCACA-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00067 Lef1_primary Reverse Complement Original Motif Forward 2 17 1.048067 Species: Mus musculus Original motif 0.281920 0.214207 0.278077 0.225796 0.325566 0.151435 0.298797 0.224202 0.290253 0.145824 0.243443 0.320480 0.069286 0.404645 0.141614 0.384454 0.070044 0.621448 0.142647 0.165862 0.007295 0.907657 0.038110 0.046938 0.015587 0.018273 0.000658 0.965482 0.005527 0.005886 0.001905 0.986682 0.024512 0.001189 0.001344 0.972955 0.007384 0.025221 0.952270 0.015125 0.966438 0.000630 0.002693 0.030239 0.082252 0.001173 0.001495 0.915080 0.030255 0.677155 0.275323 0.017267 0.199467 0.118815 0.056814 0.624905 0.345445 0.169597 0.216831 0.268127 0.278106 0.150864 0.173693 0.397336 0.251834 0.339733 0.219703 0.188730 Consensus sequence: DDDYCCTTTGATCTDDV Reverse complement motif 0.251834 0.219703 0.339733 0.188730 0.397336 0.150864 0.173693 0.278106 0.268127 0.169597 0.216831 0.345445 0.624905 0.118815 0.056814 0.199467 0.030255 0.275323 0.677155 0.017267 0.915080 0.001173 0.001495 0.082252 0.030239 0.000630 0.002693 0.966438 0.007384 0.952270 0.025221 0.015125 0.972955 0.001189 0.001344 0.024512 0.986682 0.005886 0.001905 0.005527 0.965482 0.018273 0.000658 0.015587 0.007295 0.038110 0.907657 0.046938 0.070044 0.142647 0.621448 0.165862 0.069286 0.141614 0.404645 0.384454 0.320480 0.145824 0.243443 0.290253 0.224202 0.151435 0.298797 0.325566 0.225796 0.214207 0.278077 0.281920 Consensus sequence: VDDAGATCAAAGGKDDD Alignment: VDDAGATCAAAGGKDDD-- -GGAGCACTGTGACACCACA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v015681_primary Reverse Complement Original Motif Forward 3 17 1.048311 Species: Mus musculus Original motif 0.641428 0.180211 0.044767 0.133594 0.171696 0.262981 0.334148 0.231174 0.129726 0.322735 0.243462 0.304077 0.165713 0.175735 0.256108 0.402445 0.146090 0.171890 0.412753 0.269266 0.212837 0.439192 0.280990 0.066980 0.251088 0.275516 0.374380 0.099015 0.575438 0.079656 0.338201 0.006704 0.005634 0.003422 0.972597 0.018348 0.890447 0.077034 0.031851 0.000668 0.007128 0.986862 0.000496 0.005515 0.001445 0.991564 0.001925 0.005066 0.738761 0.190157 0.026399 0.044684 0.013384 0.983783 0.000896 0.001937 0.068077 0.929549 0.000773 0.001602 0.040830 0.933742 0.005283 0.020145 0.730274 0.029225 0.145689 0.094812 0.165032 0.572838 0.162001 0.100129 0.383584 0.129942 0.429497 0.056977 0.455959 0.071959 0.208204 0.263878 0.134271 0.262985 0.222626 0.380117 0.071193 0.346594 0.346081 0.236132 0.445661 0.405278 0.053901 0.095160 Consensus sequence: ABBBBVVRGACCACCCACRDBBM Reverse complement motif 0.095160 0.405278 0.053901 0.445661 0.071193 0.346081 0.346594 0.236132 0.380117 0.262985 0.222626 0.134271 0.263878 0.071959 0.208204 0.455959 0.383584 0.429497 0.129942 0.056977 0.165032 0.162001 0.572838 0.100129 0.094812 0.029225 0.145689 0.730274 0.040830 0.005283 0.933742 0.020145 0.068077 0.000773 0.929549 0.001602 0.013384 0.000896 0.983783 0.001937 0.044684 0.190157 0.026399 0.738761 0.001445 0.001925 0.991564 0.005066 0.007128 0.000496 0.986862 0.005515 0.000668 0.077034 0.031851 0.890447 0.005634 0.972597 0.003422 0.018348 0.006704 0.079656 0.338201 0.575438 0.251088 0.374380 0.275516 0.099015 0.212837 0.280990 0.439192 0.066980 0.146090 0.412753 0.171890 0.269266 0.402445 0.175735 0.256108 0.165713 0.129726 0.243462 0.322735 0.304077 0.171696 0.334148 0.262981 0.231174 0.133594 0.180211 0.044767 0.641428 Consensus sequence: YBVDMGTGGGTGGTCKVVBVBBT Alignment: YBVDMGTGGGTGGTCKVVBVBBT-- --GGAGCACTGTGACACCACA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00053 Rxra_primary Original Motif Original Motif Backward 3 17 1.048667 Species: Mus musculus Original motif 0.235299 0.222264 0.237416 0.305021 0.144778 0.278902 0.341673 0.234648 0.261127 0.261904 0.191591 0.285378 0.119943 0.410774 0.218940 0.250343 0.222672 0.075554 0.365253 0.336521 0.001838 0.046904 0.002828 0.948430 0.030410 0.006359 0.960821 0.002410 0.987391 0.007562 0.002810 0.002237 0.105188 0.888650 0.001163 0.004998 0.006475 0.987074 0.001793 0.004659 0.001816 0.765138 0.003092 0.229953 0.010354 0.846496 0.029899 0.113251 0.328732 0.039382 0.265510 0.366377 0.209638 0.262628 0.145613 0.382121 0.385390 0.177695 0.299828 0.137087 0.403452 0.268924 0.096028 0.231595 0.203082 0.231812 0.213520 0.351585 Consensus sequence: DBHBDTGACCCCDHVHB Reverse complement motif 0.351585 0.231812 0.213520 0.203082 0.231595 0.268924 0.096028 0.403452 0.137087 0.177695 0.299828 0.385390 0.382121 0.262628 0.145613 0.209638 0.366377 0.039382 0.265510 0.328732 0.010354 0.029899 0.846496 0.113251 0.001816 0.003092 0.765138 0.229953 0.006475 0.001793 0.987074 0.004659 0.105188 0.001163 0.888650 0.004998 0.002237 0.007562 0.002810 0.987391 0.030410 0.960821 0.006359 0.002410 0.948430 0.046904 0.002828 0.001838 0.222672 0.365253 0.075554 0.336521 0.119943 0.218940 0.410774 0.250343 0.285378 0.261904 0.191591 0.261127 0.144778 0.341673 0.278902 0.234648 0.305021 0.222264 0.237416 0.235299 Consensus sequence: VHBHDGGGGTCAHBHBD Alignment: --DBHBDTGACCCCDHVHB TGTGGTGTCACAGTGCTCC-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00388 Six6_2267.4 Reverse Complement Reverse Complement Forward 3 17 1.049102 Species: Mus musculus Original motif 0.330559 0.118371 0.278738 0.272331 0.605486 0.104492 0.066247 0.223775 0.180170 0.051522 0.131669 0.636639 0.431457 0.173748 0.323416 0.071378 0.131729 0.037944 0.812991 0.017337 0.022726 0.033975 0.914981 0.028317 0.138556 0.012597 0.847660 0.001188 0.001916 0.001156 0.046653 0.950276 0.965626 0.001518 0.031319 0.001536 0.003782 0.001412 0.002175 0.992631 0.006601 0.979412 0.002328 0.011660 0.947233 0.007670 0.017734 0.027363 0.374066 0.305253 0.063914 0.256767 0.267070 0.210201 0.216997 0.305732 0.294988 0.127424 0.094154 0.483434 0.354130 0.195592 0.176636 0.273642 0.094874 0.110275 0.192261 0.602591 Consensus sequence: DATRGGGTATCAHDWHT Reverse complement motif 0.602591 0.110275 0.192261 0.094874 0.273642 0.195592 0.176636 0.354130 0.483434 0.127424 0.094154 0.294988 0.305732 0.210201 0.216997 0.267070 0.256767 0.305253 0.063914 0.374066 0.027363 0.007670 0.017734 0.947233 0.006601 0.002328 0.979412 0.011660 0.992631 0.001412 0.002175 0.003782 0.001536 0.001518 0.031319 0.965626 0.950276 0.001156 0.046653 0.001916 0.138556 0.847660 0.012597 0.001188 0.022726 0.914981 0.033975 0.028317 0.131729 0.812991 0.037944 0.017337 0.071378 0.173748 0.323416 0.431457 0.636639 0.051522 0.131669 0.180170 0.223775 0.104492 0.066247 0.605486 0.272331 0.118371 0.278738 0.330559 Consensus sequence: AHWDHTGATACCCKATD Alignment: AHWDHTGATACCCKATD-- --GGAGCACTGTGACACCACA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 2 Motif ID: 18 Motif name: sscCCCGCGcs Original motif 0.147059 0.441176 0.264706 0.147059 0.117647 0.529412 0.294118 0.058824 0.000000 0.676471 0.235294 0.088235 0.029412 0.852941 0.117647 0.000000 0.000000 0.823529 0.176471 0.000000 0.000000 0.794118 0.205882 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.058824 0.941176 0.000000 0.117647 0.470588 0.235294 0.176471 0.000000 0.323529 0.529412 0.147059 Consensus sequence: BSCCCCGCGBS Reserve complement motif 0.000000 0.529412 0.323529 0.147059 0.117647 0.235294 0.470588 0.176471 0.000000 0.941176 0.058824 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.205882 0.794118 0.000000 0.000000 0.176471 0.823529 0.000000 0.029412 0.117647 0.852941 0.000000 0.000000 0.235294 0.676471 0.088235 0.117647 0.294118 0.529412 0.058824 0.147059 0.264706 0.441176 0.147059 Consensus sequence: SBCGCGGGGSB ************************************************************************ Best Matches for Motif ID 18 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00000 Smad3_secondary Reverse Complement Reverse Complement Forward 5 11 0.009342 Species: Mus musculus Original motif 0.150668 0.131779 0.245665 0.471887 0.316817 0.287314 0.150829 0.245040 0.256473 0.409066 0.109700 0.224761 0.210646 0.220222 0.345010 0.224122 0.166679 0.508939 0.081676 0.242705 0.049351 0.759380 0.088489 0.102780 0.047598 0.785546 0.121957 0.044898 0.004606 0.944933 0.034696 0.015764 0.040252 0.050652 0.890382 0.018713 0.003038 0.913699 0.022449 0.060814 0.028672 0.941477 0.012276 0.017575 0.635243 0.139731 0.110495 0.114531 0.240016 0.385948 0.182848 0.191188 0.210430 0.274127 0.085171 0.430272 0.088118 0.454598 0.208989 0.248295 0.181269 0.265028 0.149023 0.404680 0.101070 0.252682 0.368542 0.277706 Consensus sequence: DHHBCCCCGCCAHHBHB Reverse complement motif 0.101070 0.368542 0.252682 0.277706 0.404680 0.265028 0.149023 0.181269 0.088118 0.208989 0.454598 0.248295 0.430272 0.274127 0.085171 0.210430 0.240016 0.182848 0.385948 0.191188 0.114531 0.139731 0.110495 0.635243 0.028672 0.012276 0.941477 0.017575 0.003038 0.022449 0.913699 0.060814 0.040252 0.890382 0.050652 0.018713 0.004606 0.034696 0.944933 0.015764 0.047598 0.121957 0.785546 0.044898 0.049351 0.088489 0.759380 0.102780 0.166679 0.081676 0.508939 0.242705 0.210646 0.345010 0.220222 0.224122 0.256473 0.109700 0.409066 0.224761 0.245040 0.287314 0.150829 0.316817 0.471887 0.131779 0.245665 0.150668 Consensus sequence: BHBHDTGGCGGGGBDHD Alignment: BHBHDTGGCGGGGBDHD ----SBCGCGGGGSB-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00006 Zic3_primary Original Motif Original Motif Forward 2 11 0.010579 Species: Mus musculus Original motif 0.133123 0.374622 0.252864 0.239392 0.305344 0.451195 0.093638 0.149822 0.125347 0.723516 0.027695 0.123442 0.129457 0.754873 0.045215 0.070455 0.117681 0.809987 0.036742 0.035590 0.046565 0.817263 0.077300 0.058872 0.047132 0.790594 0.143506 0.018768 0.059681 0.087688 0.665195 0.187436 0.058872 0.077300 0.817263 0.046565 0.035590 0.036742 0.809987 0.117681 0.070455 0.045215 0.754873 0.129457 0.123442 0.027695 0.723516 0.125347 0.104029 0.069439 0.636026 0.190506 0.070968 0.197801 0.581172 0.150060 0.147077 0.235294 0.230097 0.387531 Consensus sequence: BMCCCCCGGGGGGGB Reverse complement motif 0.387531 0.235294 0.230097 0.147077 0.070968 0.581172 0.197801 0.150060 0.104029 0.636026 0.069439 0.190506 0.123442 0.723516 0.027695 0.125347 0.070455 0.754873 0.045215 0.129457 0.035590 0.809987 0.036742 0.117681 0.058872 0.817263 0.077300 0.046565 0.059681 0.665195 0.087688 0.187436 0.047132 0.143506 0.790594 0.018768 0.046565 0.077300 0.817263 0.058872 0.117681 0.036742 0.809987 0.035590 0.129457 0.045215 0.754873 0.070455 0.125347 0.027695 0.723516 0.123442 0.305344 0.093638 0.451195 0.149822 0.133123 0.252864 0.374622 0.239392 Consensus sequence: VCCCCCCCGGGGGRB Alignment: BMCCCCCGGGGGGGB -BSCCCCGCGBS--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00057 Zic2_primary Reverse Complement Reverse Complement Forward 4 11 0.011249 Species: Mus musculus Original motif 0.171475 0.300729 0.275648 0.252148 0.274948 0.494479 0.090926 0.139646 0.136266 0.716563 0.033328 0.113843 0.116272 0.772964 0.046083 0.064680 0.103529 0.835329 0.032215 0.028927 0.057023 0.813129 0.071277 0.058571 0.057483 0.766273 0.157290 0.018955 0.071535 0.110226 0.631760 0.186479 0.058571 0.071277 0.813129 0.057023 0.028927 0.032215 0.835329 0.103529 0.064680 0.046083 0.772964 0.116272 0.113843 0.033328 0.716563 0.136266 0.119744 0.068294 0.609218 0.202743 0.065793 0.215443 0.562951 0.155813 0.178819 0.196535 0.205955 0.418691 Consensus sequence: BMCCCCCGGGGGGGB Reverse complement motif 0.418691 0.196535 0.205955 0.178819 0.065793 0.562951 0.215443 0.155813 0.119744 0.609218 0.068294 0.202743 0.113843 0.716563 0.033328 0.136266 0.064680 0.772964 0.046083 0.116272 0.028927 0.835329 0.032215 0.103529 0.058571 0.813129 0.071277 0.057023 0.071535 0.631760 0.110226 0.186479 0.057483 0.157290 0.766273 0.018955 0.057023 0.071277 0.813129 0.058571 0.103529 0.032215 0.835329 0.028927 0.116272 0.046083 0.772964 0.064680 0.136266 0.033328 0.716563 0.113843 0.274948 0.090926 0.494479 0.139646 0.171475 0.275648 0.300729 0.252148 Consensus sequence: VCCCCCCCGGGGGRB Alignment: VCCCCCCCGGGGGRB ---SBCGCGGGGSB- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00400 Zif268 Reverse Complement Reverse Complement Backward 7 11 0.014467 Species: Mus musculus Original motif 0.104824 0.412716 0.254506 0.227955 0.644922 0.065476 0.140479 0.149122 0.201205 0.166164 0.347131 0.285501 0.360606 0.256316 0.150766 0.232313 0.199831 0.240681 0.279350 0.280137 0.234308 0.204076 0.321306 0.240310 0.274112 0.462435 0.111425 0.152028 0.067070 0.717501 0.073934 0.141496 0.106745 0.084442 0.658566 0.150247 0.025128 0.967053 0.003585 0.004234 0.006412 0.982989 0.003227 0.007371 0.009588 0.877620 0.002571 0.110221 0.621521 0.355443 0.015669 0.007366 0.002600 0.980275 0.004191 0.012934 0.118773 0.026658 0.783843 0.070725 0.022358 0.822101 0.024684 0.130857 0.713212 0.080912 0.128793 0.077084 0.166568 0.250955 0.107934 0.474544 0.225040 0.222494 0.163301 0.389166 0.268976 0.223206 0.265314 0.242504 0.137052 0.229058 0.148439 0.485451 0.135819 0.304550 0.141994 0.417637 0.272440 0.319501 0.230580 0.177478 Consensus sequence: BADHBDHCGCCCMCGCAHHDBBV Reverse complement motif 0.272440 0.230580 0.319501 0.177478 0.417637 0.304550 0.141994 0.135819 0.485451 0.229058 0.148439 0.137052 0.242504 0.223206 0.265314 0.268976 0.389166 0.222494 0.163301 0.225040 0.474544 0.250955 0.107934 0.166568 0.077084 0.080912 0.128793 0.713212 0.022358 0.024684 0.822101 0.130857 0.118773 0.783843 0.026658 0.070725 0.002600 0.004191 0.980275 0.012934 0.007366 0.355443 0.015669 0.621521 0.009588 0.002571 0.877620 0.110221 0.006412 0.003227 0.982989 0.007371 0.025128 0.003585 0.967053 0.004234 0.106745 0.658566 0.084442 0.150247 0.067070 0.073934 0.717501 0.141496 0.274112 0.111425 0.462435 0.152028 0.234308 0.321306 0.204076 0.240310 0.280137 0.240681 0.279350 0.199831 0.232313 0.256316 0.150766 0.360606 0.201205 0.347131 0.166164 0.285501 0.149122 0.065476 0.140479 0.644922 0.104824 0.254506 0.412716 0.227955 Consensus sequence: VVVDHHTGCGYGGGCGDHVHHTB Alignment: VVVDHHTGCGYGGGCGDHVHHTB ------SBCGCGGGGSB------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00526 Foxn1_primary Reverse Complement Reverse Complement Backward 4 11 0.015056 Species: Mus musculus Original motif 0.456612 0.057181 0.078281 0.407926 0.460529 0.185506 0.083106 0.270859 0.445717 0.179510 0.239355 0.135417 0.116339 0.145186 0.275331 0.463144 0.239398 0.142078 0.480004 0.138520 0.355157 0.217877 0.284296 0.142670 0.318602 0.444835 0.153321 0.083243 0.609569 0.055866 0.280349 0.054216 0.062297 0.769824 0.027844 0.140035 0.151868 0.019245 0.803188 0.025699 0.011842 0.952534 0.017959 0.017665 0.017665 0.017959 0.952534 0.011842 0.025699 0.803188 0.019245 0.151868 0.140035 0.027844 0.769824 0.062297 0.054216 0.280349 0.055866 0.609569 0.013084 0.624655 0.177956 0.184305 0.287647 0.183527 0.295753 0.233074 0.042309 0.345931 0.198458 0.413301 0.338138 0.266033 0.045367 0.350462 0.302850 0.155320 0.074662 0.467168 0.240926 0.068901 0.283055 0.407118 0.409954 0.183157 0.154186 0.252704 Consensus sequence: WHVBVVMACGCGCGTCDYHWDH Reverse complement motif 0.252704 0.183157 0.154186 0.409954 0.407118 0.068901 0.283055 0.240926 0.467168 0.155320 0.074662 0.302850 0.350462 0.266033 0.045367 0.338138 0.413301 0.345931 0.198458 0.042309 0.287647 0.295753 0.183527 0.233074 0.013084 0.177956 0.624655 0.184305 0.609569 0.280349 0.055866 0.054216 0.140035 0.769824 0.027844 0.062297 0.025699 0.019245 0.803188 0.151868 0.017665 0.952534 0.017959 0.011842 0.011842 0.017959 0.952534 0.017665 0.151868 0.803188 0.019245 0.025699 0.062297 0.027844 0.769824 0.140035 0.054216 0.055866 0.280349 0.609569 0.318602 0.153321 0.444835 0.083243 0.142670 0.217877 0.284296 0.355157 0.239398 0.480004 0.142078 0.138520 0.463144 0.145186 0.275331 0.116339 0.135417 0.179510 0.239355 0.445717 0.270859 0.185506 0.083106 0.460529 0.407926 0.057181 0.078281 0.456612 Consensus sequence: HDWHMHGACGCGCGTRBVVBHW Alignment: HDWHMHGACGCGCGTRBVVBHW --------SBCGCGGGGSB--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00065 Zfp161_primary Original Motif Reverse Complement Backward 4 11 0.016905 Species: Mus musculus Original motif 0.142624 0.111294 0.283688 0.462394 0.221170 0.081404 0.499138 0.198288 0.290070 0.042114 0.604904 0.062912 0.109755 0.559510 0.215454 0.115281 0.111745 0.022727 0.850580 0.014948 0.015907 0.942291 0.005561 0.036241 0.088509 0.003729 0.902805 0.004957 0.004957 0.902805 0.003729 0.088509 0.036241 0.005561 0.942291 0.015907 0.014948 0.850580 0.022727 0.111745 0.325358 0.049424 0.519652 0.105566 0.062912 0.604904 0.042114 0.290070 0.214335 0.388248 0.125912 0.271505 0.128984 0.372787 0.092390 0.405839 0.269058 0.098422 0.484016 0.148504 0.362176 0.156050 0.188642 0.293132 Consensus sequence: DDGCGCGCGCRCHYRD Reverse complement motif 0.293132 0.156050 0.188642 0.362176 0.269058 0.484016 0.098422 0.148504 0.405839 0.372787 0.092390 0.128984 0.214335 0.125912 0.388248 0.271505 0.062912 0.042114 0.604904 0.290070 0.325358 0.519652 0.049424 0.105566 0.014948 0.022727 0.850580 0.111745 0.036241 0.942291 0.005561 0.015907 0.004957 0.003729 0.902805 0.088509 0.088509 0.902805 0.003729 0.004957 0.015907 0.005561 0.942291 0.036241 0.111745 0.850580 0.022727 0.014948 0.109755 0.215454 0.559510 0.115281 0.290070 0.604904 0.042114 0.062912 0.221170 0.499138 0.081404 0.198288 0.462394 0.111294 0.283688 0.142624 Consensus sequence: DMMDGMGCGCGCGCHD Alignment: DMMDGMGCGCGCGCHD --BSCCCCGCGBS--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00102 Zic1_primary Original Motif Original Motif Forward 2 11 0.018611 Species: Mus musculus Original motif 0.174040 0.367918 0.270176 0.187866 0.359560 0.309872 0.111047 0.219520 0.094468 0.790352 0.026034 0.089145 0.114860 0.779490 0.050895 0.054755 0.105195 0.837712 0.031857 0.025237 0.045234 0.825039 0.073990 0.055737 0.145555 0.592986 0.228415 0.033044 0.045273 0.175001 0.607615 0.172111 0.055737 0.073990 0.825039 0.045234 0.025237 0.031857 0.837712 0.105195 0.054755 0.050895 0.779490 0.114860 0.089145 0.026034 0.790352 0.094468 0.060833 0.067787 0.717352 0.154028 0.097742 0.194545 0.591608 0.116104 Consensus sequence: BHCCCCCGGGGGGG Reverse complement motif 0.097742 0.591608 0.194545 0.116104 0.060833 0.717352 0.067787 0.154028 0.089145 0.790352 0.026034 0.094468 0.054755 0.779490 0.050895 0.114860 0.025237 0.837712 0.031857 0.105195 0.055737 0.825039 0.073990 0.045234 0.045273 0.607615 0.175001 0.172111 0.145555 0.228415 0.592986 0.033044 0.045234 0.073990 0.825039 0.055737 0.105195 0.031857 0.837712 0.025237 0.114860 0.050895 0.779490 0.054755 0.094468 0.026034 0.790352 0.089145 0.219520 0.309872 0.111047 0.359560 0.174040 0.270176 0.367918 0.187866 Consensus sequence: CCCCCCCGGGGGHB Alignment: BHCCCCCGGGGGGG -BSCCCCGCGBS-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00527 Foxn4_secondary Original Motif Reverse Complement Backward 8 11 0.019240 Species: Mus musculus Original motif 0.298336 0.418632 0.208054 0.074978 0.289907 0.015608 0.457100 0.237385 0.273583 0.077889 0.107860 0.540668 0.184954 0.161611 0.384390 0.269045 0.521826 0.156340 0.089019 0.232815 0.356716 0.131104 0.394857 0.117323 0.266669 0.108765 0.505273 0.119293 0.020778 0.047199 0.919524 0.012500 0.948536 0.018775 0.008113 0.024576 0.010822 0.964042 0.014701 0.010434 0.007428 0.019505 0.966351 0.006717 0.010025 0.975678 0.008648 0.005649 0.043796 0.120935 0.742979 0.092289 0.008252 0.250704 0.541132 0.199913 0.474428 0.044681 0.134430 0.346461 0.146597 0.421317 0.143166 0.288920 0.020540 0.181479 0.553811 0.244170 0.129612 0.173360 0.535219 0.161808 0.506084 0.158156 0.130983 0.204776 0.054872 0.103043 0.545792 0.296293 0.389882 0.171037 0.164162 0.274918 0.225861 0.314031 0.288872 0.171237 Consensus sequence: VDWDARRGACGCGGWHGGAKHV Reverse complement motif 0.225861 0.288872 0.314031 0.171237 0.274918 0.171037 0.164162 0.389882 0.054872 0.545792 0.103043 0.296293 0.204776 0.158156 0.130983 0.506084 0.129612 0.535219 0.173360 0.161808 0.020540 0.553811 0.181479 0.244170 0.146597 0.143166 0.421317 0.288920 0.346461 0.044681 0.134430 0.474428 0.008252 0.541132 0.250704 0.199913 0.043796 0.742979 0.120935 0.092289 0.010025 0.008648 0.975678 0.005649 0.007428 0.966351 0.019505 0.006717 0.010822 0.014701 0.964042 0.010434 0.024576 0.018775 0.008113 0.948536 0.020778 0.919524 0.047199 0.012500 0.266669 0.505273 0.108765 0.119293 0.356716 0.394857 0.131104 0.117323 0.232815 0.156340 0.089019 0.521826 0.184954 0.384390 0.161611 0.269045 0.540668 0.077889 0.107860 0.273583 0.289907 0.457100 0.015608 0.237385 0.298336 0.208054 0.418632 0.074978 Consensus sequence: VHYTCCDWCCGCGTCMMTHWHV Alignment: VHYTCCDWCCGCGTCMMTHWHV ----BSCCCCGCGBS------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00022 Zfp740_primary Reverse Complement Reverse Complement Backward 4 11 0.020460 Species: Mus musculus Original motif 0.136946 0.396508 0.135309 0.331236 0.185528 0.417538 0.215409 0.181525 0.171276 0.341901 0.172832 0.313991 0.145641 0.590572 0.146376 0.117412 0.138035 0.660416 0.114016 0.087533 0.222728 0.750532 0.007528 0.019212 0.024633 0.963314 0.001894 0.010159 0.009557 0.979956 0.000642 0.009844 0.010416 0.977424 0.000541 0.011619 0.026401 0.956740 0.001544 0.015314 0.195502 0.755959 0.011060 0.037480 0.491291 0.364785 0.025613 0.118311 0.305153 0.398160 0.071680 0.225008 0.253497 0.232647 0.213246 0.300610 0.156964 0.297876 0.144683 0.400477 0.179549 0.292514 0.319462 0.208475 Consensus sequence: HVBCCCCCCCCMHHHB Reverse complement motif 0.179549 0.319462 0.292514 0.208475 0.400477 0.297876 0.144683 0.156964 0.300610 0.232647 0.213246 0.253497 0.305153 0.071680 0.398160 0.225008 0.118311 0.364785 0.025613 0.491291 0.195502 0.011060 0.755959 0.037480 0.026401 0.001544 0.956740 0.015314 0.010416 0.000541 0.977424 0.011619 0.009557 0.000642 0.979956 0.009844 0.024633 0.001894 0.963314 0.010159 0.222728 0.007528 0.750532 0.019212 0.138035 0.114016 0.660416 0.087533 0.145641 0.146376 0.590572 0.117412 0.171276 0.172832 0.341901 0.313991 0.185528 0.215409 0.417538 0.181525 0.136946 0.135309 0.396508 0.331236 Consensus sequence: BHHDYGGGGGGGGBVD Alignment: BHHDYGGGGGGGGBVD --SBCGCGGGGSB--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00526 Foxn1_secondary Reverse Complement Original Motif Backward 5 11 0.023211 Species: Mus musculus Original motif 0.477863 0.106306 0.184102 0.231729 0.304951 0.149020 0.361418 0.184612 0.548996 0.056128 0.348902 0.045974 0.385727 0.477782 0.086218 0.050273 0.409556 0.232265 0.173851 0.184328 0.174550 0.312880 0.307123 0.205448 0.850398 0.047204 0.041665 0.060734 0.141234 0.548534 0.142230 0.168002 0.059462 0.026354 0.892948 0.021236 0.053714 0.870297 0.028935 0.047055 0.086273 0.069147 0.805284 0.039296 0.033781 0.573881 0.034115 0.358223 0.035191 0.079663 0.824970 0.060176 0.051830 0.862631 0.019359 0.066180 0.178685 0.015738 0.762485 0.043092 0.058988 0.042615 0.017608 0.880789 0.202382 0.173360 0.284095 0.340163 0.098493 0.234651 0.506524 0.160333 0.109087 0.336204 0.250510 0.304198 0.130945 0.250843 0.177122 0.441090 0.353830 0.138838 0.162784 0.344548 0.114290 0.417163 0.160662 0.307885 Consensus sequence: DDRMHBACGCGYGCGTDGBBDB Reverse complement motif 0.114290 0.160662 0.417163 0.307885 0.344548 0.138838 0.162784 0.353830 0.441090 0.250843 0.177122 0.130945 0.109087 0.250510 0.336204 0.304198 0.098493 0.506524 0.234651 0.160333 0.340163 0.173360 0.284095 0.202382 0.880789 0.042615 0.017608 0.058988 0.178685 0.762485 0.015738 0.043092 0.051830 0.019359 0.862631 0.066180 0.035191 0.824970 0.079663 0.060176 0.033781 0.034115 0.573881 0.358223 0.086273 0.805284 0.069147 0.039296 0.053714 0.028935 0.870297 0.047055 0.059462 0.892948 0.026354 0.021236 0.141234 0.142230 0.548534 0.168002 0.060734 0.047204 0.041665 0.850398 0.174550 0.307123 0.312880 0.205448 0.184328 0.232265 0.173851 0.409556 0.385727 0.086218 0.477782 0.050273 0.045974 0.056128 0.348902 0.548996 0.304951 0.361418 0.149020 0.184612 0.231729 0.106306 0.184102 0.477863 Consensus sequence: BDVBCDACGCKCGCGTBHRKHD Alignment: DDRMHBACGCGYGCGTDGBBDB -------SBCGCGGGGSB---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 2 Motif ID: 19 Motif name: atactttggc Original motif 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 Consensus sequence: ATACTTTGGC Reserve complement motif 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 Consensus sequence: GCCAAAGTAT ************************************************************************ Best Matches for Motif ID 19 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00156 Msx2 Original Motif Reverse Complement Backward 4 10 0.022158 Species: Mus musculus Original motif 0.275513 0.256811 0.311675 0.156002 0.383321 0.282527 0.177970 0.156182 0.442557 0.124681 0.236862 0.195901 0.139318 0.227241 0.544119 0.089322 0.700103 0.083893 0.130336 0.085668 0.022691 0.796940 0.114830 0.065539 0.009654 0.562163 0.000715 0.427467 0.990884 0.001732 0.002330 0.005053 0.985387 0.012176 0.000854 0.001584 0.005044 0.003260 0.000977 0.990719 0.005122 0.009507 0.000372 0.984999 0.957648 0.000380 0.035397 0.006575 0.147183 0.050632 0.560835 0.241350 0.114465 0.415702 0.084791 0.385042 0.157227 0.095566 0.474272 0.272935 0.245081 0.362599 0.108499 0.283820 0.092460 0.210730 0.114248 0.582562 Consensus sequence: VVDGACYAATTAGYDHT Reverse complement motif 0.582562 0.210730 0.114248 0.092460 0.245081 0.108499 0.362599 0.283820 0.157227 0.474272 0.095566 0.272935 0.114465 0.084791 0.415702 0.385042 0.147183 0.560835 0.050632 0.241350 0.006575 0.000380 0.035397 0.957648 0.984999 0.009507 0.000372 0.005122 0.990719 0.003260 0.000977 0.005044 0.001584 0.012176 0.000854 0.985387 0.005053 0.001732 0.002330 0.990884 0.009654 0.000715 0.562163 0.427467 0.022691 0.114830 0.796940 0.065539 0.085668 0.083893 0.130336 0.700103 0.139318 0.544119 0.227241 0.089322 0.195901 0.124681 0.236862 0.442557 0.156182 0.282527 0.177970 0.383321 0.275513 0.311675 0.256811 0.156002 Consensus sequence: ADHKCTAATTKGTCDBV Alignment: ADHKCTAATTKGTCDBV ----ATACTTTGGC--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00101 Sox12_secondary Original Motif Reverse Complement Backward 6 10 0.027519 Species: Mus musculus Original motif 0.378898 0.318901 0.205859 0.096341 0.352524 0.321236 0.224504 0.101736 0.323551 0.182056 0.210897 0.283496 0.135539 0.325230 0.208031 0.331200 0.663106 0.055471 0.154459 0.126963 0.051748 0.292567 0.537307 0.118378 0.886489 0.042361 0.035742 0.035408 0.043647 0.688744 0.094358 0.173252 0.882052 0.039818 0.018899 0.059231 0.864171 0.036011 0.068363 0.031455 0.790158 0.046868 0.041594 0.121379 0.087447 0.143905 0.707798 0.060849 0.295919 0.132479 0.485703 0.085899 0.653156 0.133004 0.110012 0.103828 0.351764 0.131771 0.217730 0.298736 0.203977 0.196773 0.099958 0.499292 Consensus sequence: VVDBASACAAAGRADH Reverse complement motif 0.499292 0.196773 0.099958 0.203977 0.298736 0.131771 0.217730 0.351764 0.103828 0.133004 0.110012 0.653156 0.295919 0.485703 0.132479 0.085899 0.087447 0.707798 0.143905 0.060849 0.121379 0.046868 0.041594 0.790158 0.031455 0.036011 0.068363 0.864171 0.059231 0.039818 0.018899 0.882052 0.043647 0.094358 0.688744 0.173252 0.035408 0.042361 0.035742 0.886489 0.051748 0.537307 0.292567 0.118378 0.126963 0.055471 0.154459 0.663106 0.331200 0.325230 0.208031 0.135539 0.283496 0.182056 0.210897 0.323551 0.101736 0.321236 0.224504 0.352524 0.096341 0.318901 0.205859 0.378898 Consensus sequence: HDTMCTTTGTSTVDBB Alignment: HDTMCTTTGTSTVDBB -ATACTTTGGC----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00066 Hnf4a_secondary Reverse Complement Original Motif Backward 6 10 0.028579 Species: Mus musculus Original motif 0.131680 0.169949 0.346277 0.352094 0.109910 0.144258 0.373681 0.372151 0.196671 0.411335 0.159689 0.232305 0.311086 0.307077 0.122332 0.259505 0.895155 0.013238 0.038874 0.052733 0.779629 0.018399 0.171269 0.030703 0.950546 0.002649 0.041825 0.004980 0.004769 0.002646 0.985847 0.006739 0.004458 0.002117 0.012011 0.981414 0.016789 0.969626 0.003890 0.009695 0.002468 0.982852 0.004754 0.009926 0.891448 0.003193 0.097548 0.007811 0.513330 0.308971 0.070467 0.107232 0.179371 0.115514 0.130898 0.574217 0.285826 0.277536 0.166982 0.269655 0.319407 0.227783 0.129020 0.323790 Consensus sequence: BBHHAAAGTCCAMTHH Reverse complement motif 0.323790 0.227783 0.129020 0.319407 0.269655 0.277536 0.166982 0.285826 0.574217 0.115514 0.130898 0.179371 0.107232 0.308971 0.070467 0.513330 0.007811 0.003193 0.097548 0.891448 0.002468 0.004754 0.982852 0.009926 0.016789 0.003890 0.969626 0.009695 0.981414 0.002117 0.012011 0.004458 0.004769 0.985847 0.002646 0.006739 0.004980 0.002649 0.041825 0.950546 0.030703 0.018399 0.171269 0.779629 0.052733 0.013238 0.038874 0.895155 0.259505 0.307077 0.122332 0.311086 0.196671 0.159689 0.411335 0.232305 0.109910 0.373681 0.144258 0.372151 0.352094 0.169949 0.346277 0.131680 Consensus sequence: HHAYTGGACTTTHDBV Alignment: BBHHAAAGTCCAMTHH -GCCAAAGTAT----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00418 Etv6 Reverse Complement Reverse Complement Forward 5 10 0.030488 Species: Mus musculus Original motif 0.354972 0.069107 0.299350 0.276571 0.209701 0.408003 0.227382 0.154914 0.284336 0.375266 0.162604 0.177794 0.176569 0.181438 0.342172 0.299820 0.106551 0.204378 0.060299 0.628772 0.884088 0.003252 0.103113 0.009546 0.001110 0.704391 0.006294 0.288205 0.014992 0.000892 0.001401 0.982714 0.004842 0.001887 0.002470 0.990801 0.002724 0.992864 0.002206 0.002206 0.001792 0.991200 0.001615 0.005393 0.005151 0.010157 0.940259 0.044433 0.017780 0.199839 0.761921 0.020459 0.230834 0.269936 0.119652 0.379577 0.233019 0.093692 0.034743 0.638546 0.194739 0.181763 0.175340 0.448159 0.145452 0.293709 0.335917 0.224922 Consensus sequence: DVHBTACTTCCGGHTHB Reverse complement motif 0.145452 0.335917 0.293709 0.224922 0.448159 0.181763 0.175340 0.194739 0.638546 0.093692 0.034743 0.233019 0.379577 0.269936 0.119652 0.230834 0.017780 0.761921 0.199839 0.020459 0.005151 0.940259 0.010157 0.044433 0.001792 0.001615 0.991200 0.005393 0.002724 0.002206 0.992864 0.002206 0.990801 0.001887 0.002470 0.004842 0.982714 0.000892 0.001401 0.014992 0.001110 0.006294 0.704391 0.288205 0.009546 0.003252 0.103113 0.884088 0.628772 0.204378 0.060299 0.106551 0.176569 0.342172 0.181438 0.299820 0.284336 0.162604 0.375266 0.177794 0.209701 0.227382 0.408003 0.154914 0.276571 0.069107 0.299350 0.354972 Consensus sequence: BHAHCCGGAAGTABDVD Alignment: BHAHCCGGAAGTABDVD ----GCCAAAGTAT--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00083 Tcf7l2_primary Reverse Complement Reverse Complement Backward 3 10 0.031469 Species: Mus musculus Original motif 0.285725 0.187143 0.254855 0.272277 0.276264 0.157893 0.258178 0.307665 0.238788 0.161120 0.254018 0.346074 0.076041 0.333901 0.150903 0.439156 0.093376 0.526578 0.180529 0.199517 0.010827 0.880320 0.034150 0.074703 0.016546 0.023834 0.000940 0.958680 0.007166 0.008215 0.001941 0.982678 0.029634 0.001363 0.001379 0.967625 0.010872 0.031751 0.926186 0.031190 0.949407 0.000760 0.002581 0.047253 0.109203 0.001362 0.002094 0.887341 0.044198 0.567994 0.353059 0.034749 0.222623 0.142360 0.041281 0.593736 0.358872 0.167597 0.220534 0.252997 0.233072 0.141480 0.230985 0.394463 0.350703 0.243129 0.233961 0.172207 Consensus sequence: DDDYCCTTTGATSTDDV Reverse complement motif 0.172207 0.243129 0.233961 0.350703 0.394463 0.141480 0.230985 0.233072 0.252997 0.167597 0.220534 0.358872 0.593736 0.142360 0.041281 0.222623 0.044198 0.353059 0.567994 0.034749 0.887341 0.001362 0.002094 0.109203 0.047253 0.000760 0.002581 0.949407 0.010872 0.926186 0.031751 0.031190 0.967625 0.001363 0.001379 0.029634 0.982678 0.008215 0.001941 0.007166 0.958680 0.023834 0.000940 0.016546 0.010827 0.034150 0.880320 0.074703 0.093376 0.180529 0.526578 0.199517 0.439156 0.333901 0.150903 0.076041 0.346074 0.161120 0.254018 0.238788 0.307665 0.157893 0.258178 0.276264 0.272277 0.187143 0.254855 0.285725 Consensus sequence: BDDASATCAAAGGMDDD Alignment: BDDASATCAAAGGMDDD -----GCCAAAGTAT-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00030 Sox11_primary Original Motif Reverse Complement Backward 6 10 0.031729 Species: Mus musculus Original motif 0.351812 0.238467 0.143954 0.265768 0.195246 0.235838 0.281473 0.287443 0.349478 0.172616 0.210739 0.267167 0.484061 0.110438 0.173131 0.232370 0.276692 0.070713 0.479604 0.172991 0.859124 0.044167 0.083951 0.012758 0.975608 0.002029 0.002285 0.020079 0.006422 0.978485 0.007124 0.007969 0.987489 0.003025 0.002868 0.006617 0.987739 0.005463 0.002730 0.004067 0.693013 0.004067 0.002445 0.300475 0.189100 0.003677 0.801408 0.005814 0.352090 0.072517 0.567737 0.007656 0.542316 0.176545 0.192768 0.088371 0.196382 0.304176 0.205985 0.293457 0.289415 0.201358 0.182937 0.326290 0.385801 0.216362 0.152363 0.245475 Consensus sequence: HBDDRAACAAAGRABHH Reverse complement motif 0.245475 0.216362 0.152363 0.385801 0.326290 0.201358 0.182937 0.289415 0.196382 0.205985 0.304176 0.293457 0.088371 0.176545 0.192768 0.542316 0.352090 0.567737 0.072517 0.007656 0.189100 0.801408 0.003677 0.005814 0.300475 0.004067 0.002445 0.693013 0.004067 0.005463 0.002730 0.987739 0.006617 0.003025 0.002868 0.987489 0.006422 0.007124 0.978485 0.007969 0.020079 0.002029 0.002285 0.975608 0.012758 0.044167 0.083951 0.859124 0.276692 0.479604 0.070713 0.172991 0.232370 0.110438 0.173131 0.484061 0.267167 0.172616 0.210739 0.349478 0.287443 0.235838 0.281473 0.195246 0.265768 0.238467 0.143954 0.351812 Consensus sequence: HHBTMCTTTGTTMDDVH Alignment: HHBTMCTTTGTTMDDVH --ATACTTTGGC----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00062 Sox4_primary Original Motif Reverse Complement Backward 6 10 0.031914 Species: Mus musculus Original motif 0.427843 0.231210 0.119424 0.221523 0.196506 0.239531 0.304906 0.259057 0.302488 0.156922 0.290190 0.250401 0.433872 0.149126 0.196496 0.220506 0.258426 0.076511 0.475100 0.189963 0.841714 0.046453 0.099915 0.011918 0.983853 0.001612 0.001362 0.013174 0.003460 0.982032 0.005728 0.008780 0.989743 0.002253 0.002020 0.005984 0.990761 0.003397 0.002843 0.003000 0.770864 0.003540 0.001549 0.224048 0.235342 0.002598 0.757383 0.004677 0.371426 0.089574 0.529959 0.009040 0.480804 0.196949 0.240413 0.081833 0.187158 0.355102 0.216599 0.241142 0.248006 0.232182 0.157452 0.362360 0.403367 0.177684 0.164649 0.254300 Consensus sequence: HBDDDAACAAAGRVBHH Reverse complement motif 0.254300 0.177684 0.164649 0.403367 0.362360 0.232182 0.157452 0.248006 0.187158 0.216599 0.355102 0.241142 0.081833 0.196949 0.240413 0.480804 0.371426 0.529959 0.089574 0.009040 0.235342 0.757383 0.002598 0.004677 0.224048 0.003540 0.001549 0.770864 0.003000 0.003397 0.002843 0.990761 0.005984 0.002253 0.002020 0.989743 0.003460 0.005728 0.982032 0.008780 0.013174 0.001612 0.001362 0.983853 0.011918 0.046453 0.099915 0.841714 0.258426 0.475100 0.076511 0.189963 0.220506 0.149126 0.196496 0.433872 0.250401 0.156922 0.290190 0.302488 0.196506 0.304906 0.239531 0.259057 0.221523 0.231210 0.119424 0.427843 Consensus sequence: HHBBMCTTTGTTHDDBH Alignment: HHBBMCTTTGTTHDDBH --ATACTTTGGC----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00035 Hic1_primary Reverse Complement Original Motif Forward 6 10 0.032301 Species: Mus musculus Original motif 0.275207 0.211375 0.250277 0.263141 0.135064 0.327571 0.217556 0.319808 0.145659 0.242586 0.267179 0.344576 0.656519 0.009712 0.315174 0.018595 0.002265 0.004755 0.001656 0.991325 0.041873 0.001128 0.955340 0.001659 0.001306 0.974834 0.022215 0.001645 0.001978 0.992066 0.002638 0.003317 0.921032 0.072388 0.001237 0.005344 0.582027 0.211694 0.115736 0.090542 0.005990 0.927450 0.028306 0.038254 0.027374 0.799879 0.053667 0.119080 0.203510 0.191263 0.168997 0.436229 0.402253 0.154087 0.291346 0.152314 0.201201 0.414412 0.145330 0.239056 0.241094 0.332661 0.143464 0.282781 Consensus sequence: DBBATGCCAACCHVHH Reverse complement motif 0.241094 0.143464 0.332661 0.282781 0.201201 0.145330 0.414412 0.239056 0.152314 0.154087 0.291346 0.402253 0.436229 0.191263 0.168997 0.203510 0.027374 0.053667 0.799879 0.119080 0.005990 0.028306 0.927450 0.038254 0.090542 0.211694 0.115736 0.582027 0.005344 0.072388 0.001237 0.921032 0.001978 0.002638 0.992066 0.003317 0.001306 0.022215 0.974834 0.001645 0.041873 0.955340 0.001128 0.001659 0.991325 0.004755 0.001656 0.002265 0.018595 0.009712 0.315174 0.656519 0.344576 0.242586 0.267179 0.145659 0.135064 0.217556 0.327571 0.319808 0.263141 0.211375 0.250277 0.275207 Consensus sequence: DDBHGGTTGGCATVBD Alignment: DBBATGCCAACCHVHH -----GCCAAAGTAT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00146 Pou6f1_3733.1 Original Motif Original Motif Backward 4 10 0.032571 Species: Mus musculus Original motif 0.380020 0.211224 0.295981 0.112776 0.349734 0.309602 0.075135 0.265530 0.356459 0.226592 0.169646 0.247302 0.229673 0.350174 0.311906 0.108247 0.757838 0.046686 0.016036 0.179440 0.014478 0.002669 0.000464 0.982389 0.984156 0.000563 0.002241 0.013039 0.992195 0.001470 0.001823 0.004511 0.001610 0.002156 0.003120 0.993114 0.008328 0.001327 0.802239 0.188106 0.990155 0.004149 0.002815 0.002881 0.004992 0.004117 0.965215 0.025676 0.091361 0.290495 0.533319 0.084826 0.164763 0.143217 0.028702 0.663317 0.164550 0.118473 0.276288 0.440689 0.152985 0.151847 0.413228 0.281941 0.241185 0.447249 0.135344 0.176222 Consensus sequence: VHHVATAATGAGSTDDH Reverse complement motif 0.241185 0.135344 0.447249 0.176222 0.152985 0.413228 0.151847 0.281941 0.440689 0.118473 0.276288 0.164550 0.663317 0.143217 0.028702 0.164763 0.091361 0.533319 0.290495 0.084826 0.004992 0.965215 0.004117 0.025676 0.002881 0.004149 0.002815 0.990155 0.008328 0.802239 0.001327 0.188106 0.993114 0.002156 0.003120 0.001610 0.004511 0.001470 0.001823 0.992195 0.013039 0.000563 0.002241 0.984156 0.982389 0.002669 0.000464 0.014478 0.179440 0.046686 0.016036 0.757838 0.229673 0.311906 0.350174 0.108247 0.247302 0.226592 0.169646 0.356459 0.265530 0.309602 0.075135 0.349734 0.112776 0.211224 0.295981 0.380020 Consensus sequence: DHDASCTCATTATVHHB Alignment: VHHVATAATGAGSTDDH ----ATACTTTGGC--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00067 Lef1_primary Original Motif Original Motif Backward 6 10 0.033022 Species: Mus musculus Original motif 0.281920 0.214207 0.278077 0.225796 0.325566 0.151435 0.298797 0.224202 0.290253 0.145824 0.243443 0.320480 0.069286 0.404645 0.141614 0.384454 0.070044 0.621448 0.142647 0.165862 0.007295 0.907657 0.038110 0.046938 0.015587 0.018273 0.000658 0.965482 0.005527 0.005886 0.001905 0.986682 0.024512 0.001189 0.001344 0.972955 0.007384 0.025221 0.952270 0.015125 0.966438 0.000630 0.002693 0.030239 0.082252 0.001173 0.001495 0.915080 0.030255 0.677155 0.275323 0.017267 0.199467 0.118815 0.056814 0.624905 0.345445 0.169597 0.216831 0.268127 0.278106 0.150864 0.173693 0.397336 0.251834 0.339733 0.219703 0.188730 Consensus sequence: DDDYCCTTTGATCTDDV Reverse complement motif 0.251834 0.219703 0.339733 0.188730 0.397336 0.150864 0.173693 0.278106 0.268127 0.169597 0.216831 0.345445 0.624905 0.118815 0.056814 0.199467 0.030255 0.275323 0.677155 0.017267 0.915080 0.001173 0.001495 0.082252 0.030239 0.000630 0.002693 0.966438 0.007384 0.952270 0.025221 0.015125 0.972955 0.001189 0.001344 0.024512 0.986682 0.005886 0.001905 0.005527 0.965482 0.018273 0.000658 0.015587 0.007295 0.038110 0.907657 0.046938 0.070044 0.142647 0.621448 0.165862 0.069286 0.141614 0.404645 0.384454 0.320480 0.145824 0.243443 0.290253 0.224202 0.151435 0.298797 0.325566 0.225796 0.214207 0.278077 0.281920 Consensus sequence: VDDAGATCAAAGGKDDD Alignment: DDDYCCTTTGATCTDDV --ATACTTTGGC----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 2 Motif ID: 20 Motif name: CagTGCTCCACTGTGgT Original motif 0.150000 0.700000 0.016667 0.133333 0.650000 0.150000 0.050000 0.150000 0.166667 0.116667 0.633333 0.083333 0.050000 0.033333 0.066667 0.850000 0.050000 0.000000 0.833333 0.116667 0.016667 0.966667 0.000000 0.016667 0.050000 0.016667 0.000000 0.933333 0.066667 0.833333 0.066667 0.033333 0.033333 0.966667 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.050000 0.916667 0.016667 0.016667 0.166667 0.000000 0.000000 0.833333 0.083333 0.016667 0.900000 0.000000 0.000000 0.016667 0.016667 0.966667 0.000000 0.016667 0.966667 0.016667 0.116667 0.166667 0.483333 0.233333 0.066667 0.083333 0.050000 0.800000 Consensus sequence: CAGTGCTCCACTGTGBT Reserve complement motif 0.800000 0.083333 0.050000 0.066667 0.116667 0.483333 0.166667 0.233333 0.000000 0.966667 0.016667 0.016667 0.966667 0.016667 0.016667 0.000000 0.083333 0.900000 0.016667 0.000000 0.833333 0.000000 0.000000 0.166667 0.050000 0.016667 0.916667 0.016667 0.000000 0.000000 0.000000 1.000000 0.033333 0.000000 0.966667 0.000000 0.066667 0.066667 0.833333 0.033333 0.933333 0.016667 0.000000 0.050000 0.016667 0.000000 0.966667 0.016667 0.050000 0.833333 0.000000 0.116667 0.850000 0.033333 0.066667 0.050000 0.166667 0.633333 0.116667 0.083333 0.150000 0.150000 0.050000 0.650000 0.150000 0.016667 0.700000 0.133333 Consensus sequence: ABCACAGTGGAGCACTG ************************************************************************ Best Matches for Motif ID 20 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v015681_primary Reverse Complement Reverse Complement Backward 4 17 0.041931 Species: Mus musculus Original motif 0.472795 0.179227 0.091251 0.256726 0.036521 0.159743 0.204840 0.598896 0.164582 0.312805 0.221324 0.301289 0.237069 0.249050 0.293048 0.220833 0.401949 0.225181 0.229401 0.143469 0.161422 0.494334 0.252207 0.092036 0.252940 0.177721 0.369400 0.199939 0.119630 0.024651 0.849920 0.005798 0.000962 0.002398 0.990616 0.006023 0.937852 0.027016 0.034535 0.000597 0.008963 0.987756 0.000629 0.002652 0.001584 0.992898 0.002349 0.003169 0.956822 0.027342 0.002484 0.013352 0.009873 0.987759 0.000988 0.001381 0.016397 0.980856 0.000369 0.002378 0.081761 0.758555 0.038572 0.121112 0.371713 0.091838 0.448027 0.088423 0.111617 0.121913 0.683885 0.082585 0.334562 0.102916 0.436488 0.126034 0.210362 0.101261 0.238339 0.450037 0.169041 0.271583 0.320799 0.238576 0.140316 0.049885 0.735236 0.074563 Consensus sequence: HTBVVVDGGACCACCCRGRDBG Reverse complement motif 0.140316 0.735236 0.049885 0.074563 0.169041 0.320799 0.271583 0.238576 0.450037 0.101261 0.238339 0.210362 0.334562 0.436488 0.102916 0.126034 0.111617 0.683885 0.121913 0.082585 0.371713 0.448027 0.091838 0.088423 0.081761 0.038572 0.758555 0.121112 0.016397 0.000369 0.980856 0.002378 0.009873 0.000988 0.987759 0.001381 0.013352 0.027342 0.002484 0.956822 0.001584 0.002349 0.992898 0.003169 0.008963 0.000629 0.987756 0.002652 0.000597 0.027016 0.034535 0.937852 0.000962 0.990616 0.002398 0.006023 0.119630 0.849920 0.024651 0.005798 0.252940 0.369400 0.177721 0.199939 0.161422 0.252207 0.494334 0.092036 0.143469 0.225181 0.229401 0.401949 0.237069 0.293048 0.249050 0.220833 0.164582 0.221324 0.312805 0.301289 0.598896 0.159743 0.204840 0.036521 0.256726 0.179227 0.091251 0.472795 Consensus sequence: CBDMCMGGGTGGTCCHVBVBAH Alignment: CBDMCMGGGTGGTCCHVBVBAH --ABCACAGTGGAGCACTG--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00034 Sox7_primary Reverse Complement Original Motif Backward 1 17 0.050190 Species: Mus musculus Original motif 0.360997 0.300272 0.115555 0.223177 0.309749 0.228429 0.166233 0.295589 0.149419 0.176868 0.240155 0.433558 0.379704 0.095791 0.276373 0.248133 0.394549 0.174184 0.130641 0.300626 0.443749 0.070776 0.211081 0.274393 0.364301 0.074356 0.370406 0.190936 0.791976 0.038475 0.093390 0.076159 0.963721 0.001826 0.002456 0.031997 0.004516 0.954596 0.008092 0.032796 0.981080 0.002062 0.002161 0.014697 0.986185 0.001846 0.006976 0.004992 0.059567 0.003649 0.002189 0.934595 0.495328 0.024257 0.240450 0.239965 0.305027 0.094878 0.526069 0.074025 0.418442 0.196237 0.158323 0.226998 0.336713 0.220452 0.191155 0.251680 0.192296 0.300342 0.169047 0.338315 0.240387 0.144634 0.128513 0.486465 0.290763 0.271259 0.116600 0.321377 0.224825 0.296233 0.229255 0.249687 0.493240 0.171285 0.075148 0.260326 Consensus sequence: HHBDHDDAACAATDRHHHHHBW Reverse complement motif 0.260326 0.171285 0.075148 0.493240 0.224825 0.229255 0.296233 0.249687 0.321377 0.271259 0.116600 0.290763 0.486465 0.144634 0.128513 0.240387 0.338315 0.300342 0.169047 0.192296 0.251680 0.220452 0.191155 0.336713 0.226998 0.196237 0.158323 0.418442 0.305027 0.526069 0.094878 0.074025 0.239965 0.024257 0.240450 0.495328 0.934595 0.003649 0.002189 0.059567 0.004992 0.001846 0.006976 0.986185 0.014697 0.002062 0.002161 0.981080 0.004516 0.008092 0.954596 0.032796 0.031997 0.001826 0.002456 0.963721 0.076159 0.038475 0.093390 0.791976 0.364301 0.370406 0.074356 0.190936 0.274393 0.070776 0.211081 0.443749 0.300626 0.174184 0.130641 0.394549 0.248133 0.095791 0.276373 0.379704 0.433558 0.176868 0.240155 0.149419 0.295589 0.228429 0.166233 0.309749 0.223177 0.300272 0.115555 0.360997 Consensus sequence: WBHHHHHMDATTGTTHDHDVHH Alignment: HHBDHDDAACAATDRHHHHHBW -----ABCACAGTGGAGCACTG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v016060_primary Original Motif Reverse Complement Forward 3 17 0.050478 Species: Mus musculus Original motif 0.204923 0.208846 0.365383 0.220848 0.294304 0.300143 0.167287 0.238266 0.109711 0.619514 0.117379 0.153396 0.178979 0.378580 0.230177 0.212264 0.159594 0.542602 0.118178 0.179627 0.125206 0.430074 0.151826 0.292894 0.097692 0.709845 0.116956 0.075506 0.148292 0.565912 0.037632 0.248164 0.077951 0.034190 0.855503 0.032356 0.001657 0.001061 0.971877 0.025405 0.001926 0.001084 0.991712 0.005278 0.033031 0.012001 0.057796 0.897171 0.002723 0.002647 0.993348 0.001281 0.003261 0.000963 0.987199 0.008577 0.000611 0.090925 0.074857 0.833608 0.015299 0.978878 0.004949 0.000874 0.013368 0.600902 0.033485 0.352245 0.231949 0.149575 0.118804 0.499672 0.267580 0.186002 0.371242 0.175176 0.264884 0.223483 0.110082 0.401551 0.221365 0.170121 0.179559 0.428955 0.112997 0.692930 0.139981 0.054092 0.460305 0.207883 0.155111 0.176702 Consensus sequence: BHCBCBCCGGGTGGTCYHVHDCH Reverse complement motif 0.176702 0.207883 0.155111 0.460305 0.112997 0.139981 0.692930 0.054092 0.428955 0.170121 0.179559 0.221365 0.401551 0.223483 0.110082 0.264884 0.267580 0.371242 0.186002 0.175176 0.499672 0.149575 0.118804 0.231949 0.013368 0.033485 0.600902 0.352245 0.015299 0.004949 0.978878 0.000874 0.833608 0.090925 0.074857 0.000611 0.003261 0.987199 0.000963 0.008577 0.002723 0.993348 0.002647 0.001281 0.897171 0.012001 0.057796 0.033031 0.001926 0.991712 0.001084 0.005278 0.001657 0.971877 0.001061 0.025405 0.077951 0.855503 0.034190 0.032356 0.148292 0.037632 0.565912 0.248164 0.097692 0.116956 0.709845 0.075506 0.125206 0.151826 0.430074 0.292894 0.159594 0.118178 0.542602 0.179627 0.178979 0.230177 0.378580 0.212264 0.109711 0.117379 0.619514 0.153396 0.294304 0.167287 0.300143 0.238266 0.204923 0.365383 0.208846 0.220848 Consensus sequence: HGDHVHKGACCACCCGGBGBGDB Alignment: HGDHVHKGACCACCCGGBGBGDB --CAGTGCTCCACTGTGBT---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00022 Zfp740_secondary Original Motif Original Motif Forward 1 17 0.051309 Species: Mus musculus Original motif 0.398967 0.071604 0.323957 0.205472 0.457709 0.058192 0.267218 0.216881 0.393346 0.032365 0.329533 0.244756 0.119528 0.091191 0.190078 0.599202 0.273933 0.123548 0.073075 0.529444 0.068935 0.812883 0.015245 0.102937 0.029664 0.907790 0.024804 0.037742 0.020725 0.933422 0.016796 0.029057 0.015086 0.948448 0.018030 0.018436 0.015628 0.884941 0.061172 0.038259 0.067508 0.744063 0.107305 0.081125 0.108097 0.140614 0.650174 0.101115 0.065696 0.247239 0.506149 0.180916 0.395005 0.077185 0.345914 0.181895 0.527081 0.093650 0.281853 0.097416 0.289378 0.245159 0.348803 0.116660 0.147136 0.260117 0.145993 0.446754 Consensus sequence: DDDTWCCCCCCGGDRVH Reverse complement motif 0.446754 0.260117 0.145993 0.147136 0.289378 0.348803 0.245159 0.116660 0.097416 0.093650 0.281853 0.527081 0.181895 0.077185 0.345914 0.395005 0.065696 0.506149 0.247239 0.180916 0.108097 0.650174 0.140614 0.101115 0.067508 0.107305 0.744063 0.081125 0.015628 0.061172 0.884941 0.038259 0.015086 0.018030 0.948448 0.018436 0.020725 0.016796 0.933422 0.029057 0.029664 0.024804 0.907790 0.037742 0.068935 0.015245 0.812883 0.102937 0.529444 0.123548 0.073075 0.273933 0.599202 0.091191 0.190078 0.119528 0.244756 0.032365 0.329533 0.393346 0.216881 0.058192 0.267218 0.457709 0.205472 0.071604 0.323957 0.398967 Consensus sequence: HVKDCCGGGGGGWADDD Alignment: DDDTWCCCCCCGGDRVH CAGTGCTCCACTGTGBT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v015681_secondary Original Motif Reverse Complement Forward 2 17 0.051651 Species: Mus musculus Original motif 0.214165 0.143436 0.372522 0.269876 0.314445 0.406003 0.160351 0.119201 0.137147 0.092924 0.042921 0.727007 0.044121 0.072843 0.051741 0.831295 0.261292 0.324124 0.298498 0.116086 0.258125 0.323243 0.263362 0.155271 0.204557 0.589399 0.107153 0.098891 0.371021 0.244027 0.291102 0.093849 0.096327 0.572718 0.011797 0.319159 0.027282 0.046183 0.844519 0.082016 0.018921 0.012887 0.915917 0.052275 0.364793 0.166722 0.084229 0.384256 0.028216 0.011233 0.951056 0.009495 0.054974 0.004738 0.890377 0.049911 0.006802 0.312915 0.134247 0.546036 0.241289 0.628210 0.104788 0.025713 0.237863 0.302807 0.213018 0.246311 0.349399 0.203220 0.086635 0.360746 0.386634 0.144693 0.246895 0.221779 0.425101 0.354676 0.093374 0.126849 0.060272 0.391320 0.104905 0.443503 0.162090 0.190233 0.227433 0.420244 Consensus sequence: DVTTVVCVYGGHGGYCHHDMYB Reverse complement motif 0.420244 0.190233 0.227433 0.162090 0.443503 0.391320 0.104905 0.060272 0.126849 0.354676 0.093374 0.425101 0.221779 0.144693 0.246895 0.386634 0.360746 0.203220 0.086635 0.349399 0.237863 0.213018 0.302807 0.246311 0.241289 0.104788 0.628210 0.025713 0.546036 0.312915 0.134247 0.006802 0.054974 0.890377 0.004738 0.049911 0.028216 0.951056 0.011233 0.009495 0.384256 0.166722 0.084229 0.364793 0.018921 0.915917 0.012887 0.052275 0.027282 0.844519 0.046183 0.082016 0.096327 0.011797 0.572718 0.319159 0.093849 0.244027 0.291102 0.371021 0.204557 0.107153 0.589399 0.098891 0.258125 0.263362 0.323243 0.155271 0.261292 0.298498 0.324124 0.116086 0.831295 0.072843 0.051741 0.044121 0.727007 0.092924 0.042921 0.137147 0.314445 0.160351 0.406003 0.119201 0.214165 0.372522 0.143436 0.269876 Consensus sequence: VMYDHDGMCCHCCKBGVVAAVH Alignment: VMYDHDGMCCHCCKBGVVAAVH -CAGTGCTCCACTGTGBT---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00528 Foxm1_primary Reverse Complement Reverse Complement Forward 3 17 0.052352 Species: Mus musculus Original motif 0.402634 0.249702 0.143705 0.203959 0.709619 0.108953 0.130781 0.050647 0.334232 0.077498 0.228818 0.359452 0.131721 0.094794 0.234481 0.539005 0.170102 0.237609 0.252464 0.339824 0.244961 0.347304 0.228129 0.179606 0.612141 0.132244 0.180110 0.075504 0.472236 0.042388 0.234419 0.250957 0.125213 0.007413 0.849788 0.017587 0.702068 0.064216 0.141992 0.091724 0.008657 0.038238 0.002959 0.950145 0.007170 0.002244 0.986824 0.003763 0.002862 0.979956 0.000711 0.016471 0.971196 0.001954 0.011441 0.015409 0.105575 0.031482 0.022836 0.840107 0.031534 0.736742 0.032785 0.198939 0.479153 0.347558 0.031799 0.141490 0.056405 0.123140 0.023989 0.796466 0.111194 0.195344 0.501360 0.192102 0.376359 0.416820 0.072818 0.134004 0.225111 0.249460 0.306563 0.218866 0.405251 0.168478 0.108618 0.317653 0.165386 0.191749 0.268604 0.374261 Consensus sequence: HADTBVADGATGCATCMTGMVHB Reverse complement motif 0.374261 0.191749 0.268604 0.165386 0.317653 0.168478 0.108618 0.405251 0.225111 0.306563 0.249460 0.218866 0.376359 0.072818 0.416820 0.134004 0.111194 0.501360 0.195344 0.192102 0.796466 0.123140 0.023989 0.056405 0.141490 0.347558 0.031799 0.479153 0.031534 0.032785 0.736742 0.198939 0.840107 0.031482 0.022836 0.105575 0.015409 0.001954 0.011441 0.971196 0.002862 0.000711 0.979956 0.016471 0.007170 0.986824 0.002244 0.003763 0.950145 0.038238 0.002959 0.008657 0.091724 0.064216 0.141992 0.702068 0.125213 0.849788 0.007413 0.017587 0.250957 0.042388 0.234419 0.472236 0.075504 0.132244 0.180110 0.612141 0.244961 0.228129 0.347304 0.179606 0.339824 0.237609 0.252464 0.170102 0.539005 0.094794 0.234481 0.131721 0.359452 0.077498 0.228818 0.334232 0.050647 0.108953 0.130781 0.709619 0.203959 0.249702 0.143705 0.402634 Consensus sequence: VHVRCAYGATGCATCDTVVADTH Alignment: VHVRCAYGATGCATCDTVVADTH --ABCACAGTGGAGCACTG---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v016060_primary Reverse Complement Reverse Complement Forward 3 17 0.053668 Species: Mus musculus Original motif 0.180868 0.321661 0.134642 0.362829 0.232215 0.134289 0.315356 0.318141 0.065068 0.093681 0.569842 0.271408 0.370822 0.229680 0.154738 0.244759 0.323039 0.182873 0.173588 0.320500 0.175039 0.266898 0.276080 0.281984 0.412669 0.147730 0.146326 0.293275 0.325953 0.028805 0.629596 0.015646 0.003017 0.001766 0.979711 0.015507 0.888973 0.040666 0.069420 0.000941 0.017309 0.979155 0.000899 0.002637 0.001732 0.988816 0.004856 0.004596 0.889763 0.078125 0.010384 0.021729 0.007566 0.987081 0.001421 0.003932 0.027797 0.966593 0.000878 0.004731 0.025816 0.867003 0.065749 0.041433 0.220658 0.075256 0.582904 0.121182 0.088946 0.283695 0.565345 0.062015 0.328012 0.241332 0.305901 0.124755 0.307302 0.137589 0.375928 0.179181 0.298752 0.231470 0.315255 0.154524 0.094565 0.142901 0.705696 0.056838 Consensus sequence: HDGHHBHRGACCACCCGSVDVG Reverse complement motif 0.094565 0.705696 0.142901 0.056838 0.298752 0.315255 0.231470 0.154524 0.307302 0.375928 0.137589 0.179181 0.124755 0.241332 0.305901 0.328012 0.088946 0.565345 0.283695 0.062015 0.220658 0.582904 0.075256 0.121182 0.025816 0.065749 0.867003 0.041433 0.027797 0.000878 0.966593 0.004731 0.007566 0.001421 0.987081 0.003932 0.021729 0.078125 0.010384 0.889763 0.001732 0.004856 0.988816 0.004596 0.017309 0.000899 0.979155 0.002637 0.000941 0.040666 0.069420 0.888973 0.003017 0.979711 0.001766 0.015507 0.325953 0.629596 0.028805 0.015646 0.293275 0.147730 0.146326 0.412669 0.281984 0.266898 0.276080 0.175039 0.320500 0.182873 0.173588 0.323039 0.244759 0.229680 0.154738 0.370822 0.065068 0.569842 0.093681 0.271408 0.318141 0.134289 0.315356 0.232215 0.362829 0.321661 0.134642 0.180868 Consensus sequence: CVHBSCGGGTGGTCMHVHHCDH Alignment: CVHBSCGGGTGGTCMHVHHCDH --ABCACAGTGGAGCACTG--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00050 Bhlhb2_secondary Reverse Complement Original Motif Forward 6 17 0.053902 Species: Mus musculus Original motif 0.120938 0.344851 0.124072 0.410138 0.220931 0.169844 0.422396 0.186829 0.127752 0.260812 0.103811 0.507625 0.140641 0.405473 0.287668 0.166218 0.296957 0.155579 0.301094 0.246370 0.219647 0.287193 0.154072 0.339087 0.049294 0.026059 0.121789 0.802859 0.520042 0.289284 0.173423 0.017251 0.049190 0.943472 0.004308 0.003030 0.902609 0.006767 0.074770 0.015854 0.003221 0.971329 0.005512 0.019937 0.019937 0.005512 0.971329 0.003221 0.015854 0.074770 0.006767 0.902609 0.003030 0.004308 0.943472 0.049190 0.003497 0.088920 0.685942 0.221641 0.802859 0.121789 0.026059 0.049294 0.334544 0.155170 0.275193 0.235092 0.275957 0.132104 0.454982 0.136957 0.134097 0.254352 0.422940 0.188611 0.396163 0.432784 0.051281 0.119772 0.276474 0.115627 0.419844 0.188056 0.160759 0.088061 0.649863 0.101318 0.203314 0.166595 0.106821 0.523270 Consensus sequence: YDYBDHTMCACGTGGADDBMDGT Reverse complement motif 0.523270 0.166595 0.106821 0.203314 0.160759 0.649863 0.088061 0.101318 0.276474 0.419844 0.115627 0.188056 0.396163 0.051281 0.432784 0.119772 0.134097 0.422940 0.254352 0.188611 0.275957 0.454982 0.132104 0.136957 0.235092 0.155170 0.275193 0.334544 0.049294 0.121789 0.026059 0.802859 0.003497 0.685942 0.088920 0.221641 0.003030 0.943472 0.004308 0.049190 0.902609 0.074770 0.006767 0.015854 0.019937 0.971329 0.005512 0.003221 0.003221 0.005512 0.971329 0.019937 0.015854 0.006767 0.074770 0.902609 0.049190 0.004308 0.943472 0.003030 0.017251 0.289284 0.173423 0.520042 0.802859 0.026059 0.121789 0.049294 0.339087 0.287193 0.154072 0.219647 0.296957 0.301094 0.155579 0.246370 0.140641 0.287668 0.405473 0.166218 0.507625 0.260812 0.103811 0.127752 0.220931 0.422396 0.169844 0.186829 0.410138 0.344851 0.124072 0.120938 Consensus sequence: ACHRBHDTCCACGTGYAHHBMHM Alignment: YDYBDHTMCACGTGGADDBMDGT -----ABCACAGTGGAGCACTG- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00042 Gm397_primary Reverse Complement Reverse Complement Backward 1 17 0.055821 Species: Mus musculus Original motif 0.248614 0.321010 0.201723 0.228654 0.332381 0.190810 0.184854 0.291955 0.253802 0.119338 0.331394 0.295466 0.577827 0.100884 0.130066 0.191223 0.180374 0.011174 0.042942 0.765510 0.009131 0.024996 0.962422 0.003450 0.003308 0.034731 0.002930 0.959032 0.063907 0.001099 0.933714 0.001280 0.001280 0.933714 0.001099 0.063907 0.959032 0.002930 0.034731 0.003308 0.003450 0.962422 0.024996 0.009131 0.765510 0.042942 0.011174 0.180374 0.026456 0.256356 0.130672 0.586516 0.589555 0.285548 0.036864 0.088034 0.265828 0.529813 0.031915 0.172445 0.209015 0.104817 0.374275 0.311892 0.224283 0.292805 0.144270 0.338642 Consensus sequence: HHDATGTGCACATAMDH Reverse complement motif 0.338642 0.292805 0.144270 0.224283 0.209015 0.374275 0.104817 0.311892 0.265828 0.031915 0.529813 0.172445 0.088034 0.285548 0.036864 0.589555 0.586516 0.256356 0.130672 0.026456 0.180374 0.042942 0.011174 0.765510 0.003450 0.024996 0.962422 0.009131 0.003308 0.002930 0.034731 0.959032 0.001280 0.001099 0.933714 0.063907 0.063907 0.933714 0.001099 0.001280 0.959032 0.034731 0.002930 0.003308 0.009131 0.962422 0.024996 0.003450 0.765510 0.011174 0.042942 0.180374 0.191223 0.100884 0.130066 0.577827 0.253802 0.331394 0.119338 0.295466 0.291955 0.190810 0.184854 0.332381 0.248614 0.201723 0.321010 0.228654 Consensus sequence: HHRTATGTGCACATHHD Alignment: HHRTATGTGCACATHHD ABCACAGTGGAGCACTG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00526 Foxn1_secondary Original Motif Reverse Complement Backward 2 17 0.055867 Species: Mus musculus Original motif 0.477863 0.106306 0.184102 0.231729 0.304951 0.149020 0.361418 0.184612 0.548996 0.056128 0.348902 0.045974 0.385727 0.477782 0.086218 0.050273 0.409556 0.232265 0.173851 0.184328 0.174550 0.312880 0.307123 0.205448 0.850398 0.047204 0.041665 0.060734 0.141234 0.548534 0.142230 0.168002 0.059462 0.026354 0.892948 0.021236 0.053714 0.870297 0.028935 0.047055 0.086273 0.069147 0.805284 0.039296 0.033781 0.573881 0.034115 0.358223 0.035191 0.079663 0.824970 0.060176 0.051830 0.862631 0.019359 0.066180 0.178685 0.015738 0.762485 0.043092 0.058988 0.042615 0.017608 0.880789 0.202382 0.173360 0.284095 0.340163 0.098493 0.234651 0.506524 0.160333 0.109087 0.336204 0.250510 0.304198 0.130945 0.250843 0.177122 0.441090 0.353830 0.138838 0.162784 0.344548 0.114290 0.417163 0.160662 0.307885 Consensus sequence: DDRMHBACGCGYGCGTDGBBDB Reverse complement motif 0.114290 0.160662 0.417163 0.307885 0.344548 0.138838 0.162784 0.353830 0.441090 0.250843 0.177122 0.130945 0.109087 0.250510 0.336204 0.304198 0.098493 0.506524 0.234651 0.160333 0.340163 0.173360 0.284095 0.202382 0.880789 0.042615 0.017608 0.058988 0.178685 0.762485 0.015738 0.043092 0.051830 0.019359 0.862631 0.066180 0.035191 0.824970 0.079663 0.060176 0.033781 0.034115 0.573881 0.358223 0.086273 0.805284 0.069147 0.039296 0.053714 0.028935 0.870297 0.047055 0.059462 0.892948 0.026354 0.021236 0.141234 0.142230 0.548534 0.168002 0.060734 0.047204 0.041665 0.850398 0.174550 0.307123 0.312880 0.205448 0.184328 0.232265 0.173851 0.409556 0.385727 0.086218 0.477782 0.050273 0.045974 0.056128 0.348902 0.548996 0.304951 0.361418 0.149020 0.184612 0.231729 0.106306 0.184102 0.477863 Consensus sequence: BDVBCDACGCKCGCGTBHRKHD Alignment: BDVBCDACGCKCGCGTBHRKHD ----CAGTGCTCCACTGTGBT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 2 Motif ID: 21 Motif name: AmTGTGACACCACAGT Original motif 0.703125 0.187500 0.015625 0.093750 0.265625 0.500000 0.125000 0.109375 0.015625 0.046875 0.031250 0.906250 0.078125 0.015625 0.890625 0.015625 0.000000 0.000000 0.000000 1.000000 0.000000 0.031250 0.906250 0.062500 0.953125 0.000000 0.015625 0.031250 0.046875 0.890625 0.000000 0.062500 0.968750 0.000000 0.015625 0.015625 0.109375 0.781250 0.062500 0.046875 0.062500 0.890625 0.000000 0.046875 0.953125 0.000000 0.031250 0.015625 0.031250 0.781250 0.046875 0.140625 0.937500 0.015625 0.031250 0.015625 0.093750 0.078125 0.734375 0.093750 0.031250 0.078125 0.000000 0.890625 Consensus sequence: AMTGTGACACCACAGT Reserve complement motif 0.890625 0.078125 0.000000 0.031250 0.093750 0.734375 0.078125 0.093750 0.015625 0.015625 0.031250 0.937500 0.031250 0.046875 0.781250 0.140625 0.015625 0.000000 0.031250 0.953125 0.062500 0.000000 0.890625 0.046875 0.109375 0.062500 0.781250 0.046875 0.015625 0.000000 0.015625 0.968750 0.046875 0.000000 0.890625 0.062500 0.031250 0.000000 0.015625 0.953125 0.000000 0.906250 0.031250 0.062500 1.000000 0.000000 0.000000 0.000000 0.078125 0.890625 0.015625 0.015625 0.906250 0.046875 0.031250 0.015625 0.265625 0.125000 0.500000 0.109375 0.093750 0.187500 0.015625 0.703125 Consensus sequence: ACTGTGGTGTCACART ************************************************************************ Best Matches for Motif ID 21 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00020 Atf1_primary Original Motif Original Motif Forward 1 16 0.027393 Species: Mus musculus Original motif 0.381335 0.135129 0.244887 0.238648 0.139538 0.419619 0.195665 0.245178 0.158070 0.098493 0.409974 0.333462 0.472756 0.096594 0.388246 0.042403 0.008868 0.028811 0.005332 0.956990 0.014102 0.014269 0.863476 0.108153 0.962594 0.004653 0.011816 0.020937 0.003091 0.949099 0.003165 0.044646 0.044646 0.003165 0.949099 0.003091 0.020937 0.011816 0.004653 0.962594 0.108153 0.863476 0.014269 0.014102 0.956990 0.005332 0.028811 0.008868 0.049761 0.357863 0.144826 0.447550 0.225769 0.448432 0.142340 0.183460 0.264766 0.097627 0.493031 0.144576 0.352319 0.180279 0.236767 0.230635 Consensus sequence: DBDRTGACGTCAYHRD Reverse complement motif 0.230635 0.180279 0.236767 0.352319 0.264766 0.493031 0.097627 0.144576 0.225769 0.142340 0.448432 0.183460 0.447550 0.357863 0.144826 0.049761 0.008868 0.005332 0.028811 0.956990 0.108153 0.014269 0.863476 0.014102 0.962594 0.011816 0.004653 0.020937 0.044646 0.949099 0.003165 0.003091 0.003091 0.003165 0.949099 0.044646 0.020937 0.004653 0.011816 0.962594 0.014102 0.863476 0.014269 0.108153 0.956990 0.028811 0.005332 0.008868 0.042403 0.096594 0.388246 0.472756 0.158070 0.409974 0.098493 0.333462 0.139538 0.195665 0.419619 0.245178 0.238648 0.135129 0.244887 0.381335 Consensus sequence: DMDMTGACGTCAKHBD Alignment: DBDRTGACGTCAYHRD AMTGTGACACCACAGT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00159 Six2 Original Motif Reverse Complement Forward 2 16 0.030325 Species: Mus musculus Original motif 0.452545 0.099192 0.290852 0.157411 0.587199 0.117373 0.086707 0.208721 0.191837 0.044362 0.256539 0.507262 0.299111 0.107464 0.518651 0.074774 0.118226 0.040974 0.797168 0.043631 0.010113 0.030311 0.923661 0.035916 0.126925 0.002828 0.869144 0.001103 0.001338 0.000719 0.046297 0.951646 0.958864 0.001525 0.038365 0.001246 0.003353 0.001741 0.001927 0.992979 0.007665 0.981087 0.001717 0.009531 0.903866 0.022768 0.054074 0.019292 0.165996 0.505327 0.077238 0.251439 0.252666 0.168847 0.288545 0.289942 0.336830 0.080857 0.058862 0.523451 0.234102 0.268721 0.215252 0.281925 0.172036 0.083695 0.223889 0.520379 Consensus sequence: DAKRGGGTATCACDWHT Reverse complement motif 0.520379 0.083695 0.223889 0.172036 0.281925 0.268721 0.215252 0.234102 0.523451 0.080857 0.058862 0.336830 0.289942 0.168847 0.288545 0.252666 0.165996 0.077238 0.505327 0.251439 0.019292 0.022768 0.054074 0.903866 0.007665 0.001717 0.981087 0.009531 0.992979 0.001741 0.001927 0.003353 0.001246 0.001525 0.038365 0.958864 0.951646 0.000719 0.046297 0.001338 0.126925 0.869144 0.002828 0.001103 0.010113 0.923661 0.030311 0.035916 0.118226 0.797168 0.040974 0.043631 0.299111 0.518651 0.107464 0.074774 0.507262 0.044362 0.256539 0.191837 0.208721 0.117373 0.086707 0.587199 0.157411 0.099192 0.290852 0.452545 Consensus sequence: AHWDGTGATACCCMRTD Alignment: AHWDGTGATACCCMRTD -AMTGTGACACCACAGT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00103 Jundm2_primary Original Motif Original Motif Backward 1 16 0.034493 Species: Mus musculus Original motif 0.213023 0.312553 0.241727 0.232696 0.126878 0.453780 0.251405 0.167937 0.127927 0.138541 0.528637 0.204895 0.572671 0.136079 0.242107 0.049142 0.004569 0.015235 0.003215 0.976981 0.004594 0.008024 0.836426 0.150956 0.966548 0.003255 0.009947 0.020250 0.001636 0.899650 0.004880 0.093834 0.093834 0.004880 0.899650 0.001636 0.020250 0.009947 0.003255 0.966548 0.150956 0.836426 0.008024 0.004594 0.976981 0.003215 0.015235 0.004569 0.006508 0.324308 0.040126 0.629058 0.170728 0.554933 0.116757 0.157582 0.255966 0.170983 0.430910 0.142142 0.228601 0.267456 0.166199 0.337744 Consensus sequence: BBGATGACGTCAYCVH Reverse complement motif 0.337744 0.267456 0.166199 0.228601 0.255966 0.430910 0.170983 0.142142 0.170728 0.116757 0.554933 0.157582 0.629058 0.324308 0.040126 0.006508 0.004569 0.003215 0.015235 0.976981 0.150956 0.008024 0.836426 0.004594 0.966548 0.009947 0.003255 0.020250 0.093834 0.899650 0.004880 0.001636 0.001636 0.004880 0.899650 0.093834 0.020250 0.003255 0.009947 0.966548 0.004594 0.836426 0.008024 0.150956 0.976981 0.015235 0.003215 0.004569 0.049142 0.136079 0.242107 0.572671 0.127927 0.528637 0.138541 0.204895 0.126878 0.251405 0.453780 0.167937 0.213023 0.241727 0.312553 0.232696 Consensus sequence: HVGMTGACGTCATCBB Alignment: BBGATGACGTCAYCVH AMTGTGACACCACAGT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00122 Tgif1 Reverse Complement Reverse Complement Forward 1 16 0.034837 Species: Mus musculus Original motif 0.272977 0.158875 0.284742 0.283406 0.550609 0.124110 0.169608 0.155673 0.114568 0.207160 0.282464 0.395807 0.560868 0.052907 0.053508 0.332716 0.336500 0.068048 0.114050 0.481403 0.007736 0.003722 0.000495 0.988048 0.004489 0.000729 0.992211 0.002571 0.956618 0.000414 0.000890 0.042078 0.004381 0.990925 0.000538 0.004156 0.982797 0.000366 0.015539 0.001298 0.016760 0.002980 0.969991 0.010269 0.036013 0.725983 0.200022 0.037982 0.064755 0.104386 0.133891 0.696968 0.199404 0.263520 0.410228 0.126848 0.222648 0.351390 0.272575 0.153387 0.087778 0.206043 0.395671 0.310507 0.319643 0.144216 0.196041 0.340100 Consensus sequence: DABWWTGACAGCTVVBD Reverse complement motif 0.340100 0.144216 0.196041 0.319643 0.087778 0.395671 0.206043 0.310507 0.222648 0.272575 0.351390 0.153387 0.199404 0.410228 0.263520 0.126848 0.696968 0.104386 0.133891 0.064755 0.036013 0.200022 0.725983 0.037982 0.016760 0.969991 0.002980 0.010269 0.001298 0.000366 0.015539 0.982797 0.004381 0.000538 0.990925 0.004156 0.042078 0.000414 0.000890 0.956618 0.004489 0.992211 0.000729 0.002571 0.988048 0.003722 0.000495 0.007736 0.481403 0.068048 0.114050 0.336500 0.332716 0.052907 0.053508 0.560868 0.395807 0.207160 0.282464 0.114568 0.155673 0.124110 0.169608 0.550609 0.272977 0.284742 0.158875 0.283406 Consensus sequence: DBVVAGCTGTCAWWVTH Alignment: DBVVAGCTGTCAWWVTH ACTGTGGTGTCACART- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00195 Six3 Reverse Complement Original Motif Backward 2 16 0.034908 Species: Mus musculus Original motif 0.333695 0.093488 0.364569 0.208248 0.720387 0.079055 0.078819 0.121739 0.228565 0.054353 0.169178 0.547904 0.473776 0.098972 0.322497 0.104754 0.072282 0.069213 0.818062 0.040444 0.015799 0.021866 0.895094 0.067240 0.162037 0.008758 0.827015 0.002191 0.001775 0.000990 0.043426 0.953808 0.965015 0.002030 0.031105 0.001850 0.003203 0.001736 0.003784 0.991277 0.012698 0.972998 0.004011 0.010293 0.917291 0.027214 0.032991 0.022504 0.185849 0.445801 0.093804 0.274545 0.248167 0.232363 0.199701 0.319769 0.402850 0.084312 0.108918 0.403921 0.335914 0.216832 0.177371 0.269883 0.075023 0.107186 0.239759 0.578031 Consensus sequence: DATRGGGTATCAHHWHT Reverse complement motif 0.578031 0.107186 0.239759 0.075023 0.269883 0.216832 0.177371 0.335914 0.403921 0.084312 0.108918 0.402850 0.319769 0.232363 0.199701 0.248167 0.185849 0.093804 0.445801 0.274545 0.022504 0.027214 0.032991 0.917291 0.012698 0.004011 0.972998 0.010293 0.991277 0.001736 0.003784 0.003203 0.001850 0.002030 0.031105 0.965015 0.953808 0.000990 0.043426 0.001775 0.162037 0.827015 0.008758 0.002191 0.015799 0.895094 0.021866 0.067240 0.072282 0.818062 0.069213 0.040444 0.104754 0.098972 0.322497 0.473776 0.547904 0.054353 0.169178 0.228565 0.121739 0.079055 0.078819 0.720387 0.333695 0.364569 0.093488 0.208248 Consensus sequence: AHWHDTGATACCCKATH Alignment: DATRGGGTATCAHHWHT ACTGTGGTGTCACART- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00388 Six6_2267.4 Reverse Complement Original Motif Backward 2 16 0.035409 Species: Mus musculus Original motif 0.330559 0.118371 0.278738 0.272331 0.605486 0.104492 0.066247 0.223775 0.180170 0.051522 0.131669 0.636639 0.431457 0.173748 0.323416 0.071378 0.131729 0.037944 0.812991 0.017337 0.022726 0.033975 0.914981 0.028317 0.138556 0.012597 0.847660 0.001188 0.001916 0.001156 0.046653 0.950276 0.965626 0.001518 0.031319 0.001536 0.003782 0.001412 0.002175 0.992631 0.006601 0.979412 0.002328 0.011660 0.947233 0.007670 0.017734 0.027363 0.374066 0.305253 0.063914 0.256767 0.267070 0.210201 0.216997 0.305732 0.294988 0.127424 0.094154 0.483434 0.354130 0.195592 0.176636 0.273642 0.094874 0.110275 0.192261 0.602591 Consensus sequence: DATRGGGTATCAHDWHT Reverse complement motif 0.602591 0.110275 0.192261 0.094874 0.273642 0.195592 0.176636 0.354130 0.483434 0.127424 0.094154 0.294988 0.305732 0.210201 0.216997 0.267070 0.256767 0.305253 0.063914 0.374066 0.027363 0.007670 0.017734 0.947233 0.006601 0.002328 0.979412 0.011660 0.992631 0.001412 0.002175 0.003782 0.001536 0.001518 0.031319 0.965626 0.950276 0.001156 0.046653 0.001916 0.138556 0.847660 0.012597 0.001188 0.022726 0.914981 0.033975 0.028317 0.131729 0.812991 0.037944 0.017337 0.071378 0.173748 0.323416 0.431457 0.636639 0.051522 0.131669 0.180170 0.223775 0.104492 0.066247 0.605486 0.272331 0.118371 0.278738 0.330559 Consensus sequence: AHWDHTGATACCCKATD Alignment: DATRGGGTATCAHDWHT ACTGTGGTGTCACART- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00192 Six1 Reverse Complement Original Motif Forward 1 16 0.035431 Species: Mus musculus Original motif 0.319306 0.130147 0.399309 0.151238 0.482636 0.211172 0.085871 0.220321 0.214292 0.085504 0.207353 0.492851 0.392819 0.136859 0.403883 0.066438 0.215886 0.049341 0.685932 0.048842 0.039793 0.053756 0.870240 0.036211 0.202525 0.005026 0.791396 0.001053 0.001092 0.001021 0.052968 0.944919 0.963185 0.001738 0.033596 0.001480 0.002017 0.001886 0.002847 0.993250 0.009914 0.974962 0.001987 0.013137 0.909252 0.021586 0.037899 0.031263 0.177851 0.274190 0.117998 0.429961 0.228906 0.159459 0.303955 0.307681 0.330938 0.158106 0.118706 0.392251 0.160453 0.267920 0.280244 0.291383 0.176707 0.068175 0.229538 0.525580 Consensus sequence: DHDRGGGTATCAHDHBT Reverse complement motif 0.525580 0.068175 0.229538 0.176707 0.291383 0.267920 0.280244 0.160453 0.392251 0.158106 0.118706 0.330938 0.307681 0.159459 0.303955 0.228906 0.429961 0.274190 0.117998 0.177851 0.031263 0.021586 0.037899 0.909252 0.009914 0.001987 0.974962 0.013137 0.993250 0.001886 0.002847 0.002017 0.001480 0.001738 0.033596 0.963185 0.944919 0.001021 0.052968 0.001092 0.202525 0.791396 0.005026 0.001053 0.039793 0.870240 0.053756 0.036211 0.215886 0.685932 0.049341 0.048842 0.392819 0.403883 0.136859 0.066438 0.492851 0.085504 0.207353 0.214292 0.220321 0.211172 0.085871 0.482636 0.319306 0.399309 0.130147 0.151238 Consensus sequence: AVHDHTGATACCCMDHH Alignment: AVHDHTGATACCCMDHH ACTGTGGTGTCACART- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00199 Six4 Original Motif Original Motif Forward 2 16 0.035515 Species: Mus musculus Original motif 0.523054 0.168817 0.140331 0.167798 0.187385 0.177009 0.246164 0.389442 0.414492 0.118547 0.308876 0.158085 0.345234 0.289795 0.130249 0.234723 0.611522 0.116948 0.098944 0.172586 0.016342 0.029436 0.015062 0.939161 0.014351 0.004796 0.962435 0.018418 0.987454 0.005228 0.002590 0.004727 0.007431 0.812214 0.005849 0.174506 0.969354 0.025386 0.002362 0.002898 0.005123 0.989068 0.003362 0.002447 0.001424 0.969981 0.012011 0.016585 0.209729 0.227411 0.210523 0.352337 0.341679 0.297940 0.104590 0.255792 0.126190 0.288862 0.245018 0.339930 0.173008 0.295896 0.252422 0.278674 0.409639 0.210750 0.296197 0.083415 Consensus sequence: ADDHATGACACCBHBBV Reverse complement motif 0.083415 0.210750 0.296197 0.409639 0.173008 0.252422 0.295896 0.278674 0.339930 0.288862 0.245018 0.126190 0.255792 0.297940 0.104590 0.341679 0.352337 0.227411 0.210523 0.209729 0.001424 0.012011 0.969981 0.016585 0.005123 0.003362 0.989068 0.002447 0.002898 0.025386 0.002362 0.969354 0.007431 0.005849 0.812214 0.174506 0.004727 0.005228 0.002590 0.987454 0.014351 0.962435 0.004796 0.018418 0.939161 0.029436 0.015062 0.016342 0.172586 0.116948 0.098944 0.611522 0.234723 0.289795 0.130249 0.345234 0.158085 0.118547 0.308876 0.414492 0.389442 0.177009 0.246164 0.187385 0.167798 0.168817 0.140331 0.523054 Consensus sequence: BBVHVGGTGTCATHDDT Alignment: ADDHATGACACCBHBBV -AMTGTGACACCACAGT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00053 Rxra_primary Original Motif Original Motif Forward 2 16 0.036249 Species: Mus musculus Original motif 0.235299 0.222264 0.237416 0.305021 0.144778 0.278902 0.341673 0.234648 0.261127 0.261904 0.191591 0.285378 0.119943 0.410774 0.218940 0.250343 0.222672 0.075554 0.365253 0.336521 0.001838 0.046904 0.002828 0.948430 0.030410 0.006359 0.960821 0.002410 0.987391 0.007562 0.002810 0.002237 0.105188 0.888650 0.001163 0.004998 0.006475 0.987074 0.001793 0.004659 0.001816 0.765138 0.003092 0.229953 0.010354 0.846496 0.029899 0.113251 0.328732 0.039382 0.265510 0.366377 0.209638 0.262628 0.145613 0.382121 0.385390 0.177695 0.299828 0.137087 0.403452 0.268924 0.096028 0.231595 0.203082 0.231812 0.213520 0.351585 Consensus sequence: DBHBDTGACCCCDHVHB Reverse complement motif 0.351585 0.231812 0.213520 0.203082 0.231595 0.268924 0.096028 0.403452 0.137087 0.177695 0.299828 0.385390 0.382121 0.262628 0.145613 0.209638 0.366377 0.039382 0.265510 0.328732 0.010354 0.029899 0.846496 0.113251 0.001816 0.003092 0.765138 0.229953 0.006475 0.001793 0.987074 0.004659 0.105188 0.001163 0.888650 0.004998 0.002237 0.007562 0.002810 0.987391 0.030410 0.960821 0.006359 0.002410 0.948430 0.046904 0.002828 0.001838 0.222672 0.365253 0.075554 0.336521 0.119943 0.218940 0.410774 0.250343 0.285378 0.261904 0.191591 0.261127 0.144778 0.341673 0.278902 0.234648 0.305021 0.222264 0.237416 0.235299 Consensus sequence: VHBHDGGGGTCAHBHBD Alignment: DBHBDTGACCCCDHVHB -AMTGTGACACCACAGT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00388 Six6_2267.5 Original Motif Reverse Complement Backward 1 16 0.037488 Species: Mus musculus Original motif 0.357565 0.095438 0.345110 0.201887 0.415206 0.108701 0.160030 0.316063 0.276710 0.105226 0.183597 0.434468 0.461481 0.135300 0.303126 0.100093 0.190186 0.035578 0.728290 0.045946 0.040893 0.024794 0.889495 0.044817 0.197092 0.018297 0.781124 0.003487 0.005212 0.002190 0.027421 0.965178 0.970183 0.002451 0.021340 0.006025 0.004645 0.002381 0.003788 0.989186 0.017413 0.955357 0.007268 0.019962 0.927889 0.018513 0.013421 0.040177 0.411060 0.139133 0.096462 0.353345 0.215585 0.237932 0.205422 0.341060 0.409189 0.134754 0.084179 0.371879 0.210772 0.273586 0.108006 0.407635 0.091781 0.159161 0.216288 0.532770 Consensus sequence: DDDRGGGTATCAWHWHT Reverse complement motif 0.532770 0.159161 0.216288 0.091781 0.407635 0.273586 0.108006 0.210772 0.371879 0.134754 0.084179 0.409189 0.341060 0.237932 0.205422 0.215585 0.353345 0.139133 0.096462 0.411060 0.040177 0.018513 0.013421 0.927889 0.017413 0.007268 0.955357 0.019962 0.989186 0.002381 0.003788 0.004645 0.006025 0.002451 0.021340 0.970183 0.965178 0.002190 0.027421 0.005212 0.197092 0.781124 0.018297 0.003487 0.040893 0.889495 0.024794 0.044817 0.190186 0.728290 0.035578 0.045946 0.100093 0.135300 0.303126 0.461481 0.434468 0.105226 0.183597 0.276710 0.316063 0.108701 0.160030 0.415206 0.201887 0.095438 0.345110 0.357565 Consensus sequence: AHWHWTGATACCCKDDD Alignment: DDDRGGGTATCAWHWHT -AMTGTGACACCACAGT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 2 Motif ID: 22 Motif name: CACTGTGrYrtCACAGTGswsCAcT Original motif 0.111111 0.746032 0.063492 0.079365 0.857143 0.047619 0.047619 0.047619 0.047619 0.857143 0.079365 0.015873 0.031746 0.000000 0.000000 0.968254 0.031746 0.015873 0.904762 0.047619 0.000000 0.000000 0.000000 1.000000 0.031746 0.000000 0.857143 0.111111 0.396825 0.111111 0.412698 0.079365 0.031746 0.253968 0.015873 0.698413 0.365079 0.000000 0.634921 0.000000 0.079365 0.206349 0.047619 0.666667 0.047619 0.936508 0.015873 0.000000 0.952381 0.000000 0.015873 0.031746 0.015873 0.920635 0.000000 0.063492 0.920635 0.000000 0.000000 0.079365 0.063492 0.047619 0.841270 0.047619 0.000000 0.000000 0.015873 0.984127 0.047619 0.015873 0.904762 0.031746 0.015873 0.603175 0.317460 0.063492 0.396825 0.000000 0.015873 0.587302 0.015873 0.476190 0.428571 0.079365 0.063492 0.920635 0.000000 0.015873 0.920635 0.015873 0.047619 0.015873 0.095238 0.682540 0.095238 0.126984 0.047619 0.015873 0.095238 0.841270 Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reserve complement motif 0.841270 0.015873 0.095238 0.047619 0.095238 0.095238 0.682540 0.126984 0.015873 0.015873 0.047619 0.920635 0.063492 0.000000 0.920635 0.015873 0.015873 0.428571 0.476190 0.079365 0.587302 0.000000 0.015873 0.396825 0.015873 0.317460 0.603175 0.063492 0.047619 0.904762 0.015873 0.031746 0.984127 0.000000 0.015873 0.000000 0.063492 0.841270 0.047619 0.047619 0.079365 0.000000 0.000000 0.920635 0.015873 0.000000 0.920635 0.063492 0.031746 0.000000 0.015873 0.952381 0.047619 0.015873 0.936508 0.000000 0.666667 0.206349 0.047619 0.079365 0.365079 0.634921 0.000000 0.000000 0.698413 0.253968 0.015873 0.031746 0.396825 0.412698 0.111111 0.079365 0.031746 0.857143 0.000000 0.111111 1.000000 0.000000 0.000000 0.000000 0.031746 0.904762 0.015873 0.047619 0.968254 0.000000 0.000000 0.031746 0.047619 0.079365 0.857143 0.015873 0.047619 0.047619 0.047619 0.857143 0.111111 0.063492 0.746032 0.079365 Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG ************************************************************************ Best Matches for Motif ID 22 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00034 Sox7_primary Original Motif Original Motif Backward 2 21 0.055837 Species: Mus musculus Original motif 0.360997 0.300272 0.115555 0.223177 0.309749 0.228429 0.166233 0.295589 0.149419 0.176868 0.240155 0.433558 0.379704 0.095791 0.276373 0.248133 0.394549 0.174184 0.130641 0.300626 0.443749 0.070776 0.211081 0.274393 0.364301 0.074356 0.370406 0.190936 0.791976 0.038475 0.093390 0.076159 0.963721 0.001826 0.002456 0.031997 0.004516 0.954596 0.008092 0.032796 0.981080 0.002062 0.002161 0.014697 0.986185 0.001846 0.006976 0.004992 0.059567 0.003649 0.002189 0.934595 0.495328 0.024257 0.240450 0.239965 0.305027 0.094878 0.526069 0.074025 0.418442 0.196237 0.158323 0.226998 0.336713 0.220452 0.191155 0.251680 0.192296 0.300342 0.169047 0.338315 0.240387 0.144634 0.128513 0.486465 0.290763 0.271259 0.116600 0.321377 0.224825 0.296233 0.229255 0.249687 0.493240 0.171285 0.075148 0.260326 Consensus sequence: HHBDHDDAACAATDRHHHHHBW Reverse complement motif 0.260326 0.171285 0.075148 0.493240 0.224825 0.229255 0.296233 0.249687 0.321377 0.271259 0.116600 0.290763 0.486465 0.144634 0.128513 0.240387 0.338315 0.300342 0.169047 0.192296 0.251680 0.220452 0.191155 0.336713 0.226998 0.196237 0.158323 0.418442 0.305027 0.526069 0.094878 0.074025 0.239965 0.024257 0.240450 0.495328 0.934595 0.003649 0.002189 0.059567 0.004992 0.001846 0.006976 0.986185 0.014697 0.002062 0.002161 0.981080 0.004516 0.008092 0.954596 0.032796 0.031997 0.001826 0.002456 0.963721 0.076159 0.038475 0.093390 0.791976 0.364301 0.370406 0.074356 0.190936 0.274393 0.070776 0.211081 0.443749 0.300626 0.174184 0.130641 0.394549 0.248133 0.095791 0.276373 0.379704 0.433558 0.176868 0.240155 0.149419 0.295589 0.228429 0.166233 0.309749 0.223177 0.300272 0.115555 0.360997 Consensus sequence: WBHHHHHMDATTGTTHDHDVHH Alignment: ----HHBDHDDAACAATDRHHHHHBW CACTGTGRTRTCACAGTGSWSCACT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v015681_secondary Reverse Complement Reverse Complement Forward 3 20 0.554770 Species: Mus musculus Original motif 0.214165 0.143436 0.372522 0.269876 0.314445 0.406003 0.160351 0.119201 0.137147 0.092924 0.042921 0.727007 0.044121 0.072843 0.051741 0.831295 0.261292 0.324124 0.298498 0.116086 0.258125 0.323243 0.263362 0.155271 0.204557 0.589399 0.107153 0.098891 0.371021 0.244027 0.291102 0.093849 0.096327 0.572718 0.011797 0.319159 0.027282 0.046183 0.844519 0.082016 0.018921 0.012887 0.915917 0.052275 0.364793 0.166722 0.084229 0.384256 0.028216 0.011233 0.951056 0.009495 0.054974 0.004738 0.890377 0.049911 0.006802 0.312915 0.134247 0.546036 0.241289 0.628210 0.104788 0.025713 0.237863 0.302807 0.213018 0.246311 0.349399 0.203220 0.086635 0.360746 0.386634 0.144693 0.246895 0.221779 0.425101 0.354676 0.093374 0.126849 0.060272 0.391320 0.104905 0.443503 0.162090 0.190233 0.227433 0.420244 Consensus sequence: DVTTVVCVYGGHGGYCHHDMYB Reverse complement motif 0.420244 0.190233 0.227433 0.162090 0.443503 0.391320 0.104905 0.060272 0.126849 0.354676 0.093374 0.425101 0.221779 0.144693 0.246895 0.386634 0.360746 0.203220 0.086635 0.349399 0.237863 0.213018 0.302807 0.246311 0.241289 0.104788 0.628210 0.025713 0.546036 0.312915 0.134247 0.006802 0.054974 0.890377 0.004738 0.049911 0.028216 0.951056 0.011233 0.009495 0.384256 0.166722 0.084229 0.364793 0.018921 0.915917 0.012887 0.052275 0.027282 0.844519 0.046183 0.082016 0.096327 0.011797 0.572718 0.319159 0.093849 0.244027 0.291102 0.371021 0.204557 0.107153 0.589399 0.098891 0.258125 0.263362 0.323243 0.155271 0.261292 0.298498 0.324124 0.116086 0.831295 0.072843 0.051741 0.044121 0.727007 0.092924 0.042921 0.137147 0.314445 0.160351 0.406003 0.119201 0.214165 0.372522 0.143436 0.269876 Consensus sequence: VMYDHDGMCCHCCKBGVVAAVH Alignment: VMYDHDGMCCHCCKBGVVAAVH----- --AGTGSWSCACTGTGAMAMCACAGTG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v016060_primary Reverse Complement Original Motif Forward 7 19 1.057225 Species: Mus musculus Original motif 0.137831 0.118922 0.394177 0.349070 0.190108 0.163633 0.138507 0.507753 0.346002 0.332315 0.228621 0.093063 0.113254 0.287554 0.373285 0.225908 0.272578 0.125402 0.328963 0.273057 0.333973 0.115165 0.194267 0.356595 0.381054 0.086215 0.501679 0.031052 0.002232 0.007405 0.966087 0.024276 0.834741 0.112115 0.052053 0.001091 0.009034 0.983239 0.000766 0.006960 0.002054 0.988103 0.003138 0.006705 0.805772 0.171299 0.008415 0.014515 0.020076 0.976846 0.000894 0.002183 0.079914 0.917273 0.001179 0.001634 0.013983 0.950545 0.004205 0.031267 0.789407 0.039441 0.108645 0.062507 0.055453 0.161271 0.595249 0.188028 0.333424 0.128169 0.373270 0.165136 0.536103 0.109520 0.062980 0.291397 0.346477 0.090909 0.279533 0.283081 0.045892 0.190183 0.584314 0.179611 0.088294 0.406148 0.251647 0.253912 0.202467 0.447159 0.162802 0.187571 Consensus sequence: DTVBDDRGACCACCCAGDWDGBH Reverse complement motif 0.202467 0.162802 0.447159 0.187571 0.088294 0.251647 0.406148 0.253912 0.045892 0.584314 0.190183 0.179611 0.283081 0.090909 0.279533 0.346477 0.291397 0.109520 0.062980 0.536103 0.333424 0.373270 0.128169 0.165136 0.055453 0.595249 0.161271 0.188028 0.062507 0.039441 0.108645 0.789407 0.013983 0.004205 0.950545 0.031267 0.079914 0.001179 0.917273 0.001634 0.020076 0.000894 0.976846 0.002183 0.014515 0.171299 0.008415 0.805772 0.002054 0.003138 0.988103 0.006705 0.009034 0.000766 0.983239 0.006960 0.001091 0.112115 0.052053 0.834741 0.002232 0.966087 0.007405 0.024276 0.381054 0.501679 0.086215 0.031052 0.356595 0.115165 0.194267 0.333973 0.272578 0.328963 0.125402 0.273057 0.113254 0.373285 0.287554 0.225908 0.093063 0.332315 0.228621 0.346002 0.507753 0.163633 0.138507 0.190108 0.137831 0.394177 0.118922 0.349070 Consensus sequence: DBCDWHCTGGGTGGTCMDHBBAH Alignment: DBCDWHCTGGGTGGTCMDHBBAH------ ------AGTGSWSCACTGTGAMAMCACAGTG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v016060_primary Reverse Complement Reverse Complement Forward 7 19 1.059462 Species: Mus musculus Original motif 0.204923 0.208846 0.365383 0.220848 0.294304 0.300143 0.167287 0.238266 0.109711 0.619514 0.117379 0.153396 0.178979 0.378580 0.230177 0.212264 0.159594 0.542602 0.118178 0.179627 0.125206 0.430074 0.151826 0.292894 0.097692 0.709845 0.116956 0.075506 0.148292 0.565912 0.037632 0.248164 0.077951 0.034190 0.855503 0.032356 0.001657 0.001061 0.971877 0.025405 0.001926 0.001084 0.991712 0.005278 0.033031 0.012001 0.057796 0.897171 0.002723 0.002647 0.993348 0.001281 0.003261 0.000963 0.987199 0.008577 0.000611 0.090925 0.074857 0.833608 0.015299 0.978878 0.004949 0.000874 0.013368 0.600902 0.033485 0.352245 0.231949 0.149575 0.118804 0.499672 0.267580 0.186002 0.371242 0.175176 0.264884 0.223483 0.110082 0.401551 0.221365 0.170121 0.179559 0.428955 0.112997 0.692930 0.139981 0.054092 0.460305 0.207883 0.155111 0.176702 Consensus sequence: BHCBCBCCGGGTGGTCYHVHDCH Reverse complement motif 0.176702 0.207883 0.155111 0.460305 0.112997 0.139981 0.692930 0.054092 0.428955 0.170121 0.179559 0.221365 0.401551 0.223483 0.110082 0.264884 0.267580 0.371242 0.186002 0.175176 0.499672 0.149575 0.118804 0.231949 0.013368 0.033485 0.600902 0.352245 0.015299 0.004949 0.978878 0.000874 0.833608 0.090925 0.074857 0.000611 0.003261 0.987199 0.000963 0.008577 0.002723 0.993348 0.002647 0.001281 0.897171 0.012001 0.057796 0.033031 0.001926 0.991712 0.001084 0.005278 0.001657 0.971877 0.001061 0.025405 0.077951 0.855503 0.034190 0.032356 0.148292 0.037632 0.565912 0.248164 0.097692 0.116956 0.709845 0.075506 0.125206 0.151826 0.430074 0.292894 0.159594 0.118178 0.542602 0.179627 0.178979 0.230177 0.378580 0.212264 0.109711 0.117379 0.619514 0.153396 0.294304 0.167287 0.300143 0.238266 0.204923 0.365383 0.208846 0.220848 Consensus sequence: HGDHVHKGACCACCCGGBGBGDB Alignment: HGDHVHKGACCACCCGGBGBGDB------ ------AGTGSWSCACTGTGAMAMCACAGTG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v015681_primary Original Motif Reverse Complement Forward 8 18 1.549601 Species: Mus musculus Original motif 0.472795 0.179227 0.091251 0.256726 0.036521 0.159743 0.204840 0.598896 0.164582 0.312805 0.221324 0.301289 0.237069 0.249050 0.293048 0.220833 0.401949 0.225181 0.229401 0.143469 0.161422 0.494334 0.252207 0.092036 0.252940 0.177721 0.369400 0.199939 0.119630 0.024651 0.849920 0.005798 0.000962 0.002398 0.990616 0.006023 0.937852 0.027016 0.034535 0.000597 0.008963 0.987756 0.000629 0.002652 0.001584 0.992898 0.002349 0.003169 0.956822 0.027342 0.002484 0.013352 0.009873 0.987759 0.000988 0.001381 0.016397 0.980856 0.000369 0.002378 0.081761 0.758555 0.038572 0.121112 0.371713 0.091838 0.448027 0.088423 0.111617 0.121913 0.683885 0.082585 0.334562 0.102916 0.436488 0.126034 0.210362 0.101261 0.238339 0.450037 0.169041 0.271583 0.320799 0.238576 0.140316 0.049885 0.735236 0.074563 Consensus sequence: HTBVVVDGGACCACCCRGRDBG Reverse complement motif 0.140316 0.735236 0.049885 0.074563 0.169041 0.320799 0.271583 0.238576 0.450037 0.101261 0.238339 0.210362 0.334562 0.436488 0.102916 0.126034 0.111617 0.683885 0.121913 0.082585 0.371713 0.448027 0.091838 0.088423 0.081761 0.038572 0.758555 0.121112 0.016397 0.000369 0.980856 0.002378 0.009873 0.000988 0.987759 0.001381 0.013352 0.027342 0.002484 0.956822 0.001584 0.002349 0.992898 0.003169 0.008963 0.000629 0.987756 0.002652 0.000597 0.027016 0.034535 0.937852 0.000962 0.990616 0.002398 0.006023 0.119630 0.849920 0.024651 0.005798 0.252940 0.369400 0.177721 0.199939 0.161422 0.252207 0.494334 0.092036 0.143469 0.225181 0.229401 0.401949 0.237069 0.293048 0.249050 0.220833 0.164582 0.221324 0.312805 0.301289 0.598896 0.159743 0.204840 0.036521 0.256726 0.179227 0.091251 0.472795 Consensus sequence: CBDMCMGGGTGGTCCHVBVBAH Alignment: HTBVVVDGGACCACCCRGRDBG------- -------CACTGTGRTRTCACAGTGSWSCACT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00528 Foxm1_primary Original Motif Reverse Complement Forward 8 18 1.551493 Species: Mus musculus Original motif 0.402634 0.249702 0.143705 0.203959 0.709619 0.108953 0.130781 0.050647 0.334232 0.077498 0.228818 0.359452 0.131721 0.094794 0.234481 0.539005 0.170102 0.237609 0.252464 0.339824 0.244961 0.347304 0.228129 0.179606 0.612141 0.132244 0.180110 0.075504 0.472236 0.042388 0.234419 0.250957 0.125213 0.007413 0.849788 0.017587 0.702068 0.064216 0.141992 0.091724 0.008657 0.038238 0.002959 0.950145 0.007170 0.002244 0.986824 0.003763 0.002862 0.979956 0.000711 0.016471 0.971196 0.001954 0.011441 0.015409 0.105575 0.031482 0.022836 0.840107 0.031534 0.736742 0.032785 0.198939 0.479153 0.347558 0.031799 0.141490 0.056405 0.123140 0.023989 0.796466 0.111194 0.195344 0.501360 0.192102 0.376359 0.416820 0.072818 0.134004 0.225111 0.249460 0.306563 0.218866 0.405251 0.168478 0.108618 0.317653 0.165386 0.191749 0.268604 0.374261 Consensus sequence: HADTBVADGATGCATCMTGMVHB Reverse complement motif 0.374261 0.191749 0.268604 0.165386 0.317653 0.168478 0.108618 0.405251 0.225111 0.306563 0.249460 0.218866 0.376359 0.072818 0.416820 0.134004 0.111194 0.501360 0.195344 0.192102 0.796466 0.123140 0.023989 0.056405 0.141490 0.347558 0.031799 0.479153 0.031534 0.032785 0.736742 0.198939 0.840107 0.031482 0.022836 0.105575 0.015409 0.001954 0.011441 0.971196 0.002862 0.000711 0.979956 0.016471 0.007170 0.986824 0.002244 0.003763 0.950145 0.038238 0.002959 0.008657 0.091724 0.064216 0.141992 0.702068 0.125213 0.849788 0.007413 0.017587 0.250957 0.042388 0.234419 0.472236 0.075504 0.132244 0.180110 0.612141 0.244961 0.228129 0.347304 0.179606 0.339824 0.237609 0.252464 0.170102 0.539005 0.094794 0.234481 0.131721 0.359452 0.077498 0.228818 0.334232 0.050647 0.108953 0.130781 0.709619 0.203959 0.249702 0.143705 0.402634 Consensus sequence: VHVRCAYGATGCATCDTVVADTH Alignment: HADTBVADGATGCATCMTGMVHB------- -------CACTGTGRTRTCACAGTGSWSCACT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v016060_primary Reverse Complement Original Motif Backward 8 18 1.556070 Species: Mus musculus Original motif 0.180868 0.321661 0.134642 0.362829 0.232215 0.134289 0.315356 0.318141 0.065068 0.093681 0.569842 0.271408 0.370822 0.229680 0.154738 0.244759 0.323039 0.182873 0.173588 0.320500 0.175039 0.266898 0.276080 0.281984 0.412669 0.147730 0.146326 0.293275 0.325953 0.028805 0.629596 0.015646 0.003017 0.001766 0.979711 0.015507 0.888973 0.040666 0.069420 0.000941 0.017309 0.979155 0.000899 0.002637 0.001732 0.988816 0.004856 0.004596 0.889763 0.078125 0.010384 0.021729 0.007566 0.987081 0.001421 0.003932 0.027797 0.966593 0.000878 0.004731 0.025816 0.867003 0.065749 0.041433 0.220658 0.075256 0.582904 0.121182 0.088946 0.283695 0.565345 0.062015 0.328012 0.241332 0.305901 0.124755 0.307302 0.137589 0.375928 0.179181 0.298752 0.231470 0.315255 0.154524 0.094565 0.142901 0.705696 0.056838 Consensus sequence: HDGHHBHRGACCACCCGSVDVG Reverse complement motif 0.094565 0.705696 0.142901 0.056838 0.298752 0.315255 0.231470 0.154524 0.307302 0.375928 0.137589 0.179181 0.124755 0.241332 0.305901 0.328012 0.088946 0.565345 0.283695 0.062015 0.220658 0.582904 0.075256 0.121182 0.025816 0.065749 0.867003 0.041433 0.027797 0.000878 0.966593 0.004731 0.007566 0.001421 0.987081 0.003932 0.021729 0.078125 0.010384 0.889763 0.001732 0.004856 0.988816 0.004596 0.017309 0.000899 0.979155 0.002637 0.000941 0.040666 0.069420 0.888973 0.003017 0.979711 0.001766 0.015507 0.325953 0.629596 0.028805 0.015646 0.293275 0.147730 0.146326 0.412669 0.281984 0.266898 0.276080 0.175039 0.320500 0.182873 0.173588 0.323039 0.244759 0.229680 0.154738 0.370822 0.065068 0.569842 0.093681 0.271408 0.318141 0.134289 0.315356 0.232215 0.362829 0.321661 0.134642 0.180868 Consensus sequence: CVHBSCGGGTGGTCMHVHHCDH Alignment: -------CVHBSCGGGTGGTCMHVHHCDH AGTGSWSCACTGTGAMAMCACAGTG------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00228 Bapx1 Reverse Complement Original Motif Backward 8 17 2.042465 Species: Mus musculus Original motif 0.301697 0.347856 0.239075 0.111372 0.364458 0.225587 0.074842 0.335112 0.228472 0.141747 0.139010 0.490770 0.559532 0.164793 0.197557 0.078118 0.506611 0.130882 0.113226 0.249281 0.054222 0.680706 0.257913 0.007160 0.001978 0.899030 0.000622 0.098369 0.950561 0.002121 0.000888 0.046429 0.037529 0.960534 0.000660 0.001278 0.001571 0.005538 0.001403 0.991487 0.001274 0.052527 0.000520 0.945679 0.926306 0.006886 0.003823 0.062985 0.638246 0.038639 0.145042 0.178072 0.266452 0.337698 0.283972 0.111878 0.307019 0.250170 0.243307 0.199504 0.550380 0.190997 0.122920 0.135703 0.187982 0.330356 0.168897 0.312765 Consensus sequence: VHHAACCACTTAAVVAH Reverse complement motif 0.187982 0.168897 0.330356 0.312765 0.135703 0.190997 0.122920 0.550380 0.199504 0.250170 0.243307 0.307019 0.266452 0.283972 0.337698 0.111878 0.178072 0.038639 0.145042 0.638246 0.062985 0.006886 0.003823 0.926306 0.945679 0.052527 0.000520 0.001274 0.991487 0.005538 0.001403 0.001571 0.037529 0.000660 0.960534 0.001278 0.046429 0.002121 0.000888 0.950561 0.001978 0.000622 0.899030 0.098369 0.054222 0.257913 0.680706 0.007160 0.249281 0.130882 0.113226 0.506611 0.078118 0.164793 0.197557 0.559532 0.490770 0.141747 0.139010 0.228472 0.335112 0.225587 0.074842 0.364458 0.301697 0.239075 0.347856 0.111372 Consensus sequence: DTBVTTAAGTGGTTHHV Alignment: --------DTBVTTAAGTGGTTHHV AGTGSWSCACTGTGAMAMCACAGTG------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00031 Zbtb3_primary Original Motif Reverse Complement Forward 7 17 2.043161 Species: Mus musculus Original motif 0.401190 0.144405 0.268531 0.185874 0.430224 0.168519 0.221247 0.180011 0.172575 0.268499 0.274136 0.284789 0.150971 0.297110 0.290868 0.261051 0.133421 0.282842 0.434718 0.149019 0.042798 0.941105 0.001785 0.014312 0.890788 0.002551 0.103316 0.003345 0.001887 0.951368 0.043722 0.003023 0.011633 0.002218 0.002269 0.983880 0.003597 0.003728 0.984819 0.007856 0.002946 0.903520 0.072457 0.021077 0.908487 0.057072 0.018256 0.016185 0.076237 0.329864 0.228896 0.365003 0.144926 0.162981 0.177370 0.514722 0.124970 0.327876 0.295814 0.251341 0.144592 0.313887 0.301912 0.239609 0.108463 0.241747 0.350296 0.299494 Consensus sequence: DDBBBCACTGCABTBBB Reverse complement motif 0.108463 0.350296 0.241747 0.299494 0.144592 0.301912 0.313887 0.239609 0.124970 0.295814 0.327876 0.251341 0.514722 0.162981 0.177370 0.144926 0.365003 0.329864 0.228896 0.076237 0.016185 0.057072 0.018256 0.908487 0.002946 0.072457 0.903520 0.021077 0.003597 0.984819 0.003728 0.007856 0.983880 0.002218 0.002269 0.011633 0.001887 0.043722 0.951368 0.003023 0.003345 0.002551 0.103316 0.890788 0.042798 0.001785 0.941105 0.014312 0.133421 0.434718 0.282842 0.149019 0.150971 0.290868 0.297110 0.261051 0.284789 0.268499 0.274136 0.172575 0.180011 0.168519 0.221247 0.430224 0.185874 0.144405 0.268531 0.401190 Consensus sequence: BBBAVTGCAGTGBBVDD Alignment: DDBBBCACTGCABTBBB-------- ------CACTGTGRTRTCACAGTGSWSCACT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00193 Rhox11_1765.2 Reverse Complement Original Motif Forward 4 17 2.043462 Species: Mus musculus Original motif 0.538735 0.129821 0.147336 0.184107 0.331267 0.275123 0.227609 0.166001 0.174654 0.113319 0.383610 0.328417 0.296734 0.281670 0.230068 0.191527 0.128222 0.561296 0.062928 0.247554 0.027028 0.014676 0.949335 0.008962 0.087209 0.761581 0.147964 0.003246 0.006796 0.000741 0.006037 0.986427 0.039496 0.000533 0.943453 0.016517 0.005541 0.005164 0.002805 0.986489 0.561957 0.002761 0.004207 0.431075 0.780197 0.037155 0.031222 0.151425 0.518642 0.104220 0.012670 0.364468 0.314451 0.111366 0.333508 0.240676 0.236936 0.357992 0.280813 0.124259 0.314846 0.163774 0.426195 0.095185 0.408340 0.134111 0.102987 0.354562 Consensus sequence: AVDVCGCTGTWAWDVVW Reverse complement motif 0.354562 0.134111 0.102987 0.408340 0.314846 0.426195 0.163774 0.095185 0.236936 0.280813 0.357992 0.124259 0.314451 0.333508 0.111366 0.240676 0.364468 0.104220 0.012670 0.518642 0.151425 0.037155 0.031222 0.780197 0.431075 0.002761 0.004207 0.561957 0.986489 0.005164 0.002805 0.005541 0.039496 0.943453 0.000533 0.016517 0.986427 0.000741 0.006037 0.006796 0.087209 0.147964 0.761581 0.003246 0.027028 0.949335 0.014676 0.008962 0.128222 0.062928 0.561296 0.247554 0.191527 0.281670 0.230068 0.296734 0.174654 0.383610 0.113319 0.328417 0.166001 0.275123 0.227609 0.331267 0.184107 0.129821 0.147336 0.538735 Consensus sequence: WVVHWTWACAGCGBHBT Alignment: WVVHWTWACAGCGBHBT-------- ---AGTGSWSCACTGTGAMAMCACAGTG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 2 Motif ID: 23 Motif name: TGGAGCACTGTGACAcCACAGTGg Original motif 0.054054 0.040541 0.054054 0.851351 0.040541 0.013514 0.824324 0.121622 0.094595 0.135135 0.756757 0.013514 0.891892 0.000000 0.000000 0.108108 0.040541 0.094595 0.810811 0.054054 0.081081 0.797297 0.054054 0.067568 0.932432 0.027027 0.000000 0.040541 0.054054 0.756757 0.135135 0.054054 0.108108 0.027027 0.013514 0.851351 0.108108 0.000000 0.851351 0.040541 0.013514 0.000000 0.027027 0.959459 0.000000 0.013514 0.945946 0.040541 0.905405 0.000000 0.067568 0.027027 0.054054 0.837838 0.000000 0.108108 0.945946 0.013514 0.040541 0.000000 0.162162 0.500000 0.189189 0.148649 0.108108 0.824324 0.000000 0.067568 0.945946 0.000000 0.040541 0.013514 0.081081 0.837838 0.027027 0.054054 0.945946 0.000000 0.013514 0.040541 0.054054 0.067568 0.783784 0.094595 0.054054 0.027027 0.000000 0.918919 0.040541 0.013514 0.864865 0.081081 0.148649 0.121622 0.675676 0.054054 Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reserve complement motif 0.148649 0.675676 0.121622 0.054054 0.040541 0.864865 0.013514 0.081081 0.918919 0.027027 0.000000 0.054054 0.054054 0.783784 0.067568 0.094595 0.040541 0.000000 0.013514 0.945946 0.081081 0.027027 0.837838 0.054054 0.013514 0.000000 0.040541 0.945946 0.108108 0.000000 0.824324 0.067568 0.162162 0.189189 0.500000 0.148649 0.000000 0.013514 0.040541 0.945946 0.054054 0.000000 0.837838 0.108108 0.027027 0.000000 0.067568 0.905405 0.000000 0.945946 0.013514 0.040541 0.959459 0.000000 0.027027 0.013514 0.108108 0.851351 0.000000 0.040541 0.851351 0.027027 0.013514 0.108108 0.054054 0.135135 0.756757 0.054054 0.040541 0.027027 0.000000 0.932432 0.081081 0.054054 0.797297 0.067568 0.040541 0.810811 0.094595 0.054054 0.108108 0.000000 0.000000 0.891892 0.094595 0.756757 0.135135 0.013514 0.040541 0.824324 0.013514 0.121622 0.851351 0.040541 0.054054 0.054054 Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA ************************************************************************ Best Matches for Motif ID 23 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00098 Rfx3_secondary Reverse Complement Reverse Complement Forward 4 21 0.039195 Species: Mus musculus Original motif 0.314514 0.275352 0.257617 0.152518 0.126939 0.598294 0.130576 0.144192 0.102265 0.155334 0.177957 0.564445 0.129288 0.282678 0.326990 0.261044 0.318166 0.227823 0.175681 0.278330 0.109019 0.380838 0.278328 0.231815 0.226145 0.289206 0.291300 0.193348 0.035863 0.844339 0.072582 0.047216 0.223793 0.187244 0.088092 0.500871 0.039800 0.029681 0.026201 0.904317 0.298298 0.032147 0.654746 0.014809 0.014729 0.022023 0.944826 0.018422 0.485114 0.004925 0.013785 0.496176 0.035708 0.020381 0.240804 0.703108 0.951152 0.012738 0.017886 0.018224 0.023713 0.944394 0.009538 0.022355 0.291067 0.385205 0.232388 0.091339 0.340334 0.199588 0.311526 0.148552 0.198713 0.472138 0.178319 0.150830 0.321155 0.269932 0.311301 0.097612 0.412646 0.195252 0.231950 0.160152 0.297134 0.180928 0.250400 0.271538 0.151169 0.305386 0.358574 0.184871 Consensus sequence: VCTBHBVCTTGGWTACVVVVVDB Reverse complement motif 0.151169 0.358574 0.305386 0.184871 0.271538 0.180928 0.250400 0.297134 0.160152 0.195252 0.231950 0.412646 0.097612 0.269932 0.311301 0.321155 0.198713 0.178319 0.472138 0.150830 0.148552 0.199588 0.311526 0.340334 0.291067 0.232388 0.385205 0.091339 0.023713 0.009538 0.944394 0.022355 0.018224 0.012738 0.017886 0.951152 0.703108 0.020381 0.240804 0.035708 0.496176 0.004925 0.013785 0.485114 0.014729 0.944826 0.022023 0.018422 0.298298 0.654746 0.032147 0.014809 0.904317 0.029681 0.026201 0.039800 0.500871 0.187244 0.088092 0.223793 0.035863 0.072582 0.844339 0.047216 0.226145 0.291300 0.289206 0.193348 0.109019 0.278328 0.380838 0.231815 0.278330 0.227823 0.175681 0.318166 0.129288 0.326990 0.282678 0.261044 0.564445 0.155334 0.177957 0.102265 0.126939 0.130576 0.598294 0.144192 0.152518 0.275352 0.257617 0.314514 Consensus sequence: BDBBVBVGTAWCCAAGVBHBAGB Alignment: BDBBVBVGTAWCCAAGVBHBAGB--- ---CCACTGTGVTGTCACAGTGCTCCA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v015681_primary Reverse Complement Reverse Complement Forward 3 21 0.040027 Species: Mus musculus Original motif 0.641428 0.180211 0.044767 0.133594 0.171696 0.262981 0.334148 0.231174 0.129726 0.322735 0.243462 0.304077 0.165713 0.175735 0.256108 0.402445 0.146090 0.171890 0.412753 0.269266 0.212837 0.439192 0.280990 0.066980 0.251088 0.275516 0.374380 0.099015 0.575438 0.079656 0.338201 0.006704 0.005634 0.003422 0.972597 0.018348 0.890447 0.077034 0.031851 0.000668 0.007128 0.986862 0.000496 0.005515 0.001445 0.991564 0.001925 0.005066 0.738761 0.190157 0.026399 0.044684 0.013384 0.983783 0.000896 0.001937 0.068077 0.929549 0.000773 0.001602 0.040830 0.933742 0.005283 0.020145 0.730274 0.029225 0.145689 0.094812 0.165032 0.572838 0.162001 0.100129 0.383584 0.129942 0.429497 0.056977 0.455959 0.071959 0.208204 0.263878 0.134271 0.262985 0.222626 0.380117 0.071193 0.346594 0.346081 0.236132 0.445661 0.405278 0.053901 0.095160 Consensus sequence: ABBBBVVRGACCACCCACRDBBM Reverse complement motif 0.095160 0.405278 0.053901 0.445661 0.071193 0.346081 0.346594 0.236132 0.380117 0.262985 0.222626 0.134271 0.263878 0.071959 0.208204 0.455959 0.383584 0.429497 0.129942 0.056977 0.165032 0.162001 0.572838 0.100129 0.094812 0.029225 0.145689 0.730274 0.040830 0.005283 0.933742 0.020145 0.068077 0.000773 0.929549 0.001602 0.013384 0.000896 0.983783 0.001937 0.044684 0.190157 0.026399 0.738761 0.001445 0.001925 0.991564 0.005066 0.007128 0.000496 0.986862 0.005515 0.000668 0.077034 0.031851 0.890447 0.005634 0.972597 0.003422 0.018348 0.006704 0.079656 0.338201 0.575438 0.251088 0.374380 0.275516 0.099015 0.212837 0.280990 0.439192 0.066980 0.146090 0.412753 0.171890 0.269266 0.402445 0.175735 0.256108 0.165713 0.129726 0.243462 0.322735 0.304077 0.171696 0.334148 0.262981 0.231174 0.133594 0.180211 0.044767 0.641428 Consensus sequence: YBVDMGTGGGTGGTCKVVBVBBT Alignment: YBVDMGTGGGTGGTCKVVBVBBT--- --CCACTGTGVTGTCACAGTGCTCCA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v016060_primary Reverse Complement Reverse Complement Backward 5 20 0.535486 Species: Mus musculus Original motif 0.137831 0.118922 0.394177 0.349070 0.190108 0.163633 0.138507 0.507753 0.346002 0.332315 0.228621 0.093063 0.113254 0.287554 0.373285 0.225908 0.272578 0.125402 0.328963 0.273057 0.333973 0.115165 0.194267 0.356595 0.381054 0.086215 0.501679 0.031052 0.002232 0.007405 0.966087 0.024276 0.834741 0.112115 0.052053 0.001091 0.009034 0.983239 0.000766 0.006960 0.002054 0.988103 0.003138 0.006705 0.805772 0.171299 0.008415 0.014515 0.020076 0.976846 0.000894 0.002183 0.079914 0.917273 0.001179 0.001634 0.013983 0.950545 0.004205 0.031267 0.789407 0.039441 0.108645 0.062507 0.055453 0.161271 0.595249 0.188028 0.333424 0.128169 0.373270 0.165136 0.536103 0.109520 0.062980 0.291397 0.346477 0.090909 0.279533 0.283081 0.045892 0.190183 0.584314 0.179611 0.088294 0.406148 0.251647 0.253912 0.202467 0.447159 0.162802 0.187571 Consensus sequence: DTVBDDRGACCACCCAGDWDGBH Reverse complement motif 0.202467 0.162802 0.447159 0.187571 0.088294 0.251647 0.406148 0.253912 0.045892 0.584314 0.190183 0.179611 0.283081 0.090909 0.279533 0.346477 0.291397 0.109520 0.062980 0.536103 0.333424 0.373270 0.128169 0.165136 0.055453 0.595249 0.161271 0.188028 0.062507 0.039441 0.108645 0.789407 0.013983 0.004205 0.950545 0.031267 0.079914 0.001179 0.917273 0.001634 0.020076 0.000894 0.976846 0.002183 0.014515 0.171299 0.008415 0.805772 0.002054 0.003138 0.988103 0.006705 0.009034 0.000766 0.983239 0.006960 0.001091 0.112115 0.052053 0.834741 0.002232 0.966087 0.007405 0.024276 0.381054 0.501679 0.086215 0.031052 0.356595 0.115165 0.194267 0.333973 0.272578 0.328963 0.125402 0.273057 0.113254 0.373285 0.287554 0.225908 0.093063 0.332315 0.228621 0.346002 0.507753 0.163633 0.138507 0.190108 0.137831 0.394177 0.118922 0.349070 Consensus sequence: DBCDWHCTGGGTGGTCMDHBBAH Alignment: ----DBCDWHCTGGGTGGTCMDHBBAH CCACTGTGVTGTCACAGTGCTCCA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v015681_primary Reverse Complement Reverse Complement Backward 5 20 0.536069 Species: Mus musculus Original motif 0.183797 0.268049 0.330111 0.218043 0.127599 0.330310 0.243614 0.298477 0.143199 0.188046 0.268593 0.400162 0.214690 0.205230 0.247090 0.332990 0.294688 0.299104 0.327152 0.079056 0.221909 0.193223 0.480155 0.104712 0.444072 0.068239 0.481838 0.005852 0.006182 0.015429 0.901278 0.077111 0.766535 0.111138 0.121632 0.000696 0.014848 0.973961 0.000298 0.010893 0.001807 0.992200 0.002669 0.003324 0.795344 0.140510 0.018576 0.045571 0.006990 0.988200 0.002510 0.002299 0.154898 0.842296 0.000998 0.001808 0.029577 0.919262 0.006935 0.044226 0.677987 0.032075 0.185065 0.104874 0.195132 0.364580 0.319321 0.120967 0.225412 0.115034 0.612849 0.046705 0.548628 0.058900 0.162857 0.229616 0.112531 0.340331 0.165910 0.381227 0.073029 0.303078 0.363896 0.259997 0.561485 0.260567 0.092979 0.084969 0.132283 0.457691 0.140159 0.269867 Consensus sequence: BBBDVVRGACCACCCAVGABBAB Reverse complement motif 0.132283 0.140159 0.457691 0.269867 0.084969 0.260567 0.092979 0.561485 0.073029 0.363896 0.303078 0.259997 0.381227 0.340331 0.165910 0.112531 0.229616 0.058900 0.162857 0.548628 0.225412 0.612849 0.115034 0.046705 0.195132 0.319321 0.364580 0.120967 0.104874 0.032075 0.185065 0.677987 0.029577 0.006935 0.919262 0.044226 0.154898 0.000998 0.842296 0.001808 0.006990 0.002510 0.988200 0.002299 0.045571 0.140510 0.018576 0.795344 0.001807 0.002669 0.992200 0.003324 0.014848 0.000298 0.973961 0.010893 0.000696 0.111138 0.121632 0.766535 0.006182 0.901278 0.015429 0.077111 0.444072 0.481838 0.068239 0.005852 0.221909 0.480155 0.193223 0.104712 0.294688 0.327152 0.299104 0.079056 0.332990 0.205230 0.247090 0.214690 0.400162 0.188046 0.268593 0.143199 0.127599 0.243614 0.330310 0.298477 0.183797 0.330111 0.268049 0.218043 Consensus sequence: BTBVTCVTGGGTGGTCMVVDVBB Alignment: ----BTBVTCVTGGGTGGTCMVVDVBB CCACTGTGVTGTCACAGTGCTCCA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v016060_primary Original Motif Reverse Complement Backward 4 20 0.539704 Species: Mus musculus Original motif 0.204923 0.208846 0.365383 0.220848 0.294304 0.300143 0.167287 0.238266 0.109711 0.619514 0.117379 0.153396 0.178979 0.378580 0.230177 0.212264 0.159594 0.542602 0.118178 0.179627 0.125206 0.430074 0.151826 0.292894 0.097692 0.709845 0.116956 0.075506 0.148292 0.565912 0.037632 0.248164 0.077951 0.034190 0.855503 0.032356 0.001657 0.001061 0.971877 0.025405 0.001926 0.001084 0.991712 0.005278 0.033031 0.012001 0.057796 0.897171 0.002723 0.002647 0.993348 0.001281 0.003261 0.000963 0.987199 0.008577 0.000611 0.090925 0.074857 0.833608 0.015299 0.978878 0.004949 0.000874 0.013368 0.600902 0.033485 0.352245 0.231949 0.149575 0.118804 0.499672 0.267580 0.186002 0.371242 0.175176 0.264884 0.223483 0.110082 0.401551 0.221365 0.170121 0.179559 0.428955 0.112997 0.692930 0.139981 0.054092 0.460305 0.207883 0.155111 0.176702 Consensus sequence: BHCBCBCCGGGTGGTCYHVHDCH Reverse complement motif 0.176702 0.207883 0.155111 0.460305 0.112997 0.139981 0.692930 0.054092 0.428955 0.170121 0.179559 0.221365 0.401551 0.223483 0.110082 0.264884 0.267580 0.371242 0.186002 0.175176 0.499672 0.149575 0.118804 0.231949 0.013368 0.033485 0.600902 0.352245 0.015299 0.004949 0.978878 0.000874 0.833608 0.090925 0.074857 0.000611 0.003261 0.987199 0.000963 0.008577 0.002723 0.993348 0.002647 0.001281 0.897171 0.012001 0.057796 0.033031 0.001926 0.991712 0.001084 0.005278 0.001657 0.971877 0.001061 0.025405 0.077951 0.855503 0.034190 0.032356 0.148292 0.037632 0.565912 0.248164 0.097692 0.116956 0.709845 0.075506 0.125206 0.151826 0.430074 0.292894 0.159594 0.118178 0.542602 0.179627 0.178979 0.230177 0.378580 0.212264 0.109711 0.117379 0.619514 0.153396 0.294304 0.167287 0.300143 0.238266 0.204923 0.365383 0.208846 0.220848 Consensus sequence: HGDHVHKGACCACCCGGBGBGDB Alignment: ----HGDHVHKGACCACCCGGBGBGDB TGGAGCACTGTGACAVCACAGTGG--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v015681_secondary Original Motif Reverse Complement Backward 7 18 1.538189 Species: Mus musculus Original motif 0.214165 0.143436 0.372522 0.269876 0.314445 0.406003 0.160351 0.119201 0.137147 0.092924 0.042921 0.727007 0.044121 0.072843 0.051741 0.831295 0.261292 0.324124 0.298498 0.116086 0.258125 0.323243 0.263362 0.155271 0.204557 0.589399 0.107153 0.098891 0.371021 0.244027 0.291102 0.093849 0.096327 0.572718 0.011797 0.319159 0.027282 0.046183 0.844519 0.082016 0.018921 0.012887 0.915917 0.052275 0.364793 0.166722 0.084229 0.384256 0.028216 0.011233 0.951056 0.009495 0.054974 0.004738 0.890377 0.049911 0.006802 0.312915 0.134247 0.546036 0.241289 0.628210 0.104788 0.025713 0.237863 0.302807 0.213018 0.246311 0.349399 0.203220 0.086635 0.360746 0.386634 0.144693 0.246895 0.221779 0.425101 0.354676 0.093374 0.126849 0.060272 0.391320 0.104905 0.443503 0.162090 0.190233 0.227433 0.420244 Consensus sequence: DVTTVVCVYGGHGGYCHHDMYB Reverse complement motif 0.420244 0.190233 0.227433 0.162090 0.443503 0.391320 0.104905 0.060272 0.126849 0.354676 0.093374 0.425101 0.221779 0.144693 0.246895 0.386634 0.360746 0.203220 0.086635 0.349399 0.237863 0.213018 0.302807 0.246311 0.241289 0.104788 0.628210 0.025713 0.546036 0.312915 0.134247 0.006802 0.054974 0.890377 0.004738 0.049911 0.028216 0.951056 0.011233 0.009495 0.384256 0.166722 0.084229 0.364793 0.018921 0.915917 0.012887 0.052275 0.027282 0.844519 0.046183 0.082016 0.096327 0.011797 0.572718 0.319159 0.093849 0.244027 0.291102 0.371021 0.204557 0.107153 0.589399 0.098891 0.258125 0.263362 0.323243 0.155271 0.261292 0.298498 0.324124 0.116086 0.831295 0.072843 0.051741 0.044121 0.727007 0.092924 0.042921 0.137147 0.314445 0.160351 0.406003 0.119201 0.214165 0.372522 0.143436 0.269876 Consensus sequence: VMYDHDGMCCHCCKBGVVAAVH Alignment: ------DVTTVVCVYGGHGGYCHHDMYB TGGAGCACTGTGACAVCACAGTGG------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00122 Tgif1 Original Motif Original Motif Backward 3 17 2.025337 Species: Mus musculus Original motif 0.272977 0.158875 0.284742 0.283406 0.550609 0.124110 0.169608 0.155673 0.114568 0.207160 0.282464 0.395807 0.560868 0.052907 0.053508 0.332716 0.336500 0.068048 0.114050 0.481403 0.007736 0.003722 0.000495 0.988048 0.004489 0.000729 0.992211 0.002571 0.956618 0.000414 0.000890 0.042078 0.004381 0.990925 0.000538 0.004156 0.982797 0.000366 0.015539 0.001298 0.016760 0.002980 0.969991 0.010269 0.036013 0.725983 0.200022 0.037982 0.064755 0.104386 0.133891 0.696968 0.199404 0.263520 0.410228 0.126848 0.222648 0.351390 0.272575 0.153387 0.087778 0.206043 0.395671 0.310507 0.319643 0.144216 0.196041 0.340100 Consensus sequence: DABWWTGACAGCTVVBD Reverse complement motif 0.340100 0.144216 0.196041 0.319643 0.087778 0.395671 0.206043 0.310507 0.222648 0.272575 0.351390 0.153387 0.199404 0.410228 0.263520 0.126848 0.696968 0.104386 0.133891 0.064755 0.036013 0.200022 0.725983 0.037982 0.016760 0.969991 0.002980 0.010269 0.001298 0.000366 0.015539 0.982797 0.004381 0.000538 0.990925 0.004156 0.042078 0.000414 0.000890 0.956618 0.004489 0.992211 0.000729 0.002571 0.988048 0.003722 0.000495 0.007736 0.481403 0.068048 0.114050 0.336500 0.332716 0.052907 0.053508 0.560868 0.395807 0.207160 0.282464 0.114568 0.155673 0.124110 0.169608 0.550609 0.272977 0.284742 0.158875 0.283406 Consensus sequence: DBVVAGCTGTCAWWVTH Alignment: -------DABWWTGACAGCTVVBD TGGAGCACTGTGACAVCACAGTGG-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00159 Six2 Reverse Complement Original Motif Forward 3 17 2.025713 Species: Mus musculus Original motif 0.452545 0.099192 0.290852 0.157411 0.587199 0.117373 0.086707 0.208721 0.191837 0.044362 0.256539 0.507262 0.299111 0.107464 0.518651 0.074774 0.118226 0.040974 0.797168 0.043631 0.010113 0.030311 0.923661 0.035916 0.126925 0.002828 0.869144 0.001103 0.001338 0.000719 0.046297 0.951646 0.958864 0.001525 0.038365 0.001246 0.003353 0.001741 0.001927 0.992979 0.007665 0.981087 0.001717 0.009531 0.903866 0.022768 0.054074 0.019292 0.165996 0.505327 0.077238 0.251439 0.252666 0.168847 0.288545 0.289942 0.336830 0.080857 0.058862 0.523451 0.234102 0.268721 0.215252 0.281925 0.172036 0.083695 0.223889 0.520379 Consensus sequence: DAKRGGGTATCACDWHT Reverse complement motif 0.520379 0.083695 0.223889 0.172036 0.281925 0.268721 0.215252 0.234102 0.523451 0.080857 0.058862 0.336830 0.289942 0.168847 0.288545 0.252666 0.165996 0.077238 0.505327 0.251439 0.019292 0.022768 0.054074 0.903866 0.007665 0.001717 0.981087 0.009531 0.992979 0.001741 0.001927 0.003353 0.001246 0.001525 0.038365 0.958864 0.951646 0.000719 0.046297 0.001338 0.126925 0.869144 0.002828 0.001103 0.010113 0.923661 0.030311 0.035916 0.118226 0.797168 0.040974 0.043631 0.299111 0.518651 0.107464 0.074774 0.507262 0.044362 0.256539 0.191837 0.208721 0.117373 0.086707 0.587199 0.157411 0.099192 0.290852 0.452545 Consensus sequence: AHWDGTGATACCCMRTD Alignment: AHWDGTGATACCCMRTD------- --CCACTGTGVTGTCACAGTGCTCCA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00192 Six1 Reverse Complement Original Motif Forward 3 17 2.028921 Species: Mus musculus Original motif 0.319306 0.130147 0.399309 0.151238 0.482636 0.211172 0.085871 0.220321 0.214292 0.085504 0.207353 0.492851 0.392819 0.136859 0.403883 0.066438 0.215886 0.049341 0.685932 0.048842 0.039793 0.053756 0.870240 0.036211 0.202525 0.005026 0.791396 0.001053 0.001092 0.001021 0.052968 0.944919 0.963185 0.001738 0.033596 0.001480 0.002017 0.001886 0.002847 0.993250 0.009914 0.974962 0.001987 0.013137 0.909252 0.021586 0.037899 0.031263 0.177851 0.274190 0.117998 0.429961 0.228906 0.159459 0.303955 0.307681 0.330938 0.158106 0.118706 0.392251 0.160453 0.267920 0.280244 0.291383 0.176707 0.068175 0.229538 0.525580 Consensus sequence: DHDRGGGTATCAHDHBT Reverse complement motif 0.525580 0.068175 0.229538 0.176707 0.291383 0.267920 0.280244 0.160453 0.392251 0.158106 0.118706 0.330938 0.307681 0.159459 0.303955 0.228906 0.429961 0.274190 0.117998 0.177851 0.031263 0.021586 0.037899 0.909252 0.009914 0.001987 0.974962 0.013137 0.993250 0.001886 0.002847 0.002017 0.001480 0.001738 0.033596 0.963185 0.944919 0.001021 0.052968 0.001092 0.202525 0.791396 0.005026 0.001053 0.039793 0.870240 0.053756 0.036211 0.215886 0.685932 0.049341 0.048842 0.392819 0.403883 0.136859 0.066438 0.492851 0.085504 0.207353 0.214292 0.220321 0.211172 0.085871 0.482636 0.319306 0.399309 0.130147 0.151238 Consensus sequence: AVHDHTGATACCCMDHH Alignment: AVHDHTGATACCCMDHH------- --CCACTGTGVTGTCACAGTGCTCCA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00076 Rfxdc2_secondary Reverse Complement Reverse Complement Forward 4 17 2.029199 Species: Mus musculus Original motif 0.120124 0.369052 0.280026 0.230798 0.153013 0.175278 0.321983 0.349726 0.426573 0.206846 0.272112 0.094469 0.067213 0.665712 0.165815 0.101259 0.213424 0.152912 0.229260 0.404404 0.042427 0.193675 0.034144 0.729754 0.359927 0.038767 0.588911 0.012395 0.015079 0.017884 0.948607 0.018430 0.699438 0.007004 0.014579 0.278979 0.017282 0.022228 0.369181 0.591308 0.948823 0.011471 0.018805 0.020901 0.016175 0.947649 0.007710 0.028466 0.114584 0.334989 0.511562 0.038865 0.219114 0.247229 0.396478 0.137179 0.308087 0.178171 0.248356 0.265386 0.479300 0.125168 0.134837 0.260696 0.323493 0.230502 0.108189 0.337815 Consensus sequence: BBVCDTRGAKACSVDDH Reverse complement motif 0.337815 0.230502 0.108189 0.323493 0.260696 0.125168 0.134837 0.479300 0.265386 0.178171 0.248356 0.308087 0.219114 0.396478 0.247229 0.137179 0.114584 0.511562 0.334989 0.038865 0.016175 0.007710 0.947649 0.028466 0.020901 0.011471 0.018805 0.948823 0.591308 0.022228 0.369181 0.017282 0.278979 0.007004 0.014579 0.699438 0.015079 0.948607 0.017884 0.018430 0.359927 0.588911 0.038767 0.012395 0.729754 0.193675 0.034144 0.042427 0.404404 0.152912 0.229260 0.213424 0.067213 0.165815 0.665712 0.101259 0.094469 0.206846 0.272112 0.426573 0.349726 0.175278 0.321983 0.153013 0.120124 0.280026 0.369052 0.230798 Consensus sequence: HDDVSGTRTCMADGBVB Alignment: HDDVSGTRTCMADGBVB------- ---CCACTGTGVTGTCACAGTGCTCCA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 2 Motif ID: 24 Motif name: ssCCCCGCSssk Original motif 0.000000 0.444444 0.370370 0.185185 0.111111 0.407407 0.333333 0.148148 0.000000 0.888889 0.037037 0.074074 0.000000 0.888889 0.074074 0.037037 0.000000 0.777778 0.222222 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.037037 0.888889 0.000000 0.074074 0.000000 0.703704 0.296296 0.000000 0.000000 0.518519 0.370370 0.111111 0.111111 0.407407 0.259259 0.222222 0.074074 0.222222 0.407407 0.296296 Consensus sequence: SBCCCCGCCSBB Reserve complement motif 0.074074 0.407407 0.222222 0.296296 0.111111 0.259259 0.407407 0.222222 0.000000 0.370370 0.518519 0.111111 0.000000 0.296296 0.703704 0.000000 0.037037 0.000000 0.888889 0.074074 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.222222 0.777778 0.000000 0.000000 0.074074 0.888889 0.037037 0.000000 0.037037 0.888889 0.074074 0.111111 0.333333 0.407407 0.148148 0.000000 0.370370 0.444444 0.185185 Consensus sequence: BBSGGCGGGGBS ************************************************************************ Best Matches for Motif ID 24 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00000 Smad3_secondary Original Motif Original Motif Backward 4 12 0.011485 Species: Mus musculus Original motif 0.150668 0.131779 0.245665 0.471887 0.316817 0.287314 0.150829 0.245040 0.256473 0.409066 0.109700 0.224761 0.210646 0.220222 0.345010 0.224122 0.166679 0.508939 0.081676 0.242705 0.049351 0.759380 0.088489 0.102780 0.047598 0.785546 0.121957 0.044898 0.004606 0.944933 0.034696 0.015764 0.040252 0.050652 0.890382 0.018713 0.003038 0.913699 0.022449 0.060814 0.028672 0.941477 0.012276 0.017575 0.635243 0.139731 0.110495 0.114531 0.240016 0.385948 0.182848 0.191188 0.210430 0.274127 0.085171 0.430272 0.088118 0.454598 0.208989 0.248295 0.181269 0.265028 0.149023 0.404680 0.101070 0.252682 0.368542 0.277706 Consensus sequence: DHHBCCCCGCCAHHBHB Reverse complement motif 0.101070 0.368542 0.252682 0.277706 0.404680 0.265028 0.149023 0.181269 0.088118 0.208989 0.454598 0.248295 0.430272 0.274127 0.085171 0.210430 0.240016 0.182848 0.385948 0.191188 0.114531 0.139731 0.110495 0.635243 0.028672 0.012276 0.941477 0.017575 0.003038 0.022449 0.913699 0.060814 0.040252 0.890382 0.050652 0.018713 0.004606 0.034696 0.944933 0.015764 0.047598 0.121957 0.785546 0.044898 0.049351 0.088489 0.759380 0.102780 0.166679 0.081676 0.508939 0.242705 0.210646 0.345010 0.220222 0.224122 0.256473 0.109700 0.409066 0.224761 0.245040 0.287314 0.150829 0.316817 0.471887 0.131779 0.245665 0.150668 Consensus sequence: BHBHDTGGCGGGGBDHD Alignment: DHHBCCCCGCCAHHBHB --SBCCCCGCCSBB--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00093 Klf7_primary Original Motif Original Motif Forward 3 12 0.016526 Species: Mus musculus Original motif 0.204514 0.198353 0.171218 0.425915 0.167188 0.296785 0.246082 0.289946 0.267330 0.148001 0.398674 0.185994 0.549386 0.060167 0.337100 0.053347 0.050746 0.900013 0.022169 0.027073 0.037905 0.920332 0.008360 0.033403 0.410356 0.566702 0.016267 0.006675 0.009526 0.982354 0.001060 0.007060 0.204292 0.001084 0.748567 0.046056 0.003955 0.988490 0.002821 0.004735 0.004264 0.988826 0.004311 0.002598 0.002758 0.929549 0.001244 0.066448 0.260332 0.421683 0.024720 0.293265 0.184798 0.247697 0.085237 0.482268 0.347537 0.197344 0.139961 0.315159 0.255281 0.166620 0.242297 0.335802 Consensus sequence: HBDRCCMCGCCCHHHD Reverse complement motif 0.335802 0.166620 0.242297 0.255281 0.315159 0.197344 0.139961 0.347537 0.482268 0.247697 0.085237 0.184798 0.260332 0.024720 0.421683 0.293265 0.002758 0.001244 0.929549 0.066448 0.004264 0.004311 0.988826 0.002598 0.003955 0.002821 0.988490 0.004735 0.204292 0.748567 0.001084 0.046056 0.009526 0.001060 0.982354 0.007060 0.410356 0.016267 0.566702 0.006675 0.037905 0.008360 0.920332 0.033403 0.050746 0.022169 0.900013 0.027073 0.053347 0.060167 0.337100 0.549386 0.267330 0.398674 0.148001 0.185994 0.167188 0.246082 0.296785 0.289946 0.425915 0.198353 0.171218 0.204514 Consensus sequence: DHHDGGGCGRGGKHBH Alignment: HBDRCCMCGCCCHHHD --SBCCCCGCCSBB-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00022 Zfp740_primary Original Motif Original Motif Backward 3 12 0.027614 Species: Mus musculus Original motif 0.136946 0.396508 0.135309 0.331236 0.185528 0.417538 0.215409 0.181525 0.171276 0.341901 0.172832 0.313991 0.145641 0.590572 0.146376 0.117412 0.138035 0.660416 0.114016 0.087533 0.222728 0.750532 0.007528 0.019212 0.024633 0.963314 0.001894 0.010159 0.009557 0.979956 0.000642 0.009844 0.010416 0.977424 0.000541 0.011619 0.026401 0.956740 0.001544 0.015314 0.195502 0.755959 0.011060 0.037480 0.491291 0.364785 0.025613 0.118311 0.305153 0.398160 0.071680 0.225008 0.253497 0.232647 0.213246 0.300610 0.156964 0.297876 0.144683 0.400477 0.179549 0.292514 0.319462 0.208475 Consensus sequence: HVBCCCCCCCCMHHHB Reverse complement motif 0.179549 0.319462 0.292514 0.208475 0.400477 0.297876 0.144683 0.156964 0.300610 0.232647 0.213246 0.253497 0.305153 0.071680 0.398160 0.225008 0.118311 0.364785 0.025613 0.491291 0.195502 0.011060 0.755959 0.037480 0.026401 0.001544 0.956740 0.015314 0.010416 0.000541 0.977424 0.011619 0.009557 0.000642 0.979956 0.009844 0.024633 0.001894 0.963314 0.010159 0.222728 0.007528 0.750532 0.019212 0.138035 0.114016 0.660416 0.087533 0.145641 0.146376 0.590572 0.117412 0.171276 0.172832 0.341901 0.313991 0.185528 0.215409 0.417538 0.181525 0.136946 0.135309 0.396508 0.331236 Consensus sequence: BHHDYGGGGGGGGBVD Alignment: HVBCCCCCCCCMHHHB --SBCCCCGCCSBB-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00003 E2F3_primary Original Motif Reverse Complement Forward 2 12 0.032858 Species: Mus musculus Original motif 0.358868 0.212371 0.263565 0.165196 0.303014 0.253580 0.111217 0.332189 0.420933 0.110957 0.210958 0.257152 0.769724 0.062662 0.032155 0.135459 0.311973 0.051319 0.408669 0.228039 0.097916 0.141153 0.719697 0.041234 0.009980 0.014044 0.971955 0.004021 0.014425 0.974798 0.008373 0.002404 0.000891 0.013228 0.983966 0.001915 0.000827 0.938560 0.059548 0.001065 0.007071 0.102005 0.872378 0.018546 0.020099 0.897653 0.014151 0.068097 0.114080 0.346724 0.409037 0.130159 0.331439 0.279041 0.085030 0.304491 0.319846 0.136792 0.043641 0.499722 Consensus sequence: VHDADGGCGCGCSHW Reverse complement motif 0.499722 0.136792 0.043641 0.319846 0.304491 0.279041 0.085030 0.331439 0.114080 0.409037 0.346724 0.130159 0.020099 0.014151 0.897653 0.068097 0.007071 0.872378 0.102005 0.018546 0.000827 0.059548 0.938560 0.001065 0.000891 0.983966 0.013228 0.001915 0.014425 0.008373 0.974798 0.002404 0.009980 0.971955 0.014044 0.004021 0.097916 0.719697 0.141153 0.041234 0.311973 0.408669 0.051319 0.228039 0.135459 0.062662 0.032155 0.769724 0.257152 0.110957 0.210958 0.420933 0.332189 0.253580 0.111217 0.303014 0.165196 0.212371 0.263565 0.358868 Consensus sequence: WHSGCGCGCCHTDHB Alignment: WHSGCGCGCCHTDHB -SBCCCCGCCSBB-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00033 Zfp410_secondary Original Motif Original Motif Forward 2 12 0.033673 Species: Mus musculus Original motif 0.162979 0.284781 0.237433 0.314807 0.182449 0.447584 0.069464 0.300502 0.298973 0.261014 0.213211 0.226802 0.136039 0.433062 0.144274 0.286625 0.180084 0.395933 0.158565 0.265418 0.069354 0.748510 0.068898 0.113238 0.060485 0.717828 0.075333 0.146354 0.023280 0.071762 0.645500 0.259457 0.166896 0.749762 0.062730 0.020612 0.050401 0.775248 0.089072 0.085279 0.103847 0.767557 0.068804 0.059791 0.064815 0.748318 0.114588 0.072280 0.340921 0.071942 0.242981 0.344157 0.301967 0.263512 0.165927 0.268594 0.479800 0.222955 0.118441 0.178803 0.229469 0.283621 0.143099 0.343811 0.261733 0.180191 0.169905 0.388170 Consensus sequence: BHHBHCCGCCCCDHHHH Reverse complement motif 0.388170 0.180191 0.169905 0.261733 0.343811 0.283621 0.143099 0.229469 0.178803 0.222955 0.118441 0.479800 0.268594 0.263512 0.165927 0.301967 0.344157 0.071942 0.242981 0.340921 0.064815 0.114588 0.748318 0.072280 0.103847 0.068804 0.767557 0.059791 0.050401 0.089072 0.775248 0.085279 0.166896 0.062730 0.749762 0.020612 0.023280 0.645500 0.071762 0.259457 0.060485 0.075333 0.717828 0.146354 0.069354 0.068898 0.748510 0.113238 0.180084 0.158565 0.395933 0.265418 0.136039 0.144274 0.433062 0.286625 0.226802 0.261014 0.213211 0.298973 0.182449 0.069464 0.447584 0.300502 0.314807 0.284781 0.237433 0.162979 Consensus sequence: HHHHDGGGGCGGDBHDV Alignment: BHHBHCCGCCCCDHHHH -SBCCCCGCCSBB---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00001 E2F2_primary Original Motif Reverse Complement Backward 3 12 0.034574 Species: Mus musculus Original motif 0.305970 0.214348 0.269312 0.210370 0.279551 0.218276 0.140576 0.361597 0.391304 0.162239 0.193916 0.252541 0.701667 0.102206 0.041580 0.154547 0.427655 0.068368 0.324706 0.179271 0.144368 0.191048 0.609772 0.054812 0.014295 0.020613 0.958397 0.006695 0.019783 0.962982 0.013403 0.003831 0.001189 0.023882 0.973231 0.001697 0.001343 0.919840 0.077728 0.001089 0.011293 0.097945 0.865194 0.025568 0.039106 0.864604 0.025189 0.071100 0.147663 0.328105 0.407118 0.117115 0.462769 0.203531 0.107986 0.225714 0.293396 0.229650 0.082819 0.394135 Consensus sequence: VHDARGGCGCGCVHH Reverse complement motif 0.394135 0.229650 0.082819 0.293396 0.225714 0.203531 0.107986 0.462769 0.147663 0.407118 0.328105 0.117115 0.039106 0.025189 0.864604 0.071100 0.011293 0.865194 0.097945 0.025568 0.001343 0.077728 0.919840 0.001089 0.001189 0.973231 0.023882 0.001697 0.019783 0.013403 0.962982 0.003831 0.014295 0.958397 0.020613 0.006695 0.144368 0.609772 0.191048 0.054812 0.179271 0.068368 0.324706 0.427655 0.154547 0.102206 0.041580 0.701667 0.252541 0.162239 0.193916 0.391304 0.361597 0.218276 0.140576 0.279551 0.210370 0.214348 0.269312 0.305970 Consensus sequence: HHVGCGCGCCKTDHB Alignment: HHVGCGCGCCKTDHB -SBCCCCGCCSBB-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00099 Ascl2_secondary Reverse Complement Reverse Complement Backward 3 12 0.034747 Species: Mus musculus Original motif 0.114462 0.345602 0.289353 0.250583 0.192593 0.250844 0.116250 0.440313 0.338838 0.304929 0.195843 0.160390 0.312051 0.115094 0.162465 0.410390 0.143975 0.600492 0.123348 0.132185 0.078751 0.715072 0.135182 0.070995 0.146191 0.685571 0.069799 0.098439 0.137287 0.646078 0.126428 0.090207 0.335099 0.092260 0.371510 0.201131 0.033090 0.631176 0.074278 0.261456 0.117516 0.619336 0.100946 0.162202 0.114769 0.627362 0.089839 0.168031 0.195787 0.252057 0.220803 0.331353 0.415355 0.120731 0.281372 0.182542 0.111178 0.217079 0.245769 0.425974 0.191517 0.296952 0.153370 0.358162 Consensus sequence: BHVDCCCCDCCCBDBH Reverse complement motif 0.358162 0.296952 0.153370 0.191517 0.425974 0.217079 0.245769 0.111178 0.182542 0.120731 0.281372 0.415355 0.331353 0.252057 0.220803 0.195787 0.114769 0.089839 0.627362 0.168031 0.117516 0.100946 0.619336 0.162202 0.033090 0.074278 0.631176 0.261456 0.335099 0.371510 0.092260 0.201131 0.137287 0.126428 0.646078 0.090207 0.146191 0.069799 0.685571 0.098439 0.078751 0.135182 0.715072 0.070995 0.143975 0.123348 0.600492 0.132185 0.410390 0.115094 0.162465 0.312051 0.160390 0.304929 0.195843 0.338838 0.440313 0.250844 0.116250 0.192593 0.114462 0.289353 0.345602 0.250583 Consensus sequence: HVDVGGGHGGGGDBHB Alignment: HVDVGGGHGGGGDBHB --BBSGGCGGGGBS-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00043 Bcl6b_secondary Reverse Complement Reverse Complement Forward 3 12 0.035812 Species: Mus musculus Original motif 0.316572 0.278382 0.152556 0.252490 0.167141 0.257034 0.259894 0.315931 0.175523 0.325956 0.259996 0.238525 0.165052 0.385677 0.239449 0.209822 0.069489 0.782718 0.072454 0.075339 0.049943 0.800636 0.031988 0.117433 0.223382 0.060306 0.552691 0.163621 0.072944 0.818252 0.034406 0.074398 0.070535 0.845127 0.062712 0.021626 0.031035 0.859354 0.055424 0.054187 0.063668 0.798503 0.067274 0.070554 0.348488 0.030697 0.197179 0.423636 0.307220 0.256470 0.181009 0.255301 0.460933 0.285057 0.090258 0.163752 0.315798 0.228431 0.171135 0.284637 0.374527 0.268328 0.198810 0.158335 Consensus sequence: HBBBCCGCCCCWHHHV Reverse complement motif 0.158335 0.268328 0.198810 0.374527 0.284637 0.228431 0.171135 0.315798 0.163752 0.285057 0.090258 0.460933 0.255301 0.256470 0.181009 0.307220 0.423636 0.030697 0.197179 0.348488 0.063668 0.067274 0.798503 0.070554 0.031035 0.055424 0.859354 0.054187 0.070535 0.062712 0.845127 0.021626 0.072944 0.034406 0.818252 0.074398 0.223382 0.552691 0.060306 0.163621 0.049943 0.031988 0.800636 0.117433 0.069489 0.072454 0.782718 0.075339 0.165052 0.239449 0.385677 0.209822 0.175523 0.259996 0.325956 0.238525 0.315931 0.257034 0.259894 0.167141 0.252490 0.278382 0.152556 0.316572 Consensus sequence: BHHHWGGGGCGGBBVH Alignment: BHHHWGGGGCGGBBVH --BBSGGCGGGGBS-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00400 Zif268 Original Motif Original Motif Forward 9 12 0.036535 Species: Mus musculus Original motif 0.104824 0.412716 0.254506 0.227955 0.644922 0.065476 0.140479 0.149122 0.201205 0.166164 0.347131 0.285501 0.360606 0.256316 0.150766 0.232313 0.199831 0.240681 0.279350 0.280137 0.234308 0.204076 0.321306 0.240310 0.274112 0.462435 0.111425 0.152028 0.067070 0.717501 0.073934 0.141496 0.106745 0.084442 0.658566 0.150247 0.025128 0.967053 0.003585 0.004234 0.006412 0.982989 0.003227 0.007371 0.009588 0.877620 0.002571 0.110221 0.621521 0.355443 0.015669 0.007366 0.002600 0.980275 0.004191 0.012934 0.118773 0.026658 0.783843 0.070725 0.022358 0.822101 0.024684 0.130857 0.713212 0.080912 0.128793 0.077084 0.166568 0.250955 0.107934 0.474544 0.225040 0.222494 0.163301 0.389166 0.268976 0.223206 0.265314 0.242504 0.137052 0.229058 0.148439 0.485451 0.135819 0.304550 0.141994 0.417637 0.272440 0.319501 0.230580 0.177478 Consensus sequence: BADHBDHCGCCCMCGCAHHDBBV Reverse complement motif 0.272440 0.230580 0.319501 0.177478 0.417637 0.304550 0.141994 0.135819 0.485451 0.229058 0.148439 0.137052 0.242504 0.223206 0.265314 0.268976 0.389166 0.222494 0.163301 0.225040 0.474544 0.250955 0.107934 0.166568 0.077084 0.080912 0.128793 0.713212 0.022358 0.024684 0.822101 0.130857 0.118773 0.783843 0.026658 0.070725 0.002600 0.004191 0.980275 0.012934 0.007366 0.355443 0.015669 0.621521 0.009588 0.002571 0.877620 0.110221 0.006412 0.003227 0.982989 0.007371 0.025128 0.003585 0.967053 0.004234 0.106745 0.658566 0.084442 0.150247 0.067070 0.073934 0.717501 0.141496 0.274112 0.111425 0.462435 0.152028 0.234308 0.321306 0.204076 0.240310 0.280137 0.240681 0.279350 0.199831 0.232313 0.256316 0.150766 0.360606 0.201205 0.347131 0.166164 0.285501 0.149122 0.065476 0.140479 0.644922 0.104824 0.254506 0.412716 0.227955 Consensus sequence: VVVDHHTGCGYGGGCGDHVHHTB Alignment: BADHBDHCGCCCMCGCAHHDBBV --------SBCCCCGCCSBB--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00526 Foxn1_primary Reverse Complement Reverse Complement Backward 6 12 0.038973 Species: Mus musculus Original motif 0.456612 0.057181 0.078281 0.407926 0.460529 0.185506 0.083106 0.270859 0.445717 0.179510 0.239355 0.135417 0.116339 0.145186 0.275331 0.463144 0.239398 0.142078 0.480004 0.138520 0.355157 0.217877 0.284296 0.142670 0.318602 0.444835 0.153321 0.083243 0.609569 0.055866 0.280349 0.054216 0.062297 0.769824 0.027844 0.140035 0.151868 0.019245 0.803188 0.025699 0.011842 0.952534 0.017959 0.017665 0.017665 0.017959 0.952534 0.011842 0.025699 0.803188 0.019245 0.151868 0.140035 0.027844 0.769824 0.062297 0.054216 0.280349 0.055866 0.609569 0.013084 0.624655 0.177956 0.184305 0.287647 0.183527 0.295753 0.233074 0.042309 0.345931 0.198458 0.413301 0.338138 0.266033 0.045367 0.350462 0.302850 0.155320 0.074662 0.467168 0.240926 0.068901 0.283055 0.407118 0.409954 0.183157 0.154186 0.252704 Consensus sequence: WHVBVVMACGCGCGTCDYHWDH Reverse complement motif 0.252704 0.183157 0.154186 0.409954 0.407118 0.068901 0.283055 0.240926 0.467168 0.155320 0.074662 0.302850 0.350462 0.266033 0.045367 0.338138 0.413301 0.345931 0.198458 0.042309 0.287647 0.295753 0.183527 0.233074 0.013084 0.177956 0.624655 0.184305 0.609569 0.280349 0.055866 0.054216 0.140035 0.769824 0.027844 0.062297 0.025699 0.019245 0.803188 0.151868 0.017665 0.952534 0.017959 0.011842 0.011842 0.017959 0.952534 0.017665 0.151868 0.803188 0.019245 0.025699 0.062297 0.027844 0.769824 0.140035 0.054216 0.055866 0.280349 0.609569 0.318602 0.153321 0.444835 0.083243 0.142670 0.217877 0.284296 0.355157 0.239398 0.480004 0.142078 0.138520 0.463144 0.145186 0.275331 0.116339 0.135417 0.179510 0.239355 0.445717 0.270859 0.185506 0.083106 0.460529 0.407926 0.057181 0.078281 0.456612 Consensus sequence: HDWHMHGACGCGCGTRBVVBHW Alignment: HDWHMHGACGCGCGTRBVVBHW -----BBSGGCGGGGBS----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 2 Motif ID: 25 Motif name: wwCCAmAGTCmt Original motif 0.454545 0.045455 0.227273 0.272727 0.363636 0.136364 0.136364 0.363636 0.000000 1.000000 0.000000 0.000000 0.000000 0.954545 0.045455 0.000000 1.000000 0.000000 0.000000 0.000000 0.409091 0.590909 0.000000 0.000000 0.909091 0.045455 0.045455 0.000000 0.000000 0.000000 1.000000 0.000000 0.045455 0.000000 0.000000 0.954545 0.045455 0.909091 0.000000 0.045455 0.272727 0.318182 0.181818 0.227273 0.181818 0.227273 0.227273 0.363636 Consensus sequence: DDCCAMAGTCHB Reserve complement motif 0.363636 0.227273 0.227273 0.181818 0.272727 0.181818 0.318182 0.227273 0.045455 0.000000 0.909091 0.045455 0.954545 0.000000 0.000000 0.045455 0.000000 1.000000 0.000000 0.000000 0.000000 0.045455 0.045455 0.909091 0.409091 0.000000 0.590909 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.045455 0.954545 0.000000 0.000000 0.000000 1.000000 0.000000 0.363636 0.136364 0.136364 0.363636 0.272727 0.045455 0.227273 0.454545 Consensus sequence: VDGACTRTGGDD ************************************************************************ Best Matches for Motif ID 25 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00079 Esrra_primary Original Motif Original Motif Backward 5 12 0.009273 Species: Mus musculus Original motif 0.212524 0.177958 0.293723 0.315796 0.420838 0.283140 0.144938 0.151084 0.198119 0.196347 0.260353 0.345181 0.117752 0.282184 0.137207 0.462857 0.070125 0.781439 0.138093 0.010344 0.965989 0.000956 0.023828 0.009227 0.977263 0.003066 0.019255 0.000416 0.007404 0.000267 0.938934 0.053395 0.007147 0.000287 0.983377 0.009190 0.039608 0.000730 0.040682 0.918981 0.000685 0.905345 0.021930 0.072040 0.800961 0.001126 0.195791 0.002121 0.245039 0.241263 0.038084 0.475614 0.265397 0.238316 0.304963 0.191325 0.203742 0.286208 0.231002 0.279048 0.194132 0.188854 0.346693 0.270322 0.310711 0.263840 0.184317 0.241132 Consensus sequence: DHDBCAAGGTCAHVBDH Reverse complement motif 0.241132 0.263840 0.184317 0.310711 0.194132 0.346693 0.188854 0.270322 0.203742 0.231002 0.286208 0.279048 0.265397 0.304963 0.238316 0.191325 0.475614 0.241263 0.038084 0.245039 0.002121 0.001126 0.195791 0.800961 0.000685 0.021930 0.905345 0.072040 0.918981 0.000730 0.040682 0.039608 0.007147 0.983377 0.000287 0.009190 0.007404 0.938934 0.000267 0.053395 0.000416 0.003066 0.019255 0.977263 0.009227 0.000956 0.023828 0.965989 0.070125 0.138093 0.781439 0.010344 0.462857 0.282184 0.137207 0.117752 0.345181 0.196347 0.260353 0.198119 0.151084 0.283140 0.144938 0.420838 0.315796 0.177958 0.293723 0.212524 Consensus sequence: HHBVHTGACCTTGVDHD Alignment: DHDBCAAGGTCAHVBDH -DDCCAMAGTCHB---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00066 Hnf4a_secondary Original Motif Original Motif Forward 1 12 0.015755 Species: Mus musculus Original motif 0.131680 0.169949 0.346277 0.352094 0.109910 0.144258 0.373681 0.372151 0.196671 0.411335 0.159689 0.232305 0.311086 0.307077 0.122332 0.259505 0.895155 0.013238 0.038874 0.052733 0.779629 0.018399 0.171269 0.030703 0.950546 0.002649 0.041825 0.004980 0.004769 0.002646 0.985847 0.006739 0.004458 0.002117 0.012011 0.981414 0.016789 0.969626 0.003890 0.009695 0.002468 0.982852 0.004754 0.009926 0.891448 0.003193 0.097548 0.007811 0.513330 0.308971 0.070467 0.107232 0.179371 0.115514 0.130898 0.574217 0.285826 0.277536 0.166982 0.269655 0.319407 0.227783 0.129020 0.323790 Consensus sequence: BBHHAAAGTCCAMTHH Reverse complement motif 0.323790 0.227783 0.129020 0.319407 0.269655 0.277536 0.166982 0.285826 0.574217 0.115514 0.130898 0.179371 0.107232 0.308971 0.070467 0.513330 0.007811 0.003193 0.097548 0.891448 0.002468 0.004754 0.982852 0.009926 0.016789 0.003890 0.969626 0.009695 0.981414 0.002117 0.012011 0.004458 0.004769 0.985847 0.002646 0.006739 0.004980 0.002649 0.041825 0.950546 0.030703 0.018399 0.171269 0.779629 0.052733 0.013238 0.038874 0.895155 0.259505 0.307077 0.122332 0.311086 0.196671 0.159689 0.411335 0.232305 0.109910 0.373681 0.144258 0.372151 0.352094 0.169949 0.346277 0.131680 Consensus sequence: HHAYTGGACTTTHDBV Alignment: BBHHAAAGTCCAMTHH DDCCAMAGTCHB---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00023 Sox30_primary Reverse Complement Original Motif Forward 3 12 0.021894 Species: Mus musculus Original motif 0.372432 0.102933 0.322145 0.202491 0.328072 0.182071 0.157347 0.332510 0.289417 0.084511 0.292873 0.333198 0.157571 0.227851 0.441662 0.172917 0.716832 0.049010 0.201411 0.032747 0.957368 0.003162 0.004402 0.035068 0.003907 0.862678 0.009407 0.124008 0.977231 0.007658 0.004263 0.010847 0.976481 0.004510 0.015225 0.003784 0.067568 0.004353 0.005071 0.923008 0.158205 0.108442 0.467023 0.266330 0.334549 0.091557 0.510241 0.063654 0.456431 0.182602 0.150234 0.210732 0.387485 0.241062 0.151504 0.219950 0.188387 0.269857 0.176514 0.365242 0.175680 0.243984 0.165833 0.414502 Consensus sequence: DHDBAACAATDRHHHH Reverse complement motif 0.414502 0.243984 0.165833 0.175680 0.365242 0.269857 0.176514 0.188387 0.219950 0.241062 0.151504 0.387485 0.210732 0.182602 0.150234 0.456431 0.334549 0.510241 0.091557 0.063654 0.158205 0.467023 0.108442 0.266330 0.923008 0.004353 0.005071 0.067568 0.003784 0.004510 0.015225 0.976481 0.010847 0.007658 0.004263 0.977231 0.003907 0.009407 0.862678 0.124008 0.035068 0.003162 0.004402 0.957368 0.032747 0.049010 0.201411 0.716832 0.157571 0.441662 0.227851 0.172917 0.333198 0.084511 0.292873 0.289417 0.332510 0.182071 0.157347 0.328072 0.202491 0.102933 0.322145 0.372432 Consensus sequence: HHHHMHATTGTTBDHD Alignment: DHDBAACAATDRHHHH --VDGACTRTGGDD-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00028 Tcfap2e_primary Original Motif Reverse Complement Backward 2 12 0.023236 Species: Mus musculus Original motif 0.369517 0.172742 0.163174 0.294567 0.260541 0.211816 0.194359 0.333284 0.292862 0.281323 0.073013 0.352801 0.011777 0.272676 0.697188 0.018359 0.005160 0.983588 0.005917 0.005335 0.002256 0.960488 0.005733 0.031524 0.003735 0.283214 0.123762 0.589290 0.024383 0.379981 0.542999 0.052638 0.589290 0.123762 0.283214 0.003735 0.031524 0.005733 0.960488 0.002256 0.005335 0.005917 0.983588 0.005160 0.018359 0.697188 0.272676 0.011777 0.328286 0.093173 0.334133 0.244408 0.563777 0.145250 0.140240 0.150733 0.263206 0.222321 0.242153 0.272320 Consensus sequence: HHHGCCTSAGGCDAD Reverse complement motif 0.272320 0.222321 0.242153 0.263206 0.150733 0.145250 0.140240 0.563777 0.328286 0.334133 0.093173 0.244408 0.018359 0.272676 0.697188 0.011777 0.005335 0.983588 0.005917 0.005160 0.031524 0.960488 0.005733 0.002256 0.003735 0.123762 0.283214 0.589290 0.024383 0.542999 0.379981 0.052638 0.589290 0.283214 0.123762 0.003735 0.002256 0.005733 0.960488 0.031524 0.005160 0.005917 0.983588 0.005335 0.011777 0.697188 0.272676 0.018359 0.352801 0.281323 0.073013 0.292862 0.333284 0.211816 0.194359 0.260541 0.294567 0.172742 0.163174 0.369517 Consensus sequence: DTHGCCTSAGGCHHH Alignment: DTHGCCTSAGGCHHH --DDCCAMAGTCHB- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00034 Sox7_primary Reverse Complement Original Motif Backward 6 12 0.023587 Species: Mus musculus Original motif 0.360997 0.300272 0.115555 0.223177 0.309749 0.228429 0.166233 0.295589 0.149419 0.176868 0.240155 0.433558 0.379704 0.095791 0.276373 0.248133 0.394549 0.174184 0.130641 0.300626 0.443749 0.070776 0.211081 0.274393 0.364301 0.074356 0.370406 0.190936 0.791976 0.038475 0.093390 0.076159 0.963721 0.001826 0.002456 0.031997 0.004516 0.954596 0.008092 0.032796 0.981080 0.002062 0.002161 0.014697 0.986185 0.001846 0.006976 0.004992 0.059567 0.003649 0.002189 0.934595 0.495328 0.024257 0.240450 0.239965 0.305027 0.094878 0.526069 0.074025 0.418442 0.196237 0.158323 0.226998 0.336713 0.220452 0.191155 0.251680 0.192296 0.300342 0.169047 0.338315 0.240387 0.144634 0.128513 0.486465 0.290763 0.271259 0.116600 0.321377 0.224825 0.296233 0.229255 0.249687 0.493240 0.171285 0.075148 0.260326 Consensus sequence: HHBDHDDAACAATDRHHHHHBW Reverse complement motif 0.260326 0.171285 0.075148 0.493240 0.224825 0.229255 0.296233 0.249687 0.321377 0.271259 0.116600 0.290763 0.486465 0.144634 0.128513 0.240387 0.338315 0.300342 0.169047 0.192296 0.251680 0.220452 0.191155 0.336713 0.226998 0.196237 0.158323 0.418442 0.305027 0.526069 0.094878 0.074025 0.239965 0.024257 0.240450 0.495328 0.934595 0.003649 0.002189 0.059567 0.004992 0.001846 0.006976 0.986185 0.014697 0.002062 0.002161 0.981080 0.004516 0.008092 0.954596 0.032796 0.031997 0.001826 0.002456 0.963721 0.076159 0.038475 0.093390 0.791976 0.364301 0.370406 0.074356 0.190936 0.274393 0.070776 0.211081 0.443749 0.300626 0.174184 0.130641 0.394549 0.248133 0.095791 0.276373 0.379704 0.433558 0.176868 0.240155 0.149419 0.295589 0.228429 0.166233 0.309749 0.223177 0.300272 0.115555 0.360997 Consensus sequence: WBHHHHHMDATTGTTHDHDVHH Alignment: HHBDHDDAACAATDRHHHHHBW -----VDGACTRTGGDD----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00095 Zfp691_secondary Original Motif Reverse Complement Backward 4 12 0.024090 Species: Mus musculus Original motif 0.236868 0.155338 0.295091 0.312703 0.522782 0.133021 0.177386 0.166812 0.192915 0.374870 0.221406 0.210809 0.146546 0.199196 0.418035 0.236223 0.454326 0.095049 0.151770 0.298855 0.027956 0.023096 0.878335 0.070614 0.916030 0.020358 0.039894 0.023717 0.010595 0.938036 0.039415 0.011954 0.007271 0.014948 0.007990 0.969792 0.014291 0.964878 0.011126 0.009705 0.154586 0.759294 0.050151 0.035969 0.051021 0.268239 0.053410 0.627330 0.158293 0.386843 0.113152 0.341713 0.281766 0.184139 0.187916 0.346179 0.292444 0.267259 0.241323 0.198974 0.425732 0.262331 0.149076 0.162861 0.205385 0.384164 0.267912 0.142538 Consensus sequence: DABBWGACTCCTHDVHV Reverse complement motif 0.205385 0.267912 0.384164 0.142538 0.162861 0.262331 0.149076 0.425732 0.198974 0.267259 0.241323 0.292444 0.346179 0.184139 0.187916 0.281766 0.158293 0.113152 0.386843 0.341713 0.627330 0.268239 0.053410 0.051021 0.154586 0.050151 0.759294 0.035969 0.014291 0.011126 0.964878 0.009705 0.969792 0.014948 0.007990 0.007271 0.010595 0.039415 0.938036 0.011954 0.023717 0.020358 0.039894 0.916030 0.027956 0.878335 0.023096 0.070614 0.298855 0.095049 0.151770 0.454326 0.146546 0.418035 0.199196 0.236223 0.192915 0.221406 0.374870 0.210809 0.166812 0.133021 0.177386 0.522782 0.312703 0.155338 0.295091 0.236868 Consensus sequence: VHBDDAGGAGTCWBBTD Alignment: VHBDDAGGAGTCWBBTD --DDCCAMAGTCHB--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00004 Sox14_secondary Reverse Complement Original Motif Backward 2 12 0.025783 Species: Mus musculus Original motif 0.191264 0.345487 0.212142 0.251106 0.105033 0.130838 0.338939 0.425191 0.126539 0.333031 0.233364 0.307066 0.641901 0.114039 0.195933 0.048127 0.153349 0.532437 0.272427 0.041786 0.934680 0.009395 0.019668 0.036257 0.013611 0.927298 0.037729 0.021361 0.964293 0.018416 0.006724 0.010568 0.962181 0.018004 0.014592 0.005223 0.229593 0.016301 0.007632 0.746474 0.268456 0.030092 0.519349 0.182102 0.201484 0.107350 0.588833 0.102334 0.253726 0.259057 0.242924 0.244293 0.168663 0.203061 0.347898 0.280378 0.175853 0.339716 0.301724 0.182707 Consensus sequence: BKBASACAATRGHBB Reverse complement motif 0.175853 0.301724 0.339716 0.182707 0.168663 0.347898 0.203061 0.280378 0.253726 0.242924 0.259057 0.244293 0.201484 0.588833 0.107350 0.102334 0.268456 0.519349 0.030092 0.182102 0.746474 0.016301 0.007632 0.229593 0.005223 0.018004 0.014592 0.962181 0.010568 0.018416 0.006724 0.964293 0.013611 0.037729 0.927298 0.021361 0.036257 0.009395 0.019668 0.934680 0.153349 0.272427 0.532437 0.041786 0.048127 0.114039 0.195933 0.641901 0.126539 0.233364 0.333031 0.307066 0.425191 0.130838 0.338939 0.105033 0.191264 0.212142 0.345487 0.251106 Consensus sequence: BBDCMATTGTSTBRB Alignment: BKBASACAATRGHBB --VDGACTRTGGDD- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00081 Mybl1_primary Reverse Complement Original Motif Backward 3 12 0.026472 Species: Mus musculus Original motif 0.219490 0.243488 0.196239 0.340783 0.242096 0.094435 0.234242 0.429226 0.242319 0.155536 0.366023 0.236122 0.369837 0.185801 0.219486 0.224876 0.390568 0.211210 0.098244 0.299978 0.782192 0.011783 0.158354 0.047671 0.837985 0.006254 0.084522 0.071239 0.027255 0.965067 0.001360 0.006318 0.006706 0.831051 0.151462 0.010782 0.003491 0.002829 0.991758 0.001921 0.004195 0.009136 0.009776 0.976893 0.009860 0.166761 0.002159 0.821220 0.709623 0.006957 0.204415 0.079005 0.316262 0.239384 0.140024 0.304330 0.254660 0.237146 0.090326 0.417868 0.289939 0.309708 0.068038 0.332316 0.262670 0.214791 0.217375 0.305164 Consensus sequence: HDDDHAACCGTTAHHHD Reverse complement motif 0.305164 0.214791 0.217375 0.262670 0.332316 0.309708 0.068038 0.289939 0.417868 0.237146 0.090326 0.254660 0.304330 0.239384 0.140024 0.316262 0.079005 0.006957 0.204415 0.709623 0.821220 0.166761 0.002159 0.009860 0.976893 0.009136 0.009776 0.004195 0.003491 0.991758 0.002829 0.001921 0.006706 0.151462 0.831051 0.010782 0.027255 0.001360 0.965067 0.006318 0.071239 0.006254 0.084522 0.837985 0.047671 0.011783 0.158354 0.782192 0.299978 0.211210 0.098244 0.390568 0.224876 0.185801 0.219486 0.369837 0.242319 0.366023 0.155536 0.236122 0.429226 0.094435 0.234242 0.242096 0.340783 0.243488 0.196239 0.219490 Consensus sequence: DHHHTAACGGTTHDHDH Alignment: HDDDHAACCGTTAHHHD ---VDGACTRTGGDD-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00052 Osr2_primary Original Motif Reverse Complement Backward 2 12 0.027027 Species: Mus musculus Original motif 0.295210 0.230759 0.178832 0.295199 0.286163 0.186772 0.186150 0.340915 0.287577 0.235045 0.329453 0.147924 0.263264 0.191325 0.081978 0.463433 0.839420 0.118123 0.018788 0.023669 0.005488 0.984397 0.000830 0.009284 0.660134 0.001532 0.336574 0.001760 0.003020 0.001773 0.993144 0.002063 0.039664 0.001060 0.005054 0.954222 0.980339 0.000636 0.016776 0.002249 0.003849 0.001418 0.992166 0.002568 0.000858 0.950172 0.007228 0.041743 0.342840 0.230712 0.133570 0.292878 0.342486 0.316980 0.167294 0.173240 0.362426 0.178913 0.146709 0.311952 0.266586 0.140406 0.435643 0.157365 Consensus sequence: HHVHACRGTAGCHHHD Reverse complement motif 0.266586 0.435643 0.140406 0.157365 0.311952 0.178913 0.146709 0.362426 0.173240 0.316980 0.167294 0.342486 0.292878 0.230712 0.133570 0.342840 0.000858 0.007228 0.950172 0.041743 0.003849 0.992166 0.001418 0.002568 0.002249 0.000636 0.016776 0.980339 0.954222 0.001060 0.005054 0.039664 0.003020 0.993144 0.001773 0.002063 0.001760 0.001532 0.336574 0.660134 0.005488 0.000830 0.984397 0.009284 0.023669 0.118123 0.018788 0.839420 0.463433 0.191325 0.081978 0.263264 0.287577 0.329453 0.235045 0.147924 0.340915 0.186772 0.186150 0.286163 0.295199 0.230759 0.178832 0.295210 Consensus sequence: HHHHGCTACKGTHVHH Alignment: HHHHGCTACKGTHVHH ---DDCCAMAGTCHB- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00000 Smad3_primary Reverse Complement Reverse Complement Forward 3 12 0.027066 Species: Mus musculus Original motif 0.282316 0.413385 0.114930 0.189369 0.341654 0.135011 0.267943 0.255392 0.399523 0.173081 0.168845 0.258551 0.365086 0.196360 0.211856 0.226699 0.243321 0.177839 0.224206 0.354635 0.029873 0.808479 0.036309 0.125339 0.004945 0.815465 0.040635 0.138955 0.934557 0.058944 0.005027 0.001471 0.005099 0.003998 0.986148 0.004755 0.969304 0.020594 0.001929 0.008173 0.008189 0.984816 0.004199 0.002795 0.669579 0.012182 0.282153 0.036085 0.130511 0.171241 0.334041 0.364207 0.198982 0.289660 0.252392 0.258966 0.423172 0.190978 0.164411 0.221440 0.213519 0.287388 0.294414 0.204679 0.371956 0.285061 0.150191 0.192792 Consensus sequence: HDHDDCCAGACABBHVH Reverse complement motif 0.192792 0.285061 0.150191 0.371956 0.213519 0.294414 0.287388 0.204679 0.221440 0.190978 0.164411 0.423172 0.198982 0.252392 0.289660 0.258966 0.364207 0.171241 0.334041 0.130511 0.036085 0.012182 0.282153 0.669579 0.008189 0.004199 0.984816 0.002795 0.008173 0.020594 0.001929 0.969304 0.005099 0.986148 0.003998 0.004755 0.001471 0.058944 0.005027 0.934557 0.004945 0.040635 0.815465 0.138955 0.029873 0.036309 0.808479 0.125339 0.354635 0.177839 0.224206 0.243321 0.226699 0.196360 0.211856 0.365086 0.258551 0.173081 0.168845 0.399523 0.255392 0.135011 0.267943 0.341654 0.282316 0.114930 0.413385 0.189369 Consensus sequence: HVHBVTGTCTGGDDHDD Alignment: HVHBVTGTCTGGDDHDD --VDGACTRTGGDD--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 2 Motif ID: 26 Motif name: CAcCACAGTGGAGCAct Original motif 0.078125 0.734375 0.046875 0.140625 0.828125 0.046875 0.078125 0.046875 0.203125 0.484375 0.156250 0.156250 0.015625 0.984375 0.000000 0.000000 0.968750 0.015625 0.015625 0.000000 0.000000 0.906250 0.015625 0.078125 0.859375 0.000000 0.000000 0.140625 0.031250 0.000000 0.906250 0.062500 0.000000 0.015625 0.000000 0.984375 0.000000 0.000000 0.968750 0.031250 0.046875 0.062500 0.812500 0.078125 0.937500 0.015625 0.015625 0.031250 0.015625 0.031250 0.921875 0.031250 0.125000 0.796875 0.000000 0.078125 0.875000 0.046875 0.046875 0.031250 0.093750 0.656250 0.093750 0.156250 0.156250 0.078125 0.109375 0.656250 Consensus sequence: CAHCACAGTGGAGCACT Reserve complement motif 0.656250 0.078125 0.109375 0.156250 0.093750 0.093750 0.656250 0.156250 0.031250 0.046875 0.046875 0.875000 0.125000 0.000000 0.796875 0.078125 0.015625 0.921875 0.031250 0.031250 0.031250 0.015625 0.015625 0.937500 0.046875 0.812500 0.062500 0.078125 0.000000 0.968750 0.000000 0.031250 0.984375 0.015625 0.000000 0.000000 0.031250 0.906250 0.000000 0.062500 0.140625 0.000000 0.000000 0.859375 0.000000 0.015625 0.906250 0.078125 0.000000 0.015625 0.015625 0.968750 0.015625 0.000000 0.984375 0.000000 0.203125 0.156250 0.484375 0.156250 0.046875 0.046875 0.078125 0.828125 0.078125 0.046875 0.734375 0.140625 Consensus sequence: AGTGCTCCACTGTGDTG ************************************************************************ Best Matches for Motif ID 26 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v015681_primary Original Motif Reverse Complement Forward 2 17 0.038134 Species: Mus musculus Original motif 0.472795 0.179227 0.091251 0.256726 0.036521 0.159743 0.204840 0.598896 0.164582 0.312805 0.221324 0.301289 0.237069 0.249050 0.293048 0.220833 0.401949 0.225181 0.229401 0.143469 0.161422 0.494334 0.252207 0.092036 0.252940 0.177721 0.369400 0.199939 0.119630 0.024651 0.849920 0.005798 0.000962 0.002398 0.990616 0.006023 0.937852 0.027016 0.034535 0.000597 0.008963 0.987756 0.000629 0.002652 0.001584 0.992898 0.002349 0.003169 0.956822 0.027342 0.002484 0.013352 0.009873 0.987759 0.000988 0.001381 0.016397 0.980856 0.000369 0.002378 0.081761 0.758555 0.038572 0.121112 0.371713 0.091838 0.448027 0.088423 0.111617 0.121913 0.683885 0.082585 0.334562 0.102916 0.436488 0.126034 0.210362 0.101261 0.238339 0.450037 0.169041 0.271583 0.320799 0.238576 0.140316 0.049885 0.735236 0.074563 Consensus sequence: HTBVVVDGGACCACCCRGRDBG Reverse complement motif 0.140316 0.735236 0.049885 0.074563 0.169041 0.320799 0.271583 0.238576 0.450037 0.101261 0.238339 0.210362 0.334562 0.436488 0.102916 0.126034 0.111617 0.683885 0.121913 0.082585 0.371713 0.448027 0.091838 0.088423 0.081761 0.038572 0.758555 0.121112 0.016397 0.000369 0.980856 0.002378 0.009873 0.000988 0.987759 0.001381 0.013352 0.027342 0.002484 0.956822 0.001584 0.002349 0.992898 0.003169 0.008963 0.000629 0.987756 0.002652 0.000597 0.027016 0.034535 0.937852 0.000962 0.990616 0.002398 0.006023 0.119630 0.849920 0.024651 0.005798 0.252940 0.369400 0.177721 0.199939 0.161422 0.252207 0.494334 0.092036 0.143469 0.225181 0.229401 0.401949 0.237069 0.293048 0.249050 0.220833 0.164582 0.221324 0.312805 0.301289 0.598896 0.159743 0.204840 0.036521 0.256726 0.179227 0.091251 0.472795 Consensus sequence: CBDMCMGGGTGGTCCHVBVBAH Alignment: CBDMCMGGGTGGTCCHVBVBAH -CAHCACAGTGGAGCACT---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00031 Zbtb3_primary Reverse Complement Reverse Complement Backward 1 17 0.039321 Species: Mus musculus Original motif 0.401190 0.144405 0.268531 0.185874 0.430224 0.168519 0.221247 0.180011 0.172575 0.268499 0.274136 0.284789 0.150971 0.297110 0.290868 0.261051 0.133421 0.282842 0.434718 0.149019 0.042798 0.941105 0.001785 0.014312 0.890788 0.002551 0.103316 0.003345 0.001887 0.951368 0.043722 0.003023 0.011633 0.002218 0.002269 0.983880 0.003597 0.003728 0.984819 0.007856 0.002946 0.903520 0.072457 0.021077 0.908487 0.057072 0.018256 0.016185 0.076237 0.329864 0.228896 0.365003 0.144926 0.162981 0.177370 0.514722 0.124970 0.327876 0.295814 0.251341 0.144592 0.313887 0.301912 0.239609 0.108463 0.241747 0.350296 0.299494 Consensus sequence: DDBBBCACTGCABTBBB Reverse complement motif 0.108463 0.350296 0.241747 0.299494 0.144592 0.301912 0.313887 0.239609 0.124970 0.295814 0.327876 0.251341 0.514722 0.162981 0.177370 0.144926 0.365003 0.329864 0.228896 0.076237 0.016185 0.057072 0.018256 0.908487 0.002946 0.072457 0.903520 0.021077 0.003597 0.984819 0.003728 0.007856 0.983880 0.002218 0.002269 0.011633 0.001887 0.043722 0.951368 0.003023 0.003345 0.002551 0.103316 0.890788 0.042798 0.001785 0.941105 0.014312 0.133421 0.434718 0.282842 0.149019 0.150971 0.290868 0.297110 0.261051 0.284789 0.268499 0.274136 0.172575 0.180011 0.168519 0.221247 0.430224 0.185874 0.144405 0.268531 0.401190 Consensus sequence: BBBAVTGCAGTGBBVDD Alignment: BBBAVTGCAGTGBBVDD AGTGCTCCACTGTGDTG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00034 Sox7_primary Original Motif Original Motif Backward 2 17 0.044117 Species: Mus musculus Original motif 0.360997 0.300272 0.115555 0.223177 0.309749 0.228429 0.166233 0.295589 0.149419 0.176868 0.240155 0.433558 0.379704 0.095791 0.276373 0.248133 0.394549 0.174184 0.130641 0.300626 0.443749 0.070776 0.211081 0.274393 0.364301 0.074356 0.370406 0.190936 0.791976 0.038475 0.093390 0.076159 0.963721 0.001826 0.002456 0.031997 0.004516 0.954596 0.008092 0.032796 0.981080 0.002062 0.002161 0.014697 0.986185 0.001846 0.006976 0.004992 0.059567 0.003649 0.002189 0.934595 0.495328 0.024257 0.240450 0.239965 0.305027 0.094878 0.526069 0.074025 0.418442 0.196237 0.158323 0.226998 0.336713 0.220452 0.191155 0.251680 0.192296 0.300342 0.169047 0.338315 0.240387 0.144634 0.128513 0.486465 0.290763 0.271259 0.116600 0.321377 0.224825 0.296233 0.229255 0.249687 0.493240 0.171285 0.075148 0.260326 Consensus sequence: HHBDHDDAACAATDRHHHHHBW Reverse complement motif 0.260326 0.171285 0.075148 0.493240 0.224825 0.229255 0.296233 0.249687 0.321377 0.271259 0.116600 0.290763 0.486465 0.144634 0.128513 0.240387 0.338315 0.300342 0.169047 0.192296 0.251680 0.220452 0.191155 0.336713 0.226998 0.196237 0.158323 0.418442 0.305027 0.526069 0.094878 0.074025 0.239965 0.024257 0.240450 0.495328 0.934595 0.003649 0.002189 0.059567 0.004992 0.001846 0.006976 0.986185 0.014697 0.002062 0.002161 0.981080 0.004516 0.008092 0.954596 0.032796 0.031997 0.001826 0.002456 0.963721 0.076159 0.038475 0.093390 0.791976 0.364301 0.370406 0.074356 0.190936 0.274393 0.070776 0.211081 0.443749 0.300626 0.174184 0.130641 0.394549 0.248133 0.095791 0.276373 0.379704 0.433558 0.176868 0.240155 0.149419 0.295589 0.228429 0.166233 0.309749 0.223177 0.300272 0.115555 0.360997 Consensus sequence: WBHHHHHMDATTGTTHDHDVHH Alignment: HHBDHDDAACAATDRHHHHHBW ----CAHCACAGTGGAGCACT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v016060_primary Reverse Complement Reverse Complement Forward 4 17 0.047762 Species: Mus musculus Original motif 0.204923 0.208846 0.365383 0.220848 0.294304 0.300143 0.167287 0.238266 0.109711 0.619514 0.117379 0.153396 0.178979 0.378580 0.230177 0.212264 0.159594 0.542602 0.118178 0.179627 0.125206 0.430074 0.151826 0.292894 0.097692 0.709845 0.116956 0.075506 0.148292 0.565912 0.037632 0.248164 0.077951 0.034190 0.855503 0.032356 0.001657 0.001061 0.971877 0.025405 0.001926 0.001084 0.991712 0.005278 0.033031 0.012001 0.057796 0.897171 0.002723 0.002647 0.993348 0.001281 0.003261 0.000963 0.987199 0.008577 0.000611 0.090925 0.074857 0.833608 0.015299 0.978878 0.004949 0.000874 0.013368 0.600902 0.033485 0.352245 0.231949 0.149575 0.118804 0.499672 0.267580 0.186002 0.371242 0.175176 0.264884 0.223483 0.110082 0.401551 0.221365 0.170121 0.179559 0.428955 0.112997 0.692930 0.139981 0.054092 0.460305 0.207883 0.155111 0.176702 Consensus sequence: BHCBCBCCGGGTGGTCYHVHDCH Reverse complement motif 0.176702 0.207883 0.155111 0.460305 0.112997 0.139981 0.692930 0.054092 0.428955 0.170121 0.179559 0.221365 0.401551 0.223483 0.110082 0.264884 0.267580 0.371242 0.186002 0.175176 0.499672 0.149575 0.118804 0.231949 0.013368 0.033485 0.600902 0.352245 0.015299 0.004949 0.978878 0.000874 0.833608 0.090925 0.074857 0.000611 0.003261 0.987199 0.000963 0.008577 0.002723 0.993348 0.002647 0.001281 0.897171 0.012001 0.057796 0.033031 0.001926 0.991712 0.001084 0.005278 0.001657 0.971877 0.001061 0.025405 0.077951 0.855503 0.034190 0.032356 0.148292 0.037632 0.565912 0.248164 0.097692 0.116956 0.709845 0.075506 0.125206 0.151826 0.430074 0.292894 0.159594 0.118178 0.542602 0.179627 0.178979 0.230177 0.378580 0.212264 0.109711 0.117379 0.619514 0.153396 0.294304 0.167287 0.300143 0.238266 0.204923 0.365383 0.208846 0.220848 Consensus sequence: HGDHVHKGACCACCCGGBGBGDB Alignment: HGDHVHKGACCACCCGGBGBGDB ---AGTGCTCCACTGTGDTG--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00231 Nkx2-2 Original Motif Original Motif Backward 1 17 0.047942 Species: Mus musculus Original motif 0.299323 0.258429 0.141957 0.300291 0.267631 0.143882 0.146933 0.441554 0.482614 0.212022 0.233631 0.071733 0.430836 0.073912 0.334439 0.160813 0.124944 0.704331 0.166815 0.003910 0.001941 0.876479 0.000828 0.120752 0.920202 0.005985 0.000456 0.073357 0.023544 0.974093 0.000859 0.001505 0.005010 0.003098 0.001328 0.990564 0.003250 0.198149 0.000490 0.798110 0.134659 0.104976 0.753464 0.006901 0.932490 0.000724 0.006140 0.060646 0.504530 0.106203 0.360995 0.028271 0.673257 0.074893 0.106536 0.145314 0.356324 0.097610 0.230142 0.315924 0.129483 0.188353 0.203623 0.478542 0.289071 0.157675 0.231909 0.321345 Consensus sequence: HDVRCCACTTGARADBD Reverse complement motif 0.321345 0.157675 0.231909 0.289071 0.478542 0.188353 0.203623 0.129483 0.315924 0.097610 0.230142 0.356324 0.145314 0.074893 0.106536 0.673257 0.028271 0.106203 0.360995 0.504530 0.060646 0.000724 0.006140 0.932490 0.134659 0.753464 0.104976 0.006901 0.798110 0.198149 0.000490 0.003250 0.990564 0.003098 0.001328 0.005010 0.023544 0.000859 0.974093 0.001505 0.073357 0.005985 0.000456 0.920202 0.001941 0.000828 0.876479 0.120752 0.124944 0.166815 0.704331 0.003910 0.160813 0.073912 0.334439 0.430836 0.071733 0.212022 0.233631 0.482614 0.441554 0.143882 0.146933 0.267631 0.300291 0.258429 0.141957 0.299323 Consensus sequence: DVDTKTCAAGTGGKBDH Alignment: HDVRCCACTTGARADBD CAHCACAGTGGAGCACT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00528 Foxm1_primary Original Motif Reverse Complement Backward 6 17 0.048468 Species: Mus musculus Original motif 0.402634 0.249702 0.143705 0.203959 0.709619 0.108953 0.130781 0.050647 0.334232 0.077498 0.228818 0.359452 0.131721 0.094794 0.234481 0.539005 0.170102 0.237609 0.252464 0.339824 0.244961 0.347304 0.228129 0.179606 0.612141 0.132244 0.180110 0.075504 0.472236 0.042388 0.234419 0.250957 0.125213 0.007413 0.849788 0.017587 0.702068 0.064216 0.141992 0.091724 0.008657 0.038238 0.002959 0.950145 0.007170 0.002244 0.986824 0.003763 0.002862 0.979956 0.000711 0.016471 0.971196 0.001954 0.011441 0.015409 0.105575 0.031482 0.022836 0.840107 0.031534 0.736742 0.032785 0.198939 0.479153 0.347558 0.031799 0.141490 0.056405 0.123140 0.023989 0.796466 0.111194 0.195344 0.501360 0.192102 0.376359 0.416820 0.072818 0.134004 0.225111 0.249460 0.306563 0.218866 0.405251 0.168478 0.108618 0.317653 0.165386 0.191749 0.268604 0.374261 Consensus sequence: HADTBVADGATGCATCMTGMVHB Reverse complement motif 0.374261 0.191749 0.268604 0.165386 0.317653 0.168478 0.108618 0.405251 0.225111 0.306563 0.249460 0.218866 0.376359 0.072818 0.416820 0.134004 0.111194 0.501360 0.195344 0.192102 0.796466 0.123140 0.023989 0.056405 0.141490 0.347558 0.031799 0.479153 0.031534 0.032785 0.736742 0.198939 0.840107 0.031482 0.022836 0.105575 0.015409 0.001954 0.011441 0.971196 0.002862 0.000711 0.979956 0.016471 0.007170 0.986824 0.002244 0.003763 0.950145 0.038238 0.002959 0.008657 0.091724 0.064216 0.141992 0.702068 0.125213 0.849788 0.007413 0.017587 0.250957 0.042388 0.234419 0.472236 0.075504 0.132244 0.180110 0.612141 0.244961 0.228129 0.347304 0.179606 0.339824 0.237609 0.252464 0.170102 0.539005 0.094794 0.234481 0.131721 0.359452 0.077498 0.228818 0.334232 0.050647 0.108953 0.130781 0.709619 0.203959 0.249702 0.143705 0.402634 Consensus sequence: VHVRCAYGATGCATCDTVVADTH Alignment: VHVRCAYGATGCATCDTVVADTH -CAHCACAGTGGAGCACT----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v016060_secondary Reverse Complement Reverse Complement Forward 1 17 0.048744 Species: Mus musculus Original motif 0.168550 0.345968 0.396524 0.088958 0.038113 0.360882 0.114042 0.486963 0.349356 0.180599 0.051416 0.418629 0.258773 0.332518 0.244932 0.163778 0.371663 0.208591 0.263136 0.156609 0.225440 0.321741 0.175932 0.276887 0.100827 0.656850 0.018644 0.223679 0.494140 0.155427 0.327424 0.023009 0.105642 0.805846 0.027712 0.060800 0.065110 0.845072 0.058046 0.031772 0.649343 0.110180 0.180680 0.059797 0.064269 0.853604 0.066860 0.015268 0.437421 0.533797 0.016833 0.011948 0.121694 0.787708 0.016177 0.074421 0.625382 0.066925 0.266070 0.041623 0.117819 0.608153 0.165139 0.108889 0.145639 0.102001 0.604926 0.147434 0.521188 0.184986 0.064607 0.229219 0.180371 0.274237 0.096591 0.448801 0.071055 0.455813 0.332817 0.140315 0.084503 0.199982 0.448293 0.267222 0.389451 0.169545 0.155507 0.285497 0.424314 0.227621 0.101210 0.246855 Consensus sequence: VYWVVHCRCCACMCACGAHSBHH Reverse complement motif 0.246855 0.227621 0.101210 0.424314 0.285497 0.169545 0.155507 0.389451 0.084503 0.448293 0.199982 0.267222 0.071055 0.332817 0.455813 0.140315 0.448801 0.274237 0.096591 0.180371 0.229219 0.184986 0.064607 0.521188 0.145639 0.604926 0.102001 0.147434 0.117819 0.165139 0.608153 0.108889 0.041623 0.066925 0.266070 0.625382 0.121694 0.016177 0.787708 0.074421 0.437421 0.016833 0.533797 0.011948 0.064269 0.066860 0.853604 0.015268 0.059797 0.110180 0.180680 0.649343 0.065110 0.058046 0.845072 0.031772 0.105642 0.027712 0.805846 0.060800 0.023009 0.155427 0.327424 0.494140 0.100827 0.018644 0.656850 0.223679 0.225440 0.175932 0.321741 0.276887 0.156609 0.208591 0.263136 0.371663 0.258773 0.244932 0.332518 0.163778 0.418629 0.180599 0.051416 0.349356 0.486963 0.360882 0.114042 0.038113 0.168550 0.396524 0.345968 0.088958 Consensus sequence: HHBSHTCGTGRGTGGKGDBVWMV Alignment: HHBSHTCGTGRGTGGKGDBVWMV AGTGCTCCACTGTGDTG------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00046 Tcfe2a_primary Reverse Complement Reverse Complement Forward 1 17 0.048891 Species: Mus musculus Original motif 0.306209 0.232705 0.244475 0.216611 0.165668 0.171480 0.222584 0.440269 0.213008 0.429038 0.156385 0.201569 0.283226 0.329518 0.160795 0.226461 0.439156 0.283517 0.251270 0.026056 0.014994 0.980987 0.000714 0.003304 0.975741 0.020182 0.002909 0.001168 0.000926 0.191353 0.801648 0.006073 0.015382 0.090853 0.893043 0.000721 0.001549 0.005912 0.001713 0.990826 0.004000 0.000857 0.989667 0.005475 0.016957 0.663726 0.148127 0.171190 0.299047 0.091156 0.448649 0.161148 0.354701 0.214677 0.236757 0.193865 0.399446 0.174508 0.200036 0.226009 0.303545 0.277435 0.200094 0.218926 0.380242 0.148876 0.163367 0.307514 Consensus sequence: VBHHVCAGGTGCDVDHD Reverse complement motif 0.307514 0.148876 0.163367 0.380242 0.218926 0.277435 0.200094 0.303545 0.226009 0.174508 0.200036 0.399446 0.193865 0.214677 0.236757 0.354701 0.299047 0.448649 0.091156 0.161148 0.016957 0.148127 0.663726 0.171190 0.004000 0.989667 0.000857 0.005475 0.990826 0.005912 0.001713 0.001549 0.015382 0.893043 0.090853 0.000721 0.000926 0.801648 0.191353 0.006073 0.001168 0.020182 0.002909 0.975741 0.014994 0.000714 0.980987 0.003304 0.026056 0.283517 0.251270 0.439156 0.283226 0.160795 0.329518 0.226461 0.213008 0.156385 0.429038 0.201569 0.440269 0.171480 0.222584 0.165668 0.216611 0.232705 0.244475 0.306209 Consensus sequence: DHDBHGCACCTGBDDVB Alignment: DHDBHGCACCTGBDDVB AGTGCTCCACTGTGDTG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v016060_primary Original Motif Reverse Complement Backward 5 17 0.049135 Species: Mus musculus Original motif 0.180868 0.321661 0.134642 0.362829 0.232215 0.134289 0.315356 0.318141 0.065068 0.093681 0.569842 0.271408 0.370822 0.229680 0.154738 0.244759 0.323039 0.182873 0.173588 0.320500 0.175039 0.266898 0.276080 0.281984 0.412669 0.147730 0.146326 0.293275 0.325953 0.028805 0.629596 0.015646 0.003017 0.001766 0.979711 0.015507 0.888973 0.040666 0.069420 0.000941 0.017309 0.979155 0.000899 0.002637 0.001732 0.988816 0.004856 0.004596 0.889763 0.078125 0.010384 0.021729 0.007566 0.987081 0.001421 0.003932 0.027797 0.966593 0.000878 0.004731 0.025816 0.867003 0.065749 0.041433 0.220658 0.075256 0.582904 0.121182 0.088946 0.283695 0.565345 0.062015 0.328012 0.241332 0.305901 0.124755 0.307302 0.137589 0.375928 0.179181 0.298752 0.231470 0.315255 0.154524 0.094565 0.142901 0.705696 0.056838 Consensus sequence: HDGHHBHRGACCACCCGSVDVG Reverse complement motif 0.094565 0.705696 0.142901 0.056838 0.298752 0.315255 0.231470 0.154524 0.307302 0.375928 0.137589 0.179181 0.124755 0.241332 0.305901 0.328012 0.088946 0.565345 0.283695 0.062015 0.220658 0.582904 0.075256 0.121182 0.025816 0.065749 0.867003 0.041433 0.027797 0.000878 0.966593 0.004731 0.007566 0.001421 0.987081 0.003932 0.021729 0.078125 0.010384 0.889763 0.001732 0.004856 0.988816 0.004596 0.017309 0.000899 0.979155 0.002637 0.000941 0.040666 0.069420 0.888973 0.003017 0.979711 0.001766 0.015507 0.325953 0.629596 0.028805 0.015646 0.293275 0.147730 0.146326 0.412669 0.281984 0.266898 0.276080 0.175039 0.320500 0.182873 0.173588 0.323039 0.244759 0.229680 0.154738 0.370822 0.065068 0.569842 0.093681 0.271408 0.318141 0.134289 0.315356 0.232215 0.362829 0.321661 0.134642 0.180868 Consensus sequence: CVHBSCGGGTGGTCMHVHHCDH Alignment: CVHBSCGGGTGGTCMHVHHCDH -CAHCACAGTGGAGCACT---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v015681_secondary Original Motif Original Motif Forward 4 17 0.051502 Species: Mus musculus Original motif 0.214165 0.143436 0.372522 0.269876 0.314445 0.406003 0.160351 0.119201 0.137147 0.092924 0.042921 0.727007 0.044121 0.072843 0.051741 0.831295 0.261292 0.324124 0.298498 0.116086 0.258125 0.323243 0.263362 0.155271 0.204557 0.589399 0.107153 0.098891 0.371021 0.244027 0.291102 0.093849 0.096327 0.572718 0.011797 0.319159 0.027282 0.046183 0.844519 0.082016 0.018921 0.012887 0.915917 0.052275 0.364793 0.166722 0.084229 0.384256 0.028216 0.011233 0.951056 0.009495 0.054974 0.004738 0.890377 0.049911 0.006802 0.312915 0.134247 0.546036 0.241289 0.628210 0.104788 0.025713 0.237863 0.302807 0.213018 0.246311 0.349399 0.203220 0.086635 0.360746 0.386634 0.144693 0.246895 0.221779 0.425101 0.354676 0.093374 0.126849 0.060272 0.391320 0.104905 0.443503 0.162090 0.190233 0.227433 0.420244 Consensus sequence: DVTTVVCVYGGHGGYCHHDMYB Reverse complement motif 0.420244 0.190233 0.227433 0.162090 0.443503 0.391320 0.104905 0.060272 0.126849 0.354676 0.093374 0.425101 0.221779 0.144693 0.246895 0.386634 0.360746 0.203220 0.086635 0.349399 0.237863 0.213018 0.302807 0.246311 0.241289 0.104788 0.628210 0.025713 0.546036 0.312915 0.134247 0.006802 0.054974 0.890377 0.004738 0.049911 0.028216 0.951056 0.011233 0.009495 0.384256 0.166722 0.084229 0.364793 0.018921 0.915917 0.012887 0.052275 0.027282 0.844519 0.046183 0.082016 0.096327 0.011797 0.572718 0.319159 0.093849 0.244027 0.291102 0.371021 0.204557 0.107153 0.589399 0.098891 0.258125 0.263362 0.323243 0.155271 0.261292 0.298498 0.324124 0.116086 0.831295 0.072843 0.051741 0.044121 0.727007 0.092924 0.042921 0.137147 0.314445 0.160351 0.406003 0.119201 0.214165 0.372522 0.143436 0.269876 Consensus sequence: VMYDHDGMCCHCCKBGVVAAVH Alignment: DVTTVVCVYGGHGGYCHHDMYB ---CAHCACAGTGGAGCACT-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 2 Motif ID: 27 Motif name: AgTGCTCCACTGTGgTGTCACAgT Original motif 0.690141 0.126761 0.042254 0.140845 0.169014 0.098592 0.676056 0.056338 0.042254 0.028169 0.028169 0.901408 0.056338 0.000000 0.774648 0.169014 0.042254 0.887324 0.042254 0.028169 0.000000 0.014085 0.000000 0.985915 0.056338 0.830986 0.042254 0.070423 0.028169 0.957746 0.014085 0.000000 0.957746 0.000000 0.014085 0.028169 0.084507 0.845070 0.014085 0.056338 0.028169 0.014085 0.000000 0.957746 0.140845 0.028169 0.802817 0.028169 0.014085 0.014085 0.014085 0.957746 0.014085 0.000000 0.929577 0.056338 0.056338 0.154930 0.619718 0.169014 0.014085 0.028169 0.000000 0.957746 0.056338 0.014085 0.873239 0.056338 0.014085 0.000000 0.000000 0.985915 0.042254 0.929577 0.000000 0.028169 0.957746 0.028169 0.000000 0.014085 0.028169 0.845070 0.028169 0.098592 0.873239 0.014085 0.042254 0.070423 0.098592 0.154930 0.563380 0.183099 0.070423 0.014085 0.112676 0.802817 Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reserve complement motif 0.802817 0.014085 0.112676 0.070423 0.098592 0.563380 0.154930 0.183099 0.070423 0.014085 0.042254 0.873239 0.028169 0.028169 0.845070 0.098592 0.014085 0.028169 0.000000 0.957746 0.042254 0.000000 0.929577 0.028169 0.985915 0.000000 0.000000 0.014085 0.056338 0.873239 0.014085 0.056338 0.957746 0.028169 0.000000 0.014085 0.056338 0.619718 0.154930 0.169014 0.014085 0.929577 0.000000 0.056338 0.957746 0.014085 0.014085 0.014085 0.140845 0.802817 0.028169 0.028169 0.957746 0.014085 0.000000 0.028169 0.084507 0.014085 0.845070 0.056338 0.028169 0.000000 0.014085 0.957746 0.028169 0.014085 0.957746 0.000000 0.056338 0.042254 0.830986 0.070423 0.985915 0.014085 0.000000 0.000000 0.042254 0.042254 0.887324 0.028169 0.056338 0.774648 0.000000 0.169014 0.901408 0.028169 0.028169 0.042254 0.169014 0.676056 0.098592 0.056338 0.140845 0.126761 0.042254 0.690141 Consensus sequence: ACTGTGACACCACAGTGGAGCACT ************************************************************************ Best Matches for Motif ID 27 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v015681_primary Reverse Complement Original Motif Forward 1 23 0.050973 Species: Mus musculus Original motif 0.183797 0.268049 0.330111 0.218043 0.127599 0.330310 0.243614 0.298477 0.143199 0.188046 0.268593 0.400162 0.214690 0.205230 0.247090 0.332990 0.294688 0.299104 0.327152 0.079056 0.221909 0.193223 0.480155 0.104712 0.444072 0.068239 0.481838 0.005852 0.006182 0.015429 0.901278 0.077111 0.766535 0.111138 0.121632 0.000696 0.014848 0.973961 0.000298 0.010893 0.001807 0.992200 0.002669 0.003324 0.795344 0.140510 0.018576 0.045571 0.006990 0.988200 0.002510 0.002299 0.154898 0.842296 0.000998 0.001808 0.029577 0.919262 0.006935 0.044226 0.677987 0.032075 0.185065 0.104874 0.195132 0.364580 0.319321 0.120967 0.225412 0.115034 0.612849 0.046705 0.548628 0.058900 0.162857 0.229616 0.112531 0.340331 0.165910 0.381227 0.073029 0.303078 0.363896 0.259997 0.561485 0.260567 0.092979 0.084969 0.132283 0.457691 0.140159 0.269867 Consensus sequence: BBBDVVRGACCACCCAVGABBAB Reverse complement motif 0.132283 0.140159 0.457691 0.269867 0.084969 0.260567 0.092979 0.561485 0.073029 0.363896 0.303078 0.259997 0.381227 0.340331 0.165910 0.112531 0.229616 0.058900 0.162857 0.548628 0.225412 0.612849 0.115034 0.046705 0.195132 0.319321 0.364580 0.120967 0.104874 0.032075 0.185065 0.677987 0.029577 0.006935 0.919262 0.044226 0.154898 0.000998 0.842296 0.001808 0.006990 0.002510 0.988200 0.002299 0.045571 0.140510 0.018576 0.795344 0.001807 0.002669 0.992200 0.003324 0.014848 0.000298 0.973961 0.010893 0.000696 0.111138 0.121632 0.766535 0.006182 0.901278 0.015429 0.077111 0.444072 0.481838 0.068239 0.005852 0.221909 0.480155 0.193223 0.104712 0.294688 0.327152 0.299104 0.079056 0.332990 0.205230 0.247090 0.214690 0.400162 0.188046 0.268593 0.143199 0.127599 0.243614 0.330310 0.298477 0.183797 0.330111 0.268049 0.218043 Consensus sequence: BTBVTCVTGGGTGGTCMVVDVBB Alignment: BBBDVVRGACCACCCAVGABBAB- ACTGTGACACCACAGTGGAGCACT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v016060_primary Original Motif Reverse Complement Forward 4 21 1.048801 Species: Mus musculus Original motif 0.137831 0.118922 0.394177 0.349070 0.190108 0.163633 0.138507 0.507753 0.346002 0.332315 0.228621 0.093063 0.113254 0.287554 0.373285 0.225908 0.272578 0.125402 0.328963 0.273057 0.333973 0.115165 0.194267 0.356595 0.381054 0.086215 0.501679 0.031052 0.002232 0.007405 0.966087 0.024276 0.834741 0.112115 0.052053 0.001091 0.009034 0.983239 0.000766 0.006960 0.002054 0.988103 0.003138 0.006705 0.805772 0.171299 0.008415 0.014515 0.020076 0.976846 0.000894 0.002183 0.079914 0.917273 0.001179 0.001634 0.013983 0.950545 0.004205 0.031267 0.789407 0.039441 0.108645 0.062507 0.055453 0.161271 0.595249 0.188028 0.333424 0.128169 0.373270 0.165136 0.536103 0.109520 0.062980 0.291397 0.346477 0.090909 0.279533 0.283081 0.045892 0.190183 0.584314 0.179611 0.088294 0.406148 0.251647 0.253912 0.202467 0.447159 0.162802 0.187571 Consensus sequence: DTVBDDRGACCACCCAGDWDGBH Reverse complement motif 0.202467 0.162802 0.447159 0.187571 0.088294 0.251647 0.406148 0.253912 0.045892 0.584314 0.190183 0.179611 0.283081 0.090909 0.279533 0.346477 0.291397 0.109520 0.062980 0.536103 0.333424 0.373270 0.128169 0.165136 0.055453 0.595249 0.161271 0.188028 0.062507 0.039441 0.108645 0.789407 0.013983 0.004205 0.950545 0.031267 0.079914 0.001179 0.917273 0.001634 0.020076 0.000894 0.976846 0.002183 0.014515 0.171299 0.008415 0.805772 0.002054 0.003138 0.988103 0.006705 0.009034 0.000766 0.983239 0.006960 0.001091 0.112115 0.052053 0.834741 0.002232 0.966087 0.007405 0.024276 0.381054 0.501679 0.086215 0.031052 0.356595 0.115165 0.194267 0.333973 0.272578 0.328963 0.125402 0.273057 0.113254 0.373285 0.287554 0.225908 0.093063 0.332315 0.228621 0.346002 0.507753 0.163633 0.138507 0.190108 0.137831 0.394177 0.118922 0.349070 Consensus sequence: DBCDWHCTGGGTGGTCMDHBBAH Alignment: DTVBDDRGACCACCCAGDWDGBH--- ---AGTGCTCCACTGTGGTGTCACAGT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v016060_primary Reverse Complement Reverse Complement Forward 3 21 1.050875 Species: Mus musculus Original motif 0.204923 0.208846 0.365383 0.220848 0.294304 0.300143 0.167287 0.238266 0.109711 0.619514 0.117379 0.153396 0.178979 0.378580 0.230177 0.212264 0.159594 0.542602 0.118178 0.179627 0.125206 0.430074 0.151826 0.292894 0.097692 0.709845 0.116956 0.075506 0.148292 0.565912 0.037632 0.248164 0.077951 0.034190 0.855503 0.032356 0.001657 0.001061 0.971877 0.025405 0.001926 0.001084 0.991712 0.005278 0.033031 0.012001 0.057796 0.897171 0.002723 0.002647 0.993348 0.001281 0.003261 0.000963 0.987199 0.008577 0.000611 0.090925 0.074857 0.833608 0.015299 0.978878 0.004949 0.000874 0.013368 0.600902 0.033485 0.352245 0.231949 0.149575 0.118804 0.499672 0.267580 0.186002 0.371242 0.175176 0.264884 0.223483 0.110082 0.401551 0.221365 0.170121 0.179559 0.428955 0.112997 0.692930 0.139981 0.054092 0.460305 0.207883 0.155111 0.176702 Consensus sequence: BHCBCBCCGGGTGGTCYHVHDCH Reverse complement motif 0.176702 0.207883 0.155111 0.460305 0.112997 0.139981 0.692930 0.054092 0.428955 0.170121 0.179559 0.221365 0.401551 0.223483 0.110082 0.264884 0.267580 0.371242 0.186002 0.175176 0.499672 0.149575 0.118804 0.231949 0.013368 0.033485 0.600902 0.352245 0.015299 0.004949 0.978878 0.000874 0.833608 0.090925 0.074857 0.000611 0.003261 0.987199 0.000963 0.008577 0.002723 0.993348 0.002647 0.001281 0.897171 0.012001 0.057796 0.033031 0.001926 0.991712 0.001084 0.005278 0.001657 0.971877 0.001061 0.025405 0.077951 0.855503 0.034190 0.032356 0.148292 0.037632 0.565912 0.248164 0.097692 0.116956 0.709845 0.075506 0.125206 0.151826 0.430074 0.292894 0.159594 0.118178 0.542602 0.179627 0.178979 0.230177 0.378580 0.212264 0.109711 0.117379 0.619514 0.153396 0.294304 0.167287 0.300143 0.238266 0.204923 0.365383 0.208846 0.220848 Consensus sequence: HGDHVHKGACCACCCGGBGBGDB Alignment: HGDHVHKGACCACCCGGBGBGDB--- --ACTGTGACACCACAGTGGAGCACT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v015681_primary Reverse Complement Reverse Complement Forward 7 18 2.547481 Species: Mus musculus Original motif 0.472795 0.179227 0.091251 0.256726 0.036521 0.159743 0.204840 0.598896 0.164582 0.312805 0.221324 0.301289 0.237069 0.249050 0.293048 0.220833 0.401949 0.225181 0.229401 0.143469 0.161422 0.494334 0.252207 0.092036 0.252940 0.177721 0.369400 0.199939 0.119630 0.024651 0.849920 0.005798 0.000962 0.002398 0.990616 0.006023 0.937852 0.027016 0.034535 0.000597 0.008963 0.987756 0.000629 0.002652 0.001584 0.992898 0.002349 0.003169 0.956822 0.027342 0.002484 0.013352 0.009873 0.987759 0.000988 0.001381 0.016397 0.980856 0.000369 0.002378 0.081761 0.758555 0.038572 0.121112 0.371713 0.091838 0.448027 0.088423 0.111617 0.121913 0.683885 0.082585 0.334562 0.102916 0.436488 0.126034 0.210362 0.101261 0.238339 0.450037 0.169041 0.271583 0.320799 0.238576 0.140316 0.049885 0.735236 0.074563 Consensus sequence: HTBVVVDGGACCACCCRGRDBG Reverse complement motif 0.140316 0.735236 0.049885 0.074563 0.169041 0.320799 0.271583 0.238576 0.450037 0.101261 0.238339 0.210362 0.334562 0.436488 0.102916 0.126034 0.111617 0.683885 0.121913 0.082585 0.371713 0.448027 0.091838 0.088423 0.081761 0.038572 0.758555 0.121112 0.016397 0.000369 0.980856 0.002378 0.009873 0.000988 0.987759 0.001381 0.013352 0.027342 0.002484 0.956822 0.001584 0.002349 0.992898 0.003169 0.008963 0.000629 0.987756 0.002652 0.000597 0.027016 0.034535 0.937852 0.000962 0.990616 0.002398 0.006023 0.119630 0.849920 0.024651 0.005798 0.252940 0.369400 0.177721 0.199939 0.161422 0.252207 0.494334 0.092036 0.143469 0.225181 0.229401 0.401949 0.237069 0.293048 0.249050 0.220833 0.164582 0.221324 0.312805 0.301289 0.598896 0.159743 0.204840 0.036521 0.256726 0.179227 0.091251 0.472795 Consensus sequence: CBDMCMGGGTGGTCCHVBVBAH Alignment: CBDMCMGGGTGGTCCHVBVBAH------ ------ACTGTGACACCACAGTGGAGCACT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00045 Mafb_primary Original Motif Original Motif Backward 1 17 3.036695 Species: Mus musculus Original motif 0.420301 0.182299 0.161481 0.235919 0.593201 0.055751 0.202477 0.148571 0.653364 0.017008 0.054630 0.274998 0.339176 0.102943 0.050258 0.507622 0.171557 0.078698 0.267471 0.482273 0.044703 0.033212 0.003920 0.918165 0.010333 0.004451 0.972441 0.012775 0.034026 0.949298 0.004788 0.011889 0.016078 0.008878 0.004007 0.971037 0.020331 0.004077 0.929676 0.045916 0.975739 0.007450 0.005991 0.010819 0.012733 0.887375 0.018700 0.081192 0.259981 0.111885 0.243051 0.385083 0.327677 0.149969 0.094895 0.427459 0.541721 0.105923 0.242224 0.110132 0.258689 0.068305 0.493226 0.179779 0.306041 0.306854 0.168308 0.218798 Consensus sequence: HAAWDTGCTGACDWARH Reverse complement motif 0.306041 0.168308 0.306854 0.218798 0.258689 0.493226 0.068305 0.179779 0.110132 0.105923 0.242224 0.541721 0.427459 0.149969 0.094895 0.327677 0.385083 0.111885 0.243051 0.259981 0.012733 0.018700 0.887375 0.081192 0.010819 0.007450 0.005991 0.975739 0.020331 0.929676 0.004077 0.045916 0.971037 0.008878 0.004007 0.016078 0.034026 0.004788 0.949298 0.011889 0.010333 0.972441 0.004451 0.012775 0.918165 0.033212 0.003920 0.044703 0.482273 0.078698 0.267471 0.171557 0.507622 0.102943 0.050258 0.339176 0.274998 0.017008 0.054630 0.653364 0.148571 0.055751 0.202477 0.593201 0.235919 0.182299 0.161481 0.420301 Consensus sequence: DMTWDGTCAGCADWTTH Alignment: -------HAAWDTGCTGACDWARH AGTGCTCCACTGTGGTGTCACAGT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00055 Hbp1_secondary Original Motif Original Motif Backward 7 17 3.040280 Species: Mus musculus Original motif 0.313621 0.149049 0.200899 0.336432 0.262644 0.147616 0.334882 0.254859 0.175848 0.137857 0.292272 0.394023 0.045910 0.364107 0.180535 0.409448 0.093235 0.718630 0.093516 0.094619 0.095552 0.724866 0.044589 0.134993 0.058227 0.785149 0.029814 0.126810 0.897368 0.023735 0.019064 0.059832 0.043826 0.041750 0.020731 0.893692 0.044268 0.013557 0.014689 0.927487 0.102208 0.026005 0.709573 0.162214 0.058404 0.046118 0.135257 0.760221 0.303689 0.280676 0.320259 0.095375 0.258633 0.262177 0.197029 0.282161 0.564761 0.122466 0.194691 0.118082 0.104738 0.358061 0.310533 0.226668 0.267450 0.230099 0.197859 0.304593 Consensus sequence: DDDYCCCATTGTVHABH Reverse complement motif 0.304593 0.230099 0.197859 0.267450 0.104738 0.310533 0.358061 0.226668 0.118082 0.122466 0.194691 0.564761 0.282161 0.262177 0.197029 0.258633 0.303689 0.320259 0.280676 0.095375 0.760221 0.046118 0.135257 0.058404 0.102208 0.709573 0.026005 0.162214 0.927487 0.013557 0.014689 0.044268 0.893692 0.041750 0.020731 0.043826 0.059832 0.023735 0.019064 0.897368 0.058227 0.029814 0.785149 0.126810 0.095552 0.044589 0.724866 0.134993 0.093235 0.093516 0.718630 0.094619 0.409448 0.364107 0.180535 0.045910 0.394023 0.137857 0.292272 0.175848 0.262644 0.334882 0.147616 0.254859 0.336432 0.149049 0.200899 0.313621 Consensus sequence: HBTHVACAATGGGMDHD Alignment: -------DDDYCCCATTGTVHABH AGTGCTCCACTGTGGTGTCACAGT------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00031 Zbtb3_primary Original Motif Reverse Complement Backward 8 17 3.043475 Species: Mus musculus Original motif 0.401190 0.144405 0.268531 0.185874 0.430224 0.168519 0.221247 0.180011 0.172575 0.268499 0.274136 0.284789 0.150971 0.297110 0.290868 0.261051 0.133421 0.282842 0.434718 0.149019 0.042798 0.941105 0.001785 0.014312 0.890788 0.002551 0.103316 0.003345 0.001887 0.951368 0.043722 0.003023 0.011633 0.002218 0.002269 0.983880 0.003597 0.003728 0.984819 0.007856 0.002946 0.903520 0.072457 0.021077 0.908487 0.057072 0.018256 0.016185 0.076237 0.329864 0.228896 0.365003 0.144926 0.162981 0.177370 0.514722 0.124970 0.327876 0.295814 0.251341 0.144592 0.313887 0.301912 0.239609 0.108463 0.241747 0.350296 0.299494 Consensus sequence: DDBBBCACTGCABTBBB Reverse complement motif 0.108463 0.350296 0.241747 0.299494 0.144592 0.301912 0.313887 0.239609 0.124970 0.295814 0.327876 0.251341 0.514722 0.162981 0.177370 0.144926 0.365003 0.329864 0.228896 0.076237 0.016185 0.057072 0.018256 0.908487 0.002946 0.072457 0.903520 0.021077 0.003597 0.984819 0.003728 0.007856 0.983880 0.002218 0.002269 0.011633 0.001887 0.043722 0.951368 0.003023 0.003345 0.002551 0.103316 0.890788 0.042798 0.001785 0.941105 0.014312 0.133421 0.434718 0.282842 0.149019 0.150971 0.290868 0.297110 0.261051 0.284789 0.268499 0.274136 0.172575 0.180011 0.168519 0.221247 0.430224 0.185874 0.144405 0.268531 0.401190 Consensus sequence: BBBAVTGCAGTGBBVDD Alignment: -------DDBBBCACTGCABTBBB AGTGCTCCACTGTGGTGTCACAGT------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00067 Lef1_primary Reverse Complement Reverse Complement Forward 4 17 3.046621 Species: Mus musculus Original motif 0.281920 0.214207 0.278077 0.225796 0.325566 0.151435 0.298797 0.224202 0.290253 0.145824 0.243443 0.320480 0.069286 0.404645 0.141614 0.384454 0.070044 0.621448 0.142647 0.165862 0.007295 0.907657 0.038110 0.046938 0.015587 0.018273 0.000658 0.965482 0.005527 0.005886 0.001905 0.986682 0.024512 0.001189 0.001344 0.972955 0.007384 0.025221 0.952270 0.015125 0.966438 0.000630 0.002693 0.030239 0.082252 0.001173 0.001495 0.915080 0.030255 0.677155 0.275323 0.017267 0.199467 0.118815 0.056814 0.624905 0.345445 0.169597 0.216831 0.268127 0.278106 0.150864 0.173693 0.397336 0.251834 0.339733 0.219703 0.188730 Consensus sequence: DDDYCCTTTGATCTDDV Reverse complement motif 0.251834 0.219703 0.339733 0.188730 0.397336 0.150864 0.173693 0.278106 0.268127 0.169597 0.216831 0.345445 0.624905 0.118815 0.056814 0.199467 0.030255 0.275323 0.677155 0.017267 0.915080 0.001173 0.001495 0.082252 0.030239 0.000630 0.002693 0.966438 0.007384 0.952270 0.025221 0.015125 0.972955 0.001189 0.001344 0.024512 0.986682 0.005886 0.001905 0.005527 0.965482 0.018273 0.000658 0.015587 0.007295 0.038110 0.907657 0.046938 0.070044 0.142647 0.621448 0.165862 0.069286 0.141614 0.404645 0.384454 0.320480 0.145824 0.243443 0.290253 0.224202 0.151435 0.298797 0.325566 0.225796 0.214207 0.278077 0.281920 Consensus sequence: VDDAGATCAAAGGKDDD Alignment: VDDAGATCAAAGGKDDD------- ---ACTGTGACACCACAGTGGAGCACT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00070 Gcm1_secondary Original Motif Reverse Complement Forward 2 17 3.046628 Species: Mus musculus Original motif 0.298360 0.124865 0.240783 0.335992 0.184300 0.174617 0.373392 0.267691 0.150632 0.435099 0.254062 0.160207 0.212569 0.220347 0.370971 0.196113 0.258171 0.316689 0.186896 0.238243 0.872371 0.051703 0.070791 0.005135 0.011560 0.017672 0.009746 0.961022 0.888546 0.042964 0.061758 0.006732 0.071365 0.009982 0.801505 0.117148 0.010657 0.014961 0.949286 0.025096 0.004496 0.009941 0.978381 0.007182 0.005645 0.010294 0.972682 0.011378 0.499895 0.152322 0.335875 0.011908 0.109410 0.346384 0.380529 0.163677 0.371764 0.096182 0.457999 0.074056 0.450207 0.392208 0.065686 0.091898 0.104224 0.228467 0.391473 0.275836 Consensus sequence: DDBVHATAGGGGRBRMB Reverse complement motif 0.104224 0.391473 0.228467 0.275836 0.091898 0.392208 0.065686 0.450207 0.371764 0.457999 0.096182 0.074056 0.109410 0.380529 0.346384 0.163677 0.011908 0.152322 0.335875 0.499895 0.005645 0.972682 0.010294 0.011378 0.004496 0.978381 0.009941 0.007182 0.010657 0.949286 0.014961 0.025096 0.071365 0.801505 0.009982 0.117148 0.006732 0.042964 0.061758 0.888546 0.961022 0.017672 0.009746 0.011560 0.005135 0.051703 0.070791 0.872371 0.258171 0.186896 0.316689 0.238243 0.212569 0.370971 0.220347 0.196113 0.150632 0.254062 0.435099 0.160207 0.184300 0.373392 0.174617 0.267691 0.335992 0.124865 0.240783 0.298360 Consensus sequence: BYMBKCCCCTATDVBHD Alignment: DDBVHATAGGGGRBRMB------- -AGTGCTCCACTGTGGTGTCACAGT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00148 Hdx Reverse Complement Original Motif Backward 8 17 3.049068 Species: Mus musculus Original motif 0.311640 0.203273 0.213311 0.271776 0.341055 0.177799 0.257310 0.223836 0.047573 0.089551 0.516163 0.346713 0.195776 0.119326 0.352322 0.332576 0.295379 0.306027 0.157574 0.241020 0.213770 0.018770 0.724927 0.042533 0.702123 0.228608 0.050137 0.019133 0.826735 0.011735 0.061646 0.099884 0.920071 0.005458 0.026253 0.048218 0.018655 0.024240 0.028915 0.928190 0.029929 0.896758 0.043300 0.030013 0.864548 0.044943 0.013744 0.076766 0.177175 0.216931 0.155519 0.450375 0.228403 0.325164 0.203649 0.242785 0.140135 0.298665 0.306153 0.255047 0.338324 0.345500 0.057864 0.258313 0.402538 0.228867 0.191777 0.176818 Consensus sequence: DDKDHGAAATCAHHBHV Reverse complement motif 0.176818 0.228867 0.191777 0.402538 0.338324 0.057864 0.345500 0.258313 0.140135 0.306153 0.298665 0.255047 0.228403 0.203649 0.325164 0.242785 0.450375 0.216931 0.155519 0.177175 0.076766 0.044943 0.013744 0.864548 0.029929 0.043300 0.896758 0.030013 0.928190 0.024240 0.028915 0.018655 0.048218 0.005458 0.026253 0.920071 0.099884 0.011735 0.061646 0.826735 0.019133 0.228608 0.050137 0.702123 0.213770 0.724927 0.018770 0.042533 0.295379 0.157574 0.306027 0.241020 0.195776 0.352322 0.119326 0.332576 0.047573 0.516163 0.089551 0.346713 0.223836 0.177799 0.257310 0.341055 0.271776 0.203273 0.213311 0.311640 Consensus sequence: BDBDHTGATTTCDHYDD Alignment: -------BDBDHTGATTTCDHYDD ACTGTGACACCACAGTGGAGCACT------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 2 Motif ID: 28 Motif name: ssGCkTGCssk Original motif 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 0.500000 0.500000 Consensus sequence: SSGCKTGCSSK Reserve complement motif 0.000000 0.500000 0.000000 0.500000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.000000 0.500000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 Consensus sequence: YSSGCAYGCSS ************************************************************************ Best Matches for Motif ID 28 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00003 E2F3_primary Original Motif Original Motif Backward 1 11 0.004633 Species: Mus musculus Original motif 0.358868 0.212371 0.263565 0.165196 0.303014 0.253580 0.111217 0.332189 0.420933 0.110957 0.210958 0.257152 0.769724 0.062662 0.032155 0.135459 0.311973 0.051319 0.408669 0.228039 0.097916 0.141153 0.719697 0.041234 0.009980 0.014044 0.971955 0.004021 0.014425 0.974798 0.008373 0.002404 0.000891 0.013228 0.983966 0.001915 0.000827 0.938560 0.059548 0.001065 0.007071 0.102005 0.872378 0.018546 0.020099 0.897653 0.014151 0.068097 0.114080 0.346724 0.409037 0.130159 0.331439 0.279041 0.085030 0.304491 0.319846 0.136792 0.043641 0.499722 Consensus sequence: VHDADGGCGCGCSHW Reverse complement motif 0.499722 0.136792 0.043641 0.319846 0.304491 0.279041 0.085030 0.331439 0.114080 0.409037 0.346724 0.130159 0.020099 0.014151 0.897653 0.068097 0.007071 0.872378 0.102005 0.018546 0.000827 0.059548 0.938560 0.001065 0.000891 0.983966 0.013228 0.001915 0.014425 0.008373 0.974798 0.002404 0.009980 0.971955 0.014044 0.004021 0.097916 0.719697 0.141153 0.041234 0.311973 0.408669 0.051319 0.228039 0.135459 0.062662 0.032155 0.769724 0.257152 0.110957 0.210958 0.420933 0.332189 0.253580 0.111217 0.303014 0.165196 0.212371 0.263565 0.358868 Consensus sequence: WHSGCGCGCCHTDHB Alignment: VHDADGGCGCGCSHW ----SSGCKTGCSSK ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00094 Zfp128_primary Original Motif Original Motif Backward 3 11 0.004821 Species: Mus musculus Original motif 0.194238 0.221898 0.264007 0.319857 0.288200 0.308426 0.101010 0.302365 0.285270 0.161574 0.132609 0.420548 0.252760 0.126943 0.276148 0.344149 0.220972 0.026248 0.366825 0.385955 0.016419 0.006845 0.879910 0.096825 0.185479 0.004691 0.730552 0.079278 0.003651 0.988022 0.001666 0.006661 0.067428 0.001276 0.928472 0.002824 0.004284 0.002407 0.001922 0.991387 0.990094 0.001414 0.004941 0.003550 0.005452 0.989161 0.001844 0.003543 0.149564 0.620887 0.192873 0.036677 0.100768 0.559974 0.113427 0.225831 0.177258 0.260019 0.181462 0.381261 0.425243 0.223937 0.143942 0.206878 0.451743 0.122626 0.218322 0.207309 Consensus sequence: BHHDKGGCGTACCCBHD Reverse complement motif 0.207309 0.122626 0.218322 0.451743 0.206878 0.223937 0.143942 0.425243 0.381261 0.260019 0.181462 0.177258 0.100768 0.113427 0.559974 0.225831 0.149564 0.192873 0.620887 0.036677 0.005452 0.001844 0.989161 0.003543 0.003550 0.001414 0.004941 0.990094 0.991387 0.002407 0.001922 0.004284 0.067428 0.928472 0.001276 0.002824 0.003651 0.001666 0.988022 0.006661 0.185479 0.730552 0.004691 0.079278 0.016419 0.879910 0.006845 0.096825 0.385955 0.026248 0.366825 0.220972 0.344149 0.126943 0.276148 0.252760 0.420548 0.161574 0.132609 0.285270 0.288200 0.101010 0.308426 0.302365 0.319857 0.221898 0.264007 0.194238 Consensus sequence: DHVGGGTACGCCRDHDV Alignment: BHHDKGGCGTACCCBHD ----SSGCKTGCSSK-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00035 Hic1_secondary Reverse Complement Reverse Complement Backward 1 11 0.005628 Species: Mus musculus Original motif 0.204898 0.149951 0.363373 0.281778 0.112946 0.243700 0.437938 0.205417 0.205232 0.182319 0.383143 0.229305 0.242063 0.152491 0.296426 0.309020 0.312922 0.028523 0.585026 0.073529 0.006754 0.011178 0.005346 0.976723 0.127589 0.005562 0.859436 0.007414 0.010046 0.974694 0.007001 0.008259 0.010262 0.974769 0.006069 0.008899 0.015122 0.966101 0.007970 0.010807 0.556511 0.167389 0.114635 0.161465 0.586459 0.044786 0.073450 0.295305 0.297710 0.194666 0.223655 0.283969 0.303202 0.250809 0.206475 0.239514 0.279338 0.160655 0.314457 0.245550 0.266477 0.266890 0.299970 0.166662 Consensus sequence: DBDDRTGCCCAWDHDV Reverse complement motif 0.266477 0.299970 0.266890 0.166662 0.279338 0.314457 0.160655 0.245550 0.239514 0.250809 0.206475 0.303202 0.283969 0.194666 0.223655 0.297710 0.295305 0.044786 0.073450 0.586459 0.161465 0.167389 0.114635 0.556511 0.015122 0.007970 0.966101 0.010807 0.010262 0.006069 0.974769 0.008899 0.010046 0.007001 0.974694 0.008259 0.127589 0.859436 0.005562 0.007414 0.976723 0.011178 0.005346 0.006754 0.312922 0.585026 0.028523 0.073529 0.309020 0.152491 0.296426 0.242063 0.205232 0.383143 0.182319 0.229305 0.112946 0.437938 0.243700 0.205417 0.204898 0.363373 0.149951 0.281778 Consensus sequence: VHHDWTGGGCAMDHBH Alignment: VHHDWTGGGCAMDHBH -----YSSGCAYGCSS ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00065 Zfp161_primary Original Motif Original Motif Forward 3 11 0.005960 Species: Mus musculus Original motif 0.142624 0.111294 0.283688 0.462394 0.221170 0.081404 0.499138 0.198288 0.290070 0.042114 0.604904 0.062912 0.109755 0.559510 0.215454 0.115281 0.111745 0.022727 0.850580 0.014948 0.015907 0.942291 0.005561 0.036241 0.088509 0.003729 0.902805 0.004957 0.004957 0.902805 0.003729 0.088509 0.036241 0.005561 0.942291 0.015907 0.014948 0.850580 0.022727 0.111745 0.325358 0.049424 0.519652 0.105566 0.062912 0.604904 0.042114 0.290070 0.214335 0.388248 0.125912 0.271505 0.128984 0.372787 0.092390 0.405839 0.269058 0.098422 0.484016 0.148504 0.362176 0.156050 0.188642 0.293132 Consensus sequence: DDGCGCGCGCRCHYRD Reverse complement motif 0.293132 0.156050 0.188642 0.362176 0.269058 0.484016 0.098422 0.148504 0.405839 0.372787 0.092390 0.128984 0.214335 0.125912 0.388248 0.271505 0.062912 0.042114 0.604904 0.290070 0.325358 0.519652 0.049424 0.105566 0.014948 0.022727 0.850580 0.111745 0.036241 0.942291 0.005561 0.015907 0.004957 0.003729 0.902805 0.088509 0.088509 0.902805 0.003729 0.004957 0.015907 0.005561 0.942291 0.036241 0.111745 0.850580 0.022727 0.014948 0.109755 0.215454 0.559510 0.115281 0.290070 0.604904 0.042114 0.062912 0.221170 0.499138 0.081404 0.198288 0.462394 0.111294 0.283688 0.142624 Consensus sequence: DMMDGMGCGCGCGCHD Alignment: DDGCGCGCGCRCHYRD --SSGCKTGCSSK--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00001 E2F2_primary Original Motif Reverse Complement Forward 2 11 0.008217 Species: Mus musculus Original motif 0.305970 0.214348 0.269312 0.210370 0.279551 0.218276 0.140576 0.361597 0.391304 0.162239 0.193916 0.252541 0.701667 0.102206 0.041580 0.154547 0.427655 0.068368 0.324706 0.179271 0.144368 0.191048 0.609772 0.054812 0.014295 0.020613 0.958397 0.006695 0.019783 0.962982 0.013403 0.003831 0.001189 0.023882 0.973231 0.001697 0.001343 0.919840 0.077728 0.001089 0.011293 0.097945 0.865194 0.025568 0.039106 0.864604 0.025189 0.071100 0.147663 0.328105 0.407118 0.117115 0.462769 0.203531 0.107986 0.225714 0.293396 0.229650 0.082819 0.394135 Consensus sequence: VHDARGGCGCGCVHH Reverse complement motif 0.394135 0.229650 0.082819 0.293396 0.225714 0.203531 0.107986 0.462769 0.147663 0.407118 0.328105 0.117115 0.039106 0.025189 0.864604 0.071100 0.011293 0.865194 0.097945 0.025568 0.001343 0.077728 0.919840 0.001089 0.001189 0.973231 0.023882 0.001697 0.019783 0.013403 0.962982 0.003831 0.014295 0.958397 0.020613 0.006695 0.144368 0.609772 0.191048 0.054812 0.179271 0.068368 0.324706 0.427655 0.154547 0.102206 0.041580 0.701667 0.252541 0.162239 0.193916 0.391304 0.361597 0.218276 0.140576 0.279551 0.210370 0.214348 0.269312 0.305970 Consensus sequence: HHVGCGCGCCKTDHB Alignment: HHVGCGCGCCKTDHB -SSGCKTGCSSK--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00060 Max_secondary Original Motif Reverse Complement Backward 1 11 0.010926 Species: Mus musculus Original motif 0.127991 0.202889 0.399822 0.269298 0.156940 0.244015 0.182364 0.416681 0.046494 0.050598 0.744311 0.158596 0.196142 0.365183 0.183389 0.255286 0.019306 0.946805 0.015210 0.018680 0.924839 0.022113 0.027620 0.025428 0.007478 0.672138 0.027789 0.292595 0.046702 0.026044 0.906146 0.021107 0.117335 0.610863 0.025132 0.246670 0.044431 0.053581 0.722748 0.179240 0.543713 0.149809 0.190030 0.116447 0.241148 0.722386 0.022547 0.013919 0.265412 0.113032 0.270602 0.350954 0.226186 0.143504 0.332746 0.297564 Consensus sequence: BBGHCACGCGACDD Reverse complement motif 0.226186 0.332746 0.143504 0.297564 0.350954 0.113032 0.270602 0.265412 0.241148 0.022547 0.722386 0.013919 0.116447 0.149809 0.190030 0.543713 0.044431 0.722748 0.053581 0.179240 0.117335 0.025132 0.610863 0.246670 0.046702 0.906146 0.026044 0.021107 0.007478 0.027789 0.672138 0.292595 0.025428 0.022113 0.027620 0.924839 0.019306 0.015210 0.946805 0.018680 0.196142 0.183389 0.365183 0.255286 0.046494 0.744311 0.050598 0.158596 0.416681 0.244015 0.182364 0.156940 0.127991 0.399822 0.202889 0.269298 Consensus sequence: HDGTCGCGTGDCVB Alignment: HDGTCGCGTGDCVB ---SSGCKTGCSSK ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00527 Foxn4_secondary Reverse Complement Original Motif Forward 4 11 0.015020 Species: Mus musculus Original motif 0.298336 0.418632 0.208054 0.074978 0.289907 0.015608 0.457100 0.237385 0.273583 0.077889 0.107860 0.540668 0.184954 0.161611 0.384390 0.269045 0.521826 0.156340 0.089019 0.232815 0.356716 0.131104 0.394857 0.117323 0.266669 0.108765 0.505273 0.119293 0.020778 0.047199 0.919524 0.012500 0.948536 0.018775 0.008113 0.024576 0.010822 0.964042 0.014701 0.010434 0.007428 0.019505 0.966351 0.006717 0.010025 0.975678 0.008648 0.005649 0.043796 0.120935 0.742979 0.092289 0.008252 0.250704 0.541132 0.199913 0.474428 0.044681 0.134430 0.346461 0.146597 0.421317 0.143166 0.288920 0.020540 0.181479 0.553811 0.244170 0.129612 0.173360 0.535219 0.161808 0.506084 0.158156 0.130983 0.204776 0.054872 0.103043 0.545792 0.296293 0.389882 0.171037 0.164162 0.274918 0.225861 0.314031 0.288872 0.171237 Consensus sequence: VDWDARRGACGCGGWHGGAKHV Reverse complement motif 0.225861 0.288872 0.314031 0.171237 0.274918 0.171037 0.164162 0.389882 0.054872 0.545792 0.103043 0.296293 0.204776 0.158156 0.130983 0.506084 0.129612 0.535219 0.173360 0.161808 0.020540 0.553811 0.181479 0.244170 0.146597 0.143166 0.421317 0.288920 0.346461 0.044681 0.134430 0.474428 0.008252 0.541132 0.250704 0.199913 0.043796 0.742979 0.120935 0.092289 0.010025 0.008648 0.975678 0.005649 0.007428 0.966351 0.019505 0.006717 0.010822 0.014701 0.964042 0.010434 0.024576 0.018775 0.008113 0.948536 0.020778 0.919524 0.047199 0.012500 0.266669 0.505273 0.108765 0.119293 0.356716 0.394857 0.131104 0.117323 0.232815 0.156340 0.089019 0.521826 0.184954 0.384390 0.161611 0.269045 0.540668 0.077889 0.107860 0.273583 0.289907 0.457100 0.015608 0.237385 0.298336 0.208054 0.418632 0.074978 Consensus sequence: VHYTCCDWCCGCGTCMMTHWHV Alignment: VDWDARRGACGCGGWHGGAKHV ---YSSGCAYGCSS-------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00002 Sp4_secondary Reverse Complement Reverse Complement Forward 2 11 0.016078 Species: Mus musculus Original motif 0.146334 0.312326 0.244281 0.297060 0.493155 0.092609 0.162506 0.251729 0.503593 0.059863 0.077561 0.358984 0.763321 0.015264 0.213114 0.008301 0.012415 0.025932 0.945502 0.016151 0.006713 0.015221 0.950098 0.027968 0.062415 0.834303 0.054500 0.048782 0.011010 0.020677 0.928821 0.039493 0.012785 0.024162 0.145822 0.817231 0.133595 0.033962 0.787876 0.044567 0.140697 0.180481 0.428253 0.250570 0.036281 0.806412 0.033510 0.123797 0.157910 0.408607 0.122427 0.311055 0.292185 0.260017 0.197515 0.250283 0.251107 0.124480 0.359447 0.264967 Consensus sequence: BDWAGGCGTGBCHHD Reverse complement motif 0.251107 0.359447 0.124480 0.264967 0.250283 0.260017 0.197515 0.292185 0.157910 0.122427 0.408607 0.311055 0.036281 0.033510 0.806412 0.123797 0.140697 0.428253 0.180481 0.250570 0.133595 0.787876 0.033962 0.044567 0.817231 0.024162 0.145822 0.012785 0.011010 0.928821 0.020677 0.039493 0.062415 0.054500 0.834303 0.048782 0.006713 0.950098 0.015221 0.027968 0.012415 0.945502 0.025932 0.016151 0.008301 0.015264 0.213114 0.763321 0.358984 0.059863 0.077561 0.503593 0.251729 0.092609 0.162506 0.493155 0.146334 0.244281 0.312326 0.297060 Consensus sequence: HHDGBCACGCCTWDB Alignment: HHDGBCACGCCTWDB -YSSGCAYGCSS--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00526 Foxn1_primary Original Motif Reverse Complement Backward 3 11 0.017160 Species: Mus musculus Original motif 0.456612 0.057181 0.078281 0.407926 0.460529 0.185506 0.083106 0.270859 0.445717 0.179510 0.239355 0.135417 0.116339 0.145186 0.275331 0.463144 0.239398 0.142078 0.480004 0.138520 0.355157 0.217877 0.284296 0.142670 0.318602 0.444835 0.153321 0.083243 0.609569 0.055866 0.280349 0.054216 0.062297 0.769824 0.027844 0.140035 0.151868 0.019245 0.803188 0.025699 0.011842 0.952534 0.017959 0.017665 0.017665 0.017959 0.952534 0.011842 0.025699 0.803188 0.019245 0.151868 0.140035 0.027844 0.769824 0.062297 0.054216 0.280349 0.055866 0.609569 0.013084 0.624655 0.177956 0.184305 0.287647 0.183527 0.295753 0.233074 0.042309 0.345931 0.198458 0.413301 0.338138 0.266033 0.045367 0.350462 0.302850 0.155320 0.074662 0.467168 0.240926 0.068901 0.283055 0.407118 0.409954 0.183157 0.154186 0.252704 Consensus sequence: WHVBVVMACGCGCGTCDYHWDH Reverse complement motif 0.252704 0.183157 0.154186 0.409954 0.407118 0.068901 0.283055 0.240926 0.467168 0.155320 0.074662 0.302850 0.350462 0.266033 0.045367 0.338138 0.413301 0.345931 0.198458 0.042309 0.287647 0.295753 0.183527 0.233074 0.013084 0.177956 0.624655 0.184305 0.609569 0.280349 0.055866 0.054216 0.140035 0.769824 0.027844 0.062297 0.025699 0.019245 0.803188 0.151868 0.017665 0.952534 0.017959 0.011842 0.011842 0.017959 0.952534 0.017665 0.151868 0.803188 0.019245 0.025699 0.062297 0.027844 0.769824 0.140035 0.054216 0.055866 0.280349 0.609569 0.318602 0.153321 0.444835 0.083243 0.142670 0.217877 0.284296 0.355157 0.239398 0.480004 0.142078 0.138520 0.463144 0.145186 0.275331 0.116339 0.135417 0.179510 0.239355 0.445717 0.270859 0.185506 0.083106 0.460529 0.407926 0.057181 0.078281 0.456612 Consensus sequence: HDWHMHGACGCGCGTRBVVBHW Alignment: HDWHMHGACGCGCGTRBVVBHW ---------SSGCKTGCSSK-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00528 Foxm1_secondary Reverse Complement Reverse Complement Backward 6 11 0.017271 Species: Mus musculus Original motif 0.399785 0.446658 0.111435 0.042122 0.535175 0.103991 0.089706 0.271128 0.078171 0.387987 0.375083 0.158759 0.309001 0.519142 0.070618 0.101239 0.201844 0.255818 0.323149 0.219190 0.534101 0.109845 0.235026 0.121028 0.656038 0.037473 0.261484 0.045006 0.315713 0.164290 0.471815 0.048182 0.651960 0.009412 0.328237 0.010391 0.937365 0.017313 0.007516 0.037807 0.019983 0.044238 0.012387 0.923392 0.061195 0.021485 0.881645 0.035675 0.017521 0.952998 0.013139 0.016342 0.254160 0.029735 0.493023 0.223082 0.239200 0.593324 0.114503 0.052973 0.610822 0.071539 0.099169 0.218470 0.166610 0.389712 0.204400 0.239278 0.227752 0.361626 0.178497 0.232125 0.537030 0.182466 0.026035 0.254470 0.235902 0.151006 0.043788 0.569304 0.081851 0.250397 0.590059 0.077693 0.340417 0.189613 0.272075 0.197895 Consensus sequence: MWSMBAARRATGCDCABHATGD Reverse complement motif 0.197895 0.189613 0.272075 0.340417 0.081851 0.590059 0.250397 0.077693 0.569304 0.151006 0.043788 0.235902 0.254470 0.182466 0.026035 0.537030 0.227752 0.178497 0.361626 0.232125 0.166610 0.204400 0.389712 0.239278 0.218470 0.071539 0.099169 0.610822 0.239200 0.114503 0.593324 0.052973 0.254160 0.493023 0.029735 0.223082 0.017521 0.013139 0.952998 0.016342 0.061195 0.881645 0.021485 0.035675 0.923392 0.044238 0.012387 0.019983 0.037807 0.017313 0.007516 0.937365 0.010391 0.009412 0.328237 0.651960 0.315713 0.471815 0.164290 0.048182 0.045006 0.037473 0.261484 0.656038 0.121028 0.109845 0.235026 0.534101 0.201844 0.323149 0.255818 0.219190 0.309001 0.070618 0.519142 0.101239 0.078171 0.375083 0.387987 0.158759 0.271128 0.103991 0.089706 0.535175 0.399785 0.111435 0.446658 0.042122 Consensus sequence: DCATDBTGHGCATKMTTBRSWR Alignment: DCATDBTGHGCATKMTTBRSWR ------YSSGCAYGCSS----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 2 Motif ID: 29 Motif name: cCGCGGrCACG Original motif 0.000000 0.600000 0.200000 0.200000 0.000000 0.800000 0.000000 0.200000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.600000 0.000000 0.400000 0.000000 0.000000 0.800000 0.200000 0.000000 0.800000 0.000000 0.200000 0.000000 0.000000 0.800000 0.200000 0.000000 0.200000 0.000000 0.800000 0.000000 Consensus sequence: CCGCGGRCACG Reserve complement motif 0.200000 0.800000 0.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.200000 0.800000 0.000000 0.000000 0.000000 0.400000 0.600000 0.000000 0.800000 0.200000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.800000 0.200000 0.000000 0.200000 0.600000 0.200000 Consensus sequence: CGTGKCCGCGG ************************************************************************ Best Matches for Motif ID 29 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00065 Zfp161_primary Original Motif Original Motif Backward 2 11 0.022021 Species: Mus musculus Original motif 0.142624 0.111294 0.283688 0.462394 0.221170 0.081404 0.499138 0.198288 0.290070 0.042114 0.604904 0.062912 0.109755 0.559510 0.215454 0.115281 0.111745 0.022727 0.850580 0.014948 0.015907 0.942291 0.005561 0.036241 0.088509 0.003729 0.902805 0.004957 0.004957 0.902805 0.003729 0.088509 0.036241 0.005561 0.942291 0.015907 0.014948 0.850580 0.022727 0.111745 0.325358 0.049424 0.519652 0.105566 0.062912 0.604904 0.042114 0.290070 0.214335 0.388248 0.125912 0.271505 0.128984 0.372787 0.092390 0.405839 0.269058 0.098422 0.484016 0.148504 0.362176 0.156050 0.188642 0.293132 Consensus sequence: DDGCGCGCGCRCHYRD Reverse complement motif 0.293132 0.156050 0.188642 0.362176 0.269058 0.484016 0.098422 0.148504 0.405839 0.372787 0.092390 0.128984 0.214335 0.125912 0.388248 0.271505 0.062912 0.042114 0.604904 0.290070 0.325358 0.519652 0.049424 0.105566 0.014948 0.022727 0.850580 0.111745 0.036241 0.942291 0.005561 0.015907 0.004957 0.003729 0.902805 0.088509 0.088509 0.902805 0.003729 0.004957 0.015907 0.005561 0.942291 0.036241 0.111745 0.850580 0.022727 0.014948 0.109755 0.215454 0.559510 0.115281 0.290070 0.604904 0.042114 0.062912 0.221170 0.499138 0.081404 0.198288 0.462394 0.111294 0.283688 0.142624 Consensus sequence: DMMDGMGCGCGCGCHD Alignment: DDGCGCGCGCRCHYRD ----CCGCGGRCACG- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00527 Foxn4_secondary Reverse Complement Reverse Complement Backward 9 11 0.024575 Species: Mus musculus Original motif 0.298336 0.418632 0.208054 0.074978 0.289907 0.015608 0.457100 0.237385 0.273583 0.077889 0.107860 0.540668 0.184954 0.161611 0.384390 0.269045 0.521826 0.156340 0.089019 0.232815 0.356716 0.131104 0.394857 0.117323 0.266669 0.108765 0.505273 0.119293 0.020778 0.047199 0.919524 0.012500 0.948536 0.018775 0.008113 0.024576 0.010822 0.964042 0.014701 0.010434 0.007428 0.019505 0.966351 0.006717 0.010025 0.975678 0.008648 0.005649 0.043796 0.120935 0.742979 0.092289 0.008252 0.250704 0.541132 0.199913 0.474428 0.044681 0.134430 0.346461 0.146597 0.421317 0.143166 0.288920 0.020540 0.181479 0.553811 0.244170 0.129612 0.173360 0.535219 0.161808 0.506084 0.158156 0.130983 0.204776 0.054872 0.103043 0.545792 0.296293 0.389882 0.171037 0.164162 0.274918 0.225861 0.314031 0.288872 0.171237 Consensus sequence: VDWDARRGACGCGGWHGGAKHV Reverse complement motif 0.225861 0.288872 0.314031 0.171237 0.274918 0.171037 0.164162 0.389882 0.054872 0.545792 0.103043 0.296293 0.204776 0.158156 0.130983 0.506084 0.129612 0.535219 0.173360 0.161808 0.020540 0.553811 0.181479 0.244170 0.146597 0.143166 0.421317 0.288920 0.346461 0.044681 0.134430 0.474428 0.008252 0.541132 0.250704 0.199913 0.043796 0.742979 0.120935 0.092289 0.010025 0.008648 0.975678 0.005649 0.007428 0.966351 0.019505 0.006717 0.010822 0.014701 0.964042 0.010434 0.024576 0.018775 0.008113 0.948536 0.020778 0.919524 0.047199 0.012500 0.266669 0.505273 0.108765 0.119293 0.356716 0.394857 0.131104 0.117323 0.232815 0.156340 0.089019 0.521826 0.184954 0.384390 0.161611 0.269045 0.540668 0.077889 0.107860 0.273583 0.289907 0.457100 0.015608 0.237385 0.298336 0.208054 0.418632 0.074978 Consensus sequence: VHYTCCDWCCGCGTCMMTHWHV Alignment: VHYTCCDWCCGCGTCMMTHWHV ---CGTGKCCGCGG-------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00042 Gm397_second Original Motif Original Motif Forward 3 11 0.027937 Species: Mus musculus Original motif 0.360404 0.193218 0.248888 0.197490 0.286498 0.224597 0.426555 0.062349 0.347032 0.440548 0.033161 0.179259 0.337062 0.193658 0.385751 0.083529 0.108793 0.005723 0.878300 0.007184 0.015151 0.973406 0.009324 0.002118 0.972117 0.003915 0.019783 0.004185 0.010144 0.980912 0.003106 0.005839 0.974864 0.007532 0.015914 0.001691 0.012441 0.939195 0.029256 0.019108 0.759620 0.106164 0.073819 0.060397 0.157234 0.818234 0.007449 0.017083 0.050076 0.063608 0.505171 0.381144 0.131903 0.538163 0.124608 0.205325 0.367623 0.286526 0.240931 0.104919 0.357798 0.317606 0.097711 0.226885 Consensus sequence: DVMVGCACACACKCVH Reverse complement motif 0.226885 0.317606 0.097711 0.357798 0.104919 0.286526 0.240931 0.367623 0.131903 0.124608 0.538163 0.205325 0.050076 0.505171 0.063608 0.381144 0.157234 0.007449 0.818234 0.017083 0.060397 0.106164 0.073819 0.759620 0.012441 0.029256 0.939195 0.019108 0.001691 0.007532 0.015914 0.974864 0.010144 0.003106 0.980912 0.005839 0.004185 0.003915 0.019783 0.972117 0.015151 0.009324 0.973406 0.002118 0.108793 0.878300 0.005723 0.007184 0.337062 0.385751 0.193658 0.083529 0.347032 0.033161 0.440548 0.179259 0.286498 0.426555 0.224597 0.062349 0.197490 0.193218 0.248888 0.360404 Consensus sequence: HBGYGTGTGTGCVRVD Alignment: DVMVGCACACACKCVH --CCGCGGRCACG--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00007 Egr1_primary Original Motif Reverse Complement Forward 2 11 0.028538 Species: Mus musculus Original motif 0.211547 0.282708 0.203472 0.302273 0.141988 0.722437 0.054854 0.080721 0.032605 0.877172 0.012432 0.077792 0.115126 0.070606 0.781290 0.032979 0.003516 0.990021 0.002265 0.004198 0.004715 0.982482 0.009897 0.002906 0.001627 0.975937 0.001662 0.020774 0.262352 0.731732 0.002730 0.003187 0.005890 0.985756 0.002081 0.006273 0.022893 0.090460 0.649322 0.237324 0.023038 0.859949 0.037913 0.079101 0.567633 0.057394 0.166792 0.208181 0.176597 0.331265 0.125308 0.366830 0.183049 0.183774 0.226793 0.406384 Consensus sequence: HCCGCCCCCGCAHB Reverse complement motif 0.406384 0.183774 0.226793 0.183049 0.366830 0.331265 0.125308 0.176597 0.208181 0.057394 0.166792 0.567633 0.023038 0.037913 0.859949 0.079101 0.022893 0.649322 0.090460 0.237324 0.005890 0.002081 0.985756 0.006273 0.262352 0.002730 0.731732 0.003187 0.001627 0.001662 0.975937 0.020774 0.004715 0.009897 0.982482 0.002906 0.003516 0.002265 0.990021 0.004198 0.115126 0.781290 0.070606 0.032979 0.032605 0.012432 0.877172 0.077792 0.141988 0.054854 0.722437 0.080721 0.302273 0.282708 0.203472 0.211547 Consensus sequence: VHTGCGGGGGCGGH Alignment: VHTGCGGGGGCGGH -CCGCGGRCACG-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00050 Bhlhb2_secondary Original Motif Reverse Complement Forward 9 11 0.033538 Species: Mus musculus Original motif 0.120938 0.344851 0.124072 0.410138 0.220931 0.169844 0.422396 0.186829 0.127752 0.260812 0.103811 0.507625 0.140641 0.405473 0.287668 0.166218 0.296957 0.155579 0.301094 0.246370 0.219647 0.287193 0.154072 0.339087 0.049294 0.026059 0.121789 0.802859 0.520042 0.289284 0.173423 0.017251 0.049190 0.943472 0.004308 0.003030 0.902609 0.006767 0.074770 0.015854 0.003221 0.971329 0.005512 0.019937 0.019937 0.005512 0.971329 0.003221 0.015854 0.074770 0.006767 0.902609 0.003030 0.004308 0.943472 0.049190 0.003497 0.088920 0.685942 0.221641 0.802859 0.121789 0.026059 0.049294 0.334544 0.155170 0.275193 0.235092 0.275957 0.132104 0.454982 0.136957 0.134097 0.254352 0.422940 0.188611 0.396163 0.432784 0.051281 0.119772 0.276474 0.115627 0.419844 0.188056 0.160759 0.088061 0.649863 0.101318 0.203314 0.166595 0.106821 0.523270 Consensus sequence: YDYBDHTMCACGTGGADDBMDGT Reverse complement motif 0.523270 0.166595 0.106821 0.203314 0.160759 0.649863 0.088061 0.101318 0.276474 0.419844 0.115627 0.188056 0.396163 0.051281 0.432784 0.119772 0.134097 0.422940 0.254352 0.188611 0.275957 0.454982 0.132104 0.136957 0.235092 0.155170 0.275193 0.334544 0.049294 0.121789 0.026059 0.802859 0.003497 0.685942 0.088920 0.221641 0.003030 0.943472 0.004308 0.049190 0.902609 0.074770 0.006767 0.015854 0.019937 0.971329 0.005512 0.003221 0.003221 0.005512 0.971329 0.019937 0.015854 0.006767 0.074770 0.902609 0.049190 0.004308 0.943472 0.003030 0.017251 0.289284 0.173423 0.520042 0.802859 0.026059 0.121789 0.049294 0.339087 0.287193 0.154072 0.219647 0.296957 0.301094 0.155579 0.246370 0.140641 0.287668 0.405473 0.166218 0.507625 0.260812 0.103811 0.127752 0.220931 0.422396 0.169844 0.186829 0.410138 0.344851 0.124072 0.120938 Consensus sequence: ACHRBHDTCCACGTGYAHHBMHM Alignment: ACHRBHDTCCACGTGYAHHBMHM --------CCGCGGRCACG---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00400 Zif268 Original Motif Reverse Complement Backward 6 11 0.034043 Species: Mus musculus Original motif 0.104824 0.412716 0.254506 0.227955 0.644922 0.065476 0.140479 0.149122 0.201205 0.166164 0.347131 0.285501 0.360606 0.256316 0.150766 0.232313 0.199831 0.240681 0.279350 0.280137 0.234308 0.204076 0.321306 0.240310 0.274112 0.462435 0.111425 0.152028 0.067070 0.717501 0.073934 0.141496 0.106745 0.084442 0.658566 0.150247 0.025128 0.967053 0.003585 0.004234 0.006412 0.982989 0.003227 0.007371 0.009588 0.877620 0.002571 0.110221 0.621521 0.355443 0.015669 0.007366 0.002600 0.980275 0.004191 0.012934 0.118773 0.026658 0.783843 0.070725 0.022358 0.822101 0.024684 0.130857 0.713212 0.080912 0.128793 0.077084 0.166568 0.250955 0.107934 0.474544 0.225040 0.222494 0.163301 0.389166 0.268976 0.223206 0.265314 0.242504 0.137052 0.229058 0.148439 0.485451 0.135819 0.304550 0.141994 0.417637 0.272440 0.319501 0.230580 0.177478 Consensus sequence: BADHBDHCGCCCMCGCAHHDBBV Reverse complement motif 0.272440 0.230580 0.319501 0.177478 0.417637 0.304550 0.141994 0.135819 0.485451 0.229058 0.148439 0.137052 0.242504 0.223206 0.265314 0.268976 0.389166 0.222494 0.163301 0.225040 0.474544 0.250955 0.107934 0.166568 0.077084 0.080912 0.128793 0.713212 0.022358 0.024684 0.822101 0.130857 0.118773 0.783843 0.026658 0.070725 0.002600 0.004191 0.980275 0.012934 0.007366 0.355443 0.015669 0.621521 0.009588 0.002571 0.877620 0.110221 0.006412 0.003227 0.982989 0.007371 0.025128 0.003585 0.967053 0.004234 0.106745 0.658566 0.084442 0.150247 0.067070 0.073934 0.717501 0.141496 0.274112 0.111425 0.462435 0.152028 0.234308 0.321306 0.204076 0.240310 0.280137 0.240681 0.279350 0.199831 0.232313 0.256316 0.150766 0.360606 0.201205 0.347131 0.166164 0.285501 0.149122 0.065476 0.140479 0.644922 0.104824 0.254506 0.412716 0.227955 Consensus sequence: VVVDHHTGCGYGGGCGDHVHHTB Alignment: VVVDHHTGCGYGGGCGDHVHHTB -------CCGCGGRCACG----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00065 Zfp161_secondary Original Motif Original Motif Forward 2 11 0.034586 Species: Mus musculus Original motif 0.142646 0.070072 0.573757 0.213525 0.142215 0.493588 0.067040 0.297157 0.024280 0.923170 0.017567 0.034984 0.015569 0.033118 0.937202 0.014111 0.039447 0.888724 0.020074 0.051755 0.016404 0.008157 0.963367 0.012073 0.063620 0.860169 0.044753 0.031458 0.787911 0.122939 0.024389 0.064761 0.260517 0.103413 0.509585 0.126484 0.203752 0.216621 0.251506 0.328121 0.081075 0.040917 0.820854 0.057154 0.096434 0.760303 0.054942 0.088321 0.266016 0.190184 0.384583 0.159217 0.223960 0.243225 0.228688 0.304127 Consensus sequence: GYCGCGCARBGCVB Reverse complement motif 0.304127 0.243225 0.228688 0.223960 0.266016 0.384583 0.190184 0.159217 0.096434 0.054942 0.760303 0.088321 0.081075 0.820854 0.040917 0.057154 0.328121 0.216621 0.251506 0.203752 0.260517 0.509585 0.103413 0.126484 0.064761 0.122939 0.024389 0.787911 0.063620 0.044753 0.860169 0.031458 0.016404 0.963367 0.008157 0.012073 0.039447 0.020074 0.888724 0.051755 0.015569 0.937202 0.033118 0.014111 0.024280 0.017567 0.923170 0.034984 0.142215 0.067040 0.493588 0.297157 0.142646 0.573757 0.070072 0.213525 Consensus sequence: VVGCVMTGCGCGKC Alignment: GYCGCGCARBGCVB -CCGCGGRCACG-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00097 Mtf1_primary Original Motif Original Motif Backward 3 11 0.035043 Species: Mus musculus Original motif 0.220880 0.102939 0.418146 0.258035 0.154303 0.210788 0.420671 0.214238 0.229141 0.160788 0.412818 0.197253 0.167193 0.404248 0.092489 0.336070 0.025978 0.931335 0.023830 0.018857 0.009150 0.002023 0.977342 0.011485 0.044768 0.024113 0.039091 0.892028 0.007577 0.008370 0.973767 0.010286 0.005251 0.264996 0.004018 0.725735 0.009165 0.002428 0.980566 0.007841 0.021296 0.956027 0.008893 0.013784 0.982532 0.003341 0.005773 0.008353 0.500983 0.226027 0.143944 0.129045 0.544466 0.285936 0.044719 0.124879 0.321158 0.168428 0.261827 0.248587 0.271460 0.263221 0.199083 0.266236 Consensus sequence: DBDHCGTGTGCAAMDH Reverse complement motif 0.266236 0.263221 0.199083 0.271460 0.248587 0.168428 0.261827 0.321158 0.124879 0.285936 0.044719 0.544466 0.129045 0.226027 0.143944 0.500983 0.008353 0.003341 0.005773 0.982532 0.021296 0.008893 0.956027 0.013784 0.009165 0.980566 0.002428 0.007841 0.725735 0.264996 0.004018 0.005251 0.007577 0.973767 0.008370 0.010286 0.892028 0.024113 0.039091 0.044768 0.009150 0.977342 0.002023 0.011485 0.025978 0.023830 0.931335 0.018857 0.167193 0.092489 0.404248 0.336070 0.229141 0.412818 0.160788 0.197253 0.154303 0.420671 0.210788 0.214238 0.220880 0.418146 0.102939 0.258035 Consensus sequence: HDYTTGCACACGDHBH Alignment: DBDHCGTGTGCAAMDH ---CCGCGGRCACG-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00076 Rfxdc2_secondary Reverse Complement Reverse Complement Backward 3 11 0.035993 Species: Mus musculus Original motif 0.120124 0.369052 0.280026 0.230798 0.153013 0.175278 0.321983 0.349726 0.426573 0.206846 0.272112 0.094469 0.067213 0.665712 0.165815 0.101259 0.213424 0.152912 0.229260 0.404404 0.042427 0.193675 0.034144 0.729754 0.359927 0.038767 0.588911 0.012395 0.015079 0.017884 0.948607 0.018430 0.699438 0.007004 0.014579 0.278979 0.017282 0.022228 0.369181 0.591308 0.948823 0.011471 0.018805 0.020901 0.016175 0.947649 0.007710 0.028466 0.114584 0.334989 0.511562 0.038865 0.219114 0.247229 0.396478 0.137179 0.308087 0.178171 0.248356 0.265386 0.479300 0.125168 0.134837 0.260696 0.323493 0.230502 0.108189 0.337815 Consensus sequence: BBVCDTRGAKACSVDDH Reverse complement motif 0.337815 0.230502 0.108189 0.323493 0.260696 0.125168 0.134837 0.479300 0.265386 0.178171 0.248356 0.308087 0.219114 0.396478 0.247229 0.137179 0.114584 0.511562 0.334989 0.038865 0.016175 0.007710 0.947649 0.028466 0.020901 0.011471 0.018805 0.948823 0.591308 0.022228 0.369181 0.017282 0.278979 0.007004 0.014579 0.699438 0.015079 0.948607 0.017884 0.018430 0.359927 0.588911 0.038767 0.012395 0.729754 0.193675 0.034144 0.042427 0.404404 0.152912 0.229260 0.213424 0.067213 0.165815 0.665712 0.101259 0.094469 0.206846 0.272112 0.426573 0.349726 0.175278 0.321983 0.153013 0.120124 0.280026 0.369052 0.230798 Consensus sequence: HDDVSGTRTCMADGBVB Alignment: HDDVSGTRTCMADGBVB ----CGTGKCCGCGG-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00526 Foxn1_primary Original Motif Reverse Complement Backward 3 11 0.036196 Species: Mus musculus Original motif 0.456612 0.057181 0.078281 0.407926 0.460529 0.185506 0.083106 0.270859 0.445717 0.179510 0.239355 0.135417 0.116339 0.145186 0.275331 0.463144 0.239398 0.142078 0.480004 0.138520 0.355157 0.217877 0.284296 0.142670 0.318602 0.444835 0.153321 0.083243 0.609569 0.055866 0.280349 0.054216 0.062297 0.769824 0.027844 0.140035 0.151868 0.019245 0.803188 0.025699 0.011842 0.952534 0.017959 0.017665 0.017665 0.017959 0.952534 0.011842 0.025699 0.803188 0.019245 0.151868 0.140035 0.027844 0.769824 0.062297 0.054216 0.280349 0.055866 0.609569 0.013084 0.624655 0.177956 0.184305 0.287647 0.183527 0.295753 0.233074 0.042309 0.345931 0.198458 0.413301 0.338138 0.266033 0.045367 0.350462 0.302850 0.155320 0.074662 0.467168 0.240926 0.068901 0.283055 0.407118 0.409954 0.183157 0.154186 0.252704 Consensus sequence: WHVBVVMACGCGCGTCDYHWDH Reverse complement motif 0.252704 0.183157 0.154186 0.409954 0.407118 0.068901 0.283055 0.240926 0.467168 0.155320 0.074662 0.302850 0.350462 0.266033 0.045367 0.338138 0.413301 0.345931 0.198458 0.042309 0.287647 0.295753 0.183527 0.233074 0.013084 0.177956 0.624655 0.184305 0.609569 0.280349 0.055866 0.054216 0.140035 0.769824 0.027844 0.062297 0.025699 0.019245 0.803188 0.151868 0.017665 0.952534 0.017959 0.011842 0.011842 0.017959 0.952534 0.017665 0.151868 0.803188 0.019245 0.025699 0.062297 0.027844 0.769824 0.140035 0.054216 0.055866 0.280349 0.609569 0.318602 0.153321 0.444835 0.083243 0.142670 0.217877 0.284296 0.355157 0.239398 0.480004 0.142078 0.138520 0.463144 0.145186 0.275331 0.116339 0.135417 0.179510 0.239355 0.445717 0.270859 0.185506 0.083106 0.460529 0.407926 0.057181 0.078281 0.456612 Consensus sequence: HDWHMHGACGCGCGTRBVVBHW Alignment: HDWHMHGACGCGCGTRBVVBHW ---------CCGCGGRCACG-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 2 Motif ID: 30 Motif name: taaacgatgcc Original motif 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 Consensus sequence: TAAACGATGCC Reserve complement motif 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 Consensus sequence: GGCATCGTTTA ************************************************************************ Best Matches for Motif ID 30 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00114 Homez Original Motif Reverse Complement Backward 3 11 0.020764 Species: Mus musculus Original motif 0.585235 0.056880 0.174898 0.182987 0.344783 0.171238 0.144379 0.339600 0.496888 0.112442 0.086669 0.304001 0.457408 0.134777 0.032789 0.375026 0.342717 0.420568 0.171418 0.065297 0.872988 0.030946 0.004203 0.091862 0.006581 0.013120 0.006495 0.973804 0.036193 0.946961 0.004377 0.012469 0.014767 0.005226 0.966106 0.013901 0.208700 0.008264 0.021875 0.761161 0.037957 0.018882 0.028895 0.914266 0.157997 0.026546 0.021365 0.794092 0.139814 0.136272 0.117987 0.605927 0.125467 0.233302 0.183071 0.458161 0.523941 0.191122 0.050126 0.234811 0.374984 0.049392 0.291831 0.283793 0.268235 0.165772 0.308515 0.257477 Consensus sequence: AHWWMATCGTTTTBADD Reverse complement motif 0.268235 0.308515 0.165772 0.257477 0.283793 0.049392 0.291831 0.374984 0.234811 0.191122 0.050126 0.523941 0.458161 0.233302 0.183071 0.125467 0.605927 0.136272 0.117987 0.139814 0.794092 0.026546 0.021365 0.157997 0.914266 0.018882 0.028895 0.037957 0.761161 0.008264 0.021875 0.208700 0.014767 0.966106 0.005226 0.013901 0.036193 0.004377 0.946961 0.012469 0.973804 0.013120 0.006495 0.006581 0.091862 0.030946 0.004203 0.872988 0.342717 0.171418 0.420568 0.065297 0.375026 0.134777 0.032789 0.457408 0.304001 0.112442 0.086669 0.496888 0.339600 0.171238 0.144379 0.344783 0.182987 0.056880 0.174898 0.585235 Consensus sequence: HDTVAAAACGATRWWHT Alignment: HDTVAAAACGATRWWHT ----TAAACGATGCC-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00061 Foxl1_primary Reverse Complement Reverse Complement Forward 1 11 0.029432 Species: Mus musculus Original motif 0.323208 0.152915 0.185111 0.338766 0.428132 0.056109 0.099487 0.416272 0.659386 0.039965 0.035805 0.264843 0.647143 0.049206 0.078984 0.224667 0.208834 0.076592 0.071631 0.642943 0.341077 0.003865 0.649511 0.005547 0.016627 0.001866 0.001715 0.979792 0.952319 0.045294 0.000870 0.001516 0.988834 0.004620 0.000720 0.005826 0.989346 0.001005 0.006467 0.003182 0.001093 0.784230 0.001235 0.213442 0.991209 0.002017 0.001737 0.005037 0.801581 0.037084 0.023060 0.138274 0.528554 0.089350 0.107501 0.274595 0.208802 0.268646 0.368022 0.154530 0.280218 0.221367 0.340497 0.157918 0.146611 0.250725 0.293524 0.309140 Consensus sequence: DWAATRTAAACAAWVVB Reverse complement motif 0.309140 0.250725 0.293524 0.146611 0.280218 0.340497 0.221367 0.157918 0.208802 0.368022 0.268646 0.154530 0.274595 0.089350 0.107501 0.528554 0.138274 0.037084 0.023060 0.801581 0.005037 0.002017 0.001737 0.991209 0.001093 0.001235 0.784230 0.213442 0.003182 0.001005 0.006467 0.989346 0.005826 0.004620 0.000720 0.988834 0.001516 0.045294 0.000870 0.952319 0.979792 0.001866 0.001715 0.016627 0.341077 0.649511 0.003865 0.005547 0.642943 0.076592 0.071631 0.208834 0.224667 0.049206 0.078984 0.647143 0.264843 0.039965 0.035805 0.659386 0.416272 0.056109 0.099487 0.428132 0.338766 0.152915 0.185111 0.323208 Consensus sequence: VVVWTTGTTTAMATTWD Alignment: VVVWTTGTTTAMATTWD GGCATCGTTTA------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00039 Foxj3_primary Original Motif Original Motif Backward 1 11 0.030091 Species: Mus musculus Original motif 0.273456 0.257473 0.208488 0.260583 0.338566 0.133379 0.306363 0.221693 0.475488 0.192852 0.156858 0.174803 0.506619 0.132646 0.170373 0.190362 0.349042 0.127275 0.325924 0.197759 0.303850 0.013619 0.678034 0.004497 0.014136 0.015691 0.003073 0.967100 0.913373 0.082928 0.001910 0.001789 0.956294 0.017745 0.000584 0.025378 0.987796 0.001685 0.004159 0.006360 0.002288 0.814764 0.001427 0.181521 0.986707 0.002688 0.003346 0.007259 0.787378 0.065481 0.057961 0.089180 0.572982 0.089910 0.066184 0.270924 0.224167 0.339979 0.258886 0.176968 0.268414 0.272007 0.239541 0.220038 0.241771 0.394748 0.174273 0.189208 Consensus sequence: HDHADGTAAACAAAVVH Reverse complement motif 0.241771 0.174273 0.394748 0.189208 0.268414 0.239541 0.272007 0.220038 0.224167 0.258886 0.339979 0.176968 0.270924 0.089910 0.066184 0.572982 0.089180 0.065481 0.057961 0.787378 0.007259 0.002688 0.003346 0.986707 0.002288 0.001427 0.814764 0.181521 0.006360 0.001685 0.004159 0.987796 0.025378 0.017745 0.000584 0.956294 0.001789 0.082928 0.001910 0.913373 0.967100 0.015691 0.003073 0.014136 0.303850 0.678034 0.013619 0.004497 0.197759 0.127275 0.325924 0.349042 0.190362 0.132646 0.170373 0.506619 0.174803 0.192852 0.156858 0.475488 0.221693 0.133379 0.306363 0.338566 0.260583 0.257473 0.208488 0.273456 Consensus sequence: DVVTTTGTTTACDTHDH Alignment: HDHADGTAAACAAAVVH ------TAAACGATGCC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00025 Foxk1_primary Reverse Complement Reverse Complement Backward 7 11 0.030661 Species: Mus musculus Original motif 0.338172 0.192194 0.207817 0.261817 0.407924 0.117261 0.278236 0.196580 0.595570 0.070480 0.119221 0.214729 0.710845 0.038748 0.052600 0.197807 0.124647 0.116138 0.178053 0.581162 0.201602 0.005514 0.792110 0.000774 0.024590 0.004193 0.001331 0.969886 0.919465 0.077871 0.000760 0.001904 0.972342 0.010395 0.000580 0.016683 0.991045 0.001495 0.003585 0.003875 0.001358 0.885197 0.000980 0.112465 0.990318 0.001846 0.002968 0.004867 0.804563 0.063147 0.023496 0.108795 0.564824 0.087976 0.102865 0.244336 0.269947 0.300278 0.285008 0.144767 0.337905 0.220102 0.253694 0.188299 0.153781 0.274135 0.318343 0.253741 Consensus sequence: DDAATGTAAACAAAVVB Reverse complement motif 0.153781 0.318343 0.274135 0.253741 0.188299 0.220102 0.253694 0.337905 0.269947 0.285008 0.300278 0.144767 0.244336 0.087976 0.102865 0.564824 0.108795 0.063147 0.023496 0.804563 0.004867 0.001846 0.002968 0.990318 0.001358 0.000980 0.885197 0.112465 0.003875 0.001495 0.003585 0.991045 0.016683 0.010395 0.000580 0.972342 0.001904 0.077871 0.000760 0.919465 0.969886 0.004193 0.001331 0.024590 0.201602 0.792110 0.005514 0.000774 0.581162 0.116138 0.178053 0.124647 0.197807 0.038748 0.052600 0.710845 0.214729 0.070480 0.119221 0.595570 0.196580 0.117261 0.278236 0.407924 0.261817 0.192194 0.207817 0.338172 Consensus sequence: BBVTTTGTTTACATTDD Alignment: BBVTTTGTTTACATTDD GGCATCGTTTA------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00527 Foxn4_primary Reverse Complement Original Motif Forward 10 11 0.034248 Species: Mus musculus Original motif 0.397468 0.109792 0.196359 0.296381 0.102928 0.480888 0.250249 0.165936 0.141925 0.173586 0.377365 0.307124 0.337385 0.368225 0.188518 0.105872 0.354789 0.067393 0.345343 0.232475 0.299392 0.109745 0.215552 0.375311 0.242937 0.170264 0.189245 0.397554 0.461680 0.013180 0.358677 0.166463 0.067089 0.063048 0.008045 0.861819 0.431756 0.128671 0.436022 0.003551 0.006559 0.001814 0.988272 0.003355 0.012929 0.983600 0.001468 0.002003 0.018768 0.000766 0.976433 0.004033 0.003776 0.005554 0.002991 0.987679 0.002737 0.981589 0.009028 0.006646 0.126509 0.273800 0.413161 0.186530 0.100613 0.337225 0.212034 0.350128 0.123741 0.284683 0.060914 0.530661 0.204454 0.143533 0.100462 0.551551 0.202290 0.482197 0.148368 0.167145 0.191625 0.101330 0.607860 0.099185 0.507546 0.086532 0.219554 0.186368 Consensus sequence: DBBVDDDRTRGCGTCBBYTHGA Reverse complement motif 0.186368 0.086532 0.219554 0.507546 0.191625 0.607860 0.101330 0.099185 0.202290 0.148368 0.482197 0.167145 0.551551 0.143533 0.100462 0.204454 0.530661 0.284683 0.060914 0.123741 0.350128 0.337225 0.212034 0.100613 0.126509 0.413161 0.273800 0.186530 0.002737 0.009028 0.981589 0.006646 0.987679 0.005554 0.002991 0.003776 0.018768 0.976433 0.000766 0.004033 0.012929 0.001468 0.983600 0.002003 0.006559 0.988272 0.001814 0.003355 0.431756 0.436022 0.128671 0.003551 0.861819 0.063048 0.008045 0.067089 0.166463 0.013180 0.358677 0.461680 0.397554 0.170264 0.189245 0.242937 0.375311 0.109745 0.215552 0.299392 0.232475 0.067393 0.345343 0.354789 0.337385 0.188518 0.368225 0.105872 0.141925 0.377365 0.173586 0.307124 0.102928 0.250249 0.480888 0.165936 0.296381 0.109792 0.196359 0.397468 Consensus sequence: TCDAMVBGACGCMAKDDDVBBD Alignment: DBBVDDDRTRGCGTCBBYTHGA ---------GGCATCGTTTA-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00040 Irf5_primary Reverse Complement Reverse Complement Forward 3 11 0.034502 Species: Mus musculus Original motif 0.337548 0.193688 0.194039 0.274725 0.279950 0.185928 0.199501 0.334621 0.357304 0.160203 0.278768 0.203725 0.499782 0.069569 0.166858 0.263790 0.832538 0.022992 0.085287 0.059183 0.144788 0.434769 0.040595 0.379848 0.016035 0.943520 0.003379 0.037067 0.014208 0.001713 0.982579 0.001500 0.985572 0.004274 0.008722 0.001432 0.894404 0.001440 0.007585 0.096571 0.991307 0.002706 0.001993 0.003994 0.011143 0.973529 0.013241 0.002087 0.016468 0.532173 0.009621 0.441739 0.462373 0.120288 0.237126 0.180213 0.392685 0.223865 0.229697 0.153753 Consensus sequence: DDDWAYCGAAACYDV Reverse complement motif 0.153753 0.223865 0.229697 0.392685 0.180213 0.120288 0.237126 0.462373 0.016468 0.009621 0.532173 0.441739 0.011143 0.013241 0.973529 0.002087 0.003994 0.002706 0.001993 0.991307 0.096571 0.001440 0.007585 0.894404 0.001432 0.004274 0.008722 0.985572 0.014208 0.982579 0.001713 0.001500 0.016035 0.003379 0.943520 0.037067 0.144788 0.040595 0.434769 0.379848 0.059183 0.022992 0.085287 0.832538 0.263790 0.069569 0.166858 0.499782 0.203725 0.160203 0.278768 0.357304 0.334621 0.185928 0.199501 0.279950 0.274725 0.193688 0.194039 0.337548 Consensus sequence: BDKGTTTCGKTWDDD Alignment: BDKGTTTCGKTWDDD --GGCATCGTTTA-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00528 Foxm1_primary Original Motif Reverse Complement Forward 3 11 0.035162 Species: Mus musculus Original motif 0.402634 0.249702 0.143705 0.203959 0.709619 0.108953 0.130781 0.050647 0.334232 0.077498 0.228818 0.359452 0.131721 0.094794 0.234481 0.539005 0.170102 0.237609 0.252464 0.339824 0.244961 0.347304 0.228129 0.179606 0.612141 0.132244 0.180110 0.075504 0.472236 0.042388 0.234419 0.250957 0.125213 0.007413 0.849788 0.017587 0.702068 0.064216 0.141992 0.091724 0.008657 0.038238 0.002959 0.950145 0.007170 0.002244 0.986824 0.003763 0.002862 0.979956 0.000711 0.016471 0.971196 0.001954 0.011441 0.015409 0.105575 0.031482 0.022836 0.840107 0.031534 0.736742 0.032785 0.198939 0.479153 0.347558 0.031799 0.141490 0.056405 0.123140 0.023989 0.796466 0.111194 0.195344 0.501360 0.192102 0.376359 0.416820 0.072818 0.134004 0.225111 0.249460 0.306563 0.218866 0.405251 0.168478 0.108618 0.317653 0.165386 0.191749 0.268604 0.374261 Consensus sequence: HADTBVADGATGCATCMTGMVHB Reverse complement motif 0.374261 0.191749 0.268604 0.165386 0.317653 0.168478 0.108618 0.405251 0.225111 0.306563 0.249460 0.218866 0.376359 0.072818 0.416820 0.134004 0.111194 0.501360 0.195344 0.192102 0.796466 0.123140 0.023989 0.056405 0.141490 0.347558 0.031799 0.479153 0.031534 0.032785 0.736742 0.198939 0.840107 0.031482 0.022836 0.105575 0.015409 0.001954 0.011441 0.971196 0.002862 0.000711 0.979956 0.016471 0.007170 0.986824 0.002244 0.003763 0.950145 0.038238 0.002959 0.008657 0.091724 0.064216 0.141992 0.702068 0.125213 0.849788 0.007413 0.017587 0.250957 0.042388 0.234419 0.472236 0.075504 0.132244 0.180110 0.612141 0.244961 0.228129 0.347304 0.179606 0.339824 0.237609 0.252464 0.170102 0.539005 0.094794 0.234481 0.131721 0.359452 0.077498 0.228818 0.334232 0.050647 0.108953 0.130781 0.709619 0.203959 0.249702 0.143705 0.402634 Consensus sequence: VHVRCAYGATGCATCDTVVADTH Alignment: VHVRCAYGATGCATCDTVVADTH --TAAACGATGCC---------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00232 Dobox4 Reverse Complement Reverse Complement Backward 2 11 0.037149 Species: Mus musculus Original motif 0.264302 0.211442 0.173361 0.350895 0.413224 0.116602 0.116602 0.353572 0.486656 0.190855 0.148590 0.173900 0.503388 0.062728 0.128222 0.305661 0.084825 0.015745 0.170672 0.728758 0.856596 0.001753 0.045684 0.095967 0.052745 0.001652 0.828687 0.116917 0.985176 0.012392 0.001483 0.000949 0.011350 0.100275 0.009362 0.879013 0.764353 0.230179 0.001125 0.004343 0.001443 0.952663 0.005512 0.040382 0.008496 0.966240 0.002248 0.023017 0.076925 0.757970 0.008043 0.157062 0.097162 0.473715 0.088219 0.340904 0.392557 0.078339 0.147795 0.381309 0.055342 0.079606 0.149083 0.715969 0.369817 0.112894 0.219338 0.297952 Consensus sequence: HWHWTAGATACCCYWTD Reverse complement motif 0.297952 0.112894 0.219338 0.369817 0.715969 0.079606 0.149083 0.055342 0.381309 0.078339 0.147795 0.392557 0.097162 0.088219 0.473715 0.340904 0.076925 0.008043 0.757970 0.157062 0.008496 0.002248 0.966240 0.023017 0.001443 0.005512 0.952663 0.040382 0.004343 0.230179 0.001125 0.764353 0.879013 0.100275 0.009362 0.011350 0.000949 0.012392 0.001483 0.985176 0.052745 0.828687 0.001652 0.116917 0.095967 0.001753 0.045684 0.856596 0.728758 0.015745 0.170672 0.084825 0.305661 0.062728 0.128222 0.503388 0.173900 0.190855 0.148590 0.486656 0.353572 0.116602 0.116602 0.413224 0.350895 0.211442 0.173361 0.264302 Consensus sequence: DAWKGGGTATCTAWHWH Alignment: DAWKGGGTATCTAWHWH -----GGCATCGTTTA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00073 Foxa2_primary Reverse Complement Reverse Complement Backward 7 11 0.038480 Species: Mus musculus Original motif 0.335487 0.205062 0.128957 0.330494 0.411635 0.179625 0.175701 0.233038 0.412976 0.128602 0.091890 0.366532 0.608396 0.079002 0.107142 0.205460 0.433474 0.035203 0.153143 0.378180 0.087552 0.005003 0.894586 0.012858 0.004459 0.038951 0.001109 0.955481 0.924470 0.068560 0.001165 0.005805 0.920483 0.070039 0.001674 0.007805 0.988335 0.001902 0.003155 0.006608 0.001527 0.656726 0.002699 0.339047 0.987505 0.001810 0.004336 0.006349 0.719584 0.065184 0.050384 0.164848 0.535389 0.099997 0.102849 0.261764 0.245215 0.272017 0.301499 0.181269 0.306107 0.209040 0.248687 0.236166 0.223744 0.278668 0.251931 0.245657 Consensus sequence: HHWAWGTAAAYAAAVDB Reverse complement motif 0.223744 0.251931 0.278668 0.245657 0.236166 0.209040 0.248687 0.306107 0.245215 0.301499 0.272017 0.181269 0.261764 0.099997 0.102849 0.535389 0.164848 0.065184 0.050384 0.719584 0.006349 0.001810 0.004336 0.987505 0.001527 0.002699 0.656726 0.339047 0.006608 0.001902 0.003155 0.988335 0.007805 0.070039 0.001674 0.920483 0.005805 0.068560 0.001165 0.924470 0.955481 0.038951 0.001109 0.004459 0.087552 0.894586 0.005003 0.012858 0.378180 0.035203 0.153143 0.433474 0.205460 0.079002 0.107142 0.608396 0.366532 0.128602 0.091890 0.412976 0.233038 0.179625 0.175701 0.411635 0.330494 0.205062 0.128957 0.335487 Consensus sequence: BDVTTTKTTTACWTWHH Alignment: BDVTTTKTTTACWTWHH GGCATCGTTTA------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00011 Irf6_primary Reverse Complement Reverse Complement Forward 6 11 0.038853 Species: Mus musculus Original motif 0.256714 0.363080 0.149403 0.230804 0.312941 0.135162 0.190389 0.361507 0.255033 0.128823 0.354898 0.261246 0.667588 0.053933 0.205778 0.072701 0.199950 0.339707 0.114445 0.345899 0.029853 0.908514 0.006383 0.055250 0.019621 0.002231 0.976266 0.001882 0.983875 0.005320 0.008639 0.002166 0.698671 0.002741 0.006725 0.291864 0.990097 0.003609 0.003047 0.003247 0.008905 0.975208 0.011495 0.004392 0.022092 0.611448 0.018828 0.347632 0.538109 0.125313 0.241515 0.095063 0.456841 0.205124 0.177213 0.160822 0.372926 0.189134 0.195747 0.242193 0.217155 0.198027 0.300393 0.284425 0.277630 0.187849 0.237049 0.297472 Consensus sequence: HDDAHCGAAACYAVDDD Reverse complement motif 0.297472 0.187849 0.237049 0.277630 0.217155 0.300393 0.198027 0.284425 0.242193 0.189134 0.195747 0.372926 0.160822 0.205124 0.177213 0.456841 0.095063 0.125313 0.241515 0.538109 0.022092 0.018828 0.611448 0.347632 0.008905 0.011495 0.975208 0.004392 0.003247 0.003609 0.003047 0.990097 0.291864 0.002741 0.006725 0.698671 0.002166 0.005320 0.008639 0.983875 0.019621 0.976266 0.002231 0.001882 0.029853 0.006383 0.908514 0.055250 0.345899 0.339707 0.114445 0.199950 0.072701 0.053933 0.205778 0.667588 0.255033 0.354898 0.128823 0.261246 0.361507 0.135162 0.190389 0.312941 0.256714 0.149403 0.363080 0.230804 Consensus sequence: DHDBTKGTTTCGHTHDD Alignment: DHDBTKGTTTCGHTHDD -----GGCATCGTTTA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 2 Motif ID: 31 Motif name: ctatacggacg Original motif 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 Consensus sequence: CTATACGGACG Reserve complement motif 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 Consensus sequence: CGTCCGTATAG ************************************************************************ Best Matches for Motif ID 31 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00038 Spdef_primary Original Motif Reverse Complement Forward 3 11 0.027939 Species: Mus musculus Original motif 0.278139 0.269446 0.332078 0.120337 0.191853 0.289569 0.165370 0.353209 0.490437 0.027482 0.446684 0.035396 0.092110 0.612324 0.134576 0.160990 0.714688 0.007177 0.042951 0.235183 0.017038 0.014836 0.006165 0.961960 0.005411 0.986820 0.005716 0.002053 0.005945 0.989961 0.001629 0.002464 0.001282 0.006131 0.872195 0.120392 0.002518 0.087009 0.857395 0.053078 0.567474 0.070909 0.194015 0.167602 0.178375 0.058626 0.041325 0.721673 0.255647 0.250555 0.158035 0.335763 0.184054 0.303968 0.126491 0.385487 0.145245 0.233810 0.150000 0.470945 0.093249 0.313763 0.190482 0.402505 Consensus sequence: VHRCATCCGGATHHBB Reverse complement motif 0.402505 0.313763 0.190482 0.093249 0.470945 0.233810 0.150000 0.145245 0.385487 0.303968 0.126491 0.184054 0.335763 0.250555 0.158035 0.255647 0.721673 0.058626 0.041325 0.178375 0.167602 0.070909 0.194015 0.567474 0.002518 0.857395 0.087009 0.053078 0.001282 0.872195 0.006131 0.120392 0.005945 0.001629 0.989961 0.002464 0.005411 0.005716 0.986820 0.002053 0.961960 0.014836 0.006165 0.017038 0.235183 0.007177 0.042951 0.714688 0.092110 0.134576 0.612324 0.160990 0.035396 0.027482 0.446684 0.490437 0.353209 0.289569 0.165370 0.191853 0.278139 0.332078 0.269446 0.120337 Consensus sequence: VVHHATCCGGATGKHV Alignment: VVHHATCCGGATGKHV --CTATACGGACG--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00527 Foxn4_secondary Original Motif Original Motif Forward 1 11 0.030812 Species: Mus musculus Original motif 0.298336 0.418632 0.208054 0.074978 0.289907 0.015608 0.457100 0.237385 0.273583 0.077889 0.107860 0.540668 0.184954 0.161611 0.384390 0.269045 0.521826 0.156340 0.089019 0.232815 0.356716 0.131104 0.394857 0.117323 0.266669 0.108765 0.505273 0.119293 0.020778 0.047199 0.919524 0.012500 0.948536 0.018775 0.008113 0.024576 0.010822 0.964042 0.014701 0.010434 0.007428 0.019505 0.966351 0.006717 0.010025 0.975678 0.008648 0.005649 0.043796 0.120935 0.742979 0.092289 0.008252 0.250704 0.541132 0.199913 0.474428 0.044681 0.134430 0.346461 0.146597 0.421317 0.143166 0.288920 0.020540 0.181479 0.553811 0.244170 0.129612 0.173360 0.535219 0.161808 0.506084 0.158156 0.130983 0.204776 0.054872 0.103043 0.545792 0.296293 0.389882 0.171037 0.164162 0.274918 0.225861 0.314031 0.288872 0.171237 Consensus sequence: VDWDARRGACGCGGWHGGAKHV Reverse complement motif 0.225861 0.288872 0.314031 0.171237 0.274918 0.171037 0.164162 0.389882 0.054872 0.545792 0.103043 0.296293 0.204776 0.158156 0.130983 0.506084 0.129612 0.535219 0.173360 0.161808 0.020540 0.553811 0.181479 0.244170 0.146597 0.143166 0.421317 0.288920 0.346461 0.044681 0.134430 0.474428 0.008252 0.541132 0.250704 0.199913 0.043796 0.742979 0.120935 0.092289 0.010025 0.008648 0.975678 0.005649 0.007428 0.966351 0.019505 0.006717 0.010822 0.014701 0.964042 0.010434 0.024576 0.018775 0.008113 0.948536 0.020778 0.919524 0.047199 0.012500 0.266669 0.505273 0.108765 0.119293 0.356716 0.394857 0.131104 0.117323 0.232815 0.156340 0.089019 0.521826 0.184954 0.384390 0.161611 0.269045 0.540668 0.077889 0.107860 0.273583 0.289907 0.457100 0.015608 0.237385 0.298336 0.208054 0.418632 0.074978 Consensus sequence: VHYTCCDWCCGCGTCMMTHWHV Alignment: VDWDARRGACGCGGWHGGAKHV CTATACGGACG----------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00413 Elf4 Original Motif Reverse Complement Forward 1 11 0.032867 Species: Mus musculus Original motif 0.349744 0.139466 0.209326 0.301464 0.080478 0.359482 0.307083 0.252956 0.145756 0.213763 0.350557 0.289924 0.317307 0.199359 0.096089 0.387245 0.868576 0.009724 0.088821 0.032878 0.001975 0.827004 0.014159 0.156862 0.045494 0.000985 0.001907 0.951615 0.011012 0.001203 0.002186 0.985599 0.002743 0.992908 0.002226 0.002123 0.001498 0.990840 0.001556 0.006106 0.000951 0.005138 0.880591 0.113319 0.003127 0.107962 0.867980 0.020930 0.156602 0.055355 0.396563 0.391480 0.421246 0.049379 0.084495 0.444880 0.223879 0.068063 0.203809 0.504249 0.144100 0.323579 0.131544 0.400777 Consensus sequence: DBBHACTTCCGGKWTH Reverse complement motif 0.400777 0.323579 0.131544 0.144100 0.504249 0.068063 0.203809 0.223879 0.444880 0.049379 0.084495 0.421246 0.156602 0.396563 0.055355 0.391480 0.003127 0.867980 0.107962 0.020930 0.000951 0.880591 0.005138 0.113319 0.001498 0.001556 0.990840 0.006106 0.002743 0.002226 0.992908 0.002123 0.985599 0.001203 0.002186 0.011012 0.951615 0.000985 0.001907 0.045494 0.001975 0.014159 0.827004 0.156862 0.032878 0.009724 0.088821 0.868576 0.387245 0.199359 0.096089 0.317307 0.145756 0.350557 0.213763 0.289924 0.080478 0.307083 0.359482 0.252956 0.301464 0.139466 0.209326 0.349744 Consensus sequence: HAWYCCGGAAGTHBBD Alignment: HAWYCCGGAAGTHBBD CTATACGGACG----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00418 Etv6 Reverse Complement Original Motif Backward 1 11 0.033401 Species: Mus musculus Original motif 0.354972 0.069107 0.299350 0.276571 0.209701 0.408003 0.227382 0.154914 0.284336 0.375266 0.162604 0.177794 0.176569 0.181438 0.342172 0.299820 0.106551 0.204378 0.060299 0.628772 0.884088 0.003252 0.103113 0.009546 0.001110 0.704391 0.006294 0.288205 0.014992 0.000892 0.001401 0.982714 0.004842 0.001887 0.002470 0.990801 0.002724 0.992864 0.002206 0.002206 0.001792 0.991200 0.001615 0.005393 0.005151 0.010157 0.940259 0.044433 0.017780 0.199839 0.761921 0.020459 0.230834 0.269936 0.119652 0.379577 0.233019 0.093692 0.034743 0.638546 0.194739 0.181763 0.175340 0.448159 0.145452 0.293709 0.335917 0.224922 Consensus sequence: DVHBTACTTCCGGHTHB Reverse complement motif 0.145452 0.335917 0.293709 0.224922 0.448159 0.181763 0.175340 0.194739 0.638546 0.093692 0.034743 0.233019 0.379577 0.269936 0.119652 0.230834 0.017780 0.761921 0.199839 0.020459 0.005151 0.940259 0.010157 0.044433 0.001792 0.001615 0.991200 0.005393 0.002724 0.002206 0.992864 0.002206 0.990801 0.001887 0.002470 0.004842 0.982714 0.000892 0.001401 0.014992 0.001110 0.006294 0.704391 0.288205 0.009546 0.003252 0.103113 0.884088 0.628772 0.204378 0.060299 0.106551 0.176569 0.342172 0.181438 0.299820 0.284336 0.162604 0.375266 0.177794 0.209701 0.227382 0.408003 0.154914 0.276571 0.069107 0.299350 0.354972 Consensus sequence: BHAHCCGGAAGTABDVD Alignment: BHAHCCGGAAGTABDVD ------CGTCCGTATAG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00409 Elf5 Original Motif Original Motif Forward 1 11 0.033639 Species: Mus musculus Original motif 0.179167 0.229135 0.279326 0.312372 0.421239 0.102900 0.145609 0.330252 0.791978 0.009721 0.028951 0.169350 0.237609 0.375543 0.161526 0.225321 0.145845 0.325411 0.516045 0.012699 0.431007 0.516333 0.051679 0.000982 0.005750 0.001408 0.990928 0.001915 0.002025 0.001886 0.992021 0.004068 0.986405 0.001705 0.001039 0.010851 0.950652 0.003619 0.000482 0.045248 0.165221 0.013897 0.819076 0.001805 0.032042 0.049374 0.014632 0.903953 0.285325 0.108010 0.127373 0.479292 0.366131 0.141246 0.290661 0.201963 Consensus sequence: BWAHSMGGAAGTWD Reverse complement motif 0.201963 0.141246 0.290661 0.366131 0.479292 0.108010 0.127373 0.285325 0.903953 0.049374 0.014632 0.032042 0.165221 0.819076 0.013897 0.001805 0.045248 0.003619 0.000482 0.950652 0.010851 0.001705 0.001039 0.986405 0.002025 0.992021 0.001886 0.004068 0.005750 0.990928 0.001408 0.001915 0.431007 0.051679 0.516333 0.000982 0.145845 0.516045 0.325411 0.012699 0.237609 0.161526 0.375543 0.225321 0.169350 0.009721 0.028951 0.791978 0.330252 0.102900 0.145609 0.421239 0.312372 0.229135 0.279326 0.179167 Consensus sequence: DWACTTCCRSDTWV Alignment: BWAHSMGGAAGTWD CTATACGGACG--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00097 Mtf1_primary Reverse Complement Original Motif Backward 2 11 0.034653 Species: Mus musculus Original motif 0.220880 0.102939 0.418146 0.258035 0.154303 0.210788 0.420671 0.214238 0.229141 0.160788 0.412818 0.197253 0.167193 0.404248 0.092489 0.336070 0.025978 0.931335 0.023830 0.018857 0.009150 0.002023 0.977342 0.011485 0.044768 0.024113 0.039091 0.892028 0.007577 0.008370 0.973767 0.010286 0.005251 0.264996 0.004018 0.725735 0.009165 0.002428 0.980566 0.007841 0.021296 0.956027 0.008893 0.013784 0.982532 0.003341 0.005773 0.008353 0.500983 0.226027 0.143944 0.129045 0.544466 0.285936 0.044719 0.124879 0.321158 0.168428 0.261827 0.248587 0.271460 0.263221 0.199083 0.266236 Consensus sequence: DBDHCGTGTGCAAMDH Reverse complement motif 0.266236 0.263221 0.199083 0.271460 0.248587 0.168428 0.261827 0.321158 0.124879 0.285936 0.044719 0.544466 0.129045 0.226027 0.143944 0.500983 0.008353 0.003341 0.005773 0.982532 0.021296 0.008893 0.956027 0.013784 0.009165 0.980566 0.002428 0.007841 0.725735 0.264996 0.004018 0.005251 0.007577 0.973767 0.008370 0.010286 0.892028 0.024113 0.039091 0.044768 0.009150 0.977342 0.002023 0.011485 0.025978 0.023830 0.931335 0.018857 0.167193 0.092489 0.404248 0.336070 0.229141 0.412818 0.160788 0.197253 0.154303 0.420671 0.210788 0.214238 0.220880 0.418146 0.102939 0.258035 Consensus sequence: HDYTTGCACACGDHBH Alignment: DBDHCGTGTGCAAMDH ----CGTCCGTATAG- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00135 Hoxc12 Original Motif Reverse Complement Backward 3 11 0.036100 Species: Mus musculus Original motif 0.183093 0.256705 0.106645 0.453557 0.293699 0.196292 0.123477 0.386533 0.412013 0.124988 0.381422 0.081576 0.195091 0.186106 0.527371 0.091431 0.152495 0.041951 0.802926 0.002628 0.001867 0.030137 0.001608 0.966389 0.042259 0.939178 0.001204 0.017359 0.130196 0.001627 0.865068 0.003109 0.003366 0.001436 0.003067 0.992131 0.922191 0.005824 0.000528 0.071457 0.973219 0.001857 0.001299 0.023624 0.979071 0.008898 0.002615 0.009416 0.503130 0.138484 0.031998 0.326389 0.337928 0.242816 0.070564 0.348692 0.182884 0.251308 0.190482 0.375326 0.307728 0.135074 0.240871 0.316326 0.189821 0.425134 0.167065 0.217980 Consensus sequence: HHRGGTCGTAAAWHBDH Reverse complement motif 0.189821 0.167065 0.425134 0.217980 0.316326 0.135074 0.240871 0.307728 0.375326 0.251308 0.190482 0.182884 0.348692 0.242816 0.070564 0.337928 0.326389 0.138484 0.031998 0.503130 0.009416 0.008898 0.002615 0.979071 0.023624 0.001857 0.001299 0.973219 0.071457 0.005824 0.000528 0.922191 0.992131 0.001436 0.003067 0.003366 0.130196 0.865068 0.001627 0.003109 0.042259 0.001204 0.939178 0.017359 0.966389 0.030137 0.001608 0.001867 0.152495 0.802926 0.041951 0.002628 0.195091 0.527371 0.186106 0.091431 0.081576 0.124988 0.381422 0.412013 0.386533 0.196292 0.123477 0.293699 0.453557 0.256705 0.106645 0.183093 Consensus sequence: DDVHWTTTACGACCKHH Alignment: DDVHWTTTACGACCKHH ----CTATACGGACG-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00084 Gmeb1_primary Reverse Complement Reverse Complement Backward 3 11 0.036547 Species: Mus musculus Original motif 0.166569 0.264627 0.345569 0.223235 0.335599 0.314451 0.153336 0.196615 0.105350 0.231839 0.348018 0.314793 0.131274 0.215623 0.291288 0.361815 0.125570 0.072341 0.404848 0.397242 0.049879 0.039110 0.325167 0.585844 0.705098 0.009202 0.284757 0.000943 0.003535 0.986983 0.004275 0.005207 0.005207 0.004275 0.986983 0.003535 0.000943 0.284757 0.009202 0.705098 0.585844 0.325167 0.039110 0.049879 0.397242 0.404848 0.072341 0.125570 0.206857 0.234555 0.371731 0.186857 0.435957 0.145115 0.181033 0.237896 0.176104 0.260127 0.230770 0.333000 0.272102 0.213365 0.312032 0.202501 0.237402 0.250982 0.266977 0.244639 Consensus sequence: BHBBKKACGTMMVDBVB Reverse complement motif 0.237402 0.266977 0.250982 0.244639 0.272102 0.312032 0.213365 0.202501 0.333000 0.260127 0.230770 0.176104 0.237896 0.145115 0.181033 0.435957 0.206857 0.371731 0.234555 0.186857 0.397242 0.072341 0.404848 0.125570 0.049879 0.325167 0.039110 0.585844 0.705098 0.284757 0.009202 0.000943 0.005207 0.986983 0.004275 0.003535 0.003535 0.004275 0.986983 0.005207 0.000943 0.009202 0.284757 0.705098 0.585844 0.039110 0.325167 0.049879 0.125570 0.404848 0.072341 0.397242 0.361815 0.215623 0.291288 0.131274 0.105350 0.348018 0.231839 0.314793 0.196615 0.314451 0.153336 0.335599 0.166569 0.345569 0.264627 0.223235 Consensus sequence: BVVDVRYACGTRYVBHB Alignment: BVVDVRYACGTRYVBHB ----CGTCCGTATAG-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00015 Ehf_primary Original Motif Original Motif Forward 2 11 0.036713 Species: Mus musculus Original motif 0.327238 0.304037 0.232174 0.136551 0.198306 0.222758 0.316421 0.262515 0.252373 0.217079 0.267210 0.263337 0.633781 0.039800 0.036914 0.289504 0.160405 0.384709 0.220671 0.234215 0.134205 0.590541 0.266074 0.009179 0.210933 0.755978 0.030378 0.002710 0.011856 0.001472 0.984138 0.002533 0.003235 0.001605 0.989465 0.005695 0.984189 0.002418 0.002842 0.010551 0.884492 0.002651 0.002095 0.110762 0.249047 0.054607 0.690939 0.005407 0.124602 0.154669 0.047597 0.673132 0.375217 0.110561 0.230374 0.283848 0.402951 0.186789 0.219551 0.190710 Consensus sequence: VBDABCCGGAAGTDD Reverse complement motif 0.190710 0.186789 0.219551 0.402951 0.283848 0.110561 0.230374 0.375217 0.673132 0.154669 0.047597 0.124602 0.249047 0.690939 0.054607 0.005407 0.110762 0.002651 0.002095 0.884492 0.010551 0.002418 0.002842 0.984189 0.003235 0.989465 0.001605 0.005695 0.011856 0.984138 0.001472 0.002533 0.210933 0.030378 0.755978 0.002710 0.134205 0.266074 0.590541 0.009179 0.160405 0.220671 0.384709 0.234215 0.289504 0.039800 0.036914 0.633781 0.252373 0.267210 0.217079 0.263337 0.198306 0.316421 0.222758 0.262515 0.136551 0.304037 0.232174 0.327238 Consensus sequence: DDACTTCCGGBTHBB Alignment: VBDABCCGGAAGTDD -CTATACGGACG--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00421 Etv1 Reverse Complement Reverse Complement Backward 2 11 0.037300 Species: Mus musculus Original motif 0.481848 0.274378 0.165047 0.078727 0.153123 0.322109 0.385794 0.138974 0.257711 0.198309 0.118559 0.425422 0.102329 0.255032 0.373097 0.269542 0.655995 0.027594 0.168796 0.147615 0.012836 0.906067 0.077134 0.003962 0.079806 0.917232 0.002438 0.000524 0.005217 0.001765 0.991859 0.001159 0.001691 0.002097 0.993588 0.002624 0.991087 0.001016 0.001937 0.005961 0.751484 0.005147 0.002324 0.241044 0.112494 0.076460 0.805095 0.005951 0.012019 0.198497 0.022413 0.767071 0.482843 0.140306 0.249898 0.126953 0.298792 0.191769 0.286874 0.222565 0.395216 0.302575 0.172247 0.129961 0.364642 0.219734 0.190320 0.225304 Consensus sequence: MVHBACCGGAAGTVDVH Reverse complement motif 0.225304 0.219734 0.190320 0.364642 0.129961 0.302575 0.172247 0.395216 0.222565 0.191769 0.286874 0.298792 0.126953 0.140306 0.249898 0.482843 0.767071 0.198497 0.022413 0.012019 0.112494 0.805095 0.076460 0.005951 0.241044 0.005147 0.002324 0.751484 0.005961 0.001016 0.001937 0.991087 0.001691 0.993588 0.002097 0.002624 0.005217 0.991859 0.001765 0.001159 0.079806 0.002438 0.917232 0.000524 0.012836 0.077134 0.906067 0.003962 0.147615 0.027594 0.168796 0.655995 0.102329 0.373097 0.255032 0.269542 0.425422 0.198309 0.118559 0.257711 0.153123 0.385794 0.322109 0.138974 0.078727 0.274378 0.165047 0.481848 Consensus sequence: HBDBACTTCCGGTBHVY Alignment: HBDBACTTCCGGTBHVY -----CGTCCGTATAG- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 2 Motif ID: 32 Motif name: gCGCGCsCgsG Original motif 0.105263 0.210526 0.526316 0.157895 0.000000 0.736842 0.105263 0.157895 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.368421 0.631579 0.000000 0.000000 0.894737 0.105263 0.000000 0.157895 0.157895 0.631579 0.052632 0.052632 0.631579 0.263158 0.052632 0.105263 0.052632 0.789474 0.052632 Consensus sequence: GCGCGCSCGCG Reserve complement motif 0.105263 0.789474 0.052632 0.052632 0.052632 0.263158 0.631579 0.052632 0.157895 0.631579 0.157895 0.052632 0.000000 0.105263 0.894737 0.000000 0.000000 0.631579 0.368421 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.105263 0.736842 0.157895 0.105263 0.526316 0.210526 0.157895 Consensus sequence: CGCGSGCGCGC ************************************************************************ Best Matches for Motif ID 32 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00065 Zfp161_primary Reverse Complement Original Motif Forward 2 11 0.000000 Species: Mus musculus Original motif 0.142624 0.111294 0.283688 0.462394 0.221170 0.081404 0.499138 0.198288 0.290070 0.042114 0.604904 0.062912 0.109755 0.559510 0.215454 0.115281 0.111745 0.022727 0.850580 0.014948 0.015907 0.942291 0.005561 0.036241 0.088509 0.003729 0.902805 0.004957 0.004957 0.902805 0.003729 0.088509 0.036241 0.005561 0.942291 0.015907 0.014948 0.850580 0.022727 0.111745 0.325358 0.049424 0.519652 0.105566 0.062912 0.604904 0.042114 0.290070 0.214335 0.388248 0.125912 0.271505 0.128984 0.372787 0.092390 0.405839 0.269058 0.098422 0.484016 0.148504 0.362176 0.156050 0.188642 0.293132 Consensus sequence: DDGCGCGCGCRCHYRD Reverse complement motif 0.293132 0.156050 0.188642 0.362176 0.269058 0.484016 0.098422 0.148504 0.405839 0.372787 0.092390 0.128984 0.214335 0.125912 0.388248 0.271505 0.062912 0.042114 0.604904 0.290070 0.325358 0.519652 0.049424 0.105566 0.014948 0.022727 0.850580 0.111745 0.036241 0.942291 0.005561 0.015907 0.004957 0.003729 0.902805 0.088509 0.088509 0.902805 0.003729 0.004957 0.015907 0.005561 0.942291 0.036241 0.111745 0.850580 0.022727 0.014948 0.109755 0.215454 0.559510 0.115281 0.290070 0.604904 0.042114 0.062912 0.221170 0.499138 0.081404 0.198288 0.462394 0.111294 0.283688 0.142624 Consensus sequence: DMMDGMGCGCGCGCHD Alignment: DDGCGCGCGCRCHYRD -CGCGSGCGCGC---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00003 E2F3_primary Reverse Complement Reverse Complement Backward 5 11 0.010201 Species: Mus musculus Original motif 0.358868 0.212371 0.263565 0.165196 0.303014 0.253580 0.111217 0.332189 0.420933 0.110957 0.210958 0.257152 0.769724 0.062662 0.032155 0.135459 0.311973 0.051319 0.408669 0.228039 0.097916 0.141153 0.719697 0.041234 0.009980 0.014044 0.971955 0.004021 0.014425 0.974798 0.008373 0.002404 0.000891 0.013228 0.983966 0.001915 0.000827 0.938560 0.059548 0.001065 0.007071 0.102005 0.872378 0.018546 0.020099 0.897653 0.014151 0.068097 0.114080 0.346724 0.409037 0.130159 0.331439 0.279041 0.085030 0.304491 0.319846 0.136792 0.043641 0.499722 Consensus sequence: VHDADGGCGCGCSHW Reverse complement motif 0.499722 0.136792 0.043641 0.319846 0.304491 0.279041 0.085030 0.331439 0.114080 0.409037 0.346724 0.130159 0.020099 0.014151 0.897653 0.068097 0.007071 0.872378 0.102005 0.018546 0.000827 0.059548 0.938560 0.001065 0.000891 0.983966 0.013228 0.001915 0.014425 0.008373 0.974798 0.002404 0.009980 0.971955 0.014044 0.004021 0.097916 0.719697 0.141153 0.041234 0.311973 0.408669 0.051319 0.228039 0.135459 0.062662 0.032155 0.769724 0.257152 0.110957 0.210958 0.420933 0.332189 0.253580 0.111217 0.303014 0.165196 0.212371 0.263565 0.358868 Consensus sequence: WHSGCGCGCCHTDHB Alignment: WHSGCGCGCCHTDHB CGCGSGCGCGC---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00001 E2F2_primary Reverse Complement Reverse Complement Forward 1 11 0.012446 Species: Mus musculus Original motif 0.305970 0.214348 0.269312 0.210370 0.279551 0.218276 0.140576 0.361597 0.391304 0.162239 0.193916 0.252541 0.701667 0.102206 0.041580 0.154547 0.427655 0.068368 0.324706 0.179271 0.144368 0.191048 0.609772 0.054812 0.014295 0.020613 0.958397 0.006695 0.019783 0.962982 0.013403 0.003831 0.001189 0.023882 0.973231 0.001697 0.001343 0.919840 0.077728 0.001089 0.011293 0.097945 0.865194 0.025568 0.039106 0.864604 0.025189 0.071100 0.147663 0.328105 0.407118 0.117115 0.462769 0.203531 0.107986 0.225714 0.293396 0.229650 0.082819 0.394135 Consensus sequence: VHDARGGCGCGCVHH Reverse complement motif 0.394135 0.229650 0.082819 0.293396 0.225714 0.203531 0.107986 0.462769 0.147663 0.407118 0.328105 0.117115 0.039106 0.025189 0.864604 0.071100 0.011293 0.865194 0.097945 0.025568 0.001343 0.077728 0.919840 0.001089 0.001189 0.973231 0.023882 0.001697 0.019783 0.013403 0.962982 0.003831 0.014295 0.958397 0.020613 0.006695 0.144368 0.609772 0.191048 0.054812 0.179271 0.068368 0.324706 0.427655 0.154547 0.102206 0.041580 0.701667 0.252541 0.162239 0.193916 0.391304 0.361597 0.218276 0.140576 0.279551 0.210370 0.214348 0.269312 0.305970 Consensus sequence: HHVGCGCGCCKTDHB Alignment: HHVGCGCGCCKTDHB CGCGSGCGCGC---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00526 Foxn1_primary Reverse Complement Original Motif Backward 8 11 0.019220 Species: Mus musculus Original motif 0.456612 0.057181 0.078281 0.407926 0.460529 0.185506 0.083106 0.270859 0.445717 0.179510 0.239355 0.135417 0.116339 0.145186 0.275331 0.463144 0.239398 0.142078 0.480004 0.138520 0.355157 0.217877 0.284296 0.142670 0.318602 0.444835 0.153321 0.083243 0.609569 0.055866 0.280349 0.054216 0.062297 0.769824 0.027844 0.140035 0.151868 0.019245 0.803188 0.025699 0.011842 0.952534 0.017959 0.017665 0.017665 0.017959 0.952534 0.011842 0.025699 0.803188 0.019245 0.151868 0.140035 0.027844 0.769824 0.062297 0.054216 0.280349 0.055866 0.609569 0.013084 0.624655 0.177956 0.184305 0.287647 0.183527 0.295753 0.233074 0.042309 0.345931 0.198458 0.413301 0.338138 0.266033 0.045367 0.350462 0.302850 0.155320 0.074662 0.467168 0.240926 0.068901 0.283055 0.407118 0.409954 0.183157 0.154186 0.252704 Consensus sequence: WHVBVVMACGCGCGTCDYHWDH Reverse complement motif 0.252704 0.183157 0.154186 0.409954 0.407118 0.068901 0.283055 0.240926 0.467168 0.155320 0.074662 0.302850 0.350462 0.266033 0.045367 0.338138 0.413301 0.345931 0.198458 0.042309 0.287647 0.295753 0.183527 0.233074 0.013084 0.177956 0.624655 0.184305 0.609569 0.280349 0.055866 0.054216 0.140035 0.769824 0.027844 0.062297 0.025699 0.019245 0.803188 0.151868 0.017665 0.952534 0.017959 0.011842 0.011842 0.017959 0.952534 0.017665 0.151868 0.803188 0.019245 0.025699 0.062297 0.027844 0.769824 0.140035 0.054216 0.055866 0.280349 0.609569 0.318602 0.153321 0.444835 0.083243 0.142670 0.217877 0.284296 0.355157 0.239398 0.480004 0.142078 0.138520 0.463144 0.145186 0.275331 0.116339 0.135417 0.179510 0.239355 0.445717 0.270859 0.185506 0.083106 0.460529 0.407926 0.057181 0.078281 0.456612 Consensus sequence: HDWHMHGACGCGCGTRBVVBHW Alignment: WHVBVVMACGCGCGTCDYHWDH ----CGCGSGCGCGC------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00526 Foxn1_secondary Reverse Complement Original Motif Forward 8 11 0.023198 Species: Mus musculus Original motif 0.477863 0.106306 0.184102 0.231729 0.304951 0.149020 0.361418 0.184612 0.548996 0.056128 0.348902 0.045974 0.385727 0.477782 0.086218 0.050273 0.409556 0.232265 0.173851 0.184328 0.174550 0.312880 0.307123 0.205448 0.850398 0.047204 0.041665 0.060734 0.141234 0.548534 0.142230 0.168002 0.059462 0.026354 0.892948 0.021236 0.053714 0.870297 0.028935 0.047055 0.086273 0.069147 0.805284 0.039296 0.033781 0.573881 0.034115 0.358223 0.035191 0.079663 0.824970 0.060176 0.051830 0.862631 0.019359 0.066180 0.178685 0.015738 0.762485 0.043092 0.058988 0.042615 0.017608 0.880789 0.202382 0.173360 0.284095 0.340163 0.098493 0.234651 0.506524 0.160333 0.109087 0.336204 0.250510 0.304198 0.130945 0.250843 0.177122 0.441090 0.353830 0.138838 0.162784 0.344548 0.114290 0.417163 0.160662 0.307885 Consensus sequence: DDRMHBACGCGYGCGTDGBBDB Reverse complement motif 0.114290 0.160662 0.417163 0.307885 0.344548 0.138838 0.162784 0.353830 0.441090 0.250843 0.177122 0.130945 0.109087 0.250510 0.336204 0.304198 0.098493 0.506524 0.234651 0.160333 0.340163 0.173360 0.284095 0.202382 0.880789 0.042615 0.017608 0.058988 0.178685 0.762485 0.015738 0.043092 0.051830 0.019359 0.862631 0.066180 0.035191 0.824970 0.079663 0.060176 0.033781 0.034115 0.573881 0.358223 0.086273 0.805284 0.069147 0.039296 0.053714 0.028935 0.870297 0.047055 0.059462 0.892948 0.026354 0.021236 0.141234 0.142230 0.548534 0.168002 0.060734 0.047204 0.041665 0.850398 0.174550 0.307123 0.312880 0.205448 0.184328 0.232265 0.173851 0.409556 0.385727 0.086218 0.477782 0.050273 0.045974 0.056128 0.348902 0.548996 0.304951 0.361418 0.149020 0.184612 0.231729 0.106306 0.184102 0.477863 Consensus sequence: BDVBCDACGCKCGCGTBHRKHD Alignment: DDRMHBACGCGYGCGTDGBBDB -------CGCGSGCGCGC---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00007 Egr1_primary Original Motif Original Motif Backward 3 11 0.028937 Species: Mus musculus Original motif 0.211547 0.282708 0.203472 0.302273 0.141988 0.722437 0.054854 0.080721 0.032605 0.877172 0.012432 0.077792 0.115126 0.070606 0.781290 0.032979 0.003516 0.990021 0.002265 0.004198 0.004715 0.982482 0.009897 0.002906 0.001627 0.975937 0.001662 0.020774 0.262352 0.731732 0.002730 0.003187 0.005890 0.985756 0.002081 0.006273 0.022893 0.090460 0.649322 0.237324 0.023038 0.859949 0.037913 0.079101 0.567633 0.057394 0.166792 0.208181 0.176597 0.331265 0.125308 0.366830 0.183049 0.183774 0.226793 0.406384 Consensus sequence: HCCGCCCCCGCAHB Reverse complement motif 0.406384 0.183774 0.226793 0.183049 0.366830 0.331265 0.125308 0.176597 0.208181 0.057394 0.166792 0.567633 0.023038 0.037913 0.859949 0.079101 0.022893 0.649322 0.090460 0.237324 0.005890 0.002081 0.985756 0.006273 0.262352 0.002730 0.731732 0.003187 0.001627 0.001662 0.975937 0.020774 0.004715 0.009897 0.982482 0.002906 0.003516 0.002265 0.990021 0.004198 0.115126 0.781290 0.070606 0.032979 0.032605 0.012432 0.877172 0.077792 0.141988 0.054854 0.722437 0.080721 0.302273 0.282708 0.203472 0.211547 Consensus sequence: VHTGCGGGGGCGGH Alignment: HCCGCCCCCGCAHB -GCGCGCSCGCG-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00400 Zif268 Original Motif Original Motif Forward 7 11 0.029725 Species: Mus musculus Original motif 0.104824 0.412716 0.254506 0.227955 0.644922 0.065476 0.140479 0.149122 0.201205 0.166164 0.347131 0.285501 0.360606 0.256316 0.150766 0.232313 0.199831 0.240681 0.279350 0.280137 0.234308 0.204076 0.321306 0.240310 0.274112 0.462435 0.111425 0.152028 0.067070 0.717501 0.073934 0.141496 0.106745 0.084442 0.658566 0.150247 0.025128 0.967053 0.003585 0.004234 0.006412 0.982989 0.003227 0.007371 0.009588 0.877620 0.002571 0.110221 0.621521 0.355443 0.015669 0.007366 0.002600 0.980275 0.004191 0.012934 0.118773 0.026658 0.783843 0.070725 0.022358 0.822101 0.024684 0.130857 0.713212 0.080912 0.128793 0.077084 0.166568 0.250955 0.107934 0.474544 0.225040 0.222494 0.163301 0.389166 0.268976 0.223206 0.265314 0.242504 0.137052 0.229058 0.148439 0.485451 0.135819 0.304550 0.141994 0.417637 0.272440 0.319501 0.230580 0.177478 Consensus sequence: BADHBDHCGCCCMCGCAHHDBBV Reverse complement motif 0.272440 0.230580 0.319501 0.177478 0.417637 0.304550 0.141994 0.135819 0.485451 0.229058 0.148439 0.137052 0.242504 0.223206 0.265314 0.268976 0.389166 0.222494 0.163301 0.225040 0.474544 0.250955 0.107934 0.166568 0.077084 0.080912 0.128793 0.713212 0.022358 0.024684 0.822101 0.130857 0.118773 0.783843 0.026658 0.070725 0.002600 0.004191 0.980275 0.012934 0.007366 0.355443 0.015669 0.621521 0.009588 0.002571 0.877620 0.110221 0.006412 0.003227 0.982989 0.007371 0.025128 0.003585 0.967053 0.004234 0.106745 0.658566 0.084442 0.150247 0.067070 0.073934 0.717501 0.141496 0.274112 0.111425 0.462435 0.152028 0.234308 0.321306 0.204076 0.240310 0.280137 0.240681 0.279350 0.199831 0.232313 0.256316 0.150766 0.360606 0.201205 0.347131 0.166164 0.285501 0.149122 0.065476 0.140479 0.644922 0.104824 0.254506 0.412716 0.227955 Consensus sequence: VVVDHHTGCGYGGGCGDHVHHTB Alignment: BADHBDHCGCCCMCGCAHHDBBV ------GCGCGCSCGCG------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00088 Plagl1_primary Reverse Complement Original Motif Forward 2 11 0.031691 Species: Mus musculus Original motif 0.119709 0.241933 0.299696 0.338662 0.236295 0.277376 0.191945 0.294383 0.203722 0.152043 0.467305 0.176931 0.187661 0.114330 0.513662 0.184347 0.047306 0.041411 0.838415 0.072868 0.131945 0.003749 0.848921 0.015385 0.003800 0.006713 0.960656 0.028832 0.002515 0.652482 0.343047 0.001955 0.001955 0.343047 0.652482 0.002515 0.028832 0.960656 0.006713 0.003800 0.015385 0.848921 0.003749 0.131945 0.072868 0.838415 0.041411 0.047306 0.193804 0.543600 0.063385 0.199211 0.210649 0.233823 0.258755 0.296773 0.376439 0.191612 0.261004 0.170945 0.230078 0.256519 0.299785 0.213618 Consensus sequence: BHDGGGGSSCCCCBVV Reverse complement motif 0.230078 0.299785 0.256519 0.213618 0.170945 0.191612 0.261004 0.376439 0.296773 0.233823 0.258755 0.210649 0.193804 0.063385 0.543600 0.199211 0.072868 0.041411 0.838415 0.047306 0.015385 0.003749 0.848921 0.131945 0.028832 0.006713 0.960656 0.003800 0.001955 0.652482 0.343047 0.002515 0.002515 0.343047 0.652482 0.001955 0.003800 0.960656 0.006713 0.028832 0.131945 0.848921 0.003749 0.015385 0.047306 0.838415 0.041411 0.072868 0.187661 0.513662 0.114330 0.184347 0.203722 0.467305 0.152043 0.176931 0.294383 0.277376 0.191945 0.236295 0.338662 0.241933 0.299696 0.119709 Consensus sequence: VBVGGGGSSCCCCHHV Alignment: BHDGGGGSSCCCCBVV -CGCGSGCGCGC---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00002 Sp4_primary Reverse Complement Reverse Complement Backward 3 11 0.032363 Species: Mus musculus Original motif 0.155386 0.223380 0.374454 0.246780 0.247106 0.159582 0.345111 0.248201 0.238889 0.258354 0.165304 0.337454 0.255612 0.489586 0.051621 0.203182 0.450100 0.545383 0.001071 0.003447 0.003704 0.991007 0.002456 0.002833 0.035504 0.001814 0.928129 0.034553 0.001494 0.991406 0.003414 0.003686 0.003045 0.990628 0.005182 0.001145 0.000990 0.963237 0.001215 0.034557 0.148016 0.838396 0.000666 0.012922 0.014261 0.905847 0.007200 0.072692 0.083394 0.270068 0.058368 0.588170 0.149141 0.286783 0.142802 0.421274 0.204851 0.347195 0.253356 0.194597 0.184442 0.299908 0.194408 0.321242 0.125793 0.380109 0.245318 0.248780 Consensus sequence: BDHHMCGCCCCCTHVBB Reverse complement motif 0.125793 0.245318 0.380109 0.248780 0.321242 0.299908 0.194408 0.184442 0.204851 0.253356 0.347195 0.194597 0.421274 0.286783 0.142802 0.149141 0.588170 0.270068 0.058368 0.083394 0.014261 0.007200 0.905847 0.072692 0.148016 0.000666 0.838396 0.012922 0.000990 0.001215 0.963237 0.034557 0.003045 0.005182 0.990628 0.001145 0.001494 0.003414 0.991406 0.003686 0.035504 0.928129 0.001814 0.034553 0.003704 0.002456 0.991007 0.002833 0.450100 0.001071 0.545383 0.003447 0.255612 0.051621 0.489586 0.203182 0.337454 0.258354 0.165304 0.238889 0.247106 0.345111 0.159582 0.248201 0.155386 0.374454 0.223380 0.246780 Consensus sequence: BVVHAGGGGGCGRDHHB Alignment: BVVHAGGGGGCGRDHHB ----CGCGSGCGCGC-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00527 Foxn4_secondary Reverse Complement Reverse Complement Forward 6 11 0.039112 Species: Mus musculus Original motif 0.298336 0.418632 0.208054 0.074978 0.289907 0.015608 0.457100 0.237385 0.273583 0.077889 0.107860 0.540668 0.184954 0.161611 0.384390 0.269045 0.521826 0.156340 0.089019 0.232815 0.356716 0.131104 0.394857 0.117323 0.266669 0.108765 0.505273 0.119293 0.020778 0.047199 0.919524 0.012500 0.948536 0.018775 0.008113 0.024576 0.010822 0.964042 0.014701 0.010434 0.007428 0.019505 0.966351 0.006717 0.010025 0.975678 0.008648 0.005649 0.043796 0.120935 0.742979 0.092289 0.008252 0.250704 0.541132 0.199913 0.474428 0.044681 0.134430 0.346461 0.146597 0.421317 0.143166 0.288920 0.020540 0.181479 0.553811 0.244170 0.129612 0.173360 0.535219 0.161808 0.506084 0.158156 0.130983 0.204776 0.054872 0.103043 0.545792 0.296293 0.389882 0.171037 0.164162 0.274918 0.225861 0.314031 0.288872 0.171237 Consensus sequence: VDWDARRGACGCGGWHGGAKHV Reverse complement motif 0.225861 0.288872 0.314031 0.171237 0.274918 0.171037 0.164162 0.389882 0.054872 0.545792 0.103043 0.296293 0.204776 0.158156 0.130983 0.506084 0.129612 0.535219 0.173360 0.161808 0.020540 0.553811 0.181479 0.244170 0.146597 0.143166 0.421317 0.288920 0.346461 0.044681 0.134430 0.474428 0.008252 0.541132 0.250704 0.199913 0.043796 0.742979 0.120935 0.092289 0.010025 0.008648 0.975678 0.005649 0.007428 0.966351 0.019505 0.006717 0.010822 0.014701 0.964042 0.010434 0.024576 0.018775 0.008113 0.948536 0.020778 0.919524 0.047199 0.012500 0.266669 0.505273 0.108765 0.119293 0.356716 0.394857 0.131104 0.117323 0.232815 0.156340 0.089019 0.521826 0.184954 0.384390 0.161611 0.269045 0.540668 0.077889 0.107860 0.273583 0.289907 0.457100 0.015608 0.237385 0.298336 0.208054 0.418632 0.074978 Consensus sequence: VHYTCCDWCCGCGTCMMTHWHV Alignment: VHYTCCDWCCGCGTCMMTHWHV -----CGCGSGCGCGC------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 2 Motif ID: 33 Motif name: srACyCCGAyr Original motif 0.000000 0.500000 0.500000 0.000000 0.500000 0.000000 0.500000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.000000 0.500000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.000000 0.500000 0.500000 0.000000 0.500000 0.000000 Consensus sequence: SRACYCCGAYR Reserve complement motif 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.500000 0.500000 0.000000 Consensus sequence: KKTCGGKGTKS ************************************************************************ Best Matches for Motif ID 33 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00024 Glis2_primary Reverse Complement Reverse Complement Forward 3 11 0.012991 Species: Mus musculus Original motif 0.135895 0.314811 0.129804 0.419490 0.379294 0.148356 0.125349 0.347001 0.331058 0.171563 0.156431 0.340948 0.238325 0.268940 0.259195 0.233540 0.014812 0.072844 0.774496 0.137848 0.826050 0.107559 0.058965 0.007426 0.013657 0.965452 0.008273 0.012618 0.011951 0.975704 0.007210 0.005135 0.015560 0.961676 0.004028 0.018736 0.010295 0.971668 0.003618 0.014418 0.087168 0.805495 0.002118 0.105220 0.098937 0.760880 0.010017 0.130166 0.492579 0.177017 0.171719 0.158685 0.160142 0.327745 0.192170 0.319943 0.484858 0.086830 0.273852 0.154461 0.266100 0.086868 0.363661 0.283371 Consensus sequence: HHHVGACCCCCCVBRD Reverse complement motif 0.266100 0.363661 0.086868 0.283371 0.154461 0.086830 0.273852 0.484858 0.160142 0.192170 0.327745 0.319943 0.158685 0.177017 0.171719 0.492579 0.098937 0.010017 0.760880 0.130166 0.087168 0.002118 0.805495 0.105220 0.010295 0.003618 0.971668 0.014418 0.015560 0.004028 0.961676 0.018736 0.011951 0.007210 0.975704 0.005135 0.013657 0.008273 0.965452 0.012618 0.007426 0.107559 0.058965 0.826050 0.014812 0.774496 0.072844 0.137848 0.238325 0.259195 0.268940 0.233540 0.340948 0.171563 0.156431 0.331058 0.347001 0.148356 0.125349 0.379294 0.419490 0.314811 0.129804 0.135895 Consensus sequence: HKBBGGGGGGTCVHHH Alignment: HKBBGGGGGGTCVHHH --KKTCGGKGTKS--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00527 Foxn4_secondary Original Motif Original Motif Forward 7 11 0.013032 Species: Mus musculus Original motif 0.298336 0.418632 0.208054 0.074978 0.289907 0.015608 0.457100 0.237385 0.273583 0.077889 0.107860 0.540668 0.184954 0.161611 0.384390 0.269045 0.521826 0.156340 0.089019 0.232815 0.356716 0.131104 0.394857 0.117323 0.266669 0.108765 0.505273 0.119293 0.020778 0.047199 0.919524 0.012500 0.948536 0.018775 0.008113 0.024576 0.010822 0.964042 0.014701 0.010434 0.007428 0.019505 0.966351 0.006717 0.010025 0.975678 0.008648 0.005649 0.043796 0.120935 0.742979 0.092289 0.008252 0.250704 0.541132 0.199913 0.474428 0.044681 0.134430 0.346461 0.146597 0.421317 0.143166 0.288920 0.020540 0.181479 0.553811 0.244170 0.129612 0.173360 0.535219 0.161808 0.506084 0.158156 0.130983 0.204776 0.054872 0.103043 0.545792 0.296293 0.389882 0.171037 0.164162 0.274918 0.225861 0.314031 0.288872 0.171237 Consensus sequence: VDWDARRGACGCGGWHGGAKHV Reverse complement motif 0.225861 0.288872 0.314031 0.171237 0.274918 0.171037 0.164162 0.389882 0.054872 0.545792 0.103043 0.296293 0.204776 0.158156 0.130983 0.506084 0.129612 0.535219 0.173360 0.161808 0.020540 0.553811 0.181479 0.244170 0.146597 0.143166 0.421317 0.288920 0.346461 0.044681 0.134430 0.474428 0.008252 0.541132 0.250704 0.199913 0.043796 0.742979 0.120935 0.092289 0.010025 0.008648 0.975678 0.005649 0.007428 0.966351 0.019505 0.006717 0.010822 0.014701 0.964042 0.010434 0.024576 0.018775 0.008113 0.948536 0.020778 0.919524 0.047199 0.012500 0.266669 0.505273 0.108765 0.119293 0.356716 0.394857 0.131104 0.117323 0.232815 0.156340 0.089019 0.521826 0.184954 0.384390 0.161611 0.269045 0.540668 0.077889 0.107860 0.273583 0.289907 0.457100 0.015608 0.237385 0.298336 0.208054 0.418632 0.074978 Consensus sequence: VHYTCCDWCCGCGTCMMTHWHV Alignment: VDWDARRGACGCGGWHGGAKHV ------SRACYCCGAYR----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00070 Gcm1_secondary Original Motif Reverse Complement Backward 5 11 0.013246 Species: Mus musculus Original motif 0.298360 0.124865 0.240783 0.335992 0.184300 0.174617 0.373392 0.267691 0.150632 0.435099 0.254062 0.160207 0.212569 0.220347 0.370971 0.196113 0.258171 0.316689 0.186896 0.238243 0.872371 0.051703 0.070791 0.005135 0.011560 0.017672 0.009746 0.961022 0.888546 0.042964 0.061758 0.006732 0.071365 0.009982 0.801505 0.117148 0.010657 0.014961 0.949286 0.025096 0.004496 0.009941 0.978381 0.007182 0.005645 0.010294 0.972682 0.011378 0.499895 0.152322 0.335875 0.011908 0.109410 0.346384 0.380529 0.163677 0.371764 0.096182 0.457999 0.074056 0.450207 0.392208 0.065686 0.091898 0.104224 0.228467 0.391473 0.275836 Consensus sequence: DDBVHATAGGGGRBRMB Reverse complement motif 0.104224 0.391473 0.228467 0.275836 0.091898 0.392208 0.065686 0.450207 0.371764 0.457999 0.096182 0.074056 0.109410 0.380529 0.346384 0.163677 0.011908 0.152322 0.335875 0.499895 0.005645 0.972682 0.010294 0.011378 0.004496 0.978381 0.009941 0.007182 0.010657 0.949286 0.014961 0.025096 0.071365 0.801505 0.009982 0.117148 0.006732 0.042964 0.061758 0.888546 0.961022 0.017672 0.009746 0.011560 0.005135 0.051703 0.070791 0.872371 0.258171 0.186896 0.316689 0.238243 0.212569 0.370971 0.220347 0.196113 0.150632 0.254062 0.435099 0.160207 0.184300 0.373392 0.174617 0.267691 0.335992 0.124865 0.240783 0.298360 Consensus sequence: BYMBKCCCCTATDVBHD Alignment: BYMBKCCCCTATDVBHD --SRACYCCGAYR---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00070 Gcm1_primary Original Motif Original Motif Forward 3 11 0.013537 Species: Mus musculus Original motif 0.251681 0.208273 0.178525 0.361520 0.323865 0.334303 0.205542 0.136289 0.308084 0.277004 0.326203 0.088709 0.280609 0.171416 0.168918 0.379057 0.734441 0.031257 0.211473 0.022829 0.006187 0.990281 0.001052 0.002480 0.005819 0.990856 0.001498 0.001826 0.043838 0.936502 0.001550 0.018110 0.022607 0.058037 0.901005 0.018350 0.000424 0.787011 0.026547 0.186017 0.980774 0.002884 0.011288 0.005054 0.009100 0.110310 0.067399 0.813192 0.247510 0.310539 0.250093 0.191858 0.279511 0.211998 0.250717 0.257774 0.264451 0.270002 0.142606 0.322941 0.227607 0.212076 0.267214 0.293102 Consensus sequence: HVVHACCCGCATVDHD Reverse complement motif 0.293102 0.212076 0.267214 0.227607 0.322941 0.270002 0.142606 0.264451 0.257774 0.211998 0.250717 0.279511 0.247510 0.250093 0.310539 0.191858 0.813192 0.110310 0.067399 0.009100 0.005054 0.002884 0.011288 0.980774 0.000424 0.026547 0.787011 0.186017 0.022607 0.901005 0.058037 0.018350 0.043838 0.001550 0.936502 0.018110 0.005819 0.001498 0.990856 0.001826 0.006187 0.001052 0.990281 0.002480 0.022829 0.031257 0.211473 0.734441 0.379057 0.171416 0.168918 0.280609 0.308084 0.326203 0.277004 0.088709 0.323865 0.205542 0.334303 0.136289 0.361520 0.208273 0.178525 0.251681 Consensus sequence: DHDVATGCGGGTHVVH Alignment: HVVHACCCGCATVDHD --SRACYCCGAYR--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00021 Zfp281_secondary Original Motif Original Motif Forward 4 11 0.013691 Species: Mus musculus Original motif 0.463582 0.061604 0.232850 0.241964 0.128956 0.062321 0.481130 0.327593 0.217730 0.020690 0.453776 0.307803 0.535427 0.042857 0.149994 0.271722 0.222391 0.125415 0.375419 0.276775 0.640877 0.065373 0.223489 0.070261 0.021896 0.962922 0.010999 0.004183 0.033993 0.953699 0.002967 0.009341 0.009096 0.979346 0.006614 0.004944 0.010148 0.971252 0.010228 0.008373 0.019605 0.958973 0.012496 0.008926 0.752208 0.080178 0.046020 0.121594 0.466313 0.149124 0.107403 0.277160 0.177748 0.055516 0.159170 0.607566 0.314879 0.170636 0.187525 0.326960 0.322202 0.105206 0.230803 0.341789 0.284925 0.228846 0.320951 0.165278 Consensus sequence: DKKWDACCCCCAHTDDV Reverse complement motif 0.284925 0.320951 0.228846 0.165278 0.341789 0.105206 0.230803 0.322202 0.326960 0.170636 0.187525 0.314879 0.607566 0.055516 0.159170 0.177748 0.277160 0.149124 0.107403 0.466313 0.121594 0.080178 0.046020 0.752208 0.019605 0.012496 0.958973 0.008926 0.010148 0.010228 0.971252 0.008373 0.009096 0.006614 0.979346 0.004944 0.033993 0.002967 0.953699 0.009341 0.021896 0.010999 0.962922 0.004183 0.070261 0.065373 0.223489 0.640877 0.222391 0.375419 0.125415 0.276775 0.271722 0.042857 0.149994 0.535427 0.217730 0.453776 0.020690 0.307803 0.128956 0.481130 0.062321 0.327593 0.241964 0.061604 0.232850 0.463582 Consensus sequence: VDDAHTGGGGGTHWYYD Alignment: DKKWDACCCCCAHTDDV ---SRACYCCGAYR--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00047 Zbtb7b_primary Reverse Complement Reverse Complement Forward 3 11 0.014609 Species: Mus musculus Original motif 0.346946 0.168959 0.284689 0.199406 0.368623 0.144282 0.255122 0.231973 0.231438 0.167540 0.443911 0.157110 0.048139 0.713513 0.224736 0.013612 0.005943 0.982494 0.009265 0.002298 0.005729 0.990328 0.002017 0.001925 0.012634 0.982154 0.001044 0.004167 0.003906 0.974044 0.002213 0.019837 0.092161 0.786818 0.026401 0.094621 0.372382 0.157921 0.109317 0.360380 0.615307 0.152879 0.040223 0.191591 0.669723 0.112856 0.072817 0.144604 0.433088 0.064050 0.180057 0.322805 0.487027 0.216787 0.092562 0.203624 0.140487 0.242560 0.157093 0.459860 Consensus sequence: DDVCCCCCCHAAWHB Reverse complement motif 0.459860 0.242560 0.157093 0.140487 0.203624 0.216787 0.092562 0.487027 0.322805 0.064050 0.180057 0.433088 0.144604 0.112856 0.072817 0.669723 0.191591 0.152879 0.040223 0.615307 0.360380 0.157921 0.109317 0.372382 0.092161 0.026401 0.786818 0.094621 0.003906 0.002213 0.974044 0.019837 0.012634 0.001044 0.982154 0.004167 0.005729 0.002017 0.990328 0.001925 0.005943 0.009265 0.982494 0.002298 0.048139 0.224736 0.713513 0.013612 0.231438 0.443911 0.167540 0.157110 0.231973 0.144282 0.255122 0.368623 0.199406 0.168959 0.284689 0.346946 Consensus sequence: VHWTTHGGGGGGVDD Alignment: VHWTTHGGGGGGVDD --KKTCGGKGTKS-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00040 Irf5_primary Reverse Complement Reverse Complement Forward 5 11 0.014819 Species: Mus musculus Original motif 0.337548 0.193688 0.194039 0.274725 0.279950 0.185928 0.199501 0.334621 0.357304 0.160203 0.278768 0.203725 0.499782 0.069569 0.166858 0.263790 0.832538 0.022992 0.085287 0.059183 0.144788 0.434769 0.040595 0.379848 0.016035 0.943520 0.003379 0.037067 0.014208 0.001713 0.982579 0.001500 0.985572 0.004274 0.008722 0.001432 0.894404 0.001440 0.007585 0.096571 0.991307 0.002706 0.001993 0.003994 0.011143 0.973529 0.013241 0.002087 0.016468 0.532173 0.009621 0.441739 0.462373 0.120288 0.237126 0.180213 0.392685 0.223865 0.229697 0.153753 Consensus sequence: DDDWAYCGAAACYDV Reverse complement motif 0.153753 0.223865 0.229697 0.392685 0.180213 0.120288 0.237126 0.462373 0.016468 0.009621 0.532173 0.441739 0.011143 0.013241 0.973529 0.002087 0.003994 0.002706 0.001993 0.991307 0.096571 0.001440 0.007585 0.894404 0.001432 0.004274 0.008722 0.985572 0.014208 0.982579 0.001713 0.001500 0.016035 0.003379 0.943520 0.037067 0.144788 0.040595 0.434769 0.379848 0.059183 0.022992 0.085287 0.832538 0.263790 0.069569 0.166858 0.499782 0.203725 0.160203 0.278768 0.357304 0.334621 0.185928 0.199501 0.279950 0.274725 0.193688 0.194039 0.337548 Consensus sequence: BDKGTTTCGKTWDDD Alignment: BDKGTTTCGKTWDDD ----KKTCGGKGTKS ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v015681_primary Original Motif Original Motif Forward 9 11 0.014859 Species: Mus musculus Original motif 0.641428 0.180211 0.044767 0.133594 0.171696 0.262981 0.334148 0.231174 0.129726 0.322735 0.243462 0.304077 0.165713 0.175735 0.256108 0.402445 0.146090 0.171890 0.412753 0.269266 0.212837 0.439192 0.280990 0.066980 0.251088 0.275516 0.374380 0.099015 0.575438 0.079656 0.338201 0.006704 0.005634 0.003422 0.972597 0.018348 0.890447 0.077034 0.031851 0.000668 0.007128 0.986862 0.000496 0.005515 0.001445 0.991564 0.001925 0.005066 0.738761 0.190157 0.026399 0.044684 0.013384 0.983783 0.000896 0.001937 0.068077 0.929549 0.000773 0.001602 0.040830 0.933742 0.005283 0.020145 0.730274 0.029225 0.145689 0.094812 0.165032 0.572838 0.162001 0.100129 0.383584 0.129942 0.429497 0.056977 0.455959 0.071959 0.208204 0.263878 0.134271 0.262985 0.222626 0.380117 0.071193 0.346594 0.346081 0.236132 0.445661 0.405278 0.053901 0.095160 Consensus sequence: ABBBBVVRGACCACCCACRDBBM Reverse complement motif 0.095160 0.405278 0.053901 0.445661 0.071193 0.346081 0.346594 0.236132 0.380117 0.262985 0.222626 0.134271 0.263878 0.071959 0.208204 0.455959 0.383584 0.429497 0.129942 0.056977 0.165032 0.162001 0.572838 0.100129 0.094812 0.029225 0.145689 0.730274 0.040830 0.005283 0.933742 0.020145 0.068077 0.000773 0.929549 0.001602 0.013384 0.000896 0.983783 0.001937 0.044684 0.190157 0.026399 0.738761 0.001445 0.001925 0.991564 0.005066 0.007128 0.000496 0.986862 0.005515 0.000668 0.077034 0.031851 0.890447 0.005634 0.972597 0.003422 0.018348 0.006704 0.079656 0.338201 0.575438 0.251088 0.374380 0.275516 0.099015 0.212837 0.280990 0.439192 0.066980 0.146090 0.412753 0.171890 0.269266 0.402445 0.175735 0.256108 0.165713 0.129726 0.243462 0.322735 0.304077 0.171696 0.334148 0.262981 0.231174 0.133594 0.180211 0.044767 0.641428 Consensus sequence: YBVDMGTGGGTGGTCKVVBVBBT Alignment: ABBBBVVRGACCACCCACRDBBM --------SRACYCCGAYR---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00021 Zfp281_primary Reverse Complement Reverse Complement Backward 5 11 0.015330 Species: Mus musculus Original motif 0.201535 0.165213 0.201324 0.431929 0.136153 0.443451 0.179132 0.241264 0.263149 0.555137 0.067983 0.113731 0.142183 0.737634 0.045722 0.074461 0.044982 0.884112 0.045356 0.025549 0.246434 0.590578 0.022655 0.140333 0.123049 0.591257 0.033072 0.252622 0.018153 0.944742 0.010254 0.026851 0.035459 0.953844 0.003988 0.006709 0.020000 0.954344 0.005966 0.019690 0.015299 0.964390 0.006755 0.013557 0.028565 0.936152 0.011660 0.023623 0.300127 0.517309 0.029700 0.152863 0.159063 0.513443 0.051834 0.275660 0.158172 0.647055 0.133256 0.061516 Consensus sequence: DBCCCCCCCCCCMYC Reverse complement motif 0.158172 0.133256 0.647055 0.061516 0.159063 0.051834 0.513443 0.275660 0.300127 0.029700 0.517309 0.152863 0.028565 0.011660 0.936152 0.023623 0.015299 0.006755 0.964390 0.013557 0.020000 0.005966 0.954344 0.019690 0.035459 0.003988 0.953844 0.006709 0.018153 0.010254 0.944742 0.026851 0.123049 0.033072 0.591257 0.252622 0.246434 0.022655 0.590578 0.140333 0.044982 0.045356 0.884112 0.025549 0.142183 0.045722 0.737634 0.074461 0.263149 0.067983 0.555137 0.113731 0.136153 0.179132 0.443451 0.241264 0.431929 0.165213 0.201324 0.201535 Consensus sequence: GKRGGGGGGGGGGBD Alignment: GKRGGGGGGGGGGBD KKTCGGKGTKS---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v016060_primary Reverse Complement Reverse Complement Backward 10 11 0.015555 Species: Mus musculus Original motif 0.137831 0.118922 0.394177 0.349070 0.190108 0.163633 0.138507 0.507753 0.346002 0.332315 0.228621 0.093063 0.113254 0.287554 0.373285 0.225908 0.272578 0.125402 0.328963 0.273057 0.333973 0.115165 0.194267 0.356595 0.381054 0.086215 0.501679 0.031052 0.002232 0.007405 0.966087 0.024276 0.834741 0.112115 0.052053 0.001091 0.009034 0.983239 0.000766 0.006960 0.002054 0.988103 0.003138 0.006705 0.805772 0.171299 0.008415 0.014515 0.020076 0.976846 0.000894 0.002183 0.079914 0.917273 0.001179 0.001634 0.013983 0.950545 0.004205 0.031267 0.789407 0.039441 0.108645 0.062507 0.055453 0.161271 0.595249 0.188028 0.333424 0.128169 0.373270 0.165136 0.536103 0.109520 0.062980 0.291397 0.346477 0.090909 0.279533 0.283081 0.045892 0.190183 0.584314 0.179611 0.088294 0.406148 0.251647 0.253912 0.202467 0.447159 0.162802 0.187571 Consensus sequence: DTVBDDRGACCACCCAGDWDGBH Reverse complement motif 0.202467 0.162802 0.447159 0.187571 0.088294 0.251647 0.406148 0.253912 0.045892 0.584314 0.190183 0.179611 0.283081 0.090909 0.279533 0.346477 0.291397 0.109520 0.062980 0.536103 0.333424 0.373270 0.128169 0.165136 0.055453 0.595249 0.161271 0.188028 0.062507 0.039441 0.108645 0.789407 0.013983 0.004205 0.950545 0.031267 0.079914 0.001179 0.917273 0.001634 0.020076 0.000894 0.976846 0.002183 0.014515 0.171299 0.008415 0.805772 0.002054 0.003138 0.988103 0.006705 0.009034 0.000766 0.983239 0.006960 0.001091 0.112115 0.052053 0.834741 0.002232 0.966087 0.007405 0.024276 0.381054 0.501679 0.086215 0.031052 0.356595 0.115165 0.194267 0.333973 0.272578 0.328963 0.125402 0.273057 0.113254 0.373285 0.287554 0.225908 0.093063 0.332315 0.228621 0.346002 0.507753 0.163633 0.138507 0.190108 0.137831 0.394177 0.118922 0.349070 Consensus sequence: DBCDWHCTGGGTGGTCMDHBBAH Alignment: DBCDWHCTGGGTGGTCMDHBBAH ---KKTCGGKGTKS--------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Results created by MOTIFSIM on 11-20-2016 21:11:03 Runtime: 725.148896 seconds MOTIFSIM is written by Ngoc Tam L. Tran