**************************************************************************************************************************************************************************************************** MOTIFSIM - Motif Similarity Detection Tool Version 2.2 **************************************************************************************************************************************************************************************************** INPUT **************************************************************************************************************************************************************************************************** Input Parameters Number of files: 5 Number of top significant motifs: 10 Number of best matches: 10 Similarity cutoff: >= 0.75 Matching motif database: UniProbe Mus Musculus Motif tree: Yes Combined similar motifs: Yes Output file type: All Output file format: All Input files and motif counts File name Count of motifs Dataset # MEME_DM05.txt 46 1 MEME-ChIP_DM05.txt 4 2 PScanChIP_DM05.txt 16 3 RSAT_peak-motifs_DM05.txt 17 4 W-ChIPMotifs_DM05.txt 11 5 **************************************************************************************************************************************************************************************************** RESULTS **************************************************************************************************************************************************************************************************** ********************************************************************** Best Matches in Database for Each Motif (Highest to Lowest) ***************************************************************** Dataset #: 1 Motif ID: 1 Motif name: Motif 1 Original motif 0.000000 0.598592 0.176056 0.225352 0.000000 0.626761 0.000000 0.373239 0.000000 0.000000 0.000000 1.000000 0.000000 0.408451 0.514084 0.077465 0.091549 0.823944 0.028169 0.056338 0.133803 0.690141 0.000000 0.176056 0.042254 0.281690 0.000000 0.676056 0.007042 0.683099 0.197183 0.112676 0.197183 0.000000 0.000000 0.802817 0.000000 0.084507 0.690141 0.225352 0.091549 0.605634 0.169014 0.133803 Consensus sequence: CYTSCCTCTGC Reserve complement motif 0.091549 0.169014 0.605634 0.133803 0.000000 0.690141 0.084507 0.225352 0.802817 0.000000 0.000000 0.197183 0.007042 0.197183 0.683099 0.112676 0.676056 0.281690 0.000000 0.042254 0.133803 0.000000 0.690141 0.176056 0.091549 0.028169 0.823944 0.056338 0.000000 0.514084 0.408451 0.077465 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.626761 0.373239 0.000000 0.176056 0.598592 0.225352 Consensus sequence: GCAGAGGSAKG ************************************************************************ Best Matches for Motif ID 1 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00043 Bcl6b_secondary Original Motif Original Motif Forward 4 11 0.031301 Species: Mus musculus Original motif 0.316572 0.278382 0.152556 0.252490 0.167141 0.257034 0.259894 0.315931 0.175523 0.325956 0.259996 0.238525 0.165052 0.385677 0.239449 0.209822 0.069489 0.782718 0.072454 0.075339 0.049943 0.800636 0.031988 0.117433 0.223382 0.060306 0.552691 0.163621 0.072944 0.818252 0.034406 0.074398 0.070535 0.845127 0.062712 0.021626 0.031035 0.859354 0.055424 0.054187 0.063668 0.798503 0.067274 0.070554 0.348488 0.030697 0.197179 0.423636 0.307220 0.256470 0.181009 0.255301 0.460933 0.285057 0.090258 0.163752 0.315798 0.228431 0.171135 0.284637 0.374527 0.268328 0.198810 0.158335 Consensus sequence: HBBBCCGCCCCWHHHV Reverse complement motif 0.158335 0.268328 0.198810 0.374527 0.284637 0.228431 0.171135 0.315798 0.163752 0.285057 0.090258 0.460933 0.255301 0.256470 0.181009 0.307220 0.423636 0.030697 0.197179 0.348488 0.063668 0.067274 0.798503 0.070554 0.031035 0.055424 0.859354 0.054187 0.070535 0.062712 0.845127 0.021626 0.072944 0.034406 0.818252 0.074398 0.223382 0.552691 0.060306 0.163621 0.049943 0.031988 0.800636 0.117433 0.069489 0.072454 0.782718 0.075339 0.165052 0.239449 0.385677 0.209822 0.175523 0.259996 0.325956 0.238525 0.315931 0.257034 0.259894 0.167141 0.252490 0.278382 0.152556 0.316572 Consensus sequence: BHHHWGGGGCGGBBVH Alignment: HBBBCCGCCCCWHHHV ---CYTSCCTCTGC-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00033 Zfp410_secondary Original Motif Original Motif Backward 3 11 0.031713 Species: Mus musculus Original motif 0.162979 0.284781 0.237433 0.314807 0.182449 0.447584 0.069464 0.300502 0.298973 0.261014 0.213211 0.226802 0.136039 0.433062 0.144274 0.286625 0.180084 0.395933 0.158565 0.265418 0.069354 0.748510 0.068898 0.113238 0.060485 0.717828 0.075333 0.146354 0.023280 0.071762 0.645500 0.259457 0.166896 0.749762 0.062730 0.020612 0.050401 0.775248 0.089072 0.085279 0.103847 0.767557 0.068804 0.059791 0.064815 0.748318 0.114588 0.072280 0.340921 0.071942 0.242981 0.344157 0.301967 0.263512 0.165927 0.268594 0.479800 0.222955 0.118441 0.178803 0.229469 0.283621 0.143099 0.343811 0.261733 0.180191 0.169905 0.388170 Consensus sequence: BHHBHCCGCCCCDHHHH Reverse complement motif 0.388170 0.180191 0.169905 0.261733 0.343811 0.283621 0.143099 0.229469 0.178803 0.222955 0.118441 0.479800 0.268594 0.263512 0.165927 0.301967 0.344157 0.071942 0.242981 0.340921 0.064815 0.114588 0.748318 0.072280 0.103847 0.068804 0.767557 0.059791 0.050401 0.089072 0.775248 0.085279 0.166896 0.062730 0.749762 0.020612 0.023280 0.645500 0.071762 0.259457 0.060485 0.075333 0.717828 0.146354 0.069354 0.068898 0.748510 0.113238 0.180084 0.158565 0.395933 0.265418 0.136039 0.144274 0.433062 0.286625 0.226802 0.261014 0.213211 0.298973 0.182449 0.069464 0.447584 0.300502 0.314807 0.284781 0.237433 0.162979 Consensus sequence: HHHHDGGGGCGGDBHDV Alignment: BHHBHCCGCCCCDHHHH ----CYTSCCTCTGC-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00013 Gabpa_secondary Original Motif Original Motif Forward 5 11 0.032275 Species: Mus musculus Original motif 0.233133 0.551828 0.139009 0.076030 0.100085 0.525562 0.101688 0.272665 0.252996 0.198121 0.299171 0.249711 0.141471 0.195290 0.234560 0.428679 0.160993 0.442765 0.082653 0.313590 0.307890 0.127950 0.071713 0.492448 0.093453 0.148935 0.080288 0.677324 0.083535 0.634212 0.074652 0.207601 0.098119 0.639328 0.099957 0.162596 0.067430 0.451776 0.357188 0.123606 0.286259 0.466975 0.063013 0.183753 0.203211 0.422637 0.133368 0.240783 0.111206 0.315595 0.192833 0.380366 0.199462 0.324652 0.305491 0.170395 0.347919 0.292387 0.230724 0.128970 0.254648 0.294196 0.194942 0.256214 Consensus sequence: CYDBYWTCCSMHBVVH Reverse complement motif 0.254648 0.194942 0.294196 0.256214 0.128970 0.292387 0.230724 0.347919 0.199462 0.305491 0.324652 0.170395 0.380366 0.315595 0.192833 0.111206 0.203211 0.133368 0.422637 0.240783 0.286259 0.063013 0.466975 0.183753 0.067430 0.357188 0.451776 0.123606 0.098119 0.099957 0.639328 0.162596 0.083535 0.074652 0.634212 0.207601 0.677324 0.148935 0.080288 0.093453 0.492448 0.127950 0.071713 0.307890 0.160993 0.082653 0.442765 0.313590 0.428679 0.195290 0.234560 0.141471 0.252996 0.299171 0.198121 0.249711 0.100085 0.101688 0.525562 0.272665 0.233133 0.139009 0.551828 0.076030 Consensus sequence: DBVVDRSGGAWKVHKG Alignment: CYDBYWTCCSMHBVVH ----CYTSCCTCTGC- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00010 Tcfap2b_secondary Original Motif Reverse Complement Backward 5 11 0.033642 Species: Mus musculus Original motif 0.325895 0.099601 0.286848 0.287657 0.177095 0.035123 0.260876 0.526906 0.344850 0.211117 0.015725 0.428308 0.128363 0.059965 0.777560 0.034112 0.048072 0.881624 0.024842 0.045462 0.072628 0.872650 0.011271 0.043451 0.057165 0.162157 0.347719 0.432959 0.015437 0.448405 0.428425 0.107733 0.446877 0.336374 0.099940 0.116809 0.090955 0.023004 0.848240 0.037801 0.040151 0.015072 0.901303 0.043473 0.087378 0.817019 0.027876 0.067727 0.532482 0.021469 0.266773 0.179276 0.325017 0.271661 0.138860 0.264463 0.203625 0.179490 0.143885 0.473001 Consensus sequence: DTWGCCKSMGGCRHH Reverse complement motif 0.473001 0.179490 0.143885 0.203625 0.264463 0.271661 0.138860 0.325017 0.179276 0.021469 0.266773 0.532482 0.087378 0.027876 0.817019 0.067727 0.040151 0.901303 0.015072 0.043473 0.090955 0.848240 0.023004 0.037801 0.116809 0.336374 0.099940 0.446877 0.015437 0.428425 0.448405 0.107733 0.432959 0.162157 0.347719 0.057165 0.072628 0.011271 0.872650 0.043451 0.048072 0.024842 0.881624 0.045462 0.128363 0.777560 0.059965 0.034112 0.428308 0.211117 0.015725 0.344850 0.526906 0.035123 0.260876 0.177095 0.287657 0.099601 0.286848 0.325895 Consensus sequence: HHKGCCYSRGGCWAD Alignment: HHKGCCYSRGGCWAD CYTSCCTCTGC---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00099 Ascl2_primary Reverse Complement Reverse Complement Forward 6 11 0.034328 Species: Mus musculus Original motif 0.168852 0.325948 0.188604 0.316596 0.150343 0.193286 0.241301 0.415069 0.091518 0.482905 0.122928 0.302648 0.472493 0.198776 0.225796 0.102935 0.294513 0.179919 0.447250 0.078318 0.014660 0.972080 0.005591 0.007668 0.954848 0.008107 0.008474 0.028571 0.006076 0.178912 0.760021 0.054991 0.052082 0.817415 0.124797 0.005707 0.019342 0.010406 0.008905 0.961347 0.005455 0.008073 0.977684 0.008788 0.042946 0.715551 0.087020 0.154483 0.116888 0.241739 0.170073 0.471300 0.315931 0.324343 0.291451 0.068274 0.199164 0.366921 0.163690 0.270226 0.218561 0.211076 0.187732 0.382631 0.145317 0.139808 0.389262 0.325614 Consensus sequence: BBYVVCAGCTGCBVHHD Reverse complement motif 0.145317 0.389262 0.139808 0.325614 0.382631 0.211076 0.187732 0.218561 0.199164 0.163690 0.366921 0.270226 0.315931 0.291451 0.324343 0.068274 0.471300 0.241739 0.170073 0.116888 0.042946 0.087020 0.715551 0.154483 0.005455 0.977684 0.008073 0.008788 0.961347 0.010406 0.008905 0.019342 0.052082 0.124797 0.817415 0.005707 0.006076 0.760021 0.178912 0.054991 0.028571 0.008107 0.008474 0.954848 0.014660 0.005591 0.972080 0.007668 0.294513 0.447250 0.179919 0.078318 0.102935 0.198776 0.225796 0.472493 0.091518 0.122928 0.482905 0.302648 0.415069 0.193286 0.241301 0.150343 0.168852 0.188604 0.325948 0.316596 Consensus sequence: HHDVVGCAGCTGVBKVB Alignment: HHDVVGCAGCTGVBKVB -----GCAGAGGSAKG- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00096 Sox13_secondary Original Motif Reverse Complement Backward 1 11 0.035988 Species: Mus musculus Original motif 0.262581 0.115233 0.405525 0.216661 0.246681 0.142854 0.145056 0.465409 0.341041 0.154355 0.306628 0.197976 0.242211 0.263918 0.113187 0.380684 0.119326 0.241913 0.117198 0.521563 0.054120 0.036135 0.784219 0.125525 0.076634 0.048399 0.788586 0.086381 0.215316 0.044119 0.663927 0.076638 0.248538 0.159141 0.015452 0.576869 0.047049 0.083570 0.788798 0.080583 0.071948 0.035098 0.768849 0.124105 0.123777 0.030383 0.713425 0.132415 0.294760 0.182119 0.181553 0.341567 0.516589 0.129377 0.116698 0.237336 0.350326 0.186505 0.112598 0.350571 0.311469 0.198085 0.147986 0.342460 0.185126 0.130721 0.242572 0.441582 Consensus sequence: DDDHTGGGTGGGHAHHD Reverse complement motif 0.441582 0.130721 0.242572 0.185126 0.342460 0.198085 0.147986 0.311469 0.350571 0.186505 0.112598 0.350326 0.237336 0.129377 0.116698 0.516589 0.341567 0.182119 0.181553 0.294760 0.123777 0.713425 0.030383 0.132415 0.071948 0.768849 0.035098 0.124105 0.047049 0.788798 0.083570 0.080583 0.576869 0.159141 0.015452 0.248538 0.215316 0.663927 0.044119 0.076638 0.076634 0.788586 0.048399 0.086381 0.054120 0.784219 0.036135 0.125525 0.521563 0.241913 0.117198 0.119326 0.380684 0.263918 0.113187 0.242211 0.197976 0.154355 0.306628 0.341041 0.465409 0.142854 0.145056 0.246681 0.262581 0.405525 0.115233 0.216661 Consensus sequence: DHHTHCCCACCCAHDDH Alignment: DDDHTGGGTGGGHAHHD ------CYTSCCTCTGC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00085 Sfpi1_primary Original Motif Reverse Complement Backward 1 11 0.036078 Species: Mus musculus Original motif 0.211586 0.273653 0.234763 0.279998 0.298032 0.104818 0.290385 0.306764 0.593467 0.048056 0.154602 0.203875 0.459746 0.052697 0.169949 0.317608 0.188623 0.155357 0.591543 0.064477 0.402746 0.286227 0.290285 0.020742 0.048569 0.001240 0.946397 0.003793 0.004354 0.001387 0.990819 0.003441 0.974272 0.001416 0.001466 0.022847 0.938748 0.003090 0.000833 0.057329 0.045831 0.270321 0.674644 0.009204 0.055664 0.092552 0.026061 0.825722 0.301235 0.122653 0.267039 0.309073 0.278680 0.276099 0.219159 0.226061 Consensus sequence: BDAWGVGGAAGTDH Reverse complement motif 0.226061 0.276099 0.219159 0.278680 0.309073 0.122653 0.267039 0.301235 0.825722 0.092552 0.026061 0.055664 0.045831 0.674644 0.270321 0.009204 0.057329 0.003090 0.000833 0.938748 0.022847 0.001416 0.001466 0.974272 0.004354 0.990819 0.001387 0.003441 0.048569 0.946397 0.001240 0.003793 0.020742 0.286227 0.290285 0.402746 0.188623 0.591543 0.155357 0.064477 0.317608 0.052697 0.169949 0.459746 0.203875 0.048056 0.154602 0.593467 0.306764 0.104818 0.290385 0.298032 0.279998 0.273653 0.234763 0.211586 Consensus sequence: HDACTTCCBCWTDV Alignment: HDACTTCCBCWTDV ---CYTSCCTCTGC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00031 Zbtb3_secondary Original Motif Reverse Complement Backward 4 11 0.036903 Species: Mus musculus Original motif 0.110412 0.519910 0.162398 0.207280 0.470593 0.172893 0.115202 0.241311 0.467126 0.160175 0.227365 0.145334 0.196112 0.169855 0.079068 0.554965 0.198275 0.671393 0.026094 0.104237 0.793465 0.046739 0.110258 0.049538 0.058204 0.867549 0.045603 0.028645 0.079471 0.027484 0.025248 0.867797 0.032277 0.065893 0.827417 0.074413 0.080553 0.119144 0.585050 0.215253 0.105106 0.470208 0.170921 0.253765 0.690158 0.033925 0.171121 0.104796 0.299543 0.155890 0.362586 0.181981 0.343375 0.213360 0.180067 0.263198 0.364819 0.149053 0.181128 0.305000 0.247818 0.143948 0.217882 0.390352 Consensus sequence: CHVTCACTGGBADHDD Reverse complement motif 0.390352 0.143948 0.217882 0.247818 0.305000 0.149053 0.181128 0.364819 0.263198 0.213360 0.180067 0.343375 0.299543 0.362586 0.155890 0.181981 0.104796 0.033925 0.171121 0.690158 0.105106 0.170921 0.470208 0.253765 0.080553 0.585050 0.119144 0.215253 0.032277 0.827417 0.065893 0.074413 0.867797 0.027484 0.025248 0.079471 0.058204 0.045603 0.867549 0.028645 0.049538 0.046739 0.110258 0.793465 0.198275 0.026094 0.671393 0.104237 0.554965 0.169855 0.079068 0.196112 0.145334 0.160175 0.227365 0.467126 0.241311 0.172893 0.115202 0.470593 0.110412 0.162398 0.519910 0.207280 Consensus sequence: DDHHTBCCAGTGABHG Alignment: DDHHTBCCAGTGABHG --CYTSCCTCTGC--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00052 Osr2_secondary Reverse Complement Reverse Complement Backward 5 11 0.037085 Species: Mus musculus Original motif 0.503814 0.061521 0.249336 0.185328 0.254929 0.299710 0.169910 0.275451 0.227652 0.250215 0.156720 0.365413 0.204377 0.213835 0.124161 0.457627 0.092364 0.094662 0.750364 0.062611 0.026436 0.897855 0.038986 0.036722 0.035250 0.085429 0.030496 0.848825 0.819775 0.042925 0.032996 0.104304 0.145642 0.810774 0.021549 0.022035 0.031252 0.486827 0.015181 0.466740 0.255316 0.101783 0.039552 0.603348 0.466712 0.084471 0.436303 0.012514 0.344321 0.408616 0.064696 0.182367 0.422210 0.112319 0.109923 0.355548 0.221064 0.283525 0.217775 0.277636 0.280658 0.350363 0.211925 0.157054 Consensus sequence: AHHHGCTACYTRMWHV Reverse complement motif 0.280658 0.211925 0.350363 0.157054 0.221064 0.217775 0.283525 0.277636 0.355548 0.112319 0.109923 0.422210 0.344321 0.064696 0.408616 0.182367 0.012514 0.084471 0.436303 0.466712 0.603348 0.101783 0.039552 0.255316 0.031252 0.015181 0.486827 0.466740 0.145642 0.021549 0.810774 0.022035 0.104304 0.042925 0.032996 0.819775 0.848825 0.085429 0.030496 0.035250 0.026436 0.038986 0.897855 0.036722 0.092364 0.750364 0.094662 0.062611 0.457627 0.213835 0.124161 0.204377 0.365413 0.250215 0.156720 0.227652 0.254929 0.169910 0.299710 0.275451 0.185328 0.061521 0.249336 0.503814 Consensus sequence: VDWRKAKGTAGCHHDT Alignment: VDWRKAKGTAGCHHDT -GCAGAGGSAKG---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v016060_secondary Original Motif Original Motif Forward 8 11 0.038182 Species: Mus musculus Original motif 0.533199 0.080715 0.330435 0.055650 0.152031 0.212841 0.110234 0.524893 0.223934 0.264217 0.087037 0.424811 0.115097 0.339994 0.343861 0.201048 0.124993 0.418259 0.365642 0.091106 0.158365 0.292428 0.088361 0.460847 0.165479 0.561778 0.022254 0.250489 0.136873 0.259822 0.579763 0.023543 0.109570 0.747495 0.055128 0.087807 0.061912 0.792986 0.109031 0.036071 0.508703 0.267806 0.169766 0.053725 0.040912 0.838888 0.057470 0.062730 0.330554 0.606077 0.016192 0.047177 0.068079 0.563969 0.029742 0.338209 0.388799 0.291667 0.191284 0.128249 0.183283 0.578079 0.171100 0.067538 0.165163 0.097206 0.631377 0.106253 0.128564 0.435496 0.253275 0.182665 0.103395 0.088222 0.234758 0.573625 0.432879 0.276641 0.155895 0.134585 0.339199 0.148928 0.311036 0.200836 0.211958 0.298526 0.158443 0.331072 Consensus sequence: RTHBSYCGCCMCMYVCGBTVDH Reverse complement motif 0.331072 0.298526 0.158443 0.211958 0.200836 0.148928 0.311036 0.339199 0.134585 0.276641 0.155895 0.432879 0.573625 0.088222 0.234758 0.103395 0.128564 0.253275 0.435496 0.182665 0.165163 0.631377 0.097206 0.106253 0.183283 0.171100 0.578079 0.067538 0.128249 0.291667 0.191284 0.388799 0.068079 0.029742 0.563969 0.338209 0.330554 0.016192 0.606077 0.047177 0.040912 0.057470 0.838888 0.062730 0.053725 0.267806 0.169766 0.508703 0.061912 0.109031 0.792986 0.036071 0.109570 0.055128 0.747495 0.087807 0.136873 0.579763 0.259822 0.023543 0.165479 0.022254 0.561778 0.250489 0.460847 0.292428 0.088361 0.158365 0.124993 0.365642 0.418259 0.091106 0.115097 0.343861 0.339994 0.201048 0.424811 0.264217 0.087037 0.223934 0.524893 0.212841 0.110234 0.152031 0.055650 0.080715 0.330435 0.533199 Consensus sequence: HDBABCGBKRGYGGCGMSBHAK Alignment: RTHBSYCGCCMCMYVCGBTVDH -------CYTSCCTCTGC---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 2 Motif name: Motif 2 Original motif 0.833333 0.000000 0.166667 0.000000 0.000000 1.000000 0.000000 0.000000 0.875000 0.000000 0.000000 0.125000 0.083333 0.875000 0.041667 0.000000 0.958333 0.000000 0.000000 0.041667 0.125000 0.875000 0.000000 0.000000 0.833333 0.166667 0.000000 0.000000 0.000000 0.750000 0.000000 0.250000 0.666667 0.000000 0.208333 0.125000 0.000000 0.833333 0.041667 0.125000 0.791667 0.125000 0.083333 0.000000 0.000000 1.000000 0.000000 0.000000 0.708334 0.000000 0.083333 0.208333 0.000000 0.958333 0.000000 0.041667 Consensus sequence: ACACACACACACAC Reserve complement motif 0.000000 0.000000 0.958333 0.041667 0.208333 0.000000 0.083333 0.708334 0.000000 0.000000 1.000000 0.000000 0.000000 0.125000 0.083333 0.791667 0.000000 0.041667 0.833333 0.125000 0.125000 0.000000 0.208333 0.666667 0.000000 0.000000 0.750000 0.250000 0.000000 0.166667 0.000000 0.833333 0.125000 0.000000 0.875000 0.000000 0.041667 0.000000 0.000000 0.958333 0.083333 0.041667 0.875000 0.000000 0.125000 0.000000 0.000000 0.875000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.166667 0.833333 Consensus sequence: GTGTGTGTGTGTGT ************************************************************************ Best Matches for Motif ID 2 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00042 Gm397_second Reverse Complement Reverse Complement Forward 1 14 0.039150 Species: Mus musculus Original motif 0.360404 0.193218 0.248888 0.197490 0.286498 0.224597 0.426555 0.062349 0.347032 0.440548 0.033161 0.179259 0.337062 0.193658 0.385751 0.083529 0.108793 0.005723 0.878300 0.007184 0.015151 0.973406 0.009324 0.002118 0.972117 0.003915 0.019783 0.004185 0.010144 0.980912 0.003106 0.005839 0.974864 0.007532 0.015914 0.001691 0.012441 0.939195 0.029256 0.019108 0.759620 0.106164 0.073819 0.060397 0.157234 0.818234 0.007449 0.017083 0.050076 0.063608 0.505171 0.381144 0.131903 0.538163 0.124608 0.205325 0.367623 0.286526 0.240931 0.104919 0.357798 0.317606 0.097711 0.226885 Consensus sequence: DVMVGCACACACKCVH Reverse complement motif 0.226885 0.317606 0.097711 0.357798 0.104919 0.286526 0.240931 0.367623 0.131903 0.124608 0.538163 0.205325 0.050076 0.505171 0.063608 0.381144 0.157234 0.007449 0.818234 0.017083 0.060397 0.106164 0.073819 0.759620 0.012441 0.029256 0.939195 0.019108 0.001691 0.007532 0.015914 0.974864 0.010144 0.003106 0.980912 0.005839 0.004185 0.003915 0.019783 0.972117 0.015151 0.009324 0.973406 0.002118 0.108793 0.878300 0.005723 0.007184 0.337062 0.385751 0.193658 0.083529 0.347032 0.033161 0.440548 0.179259 0.286498 0.426555 0.224597 0.062349 0.197490 0.193218 0.248888 0.360404 Consensus sequence: HBGYGTGTGTGCVRVD Alignment: HBGYGTGTGTGCVRVD GTGTGTGTGTGTGT-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v015681_secondary Original Motif Original Motif Forward 10 14 0.043857 Species: Mus musculus Original motif 0.404007 0.395873 0.173319 0.026801 0.305977 0.215534 0.215359 0.263130 0.370148 0.250957 0.113088 0.265808 0.324336 0.229498 0.174679 0.271487 0.263563 0.137896 0.079217 0.519324 0.265762 0.222582 0.082555 0.429102 0.206721 0.288405 0.017851 0.487023 0.164361 0.236500 0.061051 0.538088 0.593344 0.348446 0.050304 0.007906 0.031328 0.947050 0.007032 0.014590 0.010428 0.956605 0.029142 0.003825 0.459636 0.207616 0.155368 0.177380 0.014573 0.964608 0.012209 0.008610 0.066291 0.918196 0.008729 0.006784 0.019488 0.866774 0.018897 0.094841 0.767405 0.104198 0.029234 0.099164 0.052494 0.772531 0.039832 0.135142 0.296085 0.243498 0.350935 0.109482 0.518843 0.226659 0.124784 0.129714 0.647901 0.019721 0.159901 0.172477 0.113912 0.231511 0.214864 0.439713 0.223117 0.310596 0.293328 0.172959 0.185557 0.487662 0.136321 0.190459 Consensus sequence: MHHHWHYTMCCHCCCACVAABVH Reverse complement motif 0.185557 0.136321 0.487662 0.190459 0.223117 0.293328 0.310596 0.172959 0.439713 0.231511 0.214864 0.113912 0.172477 0.019721 0.159901 0.647901 0.129714 0.226659 0.124784 0.518843 0.296085 0.350935 0.243498 0.109482 0.052494 0.039832 0.772531 0.135142 0.099164 0.104198 0.029234 0.767405 0.019488 0.018897 0.866774 0.094841 0.066291 0.008729 0.918196 0.006784 0.014573 0.012209 0.964608 0.008610 0.177380 0.207616 0.155368 0.459636 0.010428 0.029142 0.956605 0.003825 0.031328 0.007032 0.947050 0.014590 0.007906 0.348446 0.050304 0.593344 0.538088 0.236500 0.061051 0.164361 0.487023 0.288405 0.017851 0.206721 0.429102 0.222582 0.082555 0.265762 0.519324 0.137896 0.079217 0.263563 0.271487 0.229498 0.174679 0.324336 0.265808 0.250957 0.113088 0.370148 0.263130 0.215534 0.215359 0.305977 0.026801 0.395873 0.173319 0.404007 Consensus sequence: DVVTTVGTGGGHGGYAMHWHHHY Alignment: MHHHWHYTMCCHCCCACVAABVH ---------ACACACACACACAC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00026 Zscan4_secondary Reverse Complement Reverse Complement Backward 3 14 0.046881 Species: Mus musculus Original motif 0.275231 0.387763 0.112851 0.224155 0.269193 0.327669 0.360934 0.042204 0.439403 0.233641 0.022359 0.304596 0.409796 0.139856 0.390450 0.059899 0.038409 0.011231 0.936209 0.014150 0.067382 0.909014 0.021244 0.002359 0.962897 0.009563 0.009687 0.017854 0.043757 0.937596 0.007648 0.010999 0.970698 0.005379 0.016825 0.007098 0.066033 0.636556 0.043955 0.253456 0.797406 0.066726 0.011988 0.123879 0.774632 0.121694 0.017773 0.085901 0.324017 0.235408 0.213365 0.227210 0.365796 0.192247 0.134547 0.307410 0.299601 0.246867 0.098395 0.355137 0.328229 0.242048 0.251143 0.178579 Consensus sequence: HVHRGCACACAAHHHV Reverse complement motif 0.178579 0.242048 0.251143 0.328229 0.355137 0.246867 0.098395 0.299601 0.307410 0.192247 0.134547 0.365796 0.227210 0.235408 0.213365 0.324017 0.085901 0.121694 0.017773 0.774632 0.123879 0.066726 0.011988 0.797406 0.066033 0.043955 0.636556 0.253456 0.007098 0.005379 0.016825 0.970698 0.043757 0.007648 0.937596 0.010999 0.017854 0.009563 0.009687 0.962897 0.067382 0.021244 0.909014 0.002359 0.038409 0.936209 0.011231 0.014150 0.059899 0.139856 0.390450 0.409796 0.304596 0.233641 0.022359 0.439403 0.269193 0.360934 0.327669 0.042204 0.275231 0.112851 0.387763 0.224155 Consensus sequence: BHHHTTGTGTGCKHVD Alignment: BHHHTTGTGTGCKHVD GTGTGTGTGTGTGT-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00400 Zif268 Original Motif Original Motif Forward 7 14 0.047934 Species: Mus musculus Original motif 0.104824 0.412716 0.254506 0.227955 0.644922 0.065476 0.140479 0.149122 0.201205 0.166164 0.347131 0.285501 0.360606 0.256316 0.150766 0.232313 0.199831 0.240681 0.279350 0.280137 0.234308 0.204076 0.321306 0.240310 0.274112 0.462435 0.111425 0.152028 0.067070 0.717501 0.073934 0.141496 0.106745 0.084442 0.658566 0.150247 0.025128 0.967053 0.003585 0.004234 0.006412 0.982989 0.003227 0.007371 0.009588 0.877620 0.002571 0.110221 0.621521 0.355443 0.015669 0.007366 0.002600 0.980275 0.004191 0.012934 0.118773 0.026658 0.783843 0.070725 0.022358 0.822101 0.024684 0.130857 0.713212 0.080912 0.128793 0.077084 0.166568 0.250955 0.107934 0.474544 0.225040 0.222494 0.163301 0.389166 0.268976 0.223206 0.265314 0.242504 0.137052 0.229058 0.148439 0.485451 0.135819 0.304550 0.141994 0.417637 0.272440 0.319501 0.230580 0.177478 Consensus sequence: BADHBDHCGCCCMCGCAHHDBBV Reverse complement motif 0.272440 0.230580 0.319501 0.177478 0.417637 0.304550 0.141994 0.135819 0.485451 0.229058 0.148439 0.137052 0.242504 0.223206 0.265314 0.268976 0.389166 0.222494 0.163301 0.225040 0.474544 0.250955 0.107934 0.166568 0.077084 0.080912 0.128793 0.713212 0.022358 0.024684 0.822101 0.130857 0.118773 0.783843 0.026658 0.070725 0.002600 0.004191 0.980275 0.012934 0.007366 0.355443 0.015669 0.621521 0.009588 0.002571 0.877620 0.110221 0.006412 0.003227 0.982989 0.007371 0.025128 0.003585 0.967053 0.004234 0.106745 0.658566 0.084442 0.150247 0.067070 0.073934 0.717501 0.141496 0.274112 0.111425 0.462435 0.152028 0.234308 0.321306 0.204076 0.240310 0.280137 0.240681 0.279350 0.199831 0.232313 0.256316 0.150766 0.360606 0.201205 0.347131 0.166164 0.285501 0.149122 0.065476 0.140479 0.644922 0.104824 0.254506 0.412716 0.227955 Consensus sequence: VVVDHHTGCGYGGGCGDHVHHTB Alignment: BADHBDHCGCCCMCGCAHHDBBV ------ACACACACACACAC--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v016060_secondary Reverse Complement Original Motif Backward 9 14 0.048596 Species: Mus musculus Original motif 0.319838 0.171199 0.138099 0.370865 0.269358 0.196600 0.346909 0.187133 0.176807 0.338888 0.193903 0.290402 0.230268 0.119645 0.310500 0.339587 0.517372 0.257658 0.111673 0.113296 0.159477 0.126524 0.561119 0.152879 0.117072 0.553013 0.130919 0.198996 0.073372 0.163548 0.525014 0.238066 0.143608 0.186896 0.170528 0.498967 0.054943 0.079034 0.722992 0.143031 0.048852 0.015134 0.852458 0.083556 0.029001 0.023938 0.918900 0.028160 0.036727 0.092645 0.090591 0.780037 0.017757 0.057598 0.895222 0.029423 0.026113 0.048113 0.879744 0.046030 0.023041 0.787043 0.123490 0.066426 0.579766 0.004868 0.296873 0.118493 0.303862 0.042931 0.290151 0.363055 0.099672 0.237431 0.262301 0.400597 0.217788 0.163908 0.367628 0.250676 0.450783 0.141108 0.226137 0.181972 0.485086 0.102553 0.242662 0.169700 0.109057 0.454222 0.145665 0.291056 Consensus sequence: HVBDAGCGBGGGTGGCRDBDDDB Reverse complement motif 0.109057 0.145665 0.454222 0.291056 0.169700 0.102553 0.242662 0.485086 0.181972 0.141108 0.226137 0.450783 0.217788 0.367628 0.163908 0.250676 0.400597 0.237431 0.262301 0.099672 0.363055 0.042931 0.290151 0.303862 0.118493 0.004868 0.296873 0.579766 0.023041 0.123490 0.787043 0.066426 0.026113 0.879744 0.048113 0.046030 0.017757 0.895222 0.057598 0.029423 0.780037 0.092645 0.090591 0.036727 0.029001 0.918900 0.023938 0.028160 0.048852 0.852458 0.015134 0.083556 0.054943 0.722992 0.079034 0.143031 0.498967 0.186896 0.170528 0.143608 0.073372 0.525014 0.163548 0.238066 0.117072 0.130919 0.553013 0.198996 0.159477 0.561119 0.126524 0.152879 0.113296 0.257658 0.111673 0.517372 0.339587 0.119645 0.310500 0.230268 0.176807 0.193903 0.338888 0.290402 0.269358 0.346909 0.196600 0.187133 0.370865 0.171199 0.138099 0.319838 Consensus sequence: BDDHVDKGCCACCCVCGCTDBVH Alignment: HVBDAGCGBGGGTGGCRDBDDDB -GTGTGTGTGTGTGT-------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v016060_secondary Original Motif Original Motif Backward 8 14 0.052696 Species: Mus musculus Original motif 0.168550 0.345968 0.396524 0.088958 0.038113 0.360882 0.114042 0.486963 0.349356 0.180599 0.051416 0.418629 0.258773 0.332518 0.244932 0.163778 0.371663 0.208591 0.263136 0.156609 0.225440 0.321741 0.175932 0.276887 0.100827 0.656850 0.018644 0.223679 0.494140 0.155427 0.327424 0.023009 0.105642 0.805846 0.027712 0.060800 0.065110 0.845072 0.058046 0.031772 0.649343 0.110180 0.180680 0.059797 0.064269 0.853604 0.066860 0.015268 0.437421 0.533797 0.016833 0.011948 0.121694 0.787708 0.016177 0.074421 0.625382 0.066925 0.266070 0.041623 0.117819 0.608153 0.165139 0.108889 0.145639 0.102001 0.604926 0.147434 0.521188 0.184986 0.064607 0.229219 0.180371 0.274237 0.096591 0.448801 0.071055 0.455813 0.332817 0.140315 0.084503 0.199982 0.448293 0.267222 0.389451 0.169545 0.155507 0.285497 0.424314 0.227621 0.101210 0.246855 Consensus sequence: VYWVVHCRCCACMCACGAHSBHH Reverse complement motif 0.246855 0.227621 0.101210 0.424314 0.285497 0.169545 0.155507 0.389451 0.084503 0.448293 0.199982 0.267222 0.071055 0.332817 0.455813 0.140315 0.448801 0.274237 0.096591 0.180371 0.229219 0.184986 0.064607 0.521188 0.145639 0.604926 0.102001 0.147434 0.117819 0.165139 0.608153 0.108889 0.041623 0.066925 0.266070 0.625382 0.121694 0.016177 0.787708 0.074421 0.437421 0.016833 0.533797 0.011948 0.064269 0.066860 0.853604 0.015268 0.059797 0.110180 0.180680 0.649343 0.065110 0.058046 0.845072 0.031772 0.105642 0.027712 0.805846 0.060800 0.023009 0.155427 0.327424 0.494140 0.100827 0.018644 0.656850 0.223679 0.225440 0.175932 0.321741 0.276887 0.156609 0.208591 0.263136 0.371663 0.258773 0.244932 0.332518 0.163778 0.418629 0.180599 0.051416 0.349356 0.486963 0.360882 0.114042 0.038113 0.168550 0.396524 0.345968 0.088958 Consensus sequence: HHBSHTCGTGRGTGGKGDBVWMV Alignment: VYWVVHCRCCACMCACGAHSBHH --ACACACACACACAC------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00036 Myf6_secondary Original Motif Original Motif Forward 1 14 0.054087 Species: Mus musculus Original motif 0.345146 0.261059 0.273931 0.119863 0.222137 0.272923 0.332024 0.172916 0.269602 0.278951 0.245221 0.206225 0.485406 0.144018 0.294421 0.076155 0.577731 0.270563 0.078955 0.072752 0.070027 0.750816 0.062819 0.116339 0.685018 0.105175 0.137110 0.072697 0.162574 0.071041 0.638464 0.127921 0.343240 0.389633 0.206226 0.060900 0.080169 0.790323 0.114211 0.015297 0.167035 0.201642 0.462780 0.168543 0.114383 0.664317 0.166143 0.055157 0.392143 0.114475 0.340085 0.153298 0.208147 0.577473 0.142694 0.071686 0.168632 0.563135 0.066181 0.202052 Consensus sequence: VVVRACAGVCBCDCC Reverse complement motif 0.168632 0.066181 0.563135 0.202052 0.208147 0.142694 0.577473 0.071686 0.153298 0.114475 0.340085 0.392143 0.114383 0.166143 0.664317 0.055157 0.167035 0.462780 0.201642 0.168543 0.080169 0.114211 0.790323 0.015297 0.343240 0.206226 0.389633 0.060900 0.162574 0.638464 0.071041 0.127921 0.072697 0.105175 0.137110 0.685018 0.070027 0.062819 0.750816 0.116339 0.072752 0.270563 0.078955 0.577731 0.076155 0.144018 0.294421 0.485406 0.269602 0.245221 0.278951 0.206225 0.222137 0.332024 0.272923 0.172916 0.119863 0.261059 0.273931 0.345146 Consensus sequence: GGDGBGVCTGTKVVB Alignment: VVVRACAGVCBCDCC ACACACACACACAC- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00526 Foxn1_secondary Original Motif Original Motif Backward 9 14 0.055008 Species: Mus musculus Original motif 0.477863 0.106306 0.184102 0.231729 0.304951 0.149020 0.361418 0.184612 0.548996 0.056128 0.348902 0.045974 0.385727 0.477782 0.086218 0.050273 0.409556 0.232265 0.173851 0.184328 0.174550 0.312880 0.307123 0.205448 0.850398 0.047204 0.041665 0.060734 0.141234 0.548534 0.142230 0.168002 0.059462 0.026354 0.892948 0.021236 0.053714 0.870297 0.028935 0.047055 0.086273 0.069147 0.805284 0.039296 0.033781 0.573881 0.034115 0.358223 0.035191 0.079663 0.824970 0.060176 0.051830 0.862631 0.019359 0.066180 0.178685 0.015738 0.762485 0.043092 0.058988 0.042615 0.017608 0.880789 0.202382 0.173360 0.284095 0.340163 0.098493 0.234651 0.506524 0.160333 0.109087 0.336204 0.250510 0.304198 0.130945 0.250843 0.177122 0.441090 0.353830 0.138838 0.162784 0.344548 0.114290 0.417163 0.160662 0.307885 Consensus sequence: DDRMHBACGCGYGCGTDGBBDB Reverse complement motif 0.114290 0.160662 0.417163 0.307885 0.344548 0.138838 0.162784 0.353830 0.441090 0.250843 0.177122 0.130945 0.109087 0.250510 0.336204 0.304198 0.098493 0.506524 0.234651 0.160333 0.340163 0.173360 0.284095 0.202382 0.880789 0.042615 0.017608 0.058988 0.178685 0.762485 0.015738 0.043092 0.051830 0.019359 0.862631 0.066180 0.035191 0.824970 0.079663 0.060176 0.033781 0.034115 0.573881 0.358223 0.086273 0.805284 0.069147 0.039296 0.053714 0.028935 0.870297 0.047055 0.059462 0.892948 0.026354 0.021236 0.141234 0.142230 0.548534 0.168002 0.060734 0.047204 0.041665 0.850398 0.174550 0.307123 0.312880 0.205448 0.184328 0.232265 0.173851 0.409556 0.385727 0.086218 0.477782 0.050273 0.045974 0.056128 0.348902 0.548996 0.304951 0.361418 0.149020 0.184612 0.231729 0.106306 0.184102 0.477863 Consensus sequence: BDVBCDACGCKCGCGTBHRKHD Alignment: DDRMHBACGCGYGCGTDGBBDB ACACACACACACAC-------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v015681_primary Original Motif Original Motif Backward 1 14 0.055413 Species: Mus musculus Original motif 0.183797 0.268049 0.330111 0.218043 0.127599 0.330310 0.243614 0.298477 0.143199 0.188046 0.268593 0.400162 0.214690 0.205230 0.247090 0.332990 0.294688 0.299104 0.327152 0.079056 0.221909 0.193223 0.480155 0.104712 0.444072 0.068239 0.481838 0.005852 0.006182 0.015429 0.901278 0.077111 0.766535 0.111138 0.121632 0.000696 0.014848 0.973961 0.000298 0.010893 0.001807 0.992200 0.002669 0.003324 0.795344 0.140510 0.018576 0.045571 0.006990 0.988200 0.002510 0.002299 0.154898 0.842296 0.000998 0.001808 0.029577 0.919262 0.006935 0.044226 0.677987 0.032075 0.185065 0.104874 0.195132 0.364580 0.319321 0.120967 0.225412 0.115034 0.612849 0.046705 0.548628 0.058900 0.162857 0.229616 0.112531 0.340331 0.165910 0.381227 0.073029 0.303078 0.363896 0.259997 0.561485 0.260567 0.092979 0.084969 0.132283 0.457691 0.140159 0.269867 Consensus sequence: BBBDVVRGACCACCCAVGABBAB Reverse complement motif 0.132283 0.140159 0.457691 0.269867 0.084969 0.260567 0.092979 0.561485 0.073029 0.363896 0.303078 0.259997 0.381227 0.340331 0.165910 0.112531 0.229616 0.058900 0.162857 0.548628 0.225412 0.612849 0.115034 0.046705 0.195132 0.319321 0.364580 0.120967 0.104874 0.032075 0.185065 0.677987 0.029577 0.006935 0.919262 0.044226 0.154898 0.000998 0.842296 0.001808 0.006990 0.002510 0.988200 0.002299 0.045571 0.140510 0.018576 0.795344 0.001807 0.002669 0.992200 0.003324 0.014848 0.000298 0.973961 0.010893 0.000696 0.111138 0.121632 0.766535 0.006182 0.901278 0.015429 0.077111 0.444072 0.481838 0.068239 0.005852 0.221909 0.480155 0.193223 0.104712 0.294688 0.327152 0.299104 0.079056 0.332990 0.205230 0.247090 0.214690 0.400162 0.188046 0.268593 0.143199 0.127599 0.243614 0.330310 0.298477 0.183797 0.330111 0.268049 0.218043 Consensus sequence: BTBVTCVTGGGTGGTCMVVDVBB Alignment: BBBDVVRGACCACCCAVGABBAB ---------ACACACACACACAC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00096 Sox13_secondary Original Motif Reverse Complement Forward 1 14 0.058256 Species: Mus musculus Original motif 0.262581 0.115233 0.405525 0.216661 0.246681 0.142854 0.145056 0.465409 0.341041 0.154355 0.306628 0.197976 0.242211 0.263918 0.113187 0.380684 0.119326 0.241913 0.117198 0.521563 0.054120 0.036135 0.784219 0.125525 0.076634 0.048399 0.788586 0.086381 0.215316 0.044119 0.663927 0.076638 0.248538 0.159141 0.015452 0.576869 0.047049 0.083570 0.788798 0.080583 0.071948 0.035098 0.768849 0.124105 0.123777 0.030383 0.713425 0.132415 0.294760 0.182119 0.181553 0.341567 0.516589 0.129377 0.116698 0.237336 0.350326 0.186505 0.112598 0.350571 0.311469 0.198085 0.147986 0.342460 0.185126 0.130721 0.242572 0.441582 Consensus sequence: DDDHTGGGTGGGHAHHD Reverse complement motif 0.441582 0.130721 0.242572 0.185126 0.342460 0.198085 0.147986 0.311469 0.350571 0.186505 0.112598 0.350326 0.237336 0.129377 0.116698 0.516589 0.341567 0.182119 0.181553 0.294760 0.123777 0.713425 0.030383 0.132415 0.071948 0.768849 0.035098 0.124105 0.047049 0.788798 0.083570 0.080583 0.576869 0.159141 0.015452 0.248538 0.215316 0.663927 0.044119 0.076638 0.076634 0.788586 0.048399 0.086381 0.054120 0.784219 0.036135 0.125525 0.521563 0.241913 0.117198 0.119326 0.380684 0.263918 0.113187 0.242211 0.197976 0.154355 0.306628 0.341041 0.465409 0.142854 0.145056 0.246681 0.262581 0.405525 0.115233 0.216661 Consensus sequence: DHHTHCCCACCCAHDDH Alignment: DDDHTGGGTGGGHAHHD ACACACACACACAC--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 3 Motif name: Motif 3 Original motif 0.239437 0.274648 0.077465 0.408451 0.084507 0.654930 0.147887 0.112676 0.753521 0.000000 0.000000 0.246479 0.309859 0.000000 0.654930 0.035211 0.302817 0.049296 0.584507 0.063380 0.542254 0.007042 0.394366 0.056338 0.457746 0.253521 0.190141 0.098592 0.584507 0.169014 0.232394 0.014085 0.274648 0.626760 0.098592 0.000000 0.852112 0.000000 0.021127 0.126761 0.000000 0.570423 0.429577 0.000000 0.760563 0.000000 0.000000 0.239437 0.204225 0.021127 0.774648 0.000000 Consensus sequence: HCAGRRVACASAG Reserve complement motif 0.204225 0.774648 0.021127 0.000000 0.239437 0.000000 0.000000 0.760563 0.000000 0.429577 0.570423 0.000000 0.126761 0.000000 0.021127 0.852112 0.274648 0.098592 0.626760 0.000000 0.014085 0.169014 0.232394 0.584507 0.098592 0.253521 0.190141 0.457746 0.056338 0.007042 0.394366 0.542254 0.302817 0.584507 0.049296 0.063380 0.309859 0.654930 0.000000 0.035211 0.246479 0.000000 0.000000 0.753521 0.084507 0.147887 0.654930 0.112676 0.408451 0.274648 0.077465 0.239437 Consensus sequence: CTSTGTBKMCTGH ************************************************************************ Best Matches for Motif ID 3 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00028 Tcfap2e_secondary Original Motif Original Motif Backward 1 13 0.044512 Species: Mus musculus Original motif 0.248591 0.214386 0.166769 0.370254 0.416041 0.167262 0.218682 0.198015 0.195301 0.542527 0.153042 0.109129 0.240156 0.185228 0.255545 0.319071 0.195809 0.247688 0.280778 0.275725 0.271555 0.129776 0.497286 0.101382 0.738080 0.057879 0.078760 0.125281 0.728876 0.074205 0.092737 0.104182 0.694380 0.084957 0.159476 0.061186 0.665572 0.111592 0.131546 0.091289 0.782384 0.059680 0.047525 0.110411 0.769981 0.105692 0.056467 0.067860 0.402932 0.087712 0.172674 0.336682 0.409485 0.160886 0.229779 0.199850 Consensus sequence: HDCDBRAAAAAADD Reverse complement motif 0.199850 0.160886 0.229779 0.409485 0.336682 0.087712 0.172674 0.402932 0.067860 0.105692 0.056467 0.769981 0.110411 0.059680 0.047525 0.782384 0.091289 0.111592 0.131546 0.665572 0.061186 0.084957 0.159476 0.694380 0.104182 0.074205 0.092737 0.728876 0.125281 0.057879 0.078760 0.738080 0.271555 0.497286 0.129776 0.101382 0.195809 0.280778 0.247688 0.275725 0.319071 0.185228 0.255545 0.240156 0.195301 0.153042 0.542527 0.109129 0.198015 0.167262 0.218682 0.416041 0.370254 0.214386 0.166769 0.248591 Consensus sequence: DDTTTTTTMBDGDH Alignment: HDCDBRAAAAAADD -HCAGRRVACASAG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00034 Sox7_secondary Reverse Complement Original Motif Forward 10 13 0.044879 Species: Mus musculus Original motif 0.067627 0.131333 0.654425 0.146615 0.156488 0.114442 0.145630 0.583441 0.206450 0.265630 0.358017 0.169903 0.090729 0.460713 0.274712 0.173847 0.285994 0.099998 0.154485 0.459523 0.635908 0.184787 0.072982 0.106323 0.748421 0.039204 0.092605 0.119769 0.081342 0.061327 0.044532 0.812799 0.143120 0.043879 0.024216 0.788785 0.247544 0.092102 0.621453 0.038901 0.295531 0.036295 0.027594 0.640580 0.194561 0.305468 0.339916 0.160055 0.175038 0.193568 0.101212 0.530182 0.145226 0.167488 0.559871 0.127415 0.271501 0.237429 0.206701 0.284369 0.216834 0.109191 0.569605 0.104370 0.182624 0.177160 0.300475 0.339742 0.331737 0.198645 0.265137 0.204482 0.230155 0.359365 0.183450 0.227029 0.056581 0.067297 0.463052 0.413070 0.198891 0.324626 0.304424 0.172059 0.181968 0.287547 0.202419 0.328066 Consensus sequence: GTVBDAATTGTVTGHGDDHKVB Reverse complement motif 0.328066 0.287547 0.202419 0.181968 0.198891 0.304424 0.324626 0.172059 0.056581 0.463052 0.067297 0.413070 0.230155 0.183450 0.359365 0.227029 0.204482 0.198645 0.265137 0.331737 0.339742 0.177160 0.300475 0.182624 0.216834 0.569605 0.109191 0.104370 0.284369 0.237429 0.206701 0.271501 0.145226 0.559871 0.167488 0.127415 0.530182 0.193568 0.101212 0.175038 0.194561 0.339916 0.305468 0.160055 0.640580 0.036295 0.027594 0.295531 0.247544 0.621453 0.092102 0.038901 0.788785 0.043879 0.024216 0.143120 0.812799 0.061327 0.044532 0.081342 0.119769 0.039204 0.092605 0.748421 0.106323 0.184787 0.072982 0.635908 0.459523 0.099998 0.154485 0.285994 0.090729 0.274712 0.460713 0.173847 0.206450 0.358017 0.265630 0.169903 0.583441 0.114442 0.145630 0.156488 0.067627 0.654425 0.131333 0.146615 Consensus sequence: VVYDDDCHCAVACAATTDBVAC Alignment: GTVBDAATTGTVTGHGDDHKVB ---------CTSTGTBKMCTGH ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00041 Foxj1_primary Reverse Complement Reverse Complement Backward 1 13 0.045455 Species: Mus musculus Original motif 0.446042 0.209997 0.124191 0.219770 0.271534 0.218131 0.245258 0.265077 0.368646 0.184693 0.168482 0.278180 0.348384 0.034204 0.583335 0.034077 0.040365 0.085618 0.013162 0.860855 0.824790 0.156631 0.004063 0.014515 0.835134 0.069381 0.003505 0.091980 0.967572 0.009280 0.006259 0.016890 0.009507 0.909577 0.004492 0.076424 0.947956 0.006994 0.008177 0.036873 0.599204 0.170666 0.065622 0.164508 0.708795 0.035865 0.070557 0.184782 0.303191 0.287145 0.184748 0.224917 0.285550 0.184167 0.248662 0.281621 0.235315 0.210836 0.254428 0.299421 0.220038 0.158539 0.286552 0.334871 Consensus sequence: HDHRTAAACAAAHDDD Reverse complement motif 0.334871 0.158539 0.286552 0.220038 0.299421 0.210836 0.254428 0.235315 0.281621 0.184167 0.248662 0.285550 0.224917 0.287145 0.184748 0.303191 0.184782 0.035865 0.070557 0.708795 0.164508 0.170666 0.065622 0.599204 0.036873 0.006994 0.008177 0.947956 0.009507 0.004492 0.909577 0.076424 0.016890 0.009280 0.006259 0.967572 0.091980 0.069381 0.003505 0.835134 0.014515 0.156631 0.004063 0.824790 0.860855 0.085618 0.013162 0.040365 0.348384 0.583335 0.034204 0.034077 0.278180 0.184693 0.168482 0.368646 0.265077 0.218131 0.245258 0.271534 0.219770 0.209997 0.124191 0.446042 Consensus sequence: DDDHTTTGTTTAMHDH Alignment: DDDHTTTGTTTAMHDH ---CTSTGTBKMCTGH ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00016 Sry_secondary Original Motif Original Motif Forward 1 13 0.048141 Species: Mus musculus Original motif 0.219740 0.291283 0.118755 0.370223 0.242432 0.282700 0.205912 0.268956 0.327415 0.133992 0.255532 0.283060 0.263415 0.304333 0.213668 0.218583 0.259356 0.177510 0.294274 0.268860 0.315458 0.184947 0.444440 0.055155 0.572256 0.199521 0.180616 0.047606 0.881847 0.020818 0.032731 0.064603 0.028134 0.863210 0.052977 0.055679 0.921133 0.023179 0.036360 0.019328 0.913642 0.029557 0.028830 0.027972 0.131537 0.035078 0.033568 0.799817 0.412204 0.069669 0.279439 0.238689 0.247458 0.179342 0.390493 0.182707 0.282951 0.233824 0.324889 0.158336 0.176058 0.325159 0.163416 0.335366 0.172201 0.210000 0.453746 0.164053 Consensus sequence: HHDHDRAACAATDDVHV Reverse complement motif 0.172201 0.453746 0.210000 0.164053 0.335366 0.325159 0.163416 0.176058 0.282951 0.324889 0.233824 0.158336 0.247458 0.390493 0.179342 0.182707 0.238689 0.069669 0.279439 0.412204 0.799817 0.035078 0.033568 0.131537 0.027972 0.029557 0.028830 0.913642 0.019328 0.023179 0.036360 0.921133 0.028134 0.052977 0.863210 0.055679 0.064603 0.020818 0.032731 0.881847 0.047606 0.199521 0.180616 0.572256 0.315458 0.444440 0.184947 0.055155 0.259356 0.294274 0.177510 0.268860 0.263415 0.213668 0.304333 0.218583 0.283060 0.133992 0.255532 0.327415 0.242432 0.205912 0.282700 0.268956 0.370223 0.291283 0.118755 0.219740 Consensus sequence: VHVHDATTGTTMHDDDH Alignment: HHDHDRAACAATDDVHV HCAGRRVACASAG---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00077 Srf_secondary Original Motif Original Motif Backward 4 13 0.054571 Species: Mus musculus Original motif 0.162968 0.284828 0.440984 0.111220 0.151392 0.200635 0.205316 0.442657 0.267215 0.083669 0.192498 0.456618 0.332771 0.180711 0.200027 0.286491 0.509370 0.102954 0.242569 0.145107 0.666262 0.077309 0.154466 0.101962 0.737968 0.113335 0.100401 0.048296 0.658878 0.141580 0.134033 0.065510 0.766115 0.094051 0.069763 0.070072 0.755621 0.088491 0.044802 0.111086 0.749083 0.135917 0.047510 0.067490 0.663231 0.176795 0.028134 0.131839 0.553358 0.277659 0.038655 0.130328 0.392578 0.314083 0.209844 0.083495 0.198462 0.237132 0.239466 0.324940 0.275121 0.210087 0.194779 0.320013 0.287748 0.277395 0.142704 0.292154 Consensus sequence: VBDDAAAAAAAAMVBHH Reverse complement motif 0.292154 0.277395 0.142704 0.287748 0.320013 0.210087 0.194779 0.275121 0.324940 0.237132 0.239466 0.198462 0.083495 0.314083 0.209844 0.392578 0.130328 0.277659 0.038655 0.553358 0.131839 0.176795 0.028134 0.663231 0.067490 0.135917 0.047510 0.749083 0.111086 0.088491 0.044802 0.755621 0.070072 0.094051 0.069763 0.766115 0.065510 0.141580 0.134033 0.658878 0.048296 0.113335 0.100401 0.737968 0.101962 0.077309 0.154466 0.666262 0.145107 0.102954 0.242569 0.509370 0.286491 0.180711 0.200027 0.332771 0.456618 0.083669 0.192498 0.267215 0.442657 0.200635 0.205316 0.151392 0.162968 0.440984 0.284828 0.111220 Consensus sequence: HHVBYTTTTTTTTDDVV Alignment: VBDDAAAAAAAAMVBHH -HCAGRRVACASAG--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00058 Tcf3_secondary Original Motif Original Motif Forward 2 13 0.055307 Species: Mus musculus Original motif 0.337361 0.181848 0.282900 0.197891 0.192382 0.237864 0.390655 0.179099 0.134397 0.374785 0.355693 0.135126 0.113675 0.477609 0.347988 0.060728 0.187411 0.212669 0.392109 0.207811 0.497832 0.111474 0.194855 0.195838 0.526043 0.126712 0.214265 0.132981 0.433876 0.180023 0.104860 0.281242 0.539525 0.140192 0.113374 0.206909 0.397301 0.176842 0.115802 0.310056 0.529441 0.199807 0.148595 0.122158 0.485035 0.166231 0.150350 0.198384 0.532479 0.165910 0.177757 0.123854 0.351189 0.173665 0.138509 0.336637 0.260688 0.223764 0.189060 0.326488 Consensus sequence: DVBSBDAHAHAHAHH Reverse complement motif 0.326488 0.223764 0.189060 0.260688 0.336637 0.173665 0.138509 0.351189 0.123854 0.165910 0.177757 0.532479 0.198384 0.166231 0.150350 0.485035 0.122158 0.199807 0.148595 0.529441 0.310056 0.176842 0.115802 0.397301 0.206909 0.140192 0.113374 0.539525 0.281242 0.180023 0.104860 0.433876 0.132981 0.126712 0.214265 0.526043 0.195838 0.111474 0.194855 0.497832 0.187411 0.392109 0.212669 0.207811 0.113675 0.347988 0.477609 0.060728 0.134397 0.355693 0.374785 0.135126 0.192382 0.390655 0.237864 0.179099 0.197891 0.181848 0.282900 0.337361 Consensus sequence: HHTHTHTHTDBSBVD Alignment: DVBSBDAHAHAHAHH -HCAGRRVACASAG- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00091 Sox5_secondary Original Motif Original Motif Backward 1 13 0.056259 Species: Mus musculus Original motif 0.246579 0.230352 0.241808 0.281260 0.352611 0.218685 0.156655 0.272048 0.249499 0.128873 0.215834 0.405794 0.007509 0.736577 0.087481 0.168432 0.566572 0.059259 0.191060 0.183109 0.149304 0.024062 0.164680 0.661954 0.540015 0.279108 0.133921 0.046956 0.755323 0.101222 0.038315 0.105140 0.170385 0.095406 0.092958 0.641252 0.097171 0.227591 0.065510 0.609729 0.348302 0.171087 0.180187 0.300424 0.602718 0.200284 0.114330 0.082668 0.142864 0.302784 0.453243 0.101109 0.252334 0.240815 0.258541 0.248309 0.285758 0.214950 0.251057 0.248235 Consensus sequence: DHDCATMATTDASDD Reverse complement motif 0.248235 0.214950 0.251057 0.285758 0.252334 0.258541 0.240815 0.248309 0.142864 0.453243 0.302784 0.101109 0.082668 0.200284 0.114330 0.602718 0.300424 0.171087 0.180187 0.348302 0.609729 0.227591 0.065510 0.097171 0.641252 0.095406 0.092958 0.170385 0.105140 0.101222 0.038315 0.755323 0.046956 0.279108 0.133921 0.540015 0.661954 0.024062 0.164680 0.149304 0.183109 0.059259 0.191060 0.566572 0.007509 0.087481 0.736577 0.168432 0.405794 0.128873 0.215834 0.249499 0.272048 0.218685 0.156655 0.352611 0.281260 0.230352 0.241808 0.246579 Consensus sequence: DHSTDAATYATGDHD Alignment: DHDCATMATTDASDD --HCAGRRVACASAG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00012 Bbx_secondary Reverse Complement Reverse Complement Forward 3 13 0.056498 Species: Mus musculus Original motif 0.198665 0.226452 0.178091 0.396792 0.303100 0.271940 0.341965 0.082996 0.485689 0.146789 0.061383 0.306139 0.220175 0.274625 0.207682 0.297518 0.163114 0.264054 0.262613 0.310218 0.074776 0.044219 0.808086 0.072919 0.061317 0.029647 0.094262 0.814774 0.047386 0.103231 0.045272 0.804111 0.815482 0.052556 0.087540 0.044422 0.748924 0.178468 0.026304 0.046303 0.162082 0.694436 0.035034 0.108448 0.641927 0.140862 0.156431 0.060780 0.142548 0.265771 0.421667 0.170014 0.280841 0.232137 0.159362 0.327660 0.167379 0.234928 0.287554 0.310139 0.295358 0.126213 0.392756 0.185673 0.281157 0.210000 0.368828 0.140015 Consensus sequence: HVWHBGTTAACABHBDV Reverse complement motif 0.281157 0.368828 0.210000 0.140015 0.295358 0.392756 0.126213 0.185673 0.310139 0.234928 0.287554 0.167379 0.327660 0.232137 0.159362 0.280841 0.142548 0.421667 0.265771 0.170014 0.060780 0.140862 0.156431 0.641927 0.162082 0.035034 0.694436 0.108448 0.046303 0.178468 0.026304 0.748924 0.044422 0.052556 0.087540 0.815482 0.804111 0.103231 0.045272 0.047386 0.814774 0.029647 0.094262 0.061317 0.074776 0.808086 0.044219 0.072919 0.310218 0.264054 0.262613 0.163114 0.297518 0.274625 0.207682 0.220175 0.306139 0.146789 0.061383 0.485689 0.303100 0.341965 0.271940 0.082996 0.396792 0.226452 0.178091 0.198665 Consensus sequence: VHVHBTGTTAACVHWVH Alignment: VHVHBTGTTAACVHWVH --CTSTGTBKMCTGH-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00073 Foxa2_secondary Original Motif Original Motif Backward 3 13 0.057107 Species: Mus musculus Original motif 0.337264 0.231140 0.283651 0.147945 0.347118 0.236817 0.257338 0.158726 0.431380 0.126811 0.187071 0.254738 0.585753 0.089587 0.164350 0.160310 0.590169 0.225841 0.088487 0.095503 0.091374 0.098551 0.099596 0.710479 0.790999 0.060485 0.081771 0.066745 0.738945 0.032660 0.093144 0.135251 0.071350 0.719067 0.064337 0.145246 0.820757 0.079130 0.029431 0.070682 0.603611 0.145951 0.097449 0.152989 0.530021 0.143634 0.190469 0.135877 0.231297 0.288099 0.276056 0.204548 0.202920 0.232513 0.431635 0.132933 0.198379 0.292889 0.308599 0.200133 Consensus sequence: VVDAATAACAAAVVB Reverse complement motif 0.198379 0.308599 0.292889 0.200133 0.202920 0.431635 0.232513 0.132933 0.231297 0.276056 0.288099 0.204548 0.135877 0.143634 0.190469 0.530021 0.152989 0.145951 0.097449 0.603611 0.070682 0.079130 0.029431 0.820757 0.071350 0.064337 0.719067 0.145246 0.135251 0.032660 0.093144 0.738945 0.066745 0.060485 0.081771 0.790999 0.710479 0.098551 0.099596 0.091374 0.095503 0.225841 0.088487 0.590169 0.160310 0.089587 0.164350 0.585753 0.254738 0.126811 0.187071 0.431380 0.158726 0.236817 0.257338 0.347118 0.147945 0.231140 0.283651 0.337264 Consensus sequence: BVVTTTGTTATTDBB Alignment: VVDAATAACAAAVVB HCAGRRVACASAG-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00054 Tcf7_secondary Reverse Complement Reverse Complement Backward 3 13 0.057500 Species: Mus musculus Original motif 0.245114 0.425060 0.146128 0.183698 0.080878 0.382058 0.241253 0.295810 0.134088 0.097064 0.441002 0.327846 0.129699 0.108033 0.111723 0.650545 0.642754 0.112803 0.078081 0.166363 0.145215 0.080417 0.074321 0.700046 0.098028 0.054508 0.153100 0.694365 0.687599 0.081954 0.149244 0.081203 0.179924 0.253518 0.272465 0.294093 0.628338 0.105355 0.083705 0.182602 0.599410 0.156473 0.106087 0.138030 0.555990 0.217439 0.055153 0.171418 0.236101 0.368060 0.113260 0.282579 0.352217 0.245799 0.158844 0.243140 0.321581 0.223144 0.211146 0.244130 Consensus sequence: HBKTATTABAAAHHH Reverse complement motif 0.244130 0.223144 0.211146 0.321581 0.243140 0.245799 0.158844 0.352217 0.236101 0.113260 0.368060 0.282579 0.171418 0.217439 0.055153 0.555990 0.138030 0.156473 0.106087 0.599410 0.182602 0.105355 0.083705 0.628338 0.294093 0.253518 0.272465 0.179924 0.081203 0.081954 0.149244 0.687599 0.694365 0.054508 0.153100 0.098028 0.700046 0.080417 0.074321 0.145215 0.166363 0.112803 0.078081 0.642754 0.650545 0.108033 0.111723 0.129699 0.134088 0.441002 0.097064 0.327846 0.080878 0.241253 0.382058 0.295810 0.245114 0.146128 0.425060 0.183698 Consensus sequence: HHDTTTVTAATAYBD Alignment: HHDTTTVTAATAYBD CTSTGTBKMCTGH-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 4 Motif name: Motif 4 Original motif 0.450000 0.250000 0.000000 0.300000 0.800000 0.000000 0.000000 0.200000 0.850000 0.000000 0.150000 0.000000 1.000000 0.000000 0.000000 0.000000 0.750000 0.000000 0.250000 0.000000 0.400000 0.300000 0.050000 0.250000 0.850000 0.100000 0.000000 0.050000 0.850000 0.150000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.100000 0.400000 0.000000 0.350000 0.650000 0.000000 0.000000 0.900000 0.000000 0.050000 0.050000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 Consensus sequence: HAAAAHAAARMAAA Reserve complement motif 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.050000 0.000000 0.050000 0.900000 0.350000 0.000000 0.650000 0.000000 0.000000 0.100000 0.400000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.150000 0.000000 0.850000 0.050000 0.100000 0.000000 0.850000 0.250000 0.300000 0.050000 0.400000 0.000000 0.000000 0.250000 0.750000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.150000 0.850000 0.200000 0.000000 0.000000 0.800000 0.300000 0.250000 0.000000 0.450000 Consensus sequence: TTTRKTTTHTTTTH ************************************************************************ Best Matches for Motif ID 4 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00025 Foxk1_primary Reverse Complement Reverse Complement Forward 4 14 0.021226 Species: Mus musculus Original motif 0.338172 0.192194 0.207817 0.261817 0.407924 0.117261 0.278236 0.196580 0.595570 0.070480 0.119221 0.214729 0.710845 0.038748 0.052600 0.197807 0.124647 0.116138 0.178053 0.581162 0.201602 0.005514 0.792110 0.000774 0.024590 0.004193 0.001331 0.969886 0.919465 0.077871 0.000760 0.001904 0.972342 0.010395 0.000580 0.016683 0.991045 0.001495 0.003585 0.003875 0.001358 0.885197 0.000980 0.112465 0.990318 0.001846 0.002968 0.004867 0.804563 0.063147 0.023496 0.108795 0.564824 0.087976 0.102865 0.244336 0.269947 0.300278 0.285008 0.144767 0.337905 0.220102 0.253694 0.188299 0.153781 0.274135 0.318343 0.253741 Consensus sequence: DDAATGTAAACAAAVVB Reverse complement motif 0.153781 0.318343 0.274135 0.253741 0.188299 0.220102 0.253694 0.337905 0.269947 0.285008 0.300278 0.144767 0.244336 0.087976 0.102865 0.564824 0.108795 0.063147 0.023496 0.804563 0.004867 0.001846 0.002968 0.990318 0.001358 0.000980 0.885197 0.112465 0.003875 0.001495 0.003585 0.991045 0.016683 0.010395 0.000580 0.972342 0.001904 0.077871 0.000760 0.919465 0.969886 0.004193 0.001331 0.024590 0.201602 0.792110 0.005514 0.000774 0.581162 0.116138 0.178053 0.124647 0.197807 0.038748 0.052600 0.710845 0.214729 0.070480 0.119221 0.595570 0.196580 0.117261 0.278236 0.407924 0.261817 0.192194 0.207817 0.338172 Consensus sequence: BBVTTTGTTTACATTDD Alignment: BBVTTTGTTTACATTDD ---TTTRKTTTHTTTTH ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00077 Srf_secondary Original Motif Original Motif Backward 1 14 0.021645 Species: Mus musculus Original motif 0.162968 0.284828 0.440984 0.111220 0.151392 0.200635 0.205316 0.442657 0.267215 0.083669 0.192498 0.456618 0.332771 0.180711 0.200027 0.286491 0.509370 0.102954 0.242569 0.145107 0.666262 0.077309 0.154466 0.101962 0.737968 0.113335 0.100401 0.048296 0.658878 0.141580 0.134033 0.065510 0.766115 0.094051 0.069763 0.070072 0.755621 0.088491 0.044802 0.111086 0.749083 0.135917 0.047510 0.067490 0.663231 0.176795 0.028134 0.131839 0.553358 0.277659 0.038655 0.130328 0.392578 0.314083 0.209844 0.083495 0.198462 0.237132 0.239466 0.324940 0.275121 0.210087 0.194779 0.320013 0.287748 0.277395 0.142704 0.292154 Consensus sequence: VBDDAAAAAAAAMVBHH Reverse complement motif 0.292154 0.277395 0.142704 0.287748 0.320013 0.210087 0.194779 0.275121 0.324940 0.237132 0.239466 0.198462 0.083495 0.314083 0.209844 0.392578 0.130328 0.277659 0.038655 0.553358 0.131839 0.176795 0.028134 0.663231 0.067490 0.135917 0.047510 0.749083 0.111086 0.088491 0.044802 0.755621 0.070072 0.094051 0.069763 0.766115 0.065510 0.141580 0.134033 0.658878 0.048296 0.113335 0.100401 0.737968 0.101962 0.077309 0.154466 0.666262 0.145107 0.102954 0.242569 0.509370 0.286491 0.180711 0.200027 0.332771 0.456618 0.083669 0.192498 0.267215 0.442657 0.200635 0.205316 0.151392 0.162968 0.440984 0.284828 0.111220 Consensus sequence: HHVBYTTTTTTTTDDVV Alignment: VBDDAAAAAAAAMVBHH ---HAAAAHAAARMAAA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00039 Foxj3_primary Reverse Complement Reverse Complement Forward 4 14 0.021683 Species: Mus musculus Original motif 0.273456 0.257473 0.208488 0.260583 0.338566 0.133379 0.306363 0.221693 0.475488 0.192852 0.156858 0.174803 0.506619 0.132646 0.170373 0.190362 0.349042 0.127275 0.325924 0.197759 0.303850 0.013619 0.678034 0.004497 0.014136 0.015691 0.003073 0.967100 0.913373 0.082928 0.001910 0.001789 0.956294 0.017745 0.000584 0.025378 0.987796 0.001685 0.004159 0.006360 0.002288 0.814764 0.001427 0.181521 0.986707 0.002688 0.003346 0.007259 0.787378 0.065481 0.057961 0.089180 0.572982 0.089910 0.066184 0.270924 0.224167 0.339979 0.258886 0.176968 0.268414 0.272007 0.239541 0.220038 0.241771 0.394748 0.174273 0.189208 Consensus sequence: HDHADGTAAACAAAVVH Reverse complement motif 0.241771 0.174273 0.394748 0.189208 0.268414 0.239541 0.272007 0.220038 0.224167 0.258886 0.339979 0.176968 0.270924 0.089910 0.066184 0.572982 0.089180 0.065481 0.057961 0.787378 0.007259 0.002688 0.003346 0.986707 0.002288 0.001427 0.814764 0.181521 0.006360 0.001685 0.004159 0.987796 0.025378 0.017745 0.000584 0.956294 0.001789 0.082928 0.001910 0.913373 0.967100 0.015691 0.003073 0.014136 0.303850 0.678034 0.013619 0.004497 0.197759 0.127275 0.325924 0.349042 0.190362 0.132646 0.170373 0.506619 0.174803 0.192852 0.156858 0.475488 0.221693 0.133379 0.306363 0.338566 0.260583 0.257473 0.208488 0.273456 Consensus sequence: DVVTTTGTTTACDTHDH Alignment: DVVTTTGTTTACDTHDH ---TTTRKTTTHTTTTH ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00061 Foxl1_primary Reverse Complement Reverse Complement Backward 1 14 0.023208 Species: Mus musculus Original motif 0.323208 0.152915 0.185111 0.338766 0.428132 0.056109 0.099487 0.416272 0.659386 0.039965 0.035805 0.264843 0.647143 0.049206 0.078984 0.224667 0.208834 0.076592 0.071631 0.642943 0.341077 0.003865 0.649511 0.005547 0.016627 0.001866 0.001715 0.979792 0.952319 0.045294 0.000870 0.001516 0.988834 0.004620 0.000720 0.005826 0.989346 0.001005 0.006467 0.003182 0.001093 0.784230 0.001235 0.213442 0.991209 0.002017 0.001737 0.005037 0.801581 0.037084 0.023060 0.138274 0.528554 0.089350 0.107501 0.274595 0.208802 0.268646 0.368022 0.154530 0.280218 0.221367 0.340497 0.157918 0.146611 0.250725 0.293524 0.309140 Consensus sequence: DWAATRTAAACAAWVVB Reverse complement motif 0.309140 0.250725 0.293524 0.146611 0.280218 0.340497 0.221367 0.157918 0.208802 0.368022 0.268646 0.154530 0.274595 0.089350 0.107501 0.528554 0.138274 0.037084 0.023060 0.801581 0.005037 0.002017 0.001737 0.991209 0.001093 0.001235 0.784230 0.213442 0.003182 0.001005 0.006467 0.989346 0.005826 0.004620 0.000720 0.988834 0.001516 0.045294 0.000870 0.952319 0.979792 0.001866 0.001715 0.016627 0.341077 0.649511 0.003865 0.005547 0.642943 0.076592 0.071631 0.208834 0.224667 0.049206 0.078984 0.647143 0.264843 0.039965 0.035805 0.659386 0.416272 0.056109 0.099487 0.428132 0.338766 0.152915 0.185111 0.323208 Consensus sequence: VVVWTTGTTTAMATTWD Alignment: VVVWTTGTTTAMATTWD ---TTTRKTTTHTTTTH ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00073 Foxa2_primary Reverse Complement Reverse Complement Backward 1 14 0.025394 Species: Mus musculus Original motif 0.335487 0.205062 0.128957 0.330494 0.411635 0.179625 0.175701 0.233038 0.412976 0.128602 0.091890 0.366532 0.608396 0.079002 0.107142 0.205460 0.433474 0.035203 0.153143 0.378180 0.087552 0.005003 0.894586 0.012858 0.004459 0.038951 0.001109 0.955481 0.924470 0.068560 0.001165 0.005805 0.920483 0.070039 0.001674 0.007805 0.988335 0.001902 0.003155 0.006608 0.001527 0.656726 0.002699 0.339047 0.987505 0.001810 0.004336 0.006349 0.719584 0.065184 0.050384 0.164848 0.535389 0.099997 0.102849 0.261764 0.245215 0.272017 0.301499 0.181269 0.306107 0.209040 0.248687 0.236166 0.223744 0.278668 0.251931 0.245657 Consensus sequence: HHWAWGTAAAYAAAVDB Reverse complement motif 0.223744 0.251931 0.278668 0.245657 0.236166 0.209040 0.248687 0.306107 0.245215 0.301499 0.272017 0.181269 0.261764 0.099997 0.102849 0.535389 0.164848 0.065184 0.050384 0.719584 0.006349 0.001810 0.004336 0.987505 0.001527 0.002699 0.656726 0.339047 0.006608 0.001902 0.003155 0.988335 0.007805 0.070039 0.001674 0.920483 0.005805 0.068560 0.001165 0.924470 0.955481 0.038951 0.001109 0.004459 0.087552 0.894586 0.005003 0.012858 0.378180 0.035203 0.153143 0.433474 0.205460 0.079002 0.107142 0.608396 0.366532 0.128602 0.091890 0.412976 0.233038 0.179625 0.175701 0.411635 0.330494 0.205062 0.128957 0.335487 Consensus sequence: BDVTTTKTTTACWTWHH Alignment: BDVTTTKTTTACWTWHH ---TTTRKTTTHTTTTH ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00025 Foxk1_secondary Reverse Complement Reverse Complement Forward 2 14 0.025736 Species: Mus musculus Original motif 0.240753 0.425595 0.141281 0.192371 0.367715 0.247224 0.117353 0.267708 0.489169 0.220343 0.113844 0.176644 0.742256 0.042809 0.146704 0.068231 0.078936 0.546144 0.032328 0.342592 0.588419 0.293580 0.082117 0.035885 0.913924 0.026256 0.050778 0.009042 0.009007 0.565680 0.010683 0.414630 0.947562 0.020878 0.018821 0.012739 0.901384 0.021519 0.030204 0.046893 0.077157 0.797900 0.026432 0.098511 0.824314 0.040128 0.051910 0.083648 0.254436 0.342235 0.143789 0.259539 0.319400 0.338163 0.129746 0.212691 0.231014 0.260719 0.169042 0.339225 Consensus sequence: HHHAYAAYAACAHHH Reverse complement motif 0.339225 0.260719 0.169042 0.231014 0.319400 0.129746 0.338163 0.212691 0.254436 0.143789 0.342235 0.259539 0.083648 0.040128 0.051910 0.824314 0.077157 0.026432 0.797900 0.098511 0.046893 0.021519 0.030204 0.901384 0.012739 0.020878 0.018821 0.947562 0.009007 0.010683 0.565680 0.414630 0.009042 0.026256 0.050778 0.913924 0.035885 0.293580 0.082117 0.588419 0.078936 0.032328 0.546144 0.342592 0.068231 0.042809 0.146704 0.742256 0.176644 0.220343 0.113844 0.489169 0.267708 0.247224 0.117353 0.367715 0.240753 0.141281 0.425595 0.192371 Consensus sequence: HDDTGTTKTTKTHHD Alignment: HDDTGTTKTTKTHHD -TTTRKTTTHTTTTH ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00037 Zfp105_primary Reverse Complement Reverse Complement Forward 2 14 0.028076 Species: Mus musculus Original motif 0.363104 0.182807 0.145232 0.308856 0.419707 0.133742 0.222546 0.224005 0.164481 0.418263 0.052397 0.364858 0.715575 0.117639 0.064914 0.101872 0.883836 0.026985 0.032584 0.056596 0.558797 0.151280 0.033120 0.256803 0.267037 0.403488 0.026746 0.302729 0.939762 0.013627 0.034579 0.012032 0.897072 0.009878 0.035642 0.057408 0.305904 0.516040 0.055311 0.122746 0.880940 0.027958 0.048350 0.042752 0.710082 0.052464 0.040250 0.197204 0.246712 0.125155 0.318627 0.309506 0.429749 0.181755 0.176892 0.211603 0.339643 0.097216 0.355250 0.207891 Consensus sequence: HDYAAAHAAMAADHD Reverse complement motif 0.339643 0.355250 0.097216 0.207891 0.211603 0.181755 0.176892 0.429749 0.246712 0.318627 0.125155 0.309506 0.197204 0.052464 0.040250 0.710082 0.042752 0.027958 0.048350 0.880940 0.305904 0.055311 0.516040 0.122746 0.057408 0.009878 0.035642 0.897072 0.012032 0.013627 0.034579 0.939762 0.267037 0.026746 0.403488 0.302729 0.256803 0.151280 0.033120 0.558797 0.056596 0.026985 0.032584 0.883836 0.101872 0.117639 0.064914 0.715575 0.164481 0.052397 0.418263 0.364858 0.224005 0.133742 0.222546 0.419707 0.308856 0.182807 0.145232 0.363104 Consensus sequence: HHHTTRTTDTTTKDH Alignment: HHHTTRTTDTTTKDH -TTTRKTTTHTTTTH ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00061 Foxl1_secondary Reverse Complement Reverse Complement Backward 1 14 0.028493 Species: Mus musculus Original motif 0.560226 0.121586 0.083231 0.234957 0.318077 0.149137 0.179955 0.352831 0.482497 0.118420 0.173594 0.225488 0.200166 0.160901 0.191493 0.447440 0.033691 0.569719 0.018901 0.377690 0.638020 0.166545 0.021254 0.174181 0.573953 0.105729 0.009308 0.311010 0.890518 0.053364 0.013424 0.042694 0.910758 0.028166 0.032648 0.028428 0.013358 0.738707 0.023981 0.223953 0.911783 0.018754 0.031898 0.037564 0.702891 0.068940 0.076823 0.151346 0.445507 0.320769 0.057216 0.176507 0.587798 0.129586 0.140592 0.142024 0.258981 0.330939 0.167334 0.242747 0.362022 0.333796 0.145861 0.158320 Consensus sequence: ADDDYAWAACAAMAHH Reverse complement motif 0.158320 0.333796 0.145861 0.362022 0.258981 0.167334 0.330939 0.242747 0.142024 0.129586 0.140592 0.587798 0.176507 0.320769 0.057216 0.445507 0.151346 0.068940 0.076823 0.702891 0.037564 0.018754 0.031898 0.911783 0.013358 0.023981 0.738707 0.223953 0.028428 0.028166 0.032648 0.910758 0.042694 0.053364 0.013424 0.890518 0.311010 0.105729 0.009308 0.573953 0.174181 0.166545 0.021254 0.638020 0.033691 0.018901 0.569719 0.377690 0.447440 0.160901 0.191493 0.200166 0.225488 0.118420 0.173594 0.482497 0.352831 0.149137 0.179955 0.318077 0.234957 0.121586 0.083231 0.560226 Consensus sequence: HDTYTTGTTWTKDDDT Alignment: HDTYTTGTTWTKDDDT --TTTRKTTTHTTTTH ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00145 Barhl2 Reverse Complement Reverse Complement Forward 3 14 0.031537 Species: Mus musculus Original motif 0.461695 0.224449 0.118884 0.194972 0.573918 0.178052 0.084607 0.163423 0.509202 0.299283 0.046830 0.144686 0.781754 0.035879 0.132996 0.049371 0.909629 0.018003 0.066327 0.006042 0.185305 0.442819 0.168153 0.203723 0.004152 0.938941 0.000741 0.056166 0.952728 0.004094 0.036915 0.006262 0.962648 0.006522 0.001095 0.029735 0.002949 0.002007 0.002143 0.992902 0.002773 0.003794 0.001682 0.991751 0.985960 0.000635 0.003183 0.010222 0.728479 0.023198 0.141457 0.106866 0.100754 0.330009 0.347597 0.221641 0.392007 0.211701 0.147142 0.249150 0.323968 0.271247 0.123950 0.280834 Consensus sequence: HAMAAHCAATTAABHH Reverse complement motif 0.280834 0.271247 0.123950 0.323968 0.249150 0.211701 0.147142 0.392007 0.100754 0.347597 0.330009 0.221641 0.106866 0.023198 0.141457 0.728479 0.010222 0.000635 0.003183 0.985960 0.991751 0.003794 0.001682 0.002773 0.992902 0.002007 0.002143 0.002949 0.029735 0.006522 0.001095 0.962648 0.006262 0.004094 0.036915 0.952728 0.004152 0.000741 0.938941 0.056166 0.185305 0.168153 0.442819 0.203723 0.006042 0.018003 0.066327 0.909629 0.049371 0.035879 0.132996 0.781754 0.144686 0.299283 0.046830 0.509202 0.163423 0.178052 0.084607 0.573918 0.194972 0.224449 0.118884 0.461695 Consensus sequence: HHBTTAATTGDTTYTH Alignment: HHBTTAATTGDTTYTH --TTTRKTTTHTTTTH ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00090 Elf3_secondary Original Motif Original Motif Backward 1 14 0.032442 Species: Mus musculus Original motif 0.155083 0.152982 0.490906 0.201030 0.123195 0.312681 0.220770 0.343354 0.110252 0.131358 0.153983 0.604406 0.216489 0.490160 0.101348 0.192003 0.396130 0.292429 0.103252 0.208189 0.634770 0.070898 0.070668 0.223664 0.667102 0.099915 0.067576 0.165407 0.625495 0.095579 0.039353 0.239573 0.717478 0.093228 0.024737 0.164558 0.729965 0.048628 0.024557 0.196850 0.670909 0.118718 0.043692 0.166681 0.689441 0.050145 0.038829 0.221584 0.506735 0.159498 0.095635 0.238132 0.406093 0.298915 0.149902 0.145090 0.193913 0.282078 0.096706 0.427303 0.272324 0.154790 0.262469 0.310417 0.224484 0.458724 0.060144 0.256647 Consensus sequence: DBTHHAAAAAAAAVHDH Reverse complement motif 0.224484 0.060144 0.458724 0.256647 0.310417 0.154790 0.262469 0.272324 0.427303 0.282078 0.096706 0.193913 0.145090 0.298915 0.149902 0.406093 0.238132 0.159498 0.095635 0.506735 0.221584 0.050145 0.038829 0.689441 0.166681 0.118718 0.043692 0.670909 0.196850 0.048628 0.024557 0.729965 0.164558 0.093228 0.024737 0.717478 0.239573 0.095579 0.039353 0.625495 0.165407 0.099915 0.067576 0.667102 0.223664 0.070898 0.070668 0.634770 0.208189 0.292429 0.103252 0.396130 0.216489 0.101348 0.490160 0.192003 0.604406 0.131358 0.153983 0.110252 0.343354 0.312681 0.220770 0.123195 0.155083 0.490906 0.152982 0.201030 Consensus sequence: DDHBTTTTTTTTHDAVH Alignment: DBTHHAAAAAAAAVHDH ---HAAAAHAAARMAAA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 5 Motif name: Motif 5 Original motif 0.000000 0.812500 0.125000 0.062500 0.375000 0.000000 0.000000 0.625000 0.062500 0.000000 0.937500 0.000000 0.562500 0.125000 0.187500 0.125000 0.000000 0.000000 1.000000 0.000000 0.062500 0.937500 0.000000 0.000000 0.000000 0.937500 0.062500 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.625000 0.000000 0.375000 0.000000 0.937500 0.062500 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.562500 0.000000 0.437500 0.000000 0.125000 0.125000 0.750000 0.062500 0.625000 0.000000 0.312500 Consensus sequence: CWGAGCCAYCTYTC Reserve complement motif 0.062500 0.000000 0.625000 0.312500 0.750000 0.125000 0.125000 0.000000 0.000000 0.000000 0.562500 0.437500 1.000000 0.000000 0.000000 0.000000 0.000000 0.062500 0.937500 0.000000 0.000000 0.000000 0.625000 0.375000 0.000000 0.000000 0.000000 1.000000 0.000000 0.062500 0.937500 0.000000 0.062500 0.000000 0.937500 0.000000 0.000000 1.000000 0.000000 0.000000 0.125000 0.125000 0.187500 0.562500 0.062500 0.937500 0.000000 0.000000 0.625000 0.000000 0.000000 0.375000 0.000000 0.125000 0.812500 0.062500 Consensus sequence: GAKAGKTGGCTCWG ************************************************************************ Best Matches for Motif ID 5 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00068 Eomes_secondary Reverse Complement Original Motif Backward 2 14 0.012034 Species: Mus musculus Original motif 0.253642 0.252604 0.298295 0.195458 0.112892 0.341342 0.341061 0.204704 0.297430 0.215095 0.343350 0.144125 0.241098 0.129378 0.421448 0.208076 0.894201 0.007299 0.061032 0.037468 0.052259 0.054303 0.856609 0.036829 0.005074 0.015048 0.966734 0.013144 0.003258 0.061529 0.002368 0.932845 0.017531 0.005025 0.973155 0.004289 0.116022 0.030172 0.047139 0.806667 0.027749 0.602513 0.009946 0.359792 0.018763 0.048982 0.794648 0.137608 0.177116 0.459591 0.284833 0.078460 0.121483 0.491485 0.148745 0.238287 0.152590 0.245835 0.214717 0.386857 0.221040 0.320773 0.249918 0.208270 Consensus sequence: VBVDAGGTGTYGVBBV Reverse complement motif 0.221040 0.249918 0.320773 0.208270 0.386857 0.245835 0.214717 0.152590 0.121483 0.148745 0.491485 0.238287 0.177116 0.284833 0.459591 0.078460 0.018763 0.794648 0.048982 0.137608 0.027749 0.009946 0.602513 0.359792 0.806667 0.030172 0.047139 0.116022 0.017531 0.973155 0.005025 0.004289 0.932845 0.061529 0.002368 0.003258 0.005074 0.966734 0.015048 0.013144 0.052259 0.856609 0.054303 0.036829 0.037468 0.007299 0.061032 0.894201 0.241098 0.421448 0.129378 0.208076 0.297430 0.343350 0.215095 0.144125 0.112892 0.341061 0.341342 0.204704 0.253642 0.298295 0.252604 0.195458 Consensus sequence: VVBVCKACACCTHVBV Alignment: VBVDAGGTGTYGVBBV -GAKAGKTGGCTCWG- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00035 Hic1_primary Original Motif Original Motif Forward 2 14 0.013786 Species: Mus musculus Original motif 0.275207 0.211375 0.250277 0.263141 0.135064 0.327571 0.217556 0.319808 0.145659 0.242586 0.267179 0.344576 0.656519 0.009712 0.315174 0.018595 0.002265 0.004755 0.001656 0.991325 0.041873 0.001128 0.955340 0.001659 0.001306 0.974834 0.022215 0.001645 0.001978 0.992066 0.002638 0.003317 0.921032 0.072388 0.001237 0.005344 0.582027 0.211694 0.115736 0.090542 0.005990 0.927450 0.028306 0.038254 0.027374 0.799879 0.053667 0.119080 0.203510 0.191263 0.168997 0.436229 0.402253 0.154087 0.291346 0.152314 0.201201 0.414412 0.145330 0.239056 0.241094 0.332661 0.143464 0.282781 Consensus sequence: DBBATGCCAACCHVHH Reverse complement motif 0.241094 0.143464 0.332661 0.282781 0.201201 0.145330 0.414412 0.239056 0.152314 0.154087 0.291346 0.402253 0.436229 0.191263 0.168997 0.203510 0.027374 0.053667 0.799879 0.119080 0.005990 0.028306 0.927450 0.038254 0.090542 0.211694 0.115736 0.582027 0.005344 0.072388 0.001237 0.921032 0.001978 0.002638 0.992066 0.003317 0.001306 0.022215 0.974834 0.001645 0.041873 0.955340 0.001128 0.001659 0.991325 0.004755 0.001656 0.002265 0.018595 0.009712 0.315174 0.656519 0.344576 0.242586 0.267179 0.145659 0.135064 0.217556 0.327571 0.319808 0.263141 0.211375 0.250277 0.275207 Consensus sequence: DDBHGGTTGGCATVBD Alignment: DBBATGCCAACCHVHH -CWGAGCCAYCTYTC- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00098 Rfx3_primary Reverse Complement Reverse Complement Forward 3 14 0.017234 Species: Mus musculus Original motif 0.218345 0.231533 0.152528 0.397594 0.264604 0.126115 0.320860 0.288421 0.117304 0.186844 0.172946 0.522906 0.111929 0.277908 0.409084 0.201079 0.343319 0.311376 0.123612 0.221692 0.193354 0.374280 0.157338 0.275028 0.166348 0.578991 0.130872 0.123789 0.006937 0.931183 0.046809 0.015072 0.255581 0.289587 0.125513 0.329319 0.002582 0.012615 0.002782 0.982021 0.850584 0.007973 0.140639 0.000803 0.037792 0.002285 0.957277 0.002646 0.009414 0.921481 0.001636 0.067469 0.943403 0.000980 0.042401 0.013216 0.991166 0.002931 0.003540 0.002364 0.003651 0.987110 0.001106 0.008133 0.208873 0.369705 0.319129 0.102292 0.322535 0.186617 0.374187 0.116660 0.326738 0.179486 0.226374 0.267402 0.299697 0.185329 0.133025 0.381949 0.300824 0.266836 0.096437 0.335904 0.418443 0.191068 0.127183 0.263306 0.386727 0.204062 0.126050 0.283161 Consensus sequence: HDTBHHCCHTAGCAACVVDHHHH Reverse complement motif 0.283161 0.204062 0.126050 0.386727 0.263306 0.191068 0.127183 0.418443 0.335904 0.266836 0.096437 0.300824 0.381949 0.185329 0.133025 0.299697 0.267402 0.179486 0.226374 0.326738 0.322535 0.374187 0.186617 0.116660 0.208873 0.319129 0.369705 0.102292 0.003651 0.001106 0.987110 0.008133 0.002364 0.002931 0.003540 0.991166 0.013216 0.000980 0.042401 0.943403 0.009414 0.001636 0.921481 0.067469 0.037792 0.957277 0.002285 0.002646 0.000803 0.007973 0.140639 0.850584 0.982021 0.012615 0.002782 0.002582 0.329319 0.289587 0.125513 0.255581 0.006937 0.046809 0.931183 0.015072 0.166348 0.130872 0.578991 0.123789 0.193354 0.157338 0.374280 0.275028 0.221692 0.311376 0.123612 0.343319 0.111929 0.409084 0.277908 0.201079 0.522906 0.186844 0.172946 0.117304 0.264604 0.320860 0.126115 0.288421 0.397594 0.231533 0.152528 0.218345 Consensus sequence: HHHHDVVGTTGCTAHGGDHBAHH Alignment: HHHHDVVGTTGCTAHGGDHBAHH --GAKAGKTGGCTCWG------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00264 Hoxa1 Reverse Complement Reverse Complement Forward 3 14 0.017454 Species: Mus musculus Original motif 0.189557 0.418057 0.185518 0.206868 0.144310 0.147945 0.055643 0.652102 0.268298 0.130092 0.466424 0.135186 0.623662 0.095919 0.152772 0.127647 0.266418 0.075174 0.613390 0.045018 0.076341 0.532879 0.217968 0.172811 0.006893 0.026113 0.001372 0.965621 0.960763 0.031216 0.006700 0.001322 0.990794 0.002636 0.002673 0.003897 0.005841 0.002488 0.001753 0.989917 0.002266 0.004876 0.007199 0.985660 0.956522 0.001370 0.038129 0.003979 0.280035 0.484469 0.167259 0.068237 0.144906 0.449298 0.138450 0.267346 0.107856 0.167050 0.411636 0.313458 0.061823 0.304997 0.175127 0.458054 Consensus sequence: HTDAGCTAATTAMHBY Reverse complement motif 0.458054 0.304997 0.175127 0.061823 0.107856 0.411636 0.167050 0.313458 0.144906 0.138450 0.449298 0.267346 0.280035 0.167259 0.484469 0.068237 0.003979 0.001370 0.038129 0.956522 0.985660 0.004876 0.007199 0.002266 0.989917 0.002488 0.001753 0.005841 0.003897 0.002636 0.002673 0.990794 0.001322 0.031216 0.006700 0.960763 0.965621 0.026113 0.001372 0.006893 0.076341 0.217968 0.532879 0.172811 0.266418 0.613390 0.075174 0.045018 0.127647 0.095919 0.152772 0.623662 0.268298 0.466424 0.130092 0.135186 0.652102 0.147945 0.055643 0.144310 0.189557 0.185518 0.418057 0.206868 Consensus sequence: MBDRTAATTAGCTHAD Alignment: MBDRTAATTAGCTHAD --GAKAGKTGGCTCWG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v016060_secondary Original Motif Reverse Complement Backward 7 14 0.018714 Species: Mus musculus Original motif 0.319838 0.171199 0.138099 0.370865 0.269358 0.196600 0.346909 0.187133 0.176807 0.338888 0.193903 0.290402 0.230268 0.119645 0.310500 0.339587 0.517372 0.257658 0.111673 0.113296 0.159477 0.126524 0.561119 0.152879 0.117072 0.553013 0.130919 0.198996 0.073372 0.163548 0.525014 0.238066 0.143608 0.186896 0.170528 0.498967 0.054943 0.079034 0.722992 0.143031 0.048852 0.015134 0.852458 0.083556 0.029001 0.023938 0.918900 0.028160 0.036727 0.092645 0.090591 0.780037 0.017757 0.057598 0.895222 0.029423 0.026113 0.048113 0.879744 0.046030 0.023041 0.787043 0.123490 0.066426 0.579766 0.004868 0.296873 0.118493 0.303862 0.042931 0.290151 0.363055 0.099672 0.237431 0.262301 0.400597 0.217788 0.163908 0.367628 0.250676 0.450783 0.141108 0.226137 0.181972 0.485086 0.102553 0.242662 0.169700 0.109057 0.454222 0.145665 0.291056 Consensus sequence: HVBDAGCGBGGGTGGCRDBDDDB Reverse complement motif 0.109057 0.145665 0.454222 0.291056 0.169700 0.102553 0.242662 0.485086 0.181972 0.141108 0.226137 0.450783 0.217788 0.367628 0.163908 0.250676 0.400597 0.237431 0.262301 0.099672 0.363055 0.042931 0.290151 0.303862 0.118493 0.004868 0.296873 0.579766 0.023041 0.123490 0.787043 0.066426 0.026113 0.879744 0.048113 0.046030 0.017757 0.895222 0.057598 0.029423 0.780037 0.092645 0.090591 0.036727 0.029001 0.918900 0.023938 0.028160 0.048852 0.852458 0.015134 0.083556 0.054943 0.722992 0.079034 0.143031 0.498967 0.186896 0.170528 0.143608 0.073372 0.525014 0.163548 0.238066 0.117072 0.130919 0.553013 0.198996 0.159477 0.561119 0.126524 0.152879 0.113296 0.257658 0.111673 0.517372 0.339587 0.119645 0.310500 0.230268 0.176807 0.193903 0.338888 0.290402 0.269358 0.346909 0.196600 0.187133 0.370865 0.171199 0.138099 0.319838 Consensus sequence: BDDHVDKGCCACCCVCGCTDBVH Alignment: BDDHVDKGCCACCCVCGCTDBVH ---CWGAGCCAYCTYTC------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00046 Tcfe2a_secondary Reverse Complement Original Motif Forward 4 14 0.019840 Species: Mus musculus Original motif 0.296417 0.247522 0.206749 0.249312 0.410113 0.201959 0.303149 0.084779 0.267313 0.132645 0.452057 0.147985 0.187929 0.136827 0.427628 0.247616 0.198671 0.425254 0.234160 0.141915 0.029244 0.953929 0.004092 0.012734 0.954570 0.014314 0.018695 0.012421 0.010025 0.055055 0.845504 0.089415 0.874802 0.040849 0.069178 0.015172 0.015084 0.010551 0.008736 0.965628 0.012981 0.007192 0.965036 0.014791 0.037724 0.016891 0.495632 0.449753 0.021685 0.438927 0.056118 0.483270 0.209872 0.365671 0.139706 0.284751 0.151815 0.336912 0.289382 0.221891 0.152995 0.262354 0.416434 0.168217 0.227567 0.187603 0.447892 0.136938 Consensus sequence: HVDDVCAGATGKYHBBV Reverse complement motif 0.227567 0.447892 0.187603 0.136938 0.152995 0.416434 0.262354 0.168217 0.151815 0.289382 0.336912 0.221891 0.209872 0.139706 0.365671 0.284751 0.483270 0.438927 0.056118 0.021685 0.037724 0.495632 0.016891 0.449753 0.012981 0.965036 0.007192 0.014791 0.965628 0.010551 0.008736 0.015084 0.015172 0.040849 0.069178 0.874802 0.010025 0.845504 0.055055 0.089415 0.012421 0.014314 0.018695 0.954570 0.029244 0.004092 0.953929 0.012734 0.198671 0.234160 0.425254 0.141915 0.187929 0.427628 0.136827 0.247616 0.267313 0.452057 0.132645 0.147985 0.084779 0.201959 0.303149 0.410113 0.249312 0.247522 0.206749 0.296417 Consensus sequence: VBBDMYCATCTGVHHBH Alignment: HVDDVCAGATGKYHBBV ---GAKAGKTGGCTCWG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00052 Osr2_secondary Reverse Complement Reverse Complement Backward 1 14 0.020344 Species: Mus musculus Original motif 0.503814 0.061521 0.249336 0.185328 0.254929 0.299710 0.169910 0.275451 0.227652 0.250215 0.156720 0.365413 0.204377 0.213835 0.124161 0.457627 0.092364 0.094662 0.750364 0.062611 0.026436 0.897855 0.038986 0.036722 0.035250 0.085429 0.030496 0.848825 0.819775 0.042925 0.032996 0.104304 0.145642 0.810774 0.021549 0.022035 0.031252 0.486827 0.015181 0.466740 0.255316 0.101783 0.039552 0.603348 0.466712 0.084471 0.436303 0.012514 0.344321 0.408616 0.064696 0.182367 0.422210 0.112319 0.109923 0.355548 0.221064 0.283525 0.217775 0.277636 0.280658 0.350363 0.211925 0.157054 Consensus sequence: AHHHGCTACYTRMWHV Reverse complement motif 0.280658 0.211925 0.350363 0.157054 0.221064 0.217775 0.283525 0.277636 0.355548 0.112319 0.109923 0.422210 0.344321 0.064696 0.408616 0.182367 0.012514 0.084471 0.436303 0.466712 0.603348 0.101783 0.039552 0.255316 0.031252 0.015181 0.486827 0.466740 0.145642 0.021549 0.810774 0.022035 0.104304 0.042925 0.032996 0.819775 0.848825 0.085429 0.030496 0.035250 0.026436 0.038986 0.897855 0.036722 0.092364 0.750364 0.094662 0.062611 0.457627 0.213835 0.124161 0.204377 0.365413 0.250215 0.156720 0.227652 0.254929 0.169910 0.299710 0.275451 0.185328 0.061521 0.249336 0.503814 Consensus sequence: VDWRKAKGTAGCHHDT Alignment: VDWRKAKGTAGCHHDT --GAKAGKTGGCTCWG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v015681_secondary Original Motif Reverse Complement Forward 7 14 0.020838 Species: Mus musculus Original motif 0.331499 0.188505 0.182841 0.297156 0.328961 0.213025 0.273530 0.184484 0.197213 0.129292 0.524914 0.148581 0.274491 0.226406 0.312118 0.186986 0.103231 0.393726 0.364988 0.138055 0.552594 0.166422 0.186262 0.094722 0.157618 0.064773 0.616497 0.161112 0.139166 0.176098 0.621185 0.063551 0.748420 0.062398 0.012447 0.176735 0.116584 0.009438 0.860326 0.013653 0.005030 0.003646 0.974877 0.016447 0.055257 0.007181 0.921760 0.015802 0.032748 0.058249 0.052709 0.856293 0.105606 0.872231 0.014370 0.007793 0.019480 0.497379 0.125899 0.357242 0.478582 0.269713 0.061464 0.190242 0.253985 0.287006 0.201320 0.257689 0.319384 0.210231 0.175842 0.294543 0.222123 0.287802 0.201294 0.288782 0.139951 0.376041 0.081133 0.402875 0.213450 0.343835 0.383676 0.059039 0.322294 0.355918 0.148062 0.173725 Consensus sequence: HVGVSAGGAGGGTCYHHHHYVH Reverse complement motif 0.322294 0.148062 0.355918 0.173725 0.213450 0.383676 0.343835 0.059039 0.402875 0.376041 0.081133 0.139951 0.288782 0.287802 0.201294 0.222123 0.294543 0.210231 0.175842 0.319384 0.253985 0.201320 0.287006 0.257689 0.190242 0.269713 0.061464 0.478582 0.019480 0.125899 0.497379 0.357242 0.105606 0.014370 0.872231 0.007793 0.856293 0.058249 0.052709 0.032748 0.055257 0.921760 0.007181 0.015802 0.005030 0.974877 0.003646 0.016447 0.116584 0.860326 0.009438 0.013653 0.176735 0.062398 0.012447 0.748420 0.139166 0.621185 0.176098 0.063551 0.157618 0.616497 0.064773 0.161112 0.094722 0.166422 0.186262 0.552594 0.103231 0.364988 0.393726 0.138055 0.274491 0.312118 0.226406 0.186986 0.197213 0.524914 0.129292 0.148581 0.184484 0.213025 0.273530 0.328961 0.297156 0.188505 0.182841 0.331499 Consensus sequence: DVMHHDHKGACCCTCCTSVCBH Alignment: DVMHHDHKGACCCTCCTSVCBH ------CWGAGCCAYCTYTC-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00095 Zfp691_secondary Reverse Complement Reverse Complement Forward 3 14 0.020945 Species: Mus musculus Original motif 0.236868 0.155338 0.295091 0.312703 0.522782 0.133021 0.177386 0.166812 0.192915 0.374870 0.221406 0.210809 0.146546 0.199196 0.418035 0.236223 0.454326 0.095049 0.151770 0.298855 0.027956 0.023096 0.878335 0.070614 0.916030 0.020358 0.039894 0.023717 0.010595 0.938036 0.039415 0.011954 0.007271 0.014948 0.007990 0.969792 0.014291 0.964878 0.011126 0.009705 0.154586 0.759294 0.050151 0.035969 0.051021 0.268239 0.053410 0.627330 0.158293 0.386843 0.113152 0.341713 0.281766 0.184139 0.187916 0.346179 0.292444 0.267259 0.241323 0.198974 0.425732 0.262331 0.149076 0.162861 0.205385 0.384164 0.267912 0.142538 Consensus sequence: DABBWGACTCCTHDVHV Reverse complement motif 0.205385 0.267912 0.384164 0.142538 0.162861 0.262331 0.149076 0.425732 0.198974 0.267259 0.241323 0.292444 0.346179 0.184139 0.187916 0.281766 0.158293 0.113152 0.386843 0.341713 0.627330 0.268239 0.053410 0.051021 0.154586 0.050151 0.759294 0.035969 0.014291 0.011126 0.964878 0.009705 0.969792 0.014948 0.007990 0.007271 0.010595 0.039415 0.938036 0.011954 0.023717 0.020358 0.039894 0.916030 0.027956 0.878335 0.023096 0.070614 0.298855 0.095049 0.151770 0.454326 0.146546 0.418035 0.199196 0.236223 0.192915 0.221406 0.374870 0.210809 0.166812 0.133021 0.177386 0.522782 0.312703 0.155338 0.295091 0.236868 Consensus sequence: VHBDDAGGAGTCWBBTD Alignment: VHBDDAGGAGTCWBBTD --GAKAGKTGGCTCWG- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00228 Bapx1 Reverse Complement Reverse Complement Forward 4 14 0.021205 Species: Mus musculus Original motif 0.301697 0.347856 0.239075 0.111372 0.364458 0.225587 0.074842 0.335112 0.228472 0.141747 0.139010 0.490770 0.559532 0.164793 0.197557 0.078118 0.506611 0.130882 0.113226 0.249281 0.054222 0.680706 0.257913 0.007160 0.001978 0.899030 0.000622 0.098369 0.950561 0.002121 0.000888 0.046429 0.037529 0.960534 0.000660 0.001278 0.001571 0.005538 0.001403 0.991487 0.001274 0.052527 0.000520 0.945679 0.926306 0.006886 0.003823 0.062985 0.638246 0.038639 0.145042 0.178072 0.266452 0.337698 0.283972 0.111878 0.307019 0.250170 0.243307 0.199504 0.550380 0.190997 0.122920 0.135703 0.187982 0.330356 0.168897 0.312765 Consensus sequence: VHHAACCACTTAAVVAH Reverse complement motif 0.187982 0.168897 0.330356 0.312765 0.135703 0.190997 0.122920 0.550380 0.199504 0.250170 0.243307 0.307019 0.266452 0.283972 0.337698 0.111878 0.178072 0.038639 0.145042 0.638246 0.062985 0.006886 0.003823 0.926306 0.945679 0.052527 0.000520 0.001274 0.991487 0.005538 0.001403 0.001571 0.037529 0.000660 0.960534 0.001278 0.046429 0.002121 0.000888 0.950561 0.001978 0.000622 0.899030 0.098369 0.054222 0.257913 0.680706 0.007160 0.249281 0.130882 0.113226 0.506611 0.078118 0.164793 0.197557 0.559532 0.490770 0.141747 0.139010 0.228472 0.335112 0.225587 0.074842 0.364458 0.301697 0.239075 0.347856 0.111372 Consensus sequence: DTBVTTAAGTGGTTHHV Alignment: DTBVTTAAGTGGTTHHV ---GAKAGKTGGCTCWG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 6 Motif name: Motif 6 Original motif 0.000000 0.857143 0.000000 0.142857 0.904762 0.000000 0.000000 0.095238 0.000000 0.571429 0.428571 0.000000 1.000000 0.000000 0.000000 0.000000 0.047619 0.380952 0.285714 0.285714 0.523810 0.047619 0.238095 0.190476 0.047619 0.809524 0.142857 0.000000 0.476190 0.000000 0.000000 0.523810 0.190476 0.333333 0.476190 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.666667 0.333333 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.857143 0.000000 0.000000 0.142857 Consensus sequence: CASABACWSACACA Reserve complement motif 0.142857 0.000000 0.000000 0.857143 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.333333 0.666667 0.000000 0.000000 0.000000 0.000000 1.000000 0.190476 0.476190 0.333333 0.000000 0.523810 0.000000 0.000000 0.476190 0.047619 0.142857 0.809524 0.000000 0.190476 0.047619 0.238095 0.523810 0.047619 0.285714 0.380952 0.285714 0.000000 0.000000 0.000000 1.000000 0.000000 0.428571 0.571429 0.000000 0.095238 0.000000 0.000000 0.904762 0.000000 0.000000 0.857143 0.142857 Consensus sequence: TGTGTSWGTBTSTG ************************************************************************ Best Matches for Motif ID 6 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00034 Sox7_secondary Original Motif Reverse Complement Forward 1 14 0.035705 Species: Mus musculus Original motif 0.067627 0.131333 0.654425 0.146615 0.156488 0.114442 0.145630 0.583441 0.206450 0.265630 0.358017 0.169903 0.090729 0.460713 0.274712 0.173847 0.285994 0.099998 0.154485 0.459523 0.635908 0.184787 0.072982 0.106323 0.748421 0.039204 0.092605 0.119769 0.081342 0.061327 0.044532 0.812799 0.143120 0.043879 0.024216 0.788785 0.247544 0.092102 0.621453 0.038901 0.295531 0.036295 0.027594 0.640580 0.194561 0.305468 0.339916 0.160055 0.175038 0.193568 0.101212 0.530182 0.145226 0.167488 0.559871 0.127415 0.271501 0.237429 0.206701 0.284369 0.216834 0.109191 0.569605 0.104370 0.182624 0.177160 0.300475 0.339742 0.331737 0.198645 0.265137 0.204482 0.230155 0.359365 0.183450 0.227029 0.056581 0.067297 0.463052 0.413070 0.198891 0.324626 0.304424 0.172059 0.181968 0.287547 0.202419 0.328066 Consensus sequence: GTVBDAATTGTVTGHGDDHKVB Reverse complement motif 0.328066 0.287547 0.202419 0.181968 0.198891 0.304424 0.324626 0.172059 0.056581 0.463052 0.067297 0.413070 0.230155 0.183450 0.359365 0.227029 0.204482 0.198645 0.265137 0.331737 0.339742 0.177160 0.300475 0.182624 0.216834 0.569605 0.109191 0.104370 0.284369 0.237429 0.206701 0.271501 0.145226 0.559871 0.167488 0.127415 0.530182 0.193568 0.101212 0.175038 0.194561 0.339916 0.305468 0.160055 0.640580 0.036295 0.027594 0.295531 0.247544 0.621453 0.092102 0.038901 0.788785 0.043879 0.024216 0.143120 0.812799 0.061327 0.044532 0.081342 0.119769 0.039204 0.092605 0.748421 0.106323 0.184787 0.072982 0.635908 0.459523 0.099998 0.154485 0.285994 0.090729 0.274712 0.460713 0.173847 0.206450 0.358017 0.265630 0.169903 0.583441 0.114442 0.145630 0.156488 0.067627 0.654425 0.131333 0.146615 Consensus sequence: VVYDDDCHCAVACAATTDBVAC Alignment: GTVBDAATTGTVTGHGDDHKVB CASABACWSACACA-------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00000 Smad3_primary Reverse Complement Reverse Complement Backward 1 14 0.048229 Species: Mus musculus Original motif 0.282316 0.413385 0.114930 0.189369 0.341654 0.135011 0.267943 0.255392 0.399523 0.173081 0.168845 0.258551 0.365086 0.196360 0.211856 0.226699 0.243321 0.177839 0.224206 0.354635 0.029873 0.808479 0.036309 0.125339 0.004945 0.815465 0.040635 0.138955 0.934557 0.058944 0.005027 0.001471 0.005099 0.003998 0.986148 0.004755 0.969304 0.020594 0.001929 0.008173 0.008189 0.984816 0.004199 0.002795 0.669579 0.012182 0.282153 0.036085 0.130511 0.171241 0.334041 0.364207 0.198982 0.289660 0.252392 0.258966 0.423172 0.190978 0.164411 0.221440 0.213519 0.287388 0.294414 0.204679 0.371956 0.285061 0.150191 0.192792 Consensus sequence: HDHDDCCAGACABBHVH Reverse complement motif 0.192792 0.285061 0.150191 0.371956 0.213519 0.294414 0.287388 0.204679 0.221440 0.190978 0.164411 0.423172 0.198982 0.252392 0.289660 0.258966 0.364207 0.171241 0.334041 0.130511 0.036085 0.012182 0.282153 0.669579 0.008189 0.004199 0.984816 0.002795 0.008173 0.020594 0.001929 0.969304 0.005099 0.986148 0.003998 0.004755 0.001471 0.058944 0.005027 0.934557 0.004945 0.040635 0.815465 0.138955 0.029873 0.036309 0.808479 0.125339 0.354635 0.177839 0.224206 0.243321 0.226699 0.196360 0.211856 0.365086 0.258551 0.173081 0.168845 0.399523 0.255392 0.135011 0.267943 0.341654 0.282316 0.114930 0.413385 0.189369 Consensus sequence: HVHBVTGTCTGGDDHDD Alignment: HVHBVTGTCTGGDDHDD ---TGTGTSWGTBTSTG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00039 Foxj3_secondary Original Motif Original Motif Forward 1 14 0.049385 Species: Mus musculus Original motif 0.317700 0.247432 0.215783 0.219085 0.352303 0.162638 0.230006 0.255053 0.168554 0.301758 0.264712 0.264975 0.529943 0.098389 0.260344 0.111324 0.205868 0.388676 0.197345 0.208111 0.033261 0.853848 0.009029 0.103862 0.673657 0.279649 0.037915 0.008779 0.496326 0.243318 0.006446 0.253910 0.913038 0.037006 0.017077 0.032879 0.948910 0.014865 0.012562 0.023664 0.010919 0.862142 0.009524 0.117414 0.955604 0.012514 0.012289 0.019594 0.409400 0.131244 0.138666 0.320691 0.465036 0.133548 0.065727 0.335688 0.212413 0.103583 0.412294 0.271710 0.182538 0.310768 0.349143 0.157550 0.294233 0.219194 0.238798 0.247776 Consensus sequence: HDBAHCAWAACADWDVD Reverse complement motif 0.247776 0.219194 0.238798 0.294233 0.182538 0.349143 0.310768 0.157550 0.212413 0.412294 0.103583 0.271710 0.335688 0.133548 0.065727 0.465036 0.320691 0.131244 0.138666 0.409400 0.019594 0.012514 0.012289 0.955604 0.010919 0.009524 0.862142 0.117414 0.023664 0.014865 0.012562 0.948910 0.032879 0.037006 0.017077 0.913038 0.253910 0.243318 0.006446 0.496326 0.008779 0.279649 0.037915 0.673657 0.033261 0.009029 0.853848 0.103862 0.205868 0.197345 0.388676 0.208111 0.111324 0.098389 0.260344 0.529943 0.168554 0.264712 0.301758 0.264975 0.255053 0.162638 0.230006 0.352303 0.219085 0.247432 0.215783 0.317700 Consensus sequence: DVHWDTGTTWTGDTBDH Alignment: HDBAHCAWAACADWDVD CASABACWSACACA--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00025 Foxk1_secondary Original Motif Original Motif Forward 1 14 0.050743 Species: Mus musculus Original motif 0.240753 0.425595 0.141281 0.192371 0.367715 0.247224 0.117353 0.267708 0.489169 0.220343 0.113844 0.176644 0.742256 0.042809 0.146704 0.068231 0.078936 0.546144 0.032328 0.342592 0.588419 0.293580 0.082117 0.035885 0.913924 0.026256 0.050778 0.009042 0.009007 0.565680 0.010683 0.414630 0.947562 0.020878 0.018821 0.012739 0.901384 0.021519 0.030204 0.046893 0.077157 0.797900 0.026432 0.098511 0.824314 0.040128 0.051910 0.083648 0.254436 0.342235 0.143789 0.259539 0.319400 0.338163 0.129746 0.212691 0.231014 0.260719 0.169042 0.339225 Consensus sequence: HHHAYAAYAACAHHH Reverse complement motif 0.339225 0.260719 0.169042 0.231014 0.319400 0.129746 0.338163 0.212691 0.254436 0.143789 0.342235 0.259539 0.083648 0.040128 0.051910 0.824314 0.077157 0.026432 0.797900 0.098511 0.046893 0.021519 0.030204 0.901384 0.012739 0.020878 0.018821 0.947562 0.009007 0.010683 0.565680 0.414630 0.009042 0.026256 0.050778 0.913924 0.035885 0.293580 0.082117 0.588419 0.078936 0.032328 0.546144 0.342592 0.068231 0.042809 0.146704 0.742256 0.176644 0.220343 0.113844 0.489169 0.267708 0.247224 0.117353 0.367715 0.240753 0.141281 0.425595 0.192371 Consensus sequence: HDDTGTTKTTKTHHD Alignment: HHHAYAAYAACAHHH CASABACWSACACA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00528 Foxm1_secondary Original Motif Original Motif Backward 9 14 0.052411 Species: Mus musculus Original motif 0.399785 0.446658 0.111435 0.042122 0.535175 0.103991 0.089706 0.271128 0.078171 0.387987 0.375083 0.158759 0.309001 0.519142 0.070618 0.101239 0.201844 0.255818 0.323149 0.219190 0.534101 0.109845 0.235026 0.121028 0.656038 0.037473 0.261484 0.045006 0.315713 0.164290 0.471815 0.048182 0.651960 0.009412 0.328237 0.010391 0.937365 0.017313 0.007516 0.037807 0.019983 0.044238 0.012387 0.923392 0.061195 0.021485 0.881645 0.035675 0.017521 0.952998 0.013139 0.016342 0.254160 0.029735 0.493023 0.223082 0.239200 0.593324 0.114503 0.052973 0.610822 0.071539 0.099169 0.218470 0.166610 0.389712 0.204400 0.239278 0.227752 0.361626 0.178497 0.232125 0.537030 0.182466 0.026035 0.254470 0.235902 0.151006 0.043788 0.569304 0.081851 0.250397 0.590059 0.077693 0.340417 0.189613 0.272075 0.197895 Consensus sequence: MWSMBAARRATGCDCABHATGD Reverse complement motif 0.197895 0.189613 0.272075 0.340417 0.081851 0.590059 0.250397 0.077693 0.569304 0.151006 0.043788 0.235902 0.254470 0.182466 0.026035 0.537030 0.227752 0.178497 0.361626 0.232125 0.166610 0.204400 0.389712 0.239278 0.218470 0.071539 0.099169 0.610822 0.239200 0.114503 0.593324 0.052973 0.254160 0.493023 0.029735 0.223082 0.017521 0.013139 0.952998 0.016342 0.061195 0.881645 0.021485 0.035675 0.923392 0.044238 0.012387 0.019983 0.037807 0.017313 0.007516 0.937365 0.010391 0.009412 0.328237 0.651960 0.315713 0.471815 0.164290 0.048182 0.045006 0.037473 0.261484 0.656038 0.121028 0.109845 0.235026 0.534101 0.201844 0.323149 0.255818 0.219190 0.309001 0.070618 0.519142 0.101239 0.078171 0.375083 0.387987 0.158759 0.271128 0.103991 0.089706 0.535175 0.399785 0.111435 0.446658 0.042122 Consensus sequence: DCATDBTGHGCATKMTTBRSWR Alignment: MWSMBAARRATGCDCABHATGD CASABACWSACACA-------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00528 Foxm1_primary Original Motif Original Motif Forward 1 14 0.053839 Species: Mus musculus Original motif 0.402634 0.249702 0.143705 0.203959 0.709619 0.108953 0.130781 0.050647 0.334232 0.077498 0.228818 0.359452 0.131721 0.094794 0.234481 0.539005 0.170102 0.237609 0.252464 0.339824 0.244961 0.347304 0.228129 0.179606 0.612141 0.132244 0.180110 0.075504 0.472236 0.042388 0.234419 0.250957 0.125213 0.007413 0.849788 0.017587 0.702068 0.064216 0.141992 0.091724 0.008657 0.038238 0.002959 0.950145 0.007170 0.002244 0.986824 0.003763 0.002862 0.979956 0.000711 0.016471 0.971196 0.001954 0.011441 0.015409 0.105575 0.031482 0.022836 0.840107 0.031534 0.736742 0.032785 0.198939 0.479153 0.347558 0.031799 0.141490 0.056405 0.123140 0.023989 0.796466 0.111194 0.195344 0.501360 0.192102 0.376359 0.416820 0.072818 0.134004 0.225111 0.249460 0.306563 0.218866 0.405251 0.168478 0.108618 0.317653 0.165386 0.191749 0.268604 0.374261 Consensus sequence: HADTBVADGATGCATCMTGMVHB Reverse complement motif 0.374261 0.191749 0.268604 0.165386 0.317653 0.168478 0.108618 0.405251 0.225111 0.306563 0.249460 0.218866 0.376359 0.072818 0.416820 0.134004 0.111194 0.501360 0.195344 0.192102 0.796466 0.123140 0.023989 0.056405 0.141490 0.347558 0.031799 0.479153 0.031534 0.032785 0.736742 0.198939 0.840107 0.031482 0.022836 0.105575 0.015409 0.001954 0.011441 0.971196 0.002862 0.000711 0.979956 0.016471 0.007170 0.986824 0.002244 0.003763 0.950145 0.038238 0.002959 0.008657 0.091724 0.064216 0.141992 0.702068 0.125213 0.849788 0.007413 0.017587 0.250957 0.042388 0.234419 0.472236 0.075504 0.132244 0.180110 0.612141 0.244961 0.228129 0.347304 0.179606 0.339824 0.237609 0.252464 0.170102 0.539005 0.094794 0.234481 0.131721 0.359452 0.077498 0.228818 0.334232 0.050647 0.108953 0.130781 0.709619 0.203959 0.249702 0.143705 0.402634 Consensus sequence: VHVRCAYGATGCATCDTVVADTH Alignment: HADTBVADGATGCATCMTGMVHB CASABACWSACACA--------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00031 Zbtb3_secondary Reverse Complement Reverse Complement Backward 1 14 0.053870 Species: Mus musculus Original motif 0.110412 0.519910 0.162398 0.207280 0.470593 0.172893 0.115202 0.241311 0.467126 0.160175 0.227365 0.145334 0.196112 0.169855 0.079068 0.554965 0.198275 0.671393 0.026094 0.104237 0.793465 0.046739 0.110258 0.049538 0.058204 0.867549 0.045603 0.028645 0.079471 0.027484 0.025248 0.867797 0.032277 0.065893 0.827417 0.074413 0.080553 0.119144 0.585050 0.215253 0.105106 0.470208 0.170921 0.253765 0.690158 0.033925 0.171121 0.104796 0.299543 0.155890 0.362586 0.181981 0.343375 0.213360 0.180067 0.263198 0.364819 0.149053 0.181128 0.305000 0.247818 0.143948 0.217882 0.390352 Consensus sequence: CHVTCACTGGBADHDD Reverse complement motif 0.390352 0.143948 0.217882 0.247818 0.305000 0.149053 0.181128 0.364819 0.263198 0.213360 0.180067 0.343375 0.299543 0.362586 0.155890 0.181981 0.104796 0.033925 0.171121 0.690158 0.105106 0.170921 0.470208 0.253765 0.080553 0.585050 0.119144 0.215253 0.032277 0.827417 0.065893 0.074413 0.867797 0.027484 0.025248 0.079471 0.058204 0.045603 0.867549 0.028645 0.049538 0.046739 0.110258 0.793465 0.198275 0.026094 0.671393 0.104237 0.554965 0.169855 0.079068 0.196112 0.145334 0.160175 0.227365 0.467126 0.241311 0.172893 0.115202 0.470593 0.110412 0.162398 0.519910 0.207280 Consensus sequence: DDHHTBCCAGTGABHG Alignment: DDHHTBCCAGTGABHG --TGTGTSWGTBTSTG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00014 Sox17_secondary Original Motif Original Motif Forward 4 14 0.054146 Species: Mus musculus Original motif 0.216056 0.230834 0.399857 0.153253 0.321065 0.233860 0.135741 0.309334 0.166479 0.321423 0.209463 0.302635 0.185647 0.499038 0.152355 0.162961 0.416451 0.221510 0.168645 0.193395 0.070777 0.581761 0.126392 0.221070 0.764583 0.085635 0.031993 0.117789 0.035294 0.112638 0.038664 0.813404 0.153178 0.046321 0.056161 0.744340 0.076540 0.825062 0.055409 0.042989 0.764357 0.060365 0.119861 0.055417 0.130143 0.178946 0.153266 0.537644 0.402684 0.154010 0.357674 0.085632 0.189784 0.349553 0.176965 0.283698 0.475181 0.145276 0.256449 0.123094 0.472286 0.151639 0.172736 0.203339 0.215278 0.186804 0.213020 0.384898 Consensus sequence: VHBHHCATTCATRHVDD Reverse complement motif 0.384898 0.186804 0.213020 0.215278 0.203339 0.151639 0.172736 0.472286 0.123094 0.145276 0.256449 0.475181 0.189784 0.176965 0.349553 0.283698 0.085632 0.154010 0.357674 0.402684 0.537644 0.178946 0.153266 0.130143 0.055417 0.060365 0.119861 0.764357 0.076540 0.055409 0.825062 0.042989 0.744340 0.046321 0.056161 0.153178 0.813404 0.112638 0.038664 0.035294 0.117789 0.085635 0.031993 0.764583 0.070777 0.126392 0.581761 0.221070 0.193395 0.221510 0.168645 0.416451 0.185647 0.152355 0.499038 0.162961 0.166479 0.209463 0.321423 0.302635 0.309334 0.233860 0.135741 0.321065 0.216056 0.399857 0.230834 0.153253 Consensus sequence: DDBDKATGAATGHDBHV Alignment: VHBHHCATTCATRHVDD ---CASABACWSACACA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v016060_secondary Original Motif Original Motif Backward 1 14 0.054165 Species: Mus musculus Original motif 0.168550 0.345968 0.396524 0.088958 0.038113 0.360882 0.114042 0.486963 0.349356 0.180599 0.051416 0.418629 0.258773 0.332518 0.244932 0.163778 0.371663 0.208591 0.263136 0.156609 0.225440 0.321741 0.175932 0.276887 0.100827 0.656850 0.018644 0.223679 0.494140 0.155427 0.327424 0.023009 0.105642 0.805846 0.027712 0.060800 0.065110 0.845072 0.058046 0.031772 0.649343 0.110180 0.180680 0.059797 0.064269 0.853604 0.066860 0.015268 0.437421 0.533797 0.016833 0.011948 0.121694 0.787708 0.016177 0.074421 0.625382 0.066925 0.266070 0.041623 0.117819 0.608153 0.165139 0.108889 0.145639 0.102001 0.604926 0.147434 0.521188 0.184986 0.064607 0.229219 0.180371 0.274237 0.096591 0.448801 0.071055 0.455813 0.332817 0.140315 0.084503 0.199982 0.448293 0.267222 0.389451 0.169545 0.155507 0.285497 0.424314 0.227621 0.101210 0.246855 Consensus sequence: VYWVVHCRCCACMCACGAHSBHH Reverse complement motif 0.246855 0.227621 0.101210 0.424314 0.285497 0.169545 0.155507 0.389451 0.084503 0.448293 0.199982 0.267222 0.071055 0.332817 0.455813 0.140315 0.448801 0.274237 0.096591 0.180371 0.229219 0.184986 0.064607 0.521188 0.145639 0.604926 0.102001 0.147434 0.117819 0.165139 0.608153 0.108889 0.041623 0.066925 0.266070 0.625382 0.121694 0.016177 0.787708 0.074421 0.437421 0.016833 0.533797 0.011948 0.064269 0.066860 0.853604 0.015268 0.059797 0.110180 0.180680 0.649343 0.065110 0.058046 0.845072 0.031772 0.105642 0.027712 0.805846 0.060800 0.023009 0.155427 0.327424 0.494140 0.100827 0.018644 0.656850 0.223679 0.225440 0.175932 0.321741 0.276887 0.156609 0.208591 0.263136 0.371663 0.258773 0.244932 0.332518 0.163778 0.418629 0.180599 0.051416 0.349356 0.486963 0.360882 0.114042 0.038113 0.168550 0.396524 0.345968 0.088958 Consensus sequence: HHBSHTCGTGRGTGGKGDBVWMV Alignment: VYWVVHCRCCACMCACGAHSBHH ---------CASABACWSACACA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00098 Rfx3_secondary Reverse Complement Reverse Complement Backward 2 14 0.054503 Species: Mus musculus Original motif 0.314514 0.275352 0.257617 0.152518 0.126939 0.598294 0.130576 0.144192 0.102265 0.155334 0.177957 0.564445 0.129288 0.282678 0.326990 0.261044 0.318166 0.227823 0.175681 0.278330 0.109019 0.380838 0.278328 0.231815 0.226145 0.289206 0.291300 0.193348 0.035863 0.844339 0.072582 0.047216 0.223793 0.187244 0.088092 0.500871 0.039800 0.029681 0.026201 0.904317 0.298298 0.032147 0.654746 0.014809 0.014729 0.022023 0.944826 0.018422 0.485114 0.004925 0.013785 0.496176 0.035708 0.020381 0.240804 0.703108 0.951152 0.012738 0.017886 0.018224 0.023713 0.944394 0.009538 0.022355 0.291067 0.385205 0.232388 0.091339 0.340334 0.199588 0.311526 0.148552 0.198713 0.472138 0.178319 0.150830 0.321155 0.269932 0.311301 0.097612 0.412646 0.195252 0.231950 0.160152 0.297134 0.180928 0.250400 0.271538 0.151169 0.305386 0.358574 0.184871 Consensus sequence: VCTBHBVCTTGGWTACVVVVVDB Reverse complement motif 0.151169 0.358574 0.305386 0.184871 0.271538 0.180928 0.250400 0.297134 0.160152 0.195252 0.231950 0.412646 0.097612 0.269932 0.311301 0.321155 0.198713 0.178319 0.472138 0.150830 0.148552 0.199588 0.311526 0.340334 0.291067 0.232388 0.385205 0.091339 0.023713 0.009538 0.944394 0.022355 0.018224 0.012738 0.017886 0.951152 0.703108 0.020381 0.240804 0.035708 0.496176 0.004925 0.013785 0.485114 0.014729 0.944826 0.022023 0.018422 0.298298 0.654746 0.032147 0.014809 0.904317 0.029681 0.026201 0.039800 0.500871 0.187244 0.088092 0.223793 0.035863 0.072582 0.844339 0.047216 0.226145 0.291300 0.289206 0.193348 0.109019 0.278328 0.380838 0.231815 0.278330 0.227823 0.175681 0.318166 0.129288 0.326990 0.282678 0.261044 0.564445 0.155334 0.177957 0.102265 0.126939 0.130576 0.598294 0.144192 0.152518 0.275352 0.257617 0.314514 Consensus sequence: BDBBVBVGTAWCCAAGVBHBAGB Alignment: BDBBVBVGTAWCCAAGVBHBAGB --------TGTGTSWGTBTSTG- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 7 Motif name: Motif 7 Original motif 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.500000 0.500000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 Consensus sequence: AAAATKCTATT Reserve complement motif 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.500000 0.000000 0.500000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 Consensus sequence: AATAGYATTTT ************************************************************************ Best Matches for Motif ID 7 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00145 Barhl2 Reverse Complement Reverse Complement Backward 1 11 0.031478 Species: Mus musculus Original motif 0.461695 0.224449 0.118884 0.194972 0.573918 0.178052 0.084607 0.163423 0.509202 0.299283 0.046830 0.144686 0.781754 0.035879 0.132996 0.049371 0.909629 0.018003 0.066327 0.006042 0.185305 0.442819 0.168153 0.203723 0.004152 0.938941 0.000741 0.056166 0.952728 0.004094 0.036915 0.006262 0.962648 0.006522 0.001095 0.029735 0.002949 0.002007 0.002143 0.992902 0.002773 0.003794 0.001682 0.991751 0.985960 0.000635 0.003183 0.010222 0.728479 0.023198 0.141457 0.106866 0.100754 0.330009 0.347597 0.221641 0.392007 0.211701 0.147142 0.249150 0.323968 0.271247 0.123950 0.280834 Consensus sequence: HAMAAHCAATTAABHH Reverse complement motif 0.280834 0.271247 0.123950 0.323968 0.249150 0.211701 0.147142 0.392007 0.100754 0.347597 0.330009 0.221641 0.106866 0.023198 0.141457 0.728479 0.010222 0.000635 0.003183 0.985960 0.991751 0.003794 0.001682 0.002773 0.992902 0.002007 0.002143 0.002949 0.029735 0.006522 0.001095 0.962648 0.006262 0.004094 0.036915 0.952728 0.004152 0.000741 0.938941 0.056166 0.185305 0.168153 0.442819 0.203723 0.006042 0.018003 0.066327 0.909629 0.049371 0.035879 0.132996 0.781754 0.144686 0.299283 0.046830 0.509202 0.163423 0.178052 0.084607 0.573918 0.194972 0.224449 0.118884 0.461695 Consensus sequence: HHBTTAATTGDTTYTH Alignment: HHBTTAATTGDTTYTH -----AATAGYATTTT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00180 Hoxd13 Original Motif Reverse Complement Backward 6 11 0.038891 Species: Mus musculus Original motif 0.279189 0.316791 0.190404 0.213616 0.297705 0.175638 0.191020 0.335637 0.333485 0.203858 0.174034 0.288623 0.046444 0.540349 0.083237 0.329969 0.016780 0.648667 0.003870 0.330682 0.679959 0.116873 0.002745 0.200422 0.936496 0.002013 0.026876 0.034615 0.004741 0.008734 0.003861 0.982665 0.904624 0.000869 0.005345 0.089162 0.967883 0.002295 0.001003 0.028819 0.980087 0.004768 0.002887 0.012258 0.898523 0.041633 0.022776 0.037069 0.246903 0.292446 0.069240 0.391411 0.192528 0.300908 0.105655 0.400908 0.247610 0.343317 0.190760 0.218313 0.246702 0.253595 0.176298 0.323404 Consensus sequence: HDHYYAATAAAAHHHH Reverse complement motif 0.323404 0.253595 0.176298 0.246702 0.247610 0.190760 0.343317 0.218313 0.400908 0.300908 0.105655 0.192528 0.391411 0.292446 0.069240 0.246903 0.037069 0.041633 0.022776 0.898523 0.012258 0.004768 0.002887 0.980087 0.028819 0.002295 0.001003 0.967883 0.089162 0.000869 0.005345 0.904624 0.982665 0.008734 0.003861 0.004741 0.034615 0.002013 0.026876 0.936496 0.200422 0.116873 0.002745 0.679959 0.016780 0.003870 0.648667 0.330682 0.046444 0.083237 0.540349 0.329969 0.288623 0.203858 0.174034 0.333485 0.335637 0.175638 0.191020 0.297705 0.279189 0.190404 0.316791 0.213616 Consensus sequence: HDHHTTTTATTKKHDD Alignment: HDHHTTTTATTKKHDD AAAATKCTATT----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00016 Sry_primary Original Motif Reverse Complement Backward 5 11 0.039378 Species: Mus musculus Original motif 0.173554 0.244647 0.248735 0.333064 0.317107 0.259459 0.118295 0.305139 0.240662 0.181192 0.247535 0.330610 0.431219 0.156611 0.141440 0.270729 0.958925 0.011290 0.006882 0.022903 0.049111 0.011065 0.012843 0.926981 0.072130 0.013140 0.006115 0.908615 0.917456 0.003886 0.069860 0.008798 0.008798 0.069860 0.003886 0.917456 0.908615 0.006115 0.013140 0.072130 0.926981 0.012843 0.011065 0.049111 0.022903 0.006882 0.011290 0.958925 0.422656 0.136248 0.266001 0.175095 0.336161 0.121946 0.177188 0.364705 0.247357 0.097153 0.248929 0.406561 0.246369 0.321670 0.222124 0.209837 Consensus sequence: BHDHATTATAATDDDV Reverse complement motif 0.246369 0.222124 0.321670 0.209837 0.406561 0.097153 0.248929 0.247357 0.364705 0.121946 0.177188 0.336161 0.175095 0.136248 0.266001 0.422656 0.958925 0.006882 0.011290 0.022903 0.049111 0.012843 0.011065 0.926981 0.072130 0.006115 0.013140 0.908615 0.917456 0.069860 0.003886 0.008798 0.008798 0.003886 0.069860 0.917456 0.908615 0.013140 0.006115 0.072130 0.926981 0.011065 0.012843 0.049111 0.022903 0.011290 0.006882 0.958925 0.270729 0.156611 0.141440 0.431219 0.330610 0.181192 0.247535 0.240662 0.305139 0.259459 0.118295 0.317107 0.333064 0.244647 0.248735 0.173554 Consensus sequence: VDDDATTATAATHDHV Alignment: VDDDATTATAATHDHV -AAAATKCTATT---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00121 Hoxd10 Original Motif Reverse Complement Backward 6 11 0.039567 Species: Mus musculus Original motif 0.405345 0.293266 0.220907 0.080482 0.398063 0.099034 0.333525 0.169378 0.049753 0.190411 0.336789 0.423048 0.243698 0.226261 0.324346 0.205696 0.030873 0.549741 0.008321 0.411065 0.714225 0.228092 0.020960 0.036723 0.833992 0.010944 0.021918 0.133146 0.008898 0.026169 0.008341 0.956591 0.811684 0.004889 0.004751 0.178676 0.952107 0.004322 0.004587 0.038984 0.925365 0.008360 0.006811 0.059464 0.850659 0.058250 0.065237 0.025855 0.193369 0.242985 0.049515 0.514131 0.266774 0.080601 0.239781 0.412844 0.335522 0.125500 0.188170 0.350809 0.407171 0.120540 0.187300 0.284989 0.281181 0.242348 0.160247 0.316224 Consensus sequence: VDKVYAATAAAATDDDH Reverse complement motif 0.316224 0.242348 0.160247 0.281181 0.284989 0.120540 0.187300 0.407171 0.350809 0.125500 0.188170 0.335522 0.412844 0.080601 0.239781 0.266774 0.514131 0.242985 0.049515 0.193369 0.025855 0.058250 0.065237 0.850659 0.059464 0.008360 0.006811 0.925365 0.038984 0.004322 0.004587 0.952107 0.178676 0.004889 0.004751 0.811684 0.956591 0.026169 0.008341 0.008898 0.133146 0.010944 0.021918 0.833992 0.036723 0.228092 0.020960 0.714225 0.030873 0.008321 0.549741 0.411065 0.243698 0.324346 0.226261 0.205696 0.423048 0.190411 0.336789 0.049753 0.169378 0.099034 0.333525 0.398063 0.080482 0.293266 0.220907 0.405345 Consensus sequence: HDDDATTTTATTKVRDB Alignment: HDDDATTTTATTKVRDB -AAAATKCTATT----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00034 Sox7_primary Original Motif Reverse Complement Forward 2 11 0.040325 Species: Mus musculus Original motif 0.360997 0.300272 0.115555 0.223177 0.309749 0.228429 0.166233 0.295589 0.149419 0.176868 0.240155 0.433558 0.379704 0.095791 0.276373 0.248133 0.394549 0.174184 0.130641 0.300626 0.443749 0.070776 0.211081 0.274393 0.364301 0.074356 0.370406 0.190936 0.791976 0.038475 0.093390 0.076159 0.963721 0.001826 0.002456 0.031997 0.004516 0.954596 0.008092 0.032796 0.981080 0.002062 0.002161 0.014697 0.986185 0.001846 0.006976 0.004992 0.059567 0.003649 0.002189 0.934595 0.495328 0.024257 0.240450 0.239965 0.305027 0.094878 0.526069 0.074025 0.418442 0.196237 0.158323 0.226998 0.336713 0.220452 0.191155 0.251680 0.192296 0.300342 0.169047 0.338315 0.240387 0.144634 0.128513 0.486465 0.290763 0.271259 0.116600 0.321377 0.224825 0.296233 0.229255 0.249687 0.493240 0.171285 0.075148 0.260326 Consensus sequence: HHBDHDDAACAATDRHHHHHBW Reverse complement motif 0.260326 0.171285 0.075148 0.493240 0.224825 0.229255 0.296233 0.249687 0.321377 0.271259 0.116600 0.290763 0.486465 0.144634 0.128513 0.240387 0.338315 0.300342 0.169047 0.192296 0.251680 0.220452 0.191155 0.336713 0.226998 0.196237 0.158323 0.418442 0.305027 0.526069 0.094878 0.074025 0.239965 0.024257 0.240450 0.495328 0.934595 0.003649 0.002189 0.059567 0.004992 0.001846 0.006976 0.986185 0.014697 0.002062 0.002161 0.981080 0.004516 0.008092 0.954596 0.032796 0.031997 0.001826 0.002456 0.963721 0.076159 0.038475 0.093390 0.791976 0.364301 0.370406 0.074356 0.190936 0.274393 0.070776 0.211081 0.443749 0.300626 0.174184 0.130641 0.394549 0.248133 0.095791 0.276373 0.379704 0.433558 0.176868 0.240155 0.149419 0.295589 0.228429 0.166233 0.309749 0.223177 0.300272 0.115555 0.360997 Consensus sequence: WBHHHHHMDATTGTTHDHDVHH Alignment: WBHHHHHMDATTGTTHDHDVHH -AAAATKCTATT---------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00038 Spdef_secondary Original Motif Original Motif Backward 3 11 0.040510 Species: Mus musculus Original motif 0.249693 0.170111 0.349462 0.230734 0.417537 0.133630 0.158772 0.290062 0.241753 0.248691 0.251987 0.257568 0.351468 0.208028 0.178365 0.262139 0.685401 0.048428 0.173290 0.092880 0.105542 0.546881 0.114355 0.233222 0.768958 0.014653 0.109429 0.106961 0.035014 0.019209 0.022146 0.923631 0.026411 0.928142 0.015617 0.029830 0.022321 0.922707 0.029827 0.025145 0.027563 0.088841 0.036549 0.847047 0.773436 0.042478 0.008878 0.175207 0.033877 0.188822 0.507219 0.270082 0.285243 0.151973 0.056921 0.505863 0.446072 0.155307 0.182833 0.215787 0.302102 0.163570 0.398527 0.135801 Consensus sequence: DDBHACATCCTAKWDV Reverse complement motif 0.302102 0.398527 0.163570 0.135801 0.215787 0.155307 0.182833 0.446072 0.505863 0.151973 0.056921 0.285243 0.033877 0.507219 0.188822 0.270082 0.175207 0.042478 0.008878 0.773436 0.847047 0.088841 0.036549 0.027563 0.022321 0.029827 0.922707 0.025145 0.026411 0.015617 0.928142 0.029830 0.923631 0.019209 0.022146 0.035014 0.106961 0.014653 0.109429 0.768958 0.105542 0.114355 0.546881 0.233222 0.092880 0.048428 0.173290 0.685401 0.262139 0.208028 0.178365 0.351468 0.257568 0.248691 0.251987 0.241753 0.290062 0.133630 0.158772 0.417537 0.249693 0.349462 0.170111 0.230734 Consensus sequence: VDWYTAGGATGTHVDH Alignment: DDBHACATCCTAKWDV ---AAAATKCTATT-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00191 Pou2f2 Reverse Complement Reverse Complement Backward 2 11 0.040676 Species: Mus musculus Original motif 0.143441 0.268530 0.212213 0.375817 0.267386 0.204043 0.174256 0.354316 0.230583 0.148604 0.348518 0.272295 0.127633 0.095216 0.030997 0.746154 0.987721 0.002410 0.003474 0.006395 0.003588 0.019280 0.002951 0.974182 0.005844 0.003199 0.919428 0.071529 0.004446 0.890754 0.005987 0.098813 0.743311 0.001562 0.003671 0.251456 0.893912 0.003008 0.014228 0.088852 0.982166 0.003049 0.002708 0.012076 0.027054 0.005668 0.023977 0.943301 0.197736 0.122428 0.271727 0.408108 0.496910 0.196661 0.105572 0.200857 0.347287 0.129915 0.369062 0.153737 0.409641 0.236160 0.215425 0.138774 Consensus sequence: BHDTATGCAAATDHDV Reverse complement motif 0.138774 0.236160 0.215425 0.409641 0.347287 0.369062 0.129915 0.153737 0.200857 0.196661 0.105572 0.496910 0.408108 0.122428 0.271727 0.197736 0.943301 0.005668 0.023977 0.027054 0.012076 0.003049 0.002708 0.982166 0.088852 0.003008 0.014228 0.893912 0.251456 0.001562 0.003671 0.743311 0.004446 0.005987 0.890754 0.098813 0.005844 0.919428 0.003199 0.071529 0.974182 0.019280 0.002951 0.003588 0.006395 0.002410 0.003474 0.987721 0.746154 0.095216 0.030997 0.127633 0.230583 0.348518 0.148604 0.272295 0.354316 0.204043 0.174256 0.267386 0.375817 0.268530 0.212213 0.143441 Consensus sequence: BHHDATTTGCATAHHV Alignment: BHHDATTTGCATAHHV ----AATAGYATTTT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00179 Pou2f3 Reverse Complement Reverse Complement Forward 5 11 0.040705 Species: Mus musculus Original motif 0.163923 0.199410 0.196283 0.440385 0.244854 0.217834 0.151102 0.386210 0.185934 0.134662 0.398787 0.280618 0.090352 0.119462 0.037157 0.753030 0.990346 0.001754 0.001818 0.006083 0.002450 0.011715 0.002154 0.983680 0.002638 0.001114 0.938678 0.057569 0.002016 0.911319 0.003818 0.082847 0.740177 0.001090 0.002005 0.256728 0.905415 0.001757 0.014660 0.078168 0.987356 0.003190 0.001846 0.007608 0.016362 0.004807 0.016312 0.962520 0.153576 0.155400 0.290074 0.400950 0.455331 0.242511 0.111337 0.190822 0.293425 0.163528 0.350203 0.192844 0.411723 0.243796 0.182398 0.162083 Consensus sequence: BHDTATGCAAATBHDV Reverse complement motif 0.162083 0.243796 0.182398 0.411723 0.293425 0.350203 0.163528 0.192844 0.190822 0.242511 0.111337 0.455331 0.400950 0.155400 0.290074 0.153576 0.962520 0.004807 0.016312 0.016362 0.007608 0.003190 0.001846 0.987356 0.078168 0.001757 0.014660 0.905415 0.256728 0.001090 0.002005 0.740177 0.002016 0.003818 0.911319 0.082847 0.002638 0.938678 0.001114 0.057569 0.983680 0.011715 0.002154 0.002450 0.006083 0.001754 0.001818 0.990346 0.753030 0.119462 0.037157 0.090352 0.185934 0.398787 0.134662 0.280618 0.386210 0.217834 0.151102 0.244854 0.440385 0.199410 0.196283 0.163923 Consensus sequence: BHHVATTTGCATAHHV Alignment: BHHVATTTGCATAHHV ----AATAGYATTTT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00023 Sox30_primary Reverse Complement Reverse Complement Backward 6 11 0.041387 Species: Mus musculus Original motif 0.372432 0.102933 0.322145 0.202491 0.328072 0.182071 0.157347 0.332510 0.289417 0.084511 0.292873 0.333198 0.157571 0.227851 0.441662 0.172917 0.716832 0.049010 0.201411 0.032747 0.957368 0.003162 0.004402 0.035068 0.003907 0.862678 0.009407 0.124008 0.977231 0.007658 0.004263 0.010847 0.976481 0.004510 0.015225 0.003784 0.067568 0.004353 0.005071 0.923008 0.158205 0.108442 0.467023 0.266330 0.334549 0.091557 0.510241 0.063654 0.456431 0.182602 0.150234 0.210732 0.387485 0.241062 0.151504 0.219950 0.188387 0.269857 0.176514 0.365242 0.175680 0.243984 0.165833 0.414502 Consensus sequence: DHDBAACAATDRHHHH Reverse complement motif 0.414502 0.243984 0.165833 0.175680 0.365242 0.269857 0.176514 0.188387 0.219950 0.241062 0.151504 0.387485 0.210732 0.182602 0.150234 0.456431 0.334549 0.510241 0.091557 0.063654 0.158205 0.467023 0.108442 0.266330 0.923008 0.004353 0.005071 0.067568 0.003784 0.004510 0.015225 0.976481 0.010847 0.007658 0.004263 0.977231 0.003907 0.009407 0.862678 0.124008 0.035068 0.003162 0.004402 0.957368 0.032747 0.049010 0.201411 0.716832 0.157571 0.441662 0.227851 0.172917 0.333198 0.084511 0.292873 0.289417 0.332510 0.182071 0.157347 0.328072 0.202491 0.102933 0.322145 0.372432 Consensus sequence: HHHHMHATTGTTBDHD Alignment: HHHHMHATTGTTBDHD AATAGYATTTT----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00166 Barhl1 Original Motif Original Motif Backward 6 11 0.042744 Species: Mus musculus Original motif 0.467514 0.210142 0.140580 0.181765 0.607254 0.124874 0.137587 0.130285 0.280889 0.423565 0.125411 0.170135 0.748944 0.067655 0.136796 0.046605 0.723747 0.023732 0.218759 0.033762 0.075749 0.608701 0.182230 0.133321 0.005053 0.764340 0.000825 0.229781 0.951342 0.006010 0.029473 0.013175 0.890431 0.010111 0.000910 0.098548 0.004275 0.001291 0.002113 0.992321 0.005850 0.006608 0.000432 0.987110 0.979314 0.000732 0.001996 0.017957 0.546971 0.034786 0.326876 0.091366 0.120451 0.194359 0.328320 0.356870 0.274765 0.177491 0.231888 0.315855 0.223913 0.420032 0.139775 0.216280 Consensus sequence: HAHAACCAATTARBDH Reverse complement motif 0.223913 0.139775 0.420032 0.216280 0.315855 0.177491 0.231888 0.274765 0.356870 0.194359 0.328320 0.120451 0.091366 0.034786 0.326876 0.546971 0.017957 0.000732 0.001996 0.979314 0.987110 0.006608 0.000432 0.005850 0.992321 0.001291 0.002113 0.004275 0.098548 0.010111 0.000910 0.890431 0.013175 0.006010 0.029473 0.951342 0.005053 0.000825 0.764340 0.229781 0.075749 0.182230 0.608701 0.133321 0.033762 0.023732 0.218759 0.723747 0.046605 0.067655 0.136796 0.748944 0.280889 0.125411 0.423565 0.170135 0.130285 0.124874 0.137587 0.607254 0.181765 0.210142 0.140580 0.467514 Consensus sequence: DDVKTAATTGGTTDTH Alignment: HAHAACCAATTARBDH AAAATKCTATT----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 8 Motif name: Motif 8 Original motif 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.500000 0.500000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 Consensus sequence: TGAAAATSCTT Reserve complement motif 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.500000 0.500000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 Consensus sequence: AAGSATTTTCA ************************************************************************ Best Matches for Motif ID 8 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00179 Pou2f3 Reverse Complement Reverse Complement Forward 1 11 0.017041 Species: Mus musculus Original motif 0.163923 0.199410 0.196283 0.440385 0.244854 0.217834 0.151102 0.386210 0.185934 0.134662 0.398787 0.280618 0.090352 0.119462 0.037157 0.753030 0.990346 0.001754 0.001818 0.006083 0.002450 0.011715 0.002154 0.983680 0.002638 0.001114 0.938678 0.057569 0.002016 0.911319 0.003818 0.082847 0.740177 0.001090 0.002005 0.256728 0.905415 0.001757 0.014660 0.078168 0.987356 0.003190 0.001846 0.007608 0.016362 0.004807 0.016312 0.962520 0.153576 0.155400 0.290074 0.400950 0.455331 0.242511 0.111337 0.190822 0.293425 0.163528 0.350203 0.192844 0.411723 0.243796 0.182398 0.162083 Consensus sequence: BHDTATGCAAATBHDV Reverse complement motif 0.162083 0.243796 0.182398 0.411723 0.293425 0.350203 0.163528 0.192844 0.190822 0.242511 0.111337 0.455331 0.400950 0.155400 0.290074 0.153576 0.962520 0.004807 0.016312 0.016362 0.007608 0.003190 0.001846 0.987356 0.078168 0.001757 0.014660 0.905415 0.256728 0.001090 0.002005 0.740177 0.002016 0.003818 0.911319 0.082847 0.002638 0.938678 0.001114 0.057569 0.983680 0.011715 0.002154 0.002450 0.006083 0.001754 0.001818 0.990346 0.753030 0.119462 0.037157 0.090352 0.185934 0.398787 0.134662 0.280618 0.386210 0.217834 0.151102 0.244854 0.440385 0.199410 0.196283 0.163923 Consensus sequence: BHHVATTTGCATAHHV Alignment: BHHVATTTGCATAHHV AAGSATTTTCA----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00191 Pou2f2 Reverse Complement Reverse Complement Backward 6 11 0.018680 Species: Mus musculus Original motif 0.143441 0.268530 0.212213 0.375817 0.267386 0.204043 0.174256 0.354316 0.230583 0.148604 0.348518 0.272295 0.127633 0.095216 0.030997 0.746154 0.987721 0.002410 0.003474 0.006395 0.003588 0.019280 0.002951 0.974182 0.005844 0.003199 0.919428 0.071529 0.004446 0.890754 0.005987 0.098813 0.743311 0.001562 0.003671 0.251456 0.893912 0.003008 0.014228 0.088852 0.982166 0.003049 0.002708 0.012076 0.027054 0.005668 0.023977 0.943301 0.197736 0.122428 0.271727 0.408108 0.496910 0.196661 0.105572 0.200857 0.347287 0.129915 0.369062 0.153737 0.409641 0.236160 0.215425 0.138774 Consensus sequence: BHDTATGCAAATDHDV Reverse complement motif 0.138774 0.236160 0.215425 0.409641 0.347287 0.369062 0.129915 0.153737 0.200857 0.196661 0.105572 0.496910 0.408108 0.122428 0.271727 0.197736 0.943301 0.005668 0.023977 0.027054 0.012076 0.003049 0.002708 0.982166 0.088852 0.003008 0.014228 0.893912 0.251456 0.001562 0.003671 0.743311 0.004446 0.005987 0.890754 0.098813 0.005844 0.919428 0.003199 0.071529 0.974182 0.019280 0.002951 0.003588 0.006395 0.002410 0.003474 0.987721 0.746154 0.095216 0.030997 0.127633 0.230583 0.348518 0.148604 0.272295 0.354316 0.204043 0.174256 0.267386 0.375817 0.268530 0.212213 0.143441 Consensus sequence: BHHDATTTGCATAHHV Alignment: BHHDATTTGCATAHHV AAGSATTTTCA----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00044 Mafk_primary Original Motif Original Motif Backward 5 11 0.025968 Species: Mus musculus Original motif 0.245931 0.193118 0.199428 0.361523 0.489106 0.078574 0.157014 0.275306 0.744659 0.025715 0.102440 0.127186 0.677561 0.030532 0.064134 0.227772 0.621949 0.037389 0.034818 0.305844 0.394828 0.100590 0.123295 0.381287 0.040491 0.082155 0.007425 0.869929 0.023425 0.010118 0.934562 0.031895 0.108761 0.847231 0.005930 0.038078 0.049587 0.025925 0.010216 0.914271 0.048851 0.008289 0.821725 0.121135 0.919694 0.018019 0.017253 0.045033 0.013536 0.716811 0.037362 0.232291 0.148097 0.100721 0.092846 0.658336 0.185674 0.220883 0.168608 0.424835 Consensus sequence: DWAAAWTGCTGACTH Reverse complement motif 0.424835 0.220883 0.168608 0.185674 0.658336 0.100721 0.092846 0.148097 0.013536 0.037362 0.716811 0.232291 0.045033 0.018019 0.017253 0.919694 0.048851 0.821725 0.008289 0.121135 0.914271 0.025925 0.010216 0.049587 0.108761 0.005930 0.847231 0.038078 0.023425 0.934562 0.010118 0.031895 0.869929 0.082155 0.007425 0.040491 0.381287 0.100590 0.123295 0.394828 0.305844 0.037389 0.034818 0.621949 0.227772 0.030532 0.064134 0.677561 0.127186 0.025715 0.102440 0.744659 0.275306 0.078574 0.157014 0.489106 0.361523 0.193118 0.199428 0.245931 Consensus sequence: HAGTCAGCAWTTTWD Alignment: DWAAAWTGCTGACTH TGAAAATSCTT---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00389 Nkx3-1 Original Motif Reverse Complement Forward 3 11 0.028143 Species: Mus musculus Original motif 0.230343 0.129202 0.214468 0.425986 0.359358 0.121340 0.162570 0.356732 0.227575 0.345211 0.162386 0.264827 0.285383 0.076814 0.227804 0.409998 0.760754 0.004039 0.216886 0.018321 0.850903 0.006399 0.121474 0.021224 0.007291 0.042579 0.943324 0.006806 0.001583 0.137946 0.005502 0.854969 0.854969 0.005502 0.137946 0.001583 0.006806 0.943324 0.042579 0.007291 0.021224 0.121474 0.006399 0.850903 0.018321 0.216886 0.004039 0.760754 0.691606 0.099604 0.051045 0.157745 0.629431 0.051419 0.224807 0.094342 0.570121 0.143534 0.137491 0.148853 0.303064 0.084741 0.174009 0.438186 0.202801 0.252788 0.303231 0.241180 Consensus sequence: DDHDAAGTACTTAAADB Reverse complement motif 0.202801 0.303231 0.252788 0.241180 0.438186 0.084741 0.174009 0.303064 0.148853 0.143534 0.137491 0.570121 0.094342 0.051419 0.224807 0.629431 0.157745 0.099604 0.051045 0.691606 0.760754 0.216886 0.004039 0.018321 0.850903 0.121474 0.006399 0.021224 0.006806 0.042579 0.943324 0.007291 0.001583 0.005502 0.137946 0.854969 0.854969 0.137946 0.005502 0.001583 0.007291 0.943324 0.042579 0.006806 0.021224 0.006399 0.121474 0.850903 0.018321 0.004039 0.216886 0.760754 0.409998 0.076814 0.227804 0.285383 0.227575 0.162386 0.345211 0.264827 0.356732 0.121340 0.162570 0.359358 0.425986 0.129202 0.214468 0.230343 Consensus sequence: BDTTTAAGTACTTDDDD Alignment: BDTTTAAGTACTTDDDD --TGAAAATSCTT---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00153 Pitx1 Reverse Complement Original Motif Backward 3 11 0.028340 Species: Mus musculus Original motif 0.207371 0.246323 0.166934 0.379372 0.115831 0.171040 0.352289 0.360841 0.435857 0.190325 0.290547 0.083272 0.281154 0.147141 0.422767 0.148938 0.453996 0.050465 0.389240 0.106298 0.187631 0.043211 0.734974 0.034185 0.042788 0.001867 0.954016 0.001329 0.006032 0.001055 0.986493 0.006420 0.955163 0.042114 0.000355 0.002368 0.003755 0.004760 0.000754 0.990731 0.005515 0.009073 0.000267 0.985144 0.913280 0.000712 0.001035 0.084973 0.721584 0.024188 0.198396 0.055833 0.334868 0.490003 0.058252 0.116877 0.457303 0.071620 0.241947 0.229130 0.478355 0.207860 0.143752 0.170032 0.256961 0.248882 0.203598 0.290559 Consensus sequence: HBVDRGGGATTAAMDHH Reverse complement motif 0.290559 0.248882 0.203598 0.256961 0.170032 0.207860 0.143752 0.478355 0.229130 0.071620 0.241947 0.457303 0.334868 0.058252 0.490003 0.116877 0.055833 0.024188 0.198396 0.721584 0.084973 0.000712 0.001035 0.913280 0.985144 0.009073 0.000267 0.005515 0.990731 0.004760 0.000754 0.003755 0.002368 0.042114 0.000355 0.955163 0.006032 0.986493 0.001055 0.006420 0.042788 0.954016 0.001867 0.001329 0.187631 0.734974 0.043211 0.034185 0.106298 0.050465 0.389240 0.453996 0.281154 0.422767 0.147141 0.148938 0.083272 0.190325 0.290547 0.435857 0.360841 0.171040 0.352289 0.115831 0.379372 0.246323 0.166934 0.207371 Consensus sequence: HHDRTTAATCCCKHBVH Alignment: HBVDRGGGATTAAMDHH ----AAGSATTTTCA-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00219 Cutl1_3494.2 Original Motif Reverse Complement Forward 4 11 0.029424 Species: Mus musculus Original motif 0.233720 0.082903 0.208991 0.474386 0.507651 0.192839 0.165657 0.133852 0.416857 0.143747 0.322292 0.117104 0.029365 0.184697 0.093857 0.692081 0.144573 0.053738 0.658701 0.142989 0.867186 0.053221 0.032993 0.046600 0.042812 0.012598 0.006269 0.938320 0.338930 0.056180 0.507869 0.097021 0.938320 0.006269 0.012598 0.042812 0.046600 0.032993 0.053221 0.867186 0.142989 0.658701 0.053738 0.144573 0.692081 0.093857 0.184697 0.029365 0.260491 0.409202 0.153408 0.176899 0.151407 0.065515 0.123404 0.659674 0.492484 0.127826 0.190198 0.189491 Consensus sequence: DAVTGATRATCAHTD Reverse complement motif 0.189491 0.127826 0.190198 0.492484 0.659674 0.065515 0.123404 0.151407 0.260491 0.153408 0.409202 0.176899 0.029365 0.093857 0.184697 0.692081 0.142989 0.053738 0.658701 0.144573 0.867186 0.032993 0.053221 0.046600 0.042812 0.006269 0.012598 0.938320 0.338930 0.507869 0.056180 0.097021 0.938320 0.012598 0.006269 0.042812 0.046600 0.053221 0.032993 0.867186 0.144573 0.658701 0.053738 0.142989 0.692081 0.184697 0.093857 0.029365 0.117104 0.143747 0.322292 0.416857 0.133852 0.192839 0.165657 0.507651 0.474386 0.082903 0.208991 0.233720 Consensus sequence: DADTGATMATCABTD Alignment: DADTGATMATCABTD ---TGAAAATSCTT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00119 Nkx2-9 Reverse Complement Reverse Complement Backward 2 11 0.030083 Species: Mus musculus Original motif 0.246057 0.081231 0.164694 0.508019 0.148670 0.199380 0.121257 0.530694 0.228864 0.152179 0.074714 0.544243 0.315761 0.097229 0.242200 0.344810 0.669183 0.002936 0.306075 0.021805 0.870957 0.008933 0.091276 0.028835 0.009834 0.028141 0.956928 0.005097 0.001783 0.219475 0.004428 0.774314 0.774314 0.004428 0.219475 0.001783 0.005097 0.956928 0.028141 0.009834 0.028835 0.091276 0.008933 0.870957 0.021805 0.306075 0.002936 0.669183 0.411282 0.172328 0.253633 0.162758 0.794622 0.018789 0.052643 0.133945 0.590680 0.124233 0.103686 0.181401 0.241272 0.115001 0.214390 0.429337 0.145724 0.359816 0.128911 0.365550 Consensus sequence: TTTDAAGTACTTVAADH Reverse complement motif 0.365550 0.359816 0.128911 0.145724 0.429337 0.115001 0.214390 0.241272 0.181401 0.124233 0.103686 0.590680 0.133945 0.018789 0.052643 0.794622 0.162758 0.172328 0.253633 0.411282 0.669183 0.306075 0.002936 0.021805 0.870957 0.091276 0.008933 0.028835 0.005097 0.028141 0.956928 0.009834 0.001783 0.004428 0.219475 0.774314 0.774314 0.219475 0.004428 0.001783 0.009834 0.956928 0.028141 0.005097 0.028835 0.008933 0.091276 0.870957 0.021805 0.002936 0.306075 0.669183 0.344810 0.097229 0.242200 0.315761 0.544243 0.152179 0.074714 0.228864 0.530694 0.199380 0.121257 0.148670 0.508019 0.081231 0.164694 0.246057 Consensus sequence: HDTTBAAGTACTTDAAA Alignment: HDTTBAAGTACTTDAAA -----AAGSATTTTCA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00190 Nkx2-3 Reverse Complement Reverse Complement Forward 5 11 0.030207 Species: Mus musculus Original motif 0.112665 0.429746 0.074033 0.383556 0.100414 0.366064 0.135644 0.397877 0.083598 0.139792 0.093637 0.682973 0.157091 0.151456 0.101963 0.589490 0.804069 0.003353 0.166845 0.025733 0.880173 0.006767 0.091214 0.021845 0.009561 0.018555 0.963617 0.008268 0.001409 0.250669 0.002497 0.745425 0.745425 0.002497 0.250669 0.001409 0.008268 0.963617 0.018555 0.009561 0.021845 0.091214 0.006767 0.880173 0.025733 0.166845 0.003353 0.804069 0.534325 0.173500 0.200024 0.092151 0.581546 0.078557 0.226846 0.113051 0.210085 0.208523 0.190951 0.390441 0.231700 0.168938 0.404360 0.195002 Consensus sequence: YYTTAAGTACTTAAHD Reverse complement motif 0.231700 0.404360 0.168938 0.195002 0.390441 0.208523 0.190951 0.210085 0.113051 0.078557 0.226846 0.581546 0.092151 0.173500 0.200024 0.534325 0.804069 0.166845 0.003353 0.025733 0.880173 0.091214 0.006767 0.021845 0.008268 0.018555 0.963617 0.009561 0.001409 0.002497 0.250669 0.745425 0.745425 0.250669 0.002497 0.001409 0.009561 0.963617 0.018555 0.008268 0.021845 0.006767 0.091214 0.880173 0.025733 0.003353 0.166845 0.804069 0.589490 0.151456 0.101963 0.157091 0.682973 0.139792 0.093637 0.083598 0.397877 0.366064 0.135644 0.100414 0.112665 0.074033 0.429746 0.383556 Consensus sequence: HHTTAAGTACTTAAMK Alignment: HHTTAAGTACTTAAMK ----AAGSATTTTCA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00038 Spdef_secondary Reverse Complement Reverse Complement Backward 2 11 0.031836 Species: Mus musculus Original motif 0.249693 0.170111 0.349462 0.230734 0.417537 0.133630 0.158772 0.290062 0.241753 0.248691 0.251987 0.257568 0.351468 0.208028 0.178365 0.262139 0.685401 0.048428 0.173290 0.092880 0.105542 0.546881 0.114355 0.233222 0.768958 0.014653 0.109429 0.106961 0.035014 0.019209 0.022146 0.923631 0.026411 0.928142 0.015617 0.029830 0.022321 0.922707 0.029827 0.025145 0.027563 0.088841 0.036549 0.847047 0.773436 0.042478 0.008878 0.175207 0.033877 0.188822 0.507219 0.270082 0.285243 0.151973 0.056921 0.505863 0.446072 0.155307 0.182833 0.215787 0.302102 0.163570 0.398527 0.135801 Consensus sequence: DDBHACATCCTAKWDV Reverse complement motif 0.302102 0.398527 0.163570 0.135801 0.215787 0.155307 0.182833 0.446072 0.505863 0.151973 0.056921 0.285243 0.033877 0.507219 0.188822 0.270082 0.175207 0.042478 0.008878 0.773436 0.847047 0.088841 0.036549 0.027563 0.022321 0.029827 0.922707 0.025145 0.026411 0.015617 0.928142 0.029830 0.923631 0.019209 0.022146 0.035014 0.106961 0.014653 0.109429 0.768958 0.105542 0.114355 0.546881 0.233222 0.092880 0.048428 0.173290 0.685401 0.262139 0.208028 0.178365 0.351468 0.257568 0.248691 0.251987 0.241753 0.290062 0.133630 0.158772 0.417537 0.249693 0.349462 0.170111 0.230734 Consensus sequence: VDWYTAGGATGTHVDH Alignment: VDWYTAGGATGTHVDH ----AAGSATTTTCA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00080 Gata5_primary Reverse Complement Reverse Complement Backward 6 11 0.033342 Species: Mus musculus Original motif 0.327856 0.194160 0.111452 0.366532 0.399982 0.140479 0.170195 0.289344 0.394490 0.145267 0.180539 0.279704 0.409290 0.128785 0.262018 0.199907 0.058803 0.632511 0.120239 0.188447 0.180750 0.075071 0.002496 0.741683 0.003552 0.002471 0.990756 0.003222 0.990124 0.002186 0.003871 0.003820 0.006574 0.003792 0.002332 0.987302 0.961900 0.008809 0.000917 0.028374 0.969948 0.005720 0.005836 0.018496 0.045135 0.146533 0.781309 0.027024 0.485705 0.128187 0.338666 0.047442 0.419254 0.179521 0.274833 0.126393 0.225481 0.195034 0.334267 0.245218 0.478581 0.137289 0.161659 0.222471 0.231990 0.219367 0.227085 0.321557 Consensus sequence: HDDDCTGATAAGRVDDD Reverse complement motif 0.321557 0.219367 0.227085 0.231990 0.222471 0.137289 0.161659 0.478581 0.225481 0.334267 0.195034 0.245218 0.126393 0.179521 0.274833 0.419254 0.047442 0.128187 0.338666 0.485705 0.045135 0.781309 0.146533 0.027024 0.018496 0.005720 0.005836 0.969948 0.028374 0.008809 0.000917 0.961900 0.987302 0.003792 0.002332 0.006574 0.003820 0.002186 0.003871 0.990124 0.003552 0.990756 0.002471 0.003222 0.741683 0.075071 0.002496 0.180750 0.058803 0.120239 0.632511 0.188447 0.199907 0.128785 0.262018 0.409290 0.279704 0.145267 0.180539 0.394490 0.289344 0.140479 0.170195 0.399982 0.366532 0.194160 0.111452 0.327856 Consensus sequence: DDHBKCTTATCAGDDDH Alignment: DDHBKCTTATCAGDDDH -AAGSATTTTCA----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 9 Motif name: Motif 9 Original motif 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 Consensus sequence: AACATATTTTCA Reserve complement motif 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 Consensus sequence: TGAAAATATGTT ************************************************************************ Best Matches for Motif ID 9 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00250 Irx5 Reverse Complement Original Motif Backward 6 12 0.025322 Species: Mus musculus Original motif 0.367463 0.110357 0.154650 0.367530 0.435675 0.104106 0.185653 0.274566 0.309411 0.166534 0.199426 0.324629 0.330171 0.218393 0.207727 0.243708 0.326575 0.006155 0.067531 0.599738 0.934344 0.018417 0.011430 0.035810 0.004941 0.961788 0.005465 0.027806 0.940152 0.001107 0.011177 0.047564 0.047564 0.011177 0.001107 0.940152 0.027806 0.005465 0.961788 0.004941 0.035810 0.011430 0.018417 0.934344 0.599738 0.067531 0.006155 0.326575 0.348557 0.239288 0.195868 0.216288 0.376605 0.112652 0.210787 0.299957 0.540552 0.074408 0.115847 0.269192 0.210439 0.212707 0.245294 0.331559 0.303891 0.113735 0.133741 0.448633 Consensus sequence: DDDHWACATGTWHDABW Reverse complement motif 0.448633 0.113735 0.133741 0.303891 0.331559 0.212707 0.245294 0.210439 0.269192 0.074408 0.115847 0.540552 0.299957 0.112652 0.210787 0.376605 0.216288 0.239288 0.195868 0.348557 0.326575 0.067531 0.006155 0.599738 0.934344 0.011430 0.018417 0.035810 0.027806 0.961788 0.005465 0.004941 0.940152 0.011177 0.001107 0.047564 0.047564 0.001107 0.011177 0.940152 0.004941 0.005465 0.961788 0.027806 0.035810 0.018417 0.011430 0.934344 0.599738 0.006155 0.067531 0.326575 0.243708 0.218393 0.207727 0.330171 0.324629 0.166534 0.199426 0.309411 0.274566 0.104106 0.185653 0.435675 0.367530 0.110357 0.154650 0.367463 Consensus sequence: WVTDHWACATGTWHDDD Alignment: DDDHWACATGTWHDABW TGAAAATATGTT----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00236 Irx2 Reverse Complement Original Motif Forward 1 12 0.026734 Species: Mus musculus Original motif 0.394106 0.081399 0.100827 0.423668 0.466343 0.126236 0.130788 0.276633 0.319347 0.127772 0.257087 0.295794 0.406891 0.139766 0.252855 0.200488 0.219982 0.007245 0.029337 0.743436 0.947280 0.014984 0.012651 0.025086 0.003955 0.974386 0.007466 0.014192 0.956452 0.001229 0.011361 0.030959 0.030959 0.011361 0.001229 0.956452 0.014192 0.007466 0.974386 0.003955 0.025086 0.012651 0.014984 0.947280 0.743436 0.029337 0.007245 0.219982 0.404816 0.174236 0.206626 0.214322 0.295979 0.194049 0.285864 0.224108 0.399608 0.106063 0.123706 0.370623 0.176973 0.196462 0.269004 0.357560 0.339978 0.107593 0.083682 0.468747 Consensus sequence: WDDDTACATGTADDWBW Reverse complement motif 0.468747 0.107593 0.083682 0.339978 0.357560 0.196462 0.269004 0.176973 0.370623 0.106063 0.123706 0.399608 0.224108 0.194049 0.285864 0.295979 0.214322 0.174236 0.206626 0.404816 0.219982 0.029337 0.007245 0.743436 0.947280 0.012651 0.014984 0.025086 0.014192 0.974386 0.007466 0.003955 0.956452 0.011361 0.001229 0.030959 0.030959 0.001229 0.011361 0.956452 0.003955 0.007466 0.974386 0.014192 0.025086 0.014984 0.012651 0.947280 0.743436 0.007245 0.029337 0.219982 0.200488 0.139766 0.252855 0.406891 0.295794 0.127772 0.257087 0.319347 0.276633 0.126236 0.130788 0.466343 0.423668 0.081399 0.100827 0.394106 Consensus sequence: WVWDDTACATGTADDDW Alignment: WVWDDTACATGTADDDW TGAAAATATGTT----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00059 Arid5a_primary Reverse Complement Reverse Complement Backward 1 12 0.028582 Species: Mus musculus Original motif 0.177323 0.428313 0.229036 0.165328 0.160222 0.324571 0.032445 0.482762 0.852203 0.026733 0.073955 0.047109 0.961249 0.003798 0.010118 0.024835 0.056540 0.004008 0.007877 0.931575 0.930331 0.005138 0.007138 0.057393 0.019951 0.014189 0.006789 0.959072 0.041132 0.087506 0.039025 0.832338 0.233919 0.027935 0.519605 0.218541 0.339577 0.352988 0.184316 0.123119 0.285389 0.134719 0.268289 0.311602 0.572143 0.078418 0.190434 0.159005 0.285669 0.184068 0.262199 0.268064 0.342799 0.230460 0.153946 0.272795 Consensus sequence: VYAATATTGVDADH Reverse complement motif 0.272795 0.230460 0.153946 0.342799 0.268064 0.184068 0.262199 0.285669 0.159005 0.078418 0.190434 0.572143 0.311602 0.134719 0.268289 0.285389 0.339577 0.184316 0.352988 0.123119 0.233919 0.519605 0.027935 0.218541 0.832338 0.087506 0.039025 0.041132 0.959072 0.014189 0.006789 0.019951 0.057393 0.005138 0.007138 0.930331 0.931575 0.004008 0.007877 0.056540 0.024835 0.003798 0.010118 0.961249 0.047109 0.026733 0.073955 0.852203 0.482762 0.324571 0.032445 0.160222 0.177323 0.229036 0.428313 0.165328 Consensus sequence: HDTDVCAATATTMV Alignment: HDTDVCAATATTMV --TGAAAATATGTT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00194 Irx4 Reverse Complement Original Motif Forward 1 12 0.029742 Species: Mus musculus Original motif 0.448141 0.082257 0.141153 0.328449 0.354010 0.179239 0.231684 0.235067 0.300226 0.196857 0.192403 0.310514 0.269192 0.228296 0.259727 0.242784 0.325458 0.008737 0.038497 0.627307 0.907258 0.013201 0.015875 0.063665 0.010499 0.935216 0.007784 0.046501 0.897816 0.001332 0.019141 0.081711 0.081711 0.019141 0.001332 0.897816 0.046501 0.007784 0.935216 0.010499 0.063665 0.015875 0.013201 0.907258 0.627307 0.038497 0.008737 0.325458 0.563710 0.193341 0.098815 0.144134 0.461314 0.079125 0.155617 0.303944 0.513284 0.108439 0.126002 0.252275 0.195487 0.320893 0.240955 0.242665 0.385008 0.137791 0.149762 0.327440 Consensus sequence: WDHDWACATGTWAWABD Reverse complement motif 0.327440 0.137791 0.149762 0.385008 0.195487 0.240955 0.320893 0.242665 0.252275 0.108439 0.126002 0.513284 0.303944 0.079125 0.155617 0.461314 0.144134 0.193341 0.098815 0.563710 0.325458 0.038497 0.008737 0.627307 0.907258 0.015875 0.013201 0.063665 0.046501 0.935216 0.007784 0.010499 0.897816 0.019141 0.001332 0.081711 0.081711 0.001332 0.019141 0.897816 0.010499 0.007784 0.935216 0.046501 0.063665 0.013201 0.015875 0.907258 0.627307 0.008737 0.038497 0.325458 0.242784 0.228296 0.259727 0.269192 0.310514 0.196857 0.192403 0.300226 0.235067 0.179239 0.231684 0.354010 0.328449 0.082257 0.141153 0.448141 Consensus sequence: DBTWTWACATGTWDHDW Alignment: WDHDWACATGTWAWABD TGAAAATATGTT----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00223 Irx3_0920.1 Reverse Complement Original Motif Forward 1 12 0.029857 Species: Mus musculus Original motif 0.369314 0.086226 0.205101 0.339359 0.332302 0.160101 0.284255 0.223343 0.291107 0.190306 0.229518 0.289068 0.295366 0.218346 0.264868 0.221420 0.224029 0.007037 0.047157 0.721777 0.935123 0.014036 0.014073 0.036768 0.004474 0.977496 0.005620 0.012411 0.924256 0.001181 0.015903 0.058661 0.058661 0.015903 0.001181 0.924256 0.012411 0.005620 0.977496 0.004474 0.036768 0.014073 0.014036 0.935123 0.721777 0.047157 0.007037 0.224029 0.449320 0.226936 0.166094 0.157650 0.313283 0.070145 0.179424 0.437148 0.522855 0.074913 0.105873 0.296358 0.185897 0.387406 0.129138 0.297559 0.276853 0.127952 0.189255 0.405940 Consensus sequence: DDDDTACATGTAVWWHD Reverse complement motif 0.405940 0.127952 0.189255 0.276853 0.185897 0.129138 0.387406 0.297559 0.296358 0.074913 0.105873 0.522855 0.437148 0.070145 0.179424 0.313283 0.157650 0.226936 0.166094 0.449320 0.224029 0.047157 0.007037 0.721777 0.935123 0.014073 0.014036 0.036768 0.012411 0.977496 0.005620 0.004474 0.924256 0.015903 0.001181 0.058661 0.058661 0.001181 0.015903 0.924256 0.004474 0.005620 0.977496 0.012411 0.036768 0.014036 0.014073 0.935123 0.721777 0.007037 0.047157 0.224029 0.221420 0.218346 0.264868 0.295366 0.289068 0.190306 0.229518 0.291107 0.223343 0.160101 0.284255 0.332302 0.339359 0.086226 0.205101 0.369314 Consensus sequence: DDWWBTACATGTADDDD Alignment: DDDDTACATGTAVWWHD TGAAAATATGTT----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00223 Irx3_2226.1 Reverse Complement Original Motif Backward 6 12 0.029991 Species: Mus musculus Original motif 0.402654 0.107068 0.157939 0.332339 0.381229 0.129621 0.243277 0.245872 0.271699 0.148903 0.261472 0.317925 0.278393 0.239730 0.235045 0.246831 0.223980 0.006073 0.031227 0.738720 0.952925 0.013731 0.008900 0.024444 0.005380 0.972117 0.004335 0.018169 0.945295 0.001062 0.011429 0.042214 0.042214 0.011429 0.001062 0.945295 0.018169 0.004335 0.972117 0.005380 0.024444 0.008900 0.013731 0.952925 0.738720 0.031227 0.006073 0.223980 0.449438 0.199271 0.196335 0.154956 0.266542 0.085070 0.155050 0.493338 0.412619 0.114771 0.151818 0.320792 0.175351 0.270485 0.162372 0.391791 0.355721 0.130415 0.156633 0.357231 Consensus sequence: DDDHTACATGTAVWDHD Reverse complement motif 0.357231 0.130415 0.156633 0.355721 0.391791 0.270485 0.162372 0.175351 0.320792 0.114771 0.151818 0.412619 0.493338 0.085070 0.155050 0.266542 0.154956 0.199271 0.196335 0.449438 0.223980 0.031227 0.006073 0.738720 0.952925 0.008900 0.013731 0.024444 0.018169 0.972117 0.004335 0.005380 0.945295 0.011429 0.001062 0.042214 0.042214 0.001062 0.011429 0.945295 0.005380 0.004335 0.972117 0.018169 0.024444 0.013731 0.008900 0.952925 0.738720 0.006073 0.031227 0.223980 0.246831 0.239730 0.235045 0.278393 0.317925 0.148903 0.261472 0.271699 0.245872 0.129621 0.243277 0.381229 0.332339 0.107068 0.157939 0.402654 Consensus sequence: DHDWBTACATGTAHDDD Alignment: DDDHTACATGTAVWDHD TGAAAATATGTT----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00150 Irx6 Reverse Complement Original Motif Backward 6 12 0.030326 Species: Mus musculus Original motif 0.356323 0.182245 0.120162 0.341271 0.540549 0.133347 0.119342 0.206762 0.401575 0.161837 0.116292 0.320296 0.311151 0.164568 0.283941 0.240340 0.198376 0.006596 0.030801 0.764227 0.947120 0.014182 0.010382 0.028316 0.006934 0.957983 0.007710 0.027373 0.947314 0.001874 0.016190 0.034622 0.034622 0.016190 0.001874 0.947314 0.027373 0.007710 0.957983 0.006934 0.028316 0.010382 0.014182 0.947120 0.764227 0.030801 0.006596 0.198376 0.372950 0.265937 0.182203 0.178910 0.399793 0.101871 0.214477 0.283859 0.478414 0.110202 0.114534 0.296850 0.317990 0.215498 0.212041 0.254471 0.131398 0.063397 0.070049 0.735156 Consensus sequence: HAHDTACATGTAVDWHT Reverse complement motif 0.735156 0.063397 0.070049 0.131398 0.254471 0.215498 0.212041 0.317990 0.296850 0.110202 0.114534 0.478414 0.283859 0.101871 0.214477 0.399793 0.178910 0.265937 0.182203 0.372950 0.198376 0.030801 0.006596 0.764227 0.947120 0.010382 0.014182 0.028316 0.027373 0.957983 0.007710 0.006934 0.947314 0.016190 0.001874 0.034622 0.034622 0.001874 0.016190 0.947314 0.006934 0.007710 0.957983 0.027373 0.028316 0.014182 0.010382 0.947120 0.764227 0.006596 0.030801 0.198376 0.240340 0.164568 0.283941 0.311151 0.320296 0.161837 0.116292 0.401575 0.206762 0.133347 0.119342 0.540549 0.341271 0.182245 0.120162 0.356323 Consensus sequence: AHWDBTACATGTADHTH Alignment: HAHDTACATGTAVDWHT TGAAAATATGTT----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00171 Msx3 Reverse Complement Reverse Complement Backward 4 12 0.031600 Species: Mus musculus Original motif 0.317812 0.352438 0.231628 0.098123 0.601471 0.133830 0.164947 0.099752 0.399508 0.293187 0.098524 0.208781 0.754569 0.054130 0.133622 0.057678 0.770469 0.088090 0.086904 0.054537 0.038689 0.673100 0.189096 0.099115 0.004935 0.522968 0.000482 0.471615 0.986316 0.001484 0.009222 0.002978 0.991636 0.005079 0.001457 0.001828 0.009156 0.001857 0.001081 0.987906 0.013688 0.006588 0.000191 0.979532 0.987635 0.000354 0.005166 0.006845 0.701095 0.027828 0.154852 0.116224 0.181731 0.184800 0.303458 0.330011 0.224816 0.221032 0.182405 0.371747 0.310539 0.208307 0.099081 0.382073 Consensus sequence: VAHAACYAATTAABHH Reverse complement motif 0.382073 0.208307 0.099081 0.310539 0.371747 0.221032 0.182405 0.224816 0.330011 0.184800 0.303458 0.181731 0.116224 0.027828 0.154852 0.701095 0.006845 0.000354 0.005166 0.987635 0.979532 0.006588 0.000191 0.013688 0.987906 0.001857 0.001081 0.009156 0.001828 0.005079 0.001457 0.991636 0.002978 0.001484 0.009222 0.986316 0.004935 0.000482 0.522968 0.471615 0.038689 0.189096 0.673100 0.099115 0.054537 0.088090 0.086904 0.770469 0.057678 0.054130 0.133622 0.754569 0.208781 0.293187 0.098524 0.399508 0.099752 0.133830 0.164947 0.601471 0.317812 0.231628 0.352438 0.098123 Consensus sequence: HHVTTAATTKGTTHTV Alignment: HHVTTAATTKGTTHTV -TGAAAATATGTT--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00146 Pou6f1_3733.1 Original Motif Reverse Complement Forward 4 12 0.033085 Species: Mus musculus Original motif 0.380020 0.211224 0.295981 0.112776 0.349734 0.309602 0.075135 0.265530 0.356459 0.226592 0.169646 0.247302 0.229673 0.350174 0.311906 0.108247 0.757838 0.046686 0.016036 0.179440 0.014478 0.002669 0.000464 0.982389 0.984156 0.000563 0.002241 0.013039 0.992195 0.001470 0.001823 0.004511 0.001610 0.002156 0.003120 0.993114 0.008328 0.001327 0.802239 0.188106 0.990155 0.004149 0.002815 0.002881 0.004992 0.004117 0.965215 0.025676 0.091361 0.290495 0.533319 0.084826 0.164763 0.143217 0.028702 0.663317 0.164550 0.118473 0.276288 0.440689 0.152985 0.151847 0.413228 0.281941 0.241185 0.447249 0.135344 0.176222 Consensus sequence: VHHVATAATGAGSTDDH Reverse complement motif 0.241185 0.135344 0.447249 0.176222 0.152985 0.413228 0.151847 0.281941 0.440689 0.118473 0.276288 0.164550 0.663317 0.143217 0.028702 0.164763 0.091361 0.533319 0.290495 0.084826 0.004992 0.965215 0.004117 0.025676 0.002881 0.004149 0.002815 0.990155 0.008328 0.802239 0.001327 0.188106 0.993114 0.002156 0.003120 0.001610 0.004511 0.001470 0.001823 0.992195 0.013039 0.000563 0.002241 0.984156 0.982389 0.002669 0.000464 0.014478 0.179440 0.046686 0.016036 0.757838 0.229673 0.311906 0.350174 0.108247 0.247302 0.226592 0.169646 0.356459 0.265530 0.309602 0.075135 0.349734 0.112776 0.211224 0.295981 0.380020 Consensus sequence: DHDASCTCATTATVHHB Alignment: DHDASCTCATTATVHHB ---AACATATTTTCA-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00080 Gata5_primary Original Motif Reverse Complement Forward 1 12 0.033405 Species: Mus musculus Original motif 0.327856 0.194160 0.111452 0.366532 0.399982 0.140479 0.170195 0.289344 0.394490 0.145267 0.180539 0.279704 0.409290 0.128785 0.262018 0.199907 0.058803 0.632511 0.120239 0.188447 0.180750 0.075071 0.002496 0.741683 0.003552 0.002471 0.990756 0.003222 0.990124 0.002186 0.003871 0.003820 0.006574 0.003792 0.002332 0.987302 0.961900 0.008809 0.000917 0.028374 0.969948 0.005720 0.005836 0.018496 0.045135 0.146533 0.781309 0.027024 0.485705 0.128187 0.338666 0.047442 0.419254 0.179521 0.274833 0.126393 0.225481 0.195034 0.334267 0.245218 0.478581 0.137289 0.161659 0.222471 0.231990 0.219367 0.227085 0.321557 Consensus sequence: HDDDCTGATAAGRVDDD Reverse complement motif 0.321557 0.219367 0.227085 0.231990 0.222471 0.137289 0.161659 0.478581 0.225481 0.334267 0.195034 0.245218 0.126393 0.179521 0.274833 0.419254 0.047442 0.128187 0.338666 0.485705 0.045135 0.781309 0.146533 0.027024 0.018496 0.005720 0.005836 0.969948 0.028374 0.008809 0.000917 0.961900 0.987302 0.003792 0.002332 0.006574 0.003820 0.002186 0.003871 0.990124 0.003552 0.990756 0.002471 0.003222 0.741683 0.075071 0.002496 0.180750 0.058803 0.120239 0.632511 0.188447 0.199907 0.128785 0.262018 0.409290 0.279704 0.145267 0.180539 0.394490 0.289344 0.140479 0.170195 0.399982 0.366532 0.194160 0.111452 0.327856 Consensus sequence: DDHBKCTTATCAGDDDH Alignment: DDHBKCTTATCAGDDDH AACATATTTTCA----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 10 Motif name: Motif 10 Original motif 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 Consensus sequence: AAAMATTGTTT Reserve complement motif 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.500000 0.000000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 Consensus sequence: AAACAATYTTT ************************************************************************ Best Matches for Motif ID 10 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00114 Homez Original Motif Original Motif Backward 6 11 0.014898 Species: Mus musculus Original motif 0.585235 0.056880 0.174898 0.182987 0.344783 0.171238 0.144379 0.339600 0.496888 0.112442 0.086669 0.304001 0.457408 0.134777 0.032789 0.375026 0.342717 0.420568 0.171418 0.065297 0.872988 0.030946 0.004203 0.091862 0.006581 0.013120 0.006495 0.973804 0.036193 0.946961 0.004377 0.012469 0.014767 0.005226 0.966106 0.013901 0.208700 0.008264 0.021875 0.761161 0.037957 0.018882 0.028895 0.914266 0.157997 0.026546 0.021365 0.794092 0.139814 0.136272 0.117987 0.605927 0.125467 0.233302 0.183071 0.458161 0.523941 0.191122 0.050126 0.234811 0.374984 0.049392 0.291831 0.283793 0.268235 0.165772 0.308515 0.257477 Consensus sequence: AHWWMATCGTTTTBADD Reverse complement motif 0.268235 0.308515 0.165772 0.257477 0.283793 0.049392 0.291831 0.374984 0.234811 0.191122 0.050126 0.523941 0.458161 0.233302 0.183071 0.125467 0.605927 0.136272 0.117987 0.139814 0.794092 0.026546 0.021365 0.157997 0.914266 0.018882 0.028895 0.037957 0.761161 0.008264 0.021875 0.208700 0.014767 0.966106 0.005226 0.013901 0.036193 0.004377 0.946961 0.012469 0.973804 0.013120 0.006495 0.006581 0.091862 0.030946 0.004203 0.872988 0.342717 0.171418 0.420568 0.065297 0.375026 0.134777 0.032789 0.457408 0.304001 0.112442 0.086669 0.496888 0.339600 0.171238 0.144379 0.344783 0.182987 0.056880 0.174898 0.585235 Consensus sequence: HDTVAAAACGATRWWHT Alignment: AHWWMATCGTTTTBADD -AAAMATTGTTT----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00096 Sox13_primary Original Motif Reverse Complement Backward 5 11 0.015472 Species: Mus musculus Original motif 0.269275 0.121320 0.165706 0.443700 0.188801 0.239798 0.175798 0.395603 0.368195 0.140376 0.162749 0.328680 0.497992 0.105708 0.282795 0.113505 0.130964 0.090292 0.620010 0.158734 0.825318 0.023531 0.125342 0.025809 0.959293 0.007648 0.010682 0.022377 0.019733 0.898543 0.014756 0.066968 0.943830 0.005894 0.014484 0.035792 0.949658 0.010125 0.029732 0.010485 0.038214 0.025063 0.006015 0.930708 0.465769 0.016866 0.079467 0.437898 0.416082 0.086340 0.115778 0.381801 0.356556 0.103268 0.179331 0.360845 0.206830 0.204618 0.120034 0.468518 0.302958 0.164260 0.071574 0.461209 Consensus sequence: DHDRGAACAATWWDHW Reverse complement motif 0.461209 0.164260 0.071574 0.302958 0.468518 0.204618 0.120034 0.206830 0.360845 0.103268 0.179331 0.356556 0.381801 0.086340 0.115778 0.416082 0.437898 0.016866 0.079467 0.465769 0.930708 0.025063 0.006015 0.038214 0.010485 0.010125 0.029732 0.949658 0.035792 0.005894 0.014484 0.943830 0.019733 0.014756 0.898543 0.066968 0.022377 0.007648 0.010682 0.959293 0.025809 0.023531 0.125342 0.825318 0.130964 0.620010 0.090292 0.158734 0.113505 0.105708 0.282795 0.497992 0.328680 0.140376 0.162749 0.368195 0.395603 0.239798 0.175798 0.188801 0.443700 0.121320 0.165706 0.269275 Consensus sequence: WHDWWATTGTTCKDHD Alignment: WHDWWATTGTTCKDHD -AAAMATTGTTT---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00064 Sox18_primary Reverse Complement Reverse Complement Backward 1 11 0.020090 Species: Mus musculus Original motif 0.171923 0.236711 0.194037 0.397329 0.365499 0.126080 0.115062 0.393358 0.154238 0.330371 0.213820 0.301571 0.411934 0.286682 0.023094 0.278290 0.925907 0.006960 0.008324 0.058809 0.020208 0.014069 0.008364 0.957359 0.019255 0.004244 0.009748 0.966753 0.109433 0.025833 0.844558 0.020176 0.053352 0.006877 0.015312 0.924459 0.107006 0.077857 0.051283 0.763854 0.208320 0.284484 0.245065 0.262131 0.230912 0.143849 0.075255 0.549985 0.374917 0.276156 0.167160 0.181766 0.477406 0.100035 0.175575 0.246983 0.375092 0.278435 0.139104 0.207369 0.352086 0.238643 0.148396 0.260874 Consensus sequence: BWBHATTGTTBTHDHH Reverse complement motif 0.260874 0.238643 0.148396 0.352086 0.207369 0.278435 0.139104 0.375092 0.246983 0.100035 0.175575 0.477406 0.181766 0.276156 0.167160 0.374917 0.549985 0.143849 0.075255 0.230912 0.208320 0.245065 0.284484 0.262131 0.763854 0.077857 0.051283 0.107006 0.924459 0.006877 0.015312 0.053352 0.109433 0.844558 0.025833 0.020176 0.966753 0.004244 0.009748 0.019255 0.957359 0.014069 0.008364 0.020208 0.058809 0.006960 0.008324 0.925907 0.278290 0.286682 0.023094 0.411934 0.154238 0.213820 0.330371 0.301571 0.393358 0.126080 0.115062 0.365499 0.397329 0.236711 0.194037 0.171923 Consensus sequence: HHDHABAACAATHBWV Alignment: HHDHABAACAATHBWV -----AAACAATYTTT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00062 Sox4_secondary Reverse Complement Reverse Complement Backward 3 11 0.020377 Species: Mus musculus Original motif 0.215023 0.248815 0.405446 0.130716 0.268935 0.237160 0.296763 0.197142 0.466167 0.161620 0.117910 0.254304 0.414138 0.111006 0.235587 0.239269 0.428152 0.102177 0.293860 0.175812 0.787401 0.005828 0.171310 0.035462 0.925552 0.010602 0.040811 0.023035 0.010733 0.020900 0.013415 0.954952 0.021318 0.013984 0.008294 0.956404 0.120732 0.028204 0.837597 0.013468 0.098711 0.011718 0.010021 0.879550 0.131661 0.240511 0.090087 0.537740 0.341627 0.204369 0.243902 0.210101 0.234383 0.267102 0.292974 0.205541 0.290324 0.095769 0.424669 0.189238 0.308102 0.178524 0.283338 0.230036 0.446441 0.155978 0.209267 0.188314 Consensus sequence: VVHDDAATTGTTDVDDD Reverse complement motif 0.188314 0.155978 0.209267 0.446441 0.230036 0.178524 0.283338 0.308102 0.290324 0.424669 0.095769 0.189238 0.234383 0.292974 0.267102 0.205541 0.210101 0.204369 0.243902 0.341627 0.537740 0.240511 0.090087 0.131661 0.879550 0.011718 0.010021 0.098711 0.120732 0.837597 0.028204 0.013468 0.956404 0.013984 0.008294 0.021318 0.954952 0.020900 0.013415 0.010733 0.023035 0.010602 0.040811 0.925552 0.035462 0.005828 0.171310 0.787401 0.175812 0.102177 0.293860 0.428152 0.239269 0.111006 0.235587 0.414138 0.254304 0.161620 0.117910 0.466167 0.268935 0.296763 0.237160 0.197142 0.215023 0.405446 0.248815 0.130716 Consensus sequence: DDHVDAACAATTDDHVV Alignment: DDHVDAACAATTDDHVV ----AAACAATYTTT-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00051 Sox8_primary Reverse Complement Reverse Complement Backward 3 11 0.020812 Species: Mus musculus Original motif 0.244952 0.197659 0.278014 0.279374 0.244434 0.136006 0.278446 0.341114 0.512025 0.129954 0.139069 0.218951 0.190001 0.086232 0.125500 0.598267 0.154692 0.325860 0.193904 0.325544 0.384624 0.130540 0.035110 0.449726 0.945021 0.006713 0.011975 0.036291 0.008386 0.026630 0.004166 0.960817 0.020908 0.005554 0.009294 0.964244 0.149285 0.038995 0.806085 0.005635 0.110990 0.007155 0.007797 0.874058 0.087283 0.099671 0.059611 0.753435 0.250662 0.432576 0.082152 0.234610 0.251277 0.174578 0.147771 0.426374 0.205121 0.137656 0.296366 0.360857 0.316796 0.152457 0.164403 0.366344 0.475864 0.128717 0.153551 0.241867 Consensus sequence: DDATBWATTGTTHHDDD Reverse complement motif 0.241867 0.128717 0.153551 0.475864 0.366344 0.152457 0.164403 0.316796 0.360857 0.137656 0.296366 0.205121 0.426374 0.174578 0.147771 0.251277 0.250662 0.082152 0.432576 0.234610 0.753435 0.099671 0.059611 0.087283 0.874058 0.007155 0.007797 0.110990 0.149285 0.806085 0.038995 0.005635 0.964244 0.005554 0.009294 0.020908 0.960817 0.026630 0.004166 0.008386 0.036291 0.006713 0.011975 0.945021 0.449726 0.130540 0.035110 0.384624 0.154692 0.193904 0.325860 0.325544 0.598267 0.086232 0.125500 0.190001 0.218951 0.129954 0.139069 0.512025 0.341114 0.136006 0.278446 0.244434 0.279374 0.197659 0.278014 0.244952 Consensus sequence: DDDHDAACAATWBATDD Alignment: DDDHDAACAATWBATDD ----AAACAATYTTT-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00023 Sox30_primary Original Motif Reverse Complement Backward 4 11 0.023541 Species: Mus musculus Original motif 0.372432 0.102933 0.322145 0.202491 0.328072 0.182071 0.157347 0.332510 0.289417 0.084511 0.292873 0.333198 0.157571 0.227851 0.441662 0.172917 0.716832 0.049010 0.201411 0.032747 0.957368 0.003162 0.004402 0.035068 0.003907 0.862678 0.009407 0.124008 0.977231 0.007658 0.004263 0.010847 0.976481 0.004510 0.015225 0.003784 0.067568 0.004353 0.005071 0.923008 0.158205 0.108442 0.467023 0.266330 0.334549 0.091557 0.510241 0.063654 0.456431 0.182602 0.150234 0.210732 0.387485 0.241062 0.151504 0.219950 0.188387 0.269857 0.176514 0.365242 0.175680 0.243984 0.165833 0.414502 Consensus sequence: DHDBAACAATDRHHHH Reverse complement motif 0.414502 0.243984 0.165833 0.175680 0.365242 0.269857 0.176514 0.188387 0.219950 0.241062 0.151504 0.387485 0.210732 0.182602 0.150234 0.456431 0.334549 0.510241 0.091557 0.063654 0.158205 0.467023 0.108442 0.266330 0.923008 0.004353 0.005071 0.067568 0.003784 0.004510 0.015225 0.976481 0.010847 0.007658 0.004263 0.977231 0.003907 0.009407 0.862678 0.124008 0.035068 0.003162 0.004402 0.957368 0.032747 0.049010 0.201411 0.716832 0.157571 0.441662 0.227851 0.172917 0.333198 0.084511 0.292873 0.289417 0.332510 0.182071 0.157347 0.328072 0.202491 0.102933 0.322145 0.372432 Consensus sequence: HHHHMHATTGTTBDHD Alignment: HHHHMHATTGTTBDHD --AAAMATTGTTT--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00091 Sox5_primary Reverse Complement Original Motif Forward 5 11 0.023683 Species: Mus musculus Original motif 0.305368 0.133033 0.173233 0.388366 0.257879 0.197076 0.146872 0.398174 0.257635 0.122462 0.256979 0.362924 0.446808 0.093619 0.289963 0.169610 0.148292 0.091229 0.632311 0.128169 0.827592 0.026174 0.130622 0.015612 0.976345 0.003817 0.005452 0.014386 0.005230 0.937364 0.008904 0.048502 0.973417 0.003014 0.006136 0.017433 0.974095 0.004350 0.011425 0.010130 0.030624 0.011927 0.003795 0.953653 0.491667 0.015453 0.085481 0.407399 0.451773 0.100304 0.244084 0.203838 0.434242 0.114442 0.217049 0.234267 0.333464 0.254828 0.092729 0.318979 0.333644 0.114919 0.184420 0.367017 Consensus sequence: DHDDGAACAATWDDHD Reverse complement motif 0.367017 0.114919 0.184420 0.333644 0.318979 0.254828 0.092729 0.333464 0.234267 0.114442 0.217049 0.434242 0.203838 0.100304 0.244084 0.451773 0.407399 0.015453 0.085481 0.491667 0.953653 0.011927 0.003795 0.030624 0.010130 0.004350 0.011425 0.974095 0.017433 0.003014 0.006136 0.973417 0.005230 0.008904 0.937364 0.048502 0.014386 0.003817 0.005452 0.976345 0.015612 0.026174 0.130622 0.827592 0.148292 0.632311 0.091229 0.128169 0.169610 0.093619 0.289963 0.446808 0.362924 0.122462 0.256979 0.257635 0.398174 0.197076 0.146872 0.257879 0.388366 0.133033 0.173233 0.305368 Consensus sequence: DHDDWATTGTTCDDHD Alignment: DHDDGAACAATWDDHD ----AAACAATYTTT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00014 Sox17_primary Reverse Complement Original Motif Forward 3 11 0.025616 Species: Mus musculus Original motif 0.384811 0.284700 0.175936 0.154553 0.309402 0.148547 0.182807 0.359244 0.481080 0.063522 0.236227 0.219171 0.767683 0.076339 0.078689 0.077290 0.721907 0.020423 0.021208 0.236461 0.015843 0.855728 0.037803 0.090627 0.946041 0.014076 0.006202 0.033681 0.968744 0.003602 0.010784 0.016871 0.019919 0.012714 0.005072 0.962296 0.184775 0.020594 0.079338 0.715293 0.391691 0.169606 0.345342 0.093361 0.686419 0.086126 0.077592 0.149862 0.416935 0.101839 0.062848 0.418379 0.272943 0.305787 0.124571 0.296700 0.388624 0.124150 0.177104 0.310122 Consensus sequence: VDDAACAATTVAWHD Reverse complement motif 0.310122 0.124150 0.177104 0.388624 0.272943 0.124571 0.305787 0.296700 0.418379 0.101839 0.062848 0.416935 0.149862 0.086126 0.077592 0.686419 0.093361 0.169606 0.345342 0.391691 0.715293 0.020594 0.079338 0.184775 0.962296 0.012714 0.005072 0.019919 0.016871 0.003602 0.010784 0.968744 0.033681 0.014076 0.006202 0.946041 0.015843 0.037803 0.855728 0.090627 0.236461 0.020423 0.021208 0.721907 0.077290 0.076339 0.078689 0.767683 0.219171 0.063522 0.236227 0.481080 0.359244 0.148547 0.182807 0.309402 0.154553 0.284700 0.175936 0.384811 Consensus sequence: DDWTBAATTGTTDDB Alignment: VDDAACAATTVAWHD --AAACAATYTTT-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00034 Sox7_primary Original Motif Reverse Complement Forward 6 11 0.026403 Species: Mus musculus Original motif 0.360997 0.300272 0.115555 0.223177 0.309749 0.228429 0.166233 0.295589 0.149419 0.176868 0.240155 0.433558 0.379704 0.095791 0.276373 0.248133 0.394549 0.174184 0.130641 0.300626 0.443749 0.070776 0.211081 0.274393 0.364301 0.074356 0.370406 0.190936 0.791976 0.038475 0.093390 0.076159 0.963721 0.001826 0.002456 0.031997 0.004516 0.954596 0.008092 0.032796 0.981080 0.002062 0.002161 0.014697 0.986185 0.001846 0.006976 0.004992 0.059567 0.003649 0.002189 0.934595 0.495328 0.024257 0.240450 0.239965 0.305027 0.094878 0.526069 0.074025 0.418442 0.196237 0.158323 0.226998 0.336713 0.220452 0.191155 0.251680 0.192296 0.300342 0.169047 0.338315 0.240387 0.144634 0.128513 0.486465 0.290763 0.271259 0.116600 0.321377 0.224825 0.296233 0.229255 0.249687 0.493240 0.171285 0.075148 0.260326 Consensus sequence: HHBDHDDAACAATDRHHHHHBW Reverse complement motif 0.260326 0.171285 0.075148 0.493240 0.224825 0.229255 0.296233 0.249687 0.321377 0.271259 0.116600 0.290763 0.486465 0.144634 0.128513 0.240387 0.338315 0.300342 0.169047 0.192296 0.251680 0.220452 0.191155 0.336713 0.226998 0.196237 0.158323 0.418442 0.305027 0.526069 0.094878 0.074025 0.239965 0.024257 0.240450 0.495328 0.934595 0.003649 0.002189 0.059567 0.004992 0.001846 0.006976 0.986185 0.014697 0.002062 0.002161 0.981080 0.004516 0.008092 0.954596 0.032796 0.031997 0.001826 0.002456 0.963721 0.076159 0.038475 0.093390 0.791976 0.364301 0.370406 0.074356 0.190936 0.274393 0.070776 0.211081 0.443749 0.300626 0.174184 0.130641 0.394549 0.248133 0.095791 0.276373 0.379704 0.433558 0.176868 0.240155 0.149419 0.295589 0.228429 0.166233 0.309749 0.223177 0.300272 0.115555 0.360997 Consensus sequence: WBHHHHHMDATTGTTHDHDVHH Alignment: WBHHHHHMDATTGTTHDHDVHH -----AAAMATTGTTT------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00075 Sox15_primary Original Motif Reverse Complement Forward 3 11 0.026597 Species: Mus musculus Original motif 0.287334 0.139055 0.124297 0.449314 0.278683 0.214056 0.278266 0.228994 0.196938 0.172103 0.339663 0.291296 0.343773 0.089222 0.198442 0.368564 0.217683 0.069371 0.485495 0.227451 0.795638 0.049144 0.086842 0.068377 0.932914 0.008887 0.006817 0.051381 0.018504 0.893128 0.012624 0.075744 0.960471 0.008180 0.009943 0.021405 0.966816 0.008885 0.008787 0.015512 0.086103 0.016953 0.005969 0.890975 0.475989 0.013028 0.097844 0.413139 0.304890 0.097952 0.464158 0.133000 0.458453 0.118585 0.307695 0.115267 0.205225 0.241082 0.224896 0.328798 0.328081 0.178970 0.116466 0.376483 0.188001 0.185031 0.192398 0.434571 Consensus sequence: HDDDDAACAATWRRBHD Reverse complement motif 0.434571 0.185031 0.192398 0.188001 0.376483 0.178970 0.116466 0.328081 0.328798 0.241082 0.224896 0.205225 0.115267 0.118585 0.307695 0.458453 0.304890 0.464158 0.097952 0.133000 0.413139 0.013028 0.097844 0.475989 0.890975 0.016953 0.005969 0.086103 0.015512 0.008885 0.008787 0.966816 0.021405 0.008180 0.009943 0.960471 0.018504 0.012624 0.893128 0.075744 0.051381 0.008887 0.006817 0.932914 0.068377 0.049144 0.086842 0.795638 0.217683 0.485495 0.069371 0.227451 0.368564 0.089222 0.198442 0.343773 0.196938 0.339663 0.172103 0.291296 0.228994 0.214056 0.278266 0.278683 0.449314 0.139055 0.124297 0.287334 Consensus sequence: DHVKMWATTGTTHDHDH Alignment: DHVKMWATTGTTHDHDH --AAAMATTGTTT---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 11 Motif name: Motif 11 Original motif 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.500000 0.500000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 Consensus sequence: AAMATGTTTMAA Reserve complement motif 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.500000 0.000000 0.500000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.500000 0.000000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 Consensus sequence: TTYAAACATYTT ************************************************************************ Best Matches for Motif ID 11 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00250 Irx5 Original Motif Reverse Complement Forward 6 12 0.005694 Species: Mus musculus Original motif 0.367463 0.110357 0.154650 0.367530 0.435675 0.104106 0.185653 0.274566 0.309411 0.166534 0.199426 0.324629 0.330171 0.218393 0.207727 0.243708 0.326575 0.006155 0.067531 0.599738 0.934344 0.018417 0.011430 0.035810 0.004941 0.961788 0.005465 0.027806 0.940152 0.001107 0.011177 0.047564 0.047564 0.011177 0.001107 0.940152 0.027806 0.005465 0.961788 0.004941 0.035810 0.011430 0.018417 0.934344 0.599738 0.067531 0.006155 0.326575 0.348557 0.239288 0.195868 0.216288 0.376605 0.112652 0.210787 0.299957 0.540552 0.074408 0.115847 0.269192 0.210439 0.212707 0.245294 0.331559 0.303891 0.113735 0.133741 0.448633 Consensus sequence: DDDHWACATGTWHDABW Reverse complement motif 0.448633 0.113735 0.133741 0.303891 0.331559 0.212707 0.245294 0.210439 0.269192 0.074408 0.115847 0.540552 0.299957 0.112652 0.210787 0.376605 0.216288 0.239288 0.195868 0.348557 0.326575 0.067531 0.006155 0.599738 0.934344 0.011430 0.018417 0.035810 0.027806 0.961788 0.005465 0.004941 0.940152 0.011177 0.001107 0.047564 0.047564 0.001107 0.011177 0.940152 0.004941 0.005465 0.961788 0.027806 0.035810 0.018417 0.011430 0.934344 0.599738 0.006155 0.067531 0.326575 0.243708 0.218393 0.207727 0.330171 0.324629 0.166534 0.199426 0.309411 0.274566 0.104106 0.185653 0.435675 0.367530 0.110357 0.154650 0.367463 Consensus sequence: WVTDHWACATGTWHDDD Alignment: WVTDHWACATGTWHDDD -----AAMATGTTTMAA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00236 Irx2 Original Motif Reverse Complement Backward 1 12 0.007536 Species: Mus musculus Original motif 0.394106 0.081399 0.100827 0.423668 0.466343 0.126236 0.130788 0.276633 0.319347 0.127772 0.257087 0.295794 0.406891 0.139766 0.252855 0.200488 0.219982 0.007245 0.029337 0.743436 0.947280 0.014984 0.012651 0.025086 0.003955 0.974386 0.007466 0.014192 0.956452 0.001229 0.011361 0.030959 0.030959 0.011361 0.001229 0.956452 0.014192 0.007466 0.974386 0.003955 0.025086 0.012651 0.014984 0.947280 0.743436 0.029337 0.007245 0.219982 0.404816 0.174236 0.206626 0.214322 0.295979 0.194049 0.285864 0.224108 0.399608 0.106063 0.123706 0.370623 0.176973 0.196462 0.269004 0.357560 0.339978 0.107593 0.083682 0.468747 Consensus sequence: WDDDTACATGTADDWBW Reverse complement motif 0.468747 0.107593 0.083682 0.339978 0.357560 0.196462 0.269004 0.176973 0.370623 0.106063 0.123706 0.399608 0.224108 0.194049 0.285864 0.295979 0.214322 0.174236 0.206626 0.404816 0.219982 0.029337 0.007245 0.743436 0.947280 0.012651 0.014984 0.025086 0.014192 0.974386 0.007466 0.003955 0.956452 0.011361 0.001229 0.030959 0.030959 0.001229 0.011361 0.956452 0.003955 0.007466 0.974386 0.014192 0.025086 0.014984 0.012651 0.947280 0.743436 0.007245 0.029337 0.219982 0.200488 0.139766 0.252855 0.406891 0.295794 0.127772 0.257087 0.319347 0.276633 0.126236 0.130788 0.466343 0.423668 0.081399 0.100827 0.394106 Consensus sequence: WVWDDTACATGTADDDW Alignment: WDDDTACATGTADDWBW -----AAMATGTTTMAA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00061 Foxl1_primary Original Motif Reverse Complement Forward 2 12 0.009279 Species: Mus musculus Original motif 0.323208 0.152915 0.185111 0.338766 0.428132 0.056109 0.099487 0.416272 0.659386 0.039965 0.035805 0.264843 0.647143 0.049206 0.078984 0.224667 0.208834 0.076592 0.071631 0.642943 0.341077 0.003865 0.649511 0.005547 0.016627 0.001866 0.001715 0.979792 0.952319 0.045294 0.000870 0.001516 0.988834 0.004620 0.000720 0.005826 0.989346 0.001005 0.006467 0.003182 0.001093 0.784230 0.001235 0.213442 0.991209 0.002017 0.001737 0.005037 0.801581 0.037084 0.023060 0.138274 0.528554 0.089350 0.107501 0.274595 0.208802 0.268646 0.368022 0.154530 0.280218 0.221367 0.340497 0.157918 0.146611 0.250725 0.293524 0.309140 Consensus sequence: DWAATRTAAACAAWVVB Reverse complement motif 0.309140 0.250725 0.293524 0.146611 0.280218 0.340497 0.221367 0.157918 0.208802 0.368022 0.268646 0.154530 0.274595 0.089350 0.107501 0.528554 0.138274 0.037084 0.023060 0.801581 0.005037 0.002017 0.001737 0.991209 0.001093 0.001235 0.784230 0.213442 0.003182 0.001005 0.006467 0.989346 0.005826 0.004620 0.000720 0.988834 0.001516 0.045294 0.000870 0.952319 0.979792 0.001866 0.001715 0.016627 0.341077 0.649511 0.003865 0.005547 0.642943 0.076592 0.071631 0.208834 0.224667 0.049206 0.078984 0.647143 0.264843 0.039965 0.035805 0.659386 0.416272 0.056109 0.099487 0.428132 0.338766 0.152915 0.185111 0.323208 Consensus sequence: VVVWTTGTTTAMATTWD Alignment: VVVWTTGTTTAMATTWD -AAMATGTTTMAA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00150 Irx6 Original Motif Original Motif Forward 5 12 0.010437 Species: Mus musculus Original motif 0.356323 0.182245 0.120162 0.341271 0.540549 0.133347 0.119342 0.206762 0.401575 0.161837 0.116292 0.320296 0.311151 0.164568 0.283941 0.240340 0.198376 0.006596 0.030801 0.764227 0.947120 0.014182 0.010382 0.028316 0.006934 0.957983 0.007710 0.027373 0.947314 0.001874 0.016190 0.034622 0.034622 0.016190 0.001874 0.947314 0.027373 0.007710 0.957983 0.006934 0.028316 0.010382 0.014182 0.947120 0.764227 0.030801 0.006596 0.198376 0.372950 0.265937 0.182203 0.178910 0.399793 0.101871 0.214477 0.283859 0.478414 0.110202 0.114534 0.296850 0.317990 0.215498 0.212041 0.254471 0.131398 0.063397 0.070049 0.735156 Consensus sequence: HAHDTACATGTAVDWHT Reverse complement motif 0.735156 0.063397 0.070049 0.131398 0.254471 0.215498 0.212041 0.317990 0.296850 0.110202 0.114534 0.478414 0.283859 0.101871 0.214477 0.399793 0.178910 0.265937 0.182203 0.372950 0.198376 0.030801 0.006596 0.764227 0.947120 0.010382 0.014182 0.028316 0.027373 0.957983 0.007710 0.006934 0.947314 0.016190 0.001874 0.034622 0.034622 0.001874 0.016190 0.947314 0.006934 0.007710 0.957983 0.027373 0.028316 0.014182 0.010382 0.947120 0.764227 0.006596 0.030801 0.198376 0.240340 0.164568 0.283941 0.311151 0.320296 0.161837 0.116292 0.401575 0.206762 0.133347 0.119342 0.540549 0.341271 0.182245 0.120162 0.356323 Consensus sequence: AHWDBTACATGTADHTH Alignment: HAHDTACATGTAVDWHT ----AAMATGTTTMAA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00194 Irx4 Original Motif Original Motif Backward 2 12 0.011007 Species: Mus musculus Original motif 0.448141 0.082257 0.141153 0.328449 0.354010 0.179239 0.231684 0.235067 0.300226 0.196857 0.192403 0.310514 0.269192 0.228296 0.259727 0.242784 0.325458 0.008737 0.038497 0.627307 0.907258 0.013201 0.015875 0.063665 0.010499 0.935216 0.007784 0.046501 0.897816 0.001332 0.019141 0.081711 0.081711 0.019141 0.001332 0.897816 0.046501 0.007784 0.935216 0.010499 0.063665 0.015875 0.013201 0.907258 0.627307 0.038497 0.008737 0.325458 0.563710 0.193341 0.098815 0.144134 0.461314 0.079125 0.155617 0.303944 0.513284 0.108439 0.126002 0.252275 0.195487 0.320893 0.240955 0.242665 0.385008 0.137791 0.149762 0.327440 Consensus sequence: WDHDWACATGTWAWABD Reverse complement motif 0.327440 0.137791 0.149762 0.385008 0.195487 0.240955 0.320893 0.242665 0.252275 0.108439 0.126002 0.513284 0.303944 0.079125 0.155617 0.461314 0.144134 0.193341 0.098815 0.563710 0.325458 0.038497 0.008737 0.627307 0.907258 0.015875 0.013201 0.063665 0.046501 0.935216 0.007784 0.010499 0.897816 0.019141 0.001332 0.081711 0.081711 0.001332 0.019141 0.897816 0.010499 0.007784 0.935216 0.046501 0.063665 0.013201 0.015875 0.907258 0.627307 0.008737 0.038497 0.325458 0.242784 0.228296 0.259727 0.269192 0.310514 0.196857 0.192403 0.300226 0.235067 0.179239 0.231684 0.354010 0.328449 0.082257 0.141153 0.448141 Consensus sequence: DBTWTWACATGTWDHDW Alignment: WDHDWACATGTWAWABD ----AAMATGTTTMAA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00068 Eomes_primary Reverse Complement Reverse Complement Backward 2 12 0.011354 Species: Mus musculus Original motif 0.186316 0.215541 0.297644 0.300499 0.300381 0.234276 0.266283 0.199061 0.317841 0.211418 0.183235 0.287507 0.482598 0.095323 0.245062 0.177017 0.654197 0.008988 0.261951 0.074864 0.095656 0.022883 0.843364 0.038097 0.002655 0.008355 0.976390 0.012600 0.003287 0.080755 0.001057 0.914900 0.006753 0.001517 0.989917 0.001813 0.039940 0.098800 0.003305 0.857955 0.009015 0.039036 0.844029 0.107921 0.984070 0.002369 0.008852 0.004709 0.789505 0.101528 0.029294 0.079672 0.649685 0.139882 0.090466 0.119966 0.421759 0.205595 0.073074 0.299573 0.214779 0.290522 0.134050 0.360649 0.202141 0.270323 0.176798 0.350738 Consensus sequence: BVHDAGGTGTGAAAHHH Reverse complement motif 0.350738 0.270323 0.176798 0.202141 0.360649 0.290522 0.134050 0.214779 0.299573 0.205595 0.073074 0.421759 0.119966 0.139882 0.090466 0.649685 0.079672 0.101528 0.029294 0.789505 0.004709 0.002369 0.008852 0.984070 0.009015 0.844029 0.039036 0.107921 0.857955 0.098800 0.003305 0.039940 0.006753 0.989917 0.001517 0.001813 0.914900 0.080755 0.001057 0.003287 0.002655 0.976390 0.008355 0.012600 0.095656 0.843364 0.022883 0.038097 0.074864 0.008988 0.261951 0.654197 0.177017 0.095323 0.245062 0.482598 0.287507 0.211418 0.183235 0.317841 0.199061 0.234276 0.266283 0.300381 0.300499 0.215541 0.297644 0.186316 Consensus sequence: HHHTTTCACACCTDHBV Alignment: HHHTTTCACACCTDHBV ----TTYAAACATYTT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00223 Irx3_2226.1 Original Motif Reverse Complement Forward 6 12 0.011882 Species: Mus musculus Original motif 0.402654 0.107068 0.157939 0.332339 0.381229 0.129621 0.243277 0.245872 0.271699 0.148903 0.261472 0.317925 0.278393 0.239730 0.235045 0.246831 0.223980 0.006073 0.031227 0.738720 0.952925 0.013731 0.008900 0.024444 0.005380 0.972117 0.004335 0.018169 0.945295 0.001062 0.011429 0.042214 0.042214 0.011429 0.001062 0.945295 0.018169 0.004335 0.972117 0.005380 0.024444 0.008900 0.013731 0.952925 0.738720 0.031227 0.006073 0.223980 0.449438 0.199271 0.196335 0.154956 0.266542 0.085070 0.155050 0.493338 0.412619 0.114771 0.151818 0.320792 0.175351 0.270485 0.162372 0.391791 0.355721 0.130415 0.156633 0.357231 Consensus sequence: DDDHTACATGTAVWDHD Reverse complement motif 0.357231 0.130415 0.156633 0.355721 0.391791 0.270485 0.162372 0.175351 0.320792 0.114771 0.151818 0.412619 0.493338 0.085070 0.155050 0.266542 0.154956 0.199271 0.196335 0.449438 0.223980 0.031227 0.006073 0.738720 0.952925 0.008900 0.013731 0.024444 0.018169 0.972117 0.004335 0.005380 0.945295 0.011429 0.001062 0.042214 0.042214 0.001062 0.011429 0.945295 0.005380 0.004335 0.972117 0.018169 0.024444 0.013731 0.008900 0.952925 0.738720 0.006073 0.031227 0.223980 0.246831 0.239730 0.235045 0.278393 0.317925 0.148903 0.261472 0.271699 0.245872 0.129621 0.243277 0.381229 0.332339 0.107068 0.157939 0.402654 Consensus sequence: DHDWBTACATGTAHDDD Alignment: DHDWBTACATGTAHDDD -----AAMATGTTTMAA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00223 Irx3_0920.1 Original Motif Reverse Complement Backward 1 12 0.013215 Species: Mus musculus Original motif 0.369314 0.086226 0.205101 0.339359 0.332302 0.160101 0.284255 0.223343 0.291107 0.190306 0.229518 0.289068 0.295366 0.218346 0.264868 0.221420 0.224029 0.007037 0.047157 0.721777 0.935123 0.014036 0.014073 0.036768 0.004474 0.977496 0.005620 0.012411 0.924256 0.001181 0.015903 0.058661 0.058661 0.015903 0.001181 0.924256 0.012411 0.005620 0.977496 0.004474 0.036768 0.014073 0.014036 0.935123 0.721777 0.047157 0.007037 0.224029 0.449320 0.226936 0.166094 0.157650 0.313283 0.070145 0.179424 0.437148 0.522855 0.074913 0.105873 0.296358 0.185897 0.387406 0.129138 0.297559 0.276853 0.127952 0.189255 0.405940 Consensus sequence: DDDDTACATGTAVWWHD Reverse complement motif 0.405940 0.127952 0.189255 0.276853 0.185897 0.129138 0.387406 0.297559 0.296358 0.074913 0.105873 0.522855 0.437148 0.070145 0.179424 0.313283 0.157650 0.226936 0.166094 0.449320 0.224029 0.047157 0.007037 0.721777 0.935123 0.014073 0.014036 0.036768 0.012411 0.977496 0.005620 0.004474 0.924256 0.015903 0.001181 0.058661 0.058661 0.001181 0.015903 0.924256 0.004474 0.005620 0.977496 0.012411 0.036768 0.014036 0.014073 0.935123 0.721777 0.007037 0.047157 0.224029 0.221420 0.218346 0.264868 0.295366 0.289068 0.190306 0.229518 0.291107 0.223343 0.160101 0.284255 0.332302 0.339359 0.086226 0.205101 0.369314 Consensus sequence: DDWWBTACATGTADDDD Alignment: DDDDTACATGTAVWWHD -----AAMATGTTTMAA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00025 Foxk1_primary Original Motif Reverse Complement Backward 5 12 0.014246 Species: Mus musculus Original motif 0.338172 0.192194 0.207817 0.261817 0.407924 0.117261 0.278236 0.196580 0.595570 0.070480 0.119221 0.214729 0.710845 0.038748 0.052600 0.197807 0.124647 0.116138 0.178053 0.581162 0.201602 0.005514 0.792110 0.000774 0.024590 0.004193 0.001331 0.969886 0.919465 0.077871 0.000760 0.001904 0.972342 0.010395 0.000580 0.016683 0.991045 0.001495 0.003585 0.003875 0.001358 0.885197 0.000980 0.112465 0.990318 0.001846 0.002968 0.004867 0.804563 0.063147 0.023496 0.108795 0.564824 0.087976 0.102865 0.244336 0.269947 0.300278 0.285008 0.144767 0.337905 0.220102 0.253694 0.188299 0.153781 0.274135 0.318343 0.253741 Consensus sequence: DDAATGTAAACAAAVVB Reverse complement motif 0.153781 0.318343 0.274135 0.253741 0.188299 0.220102 0.253694 0.337905 0.269947 0.285008 0.300278 0.144767 0.244336 0.087976 0.102865 0.564824 0.108795 0.063147 0.023496 0.804563 0.004867 0.001846 0.002968 0.990318 0.001358 0.000980 0.885197 0.112465 0.003875 0.001495 0.003585 0.991045 0.016683 0.010395 0.000580 0.972342 0.001904 0.077871 0.000760 0.919465 0.969886 0.004193 0.001331 0.024590 0.201602 0.792110 0.005514 0.000774 0.581162 0.116138 0.178053 0.124647 0.197807 0.038748 0.052600 0.710845 0.214729 0.070480 0.119221 0.595570 0.196580 0.117261 0.278236 0.407924 0.261817 0.192194 0.207817 0.338172 Consensus sequence: BBVTTTGTTTACATTDD Alignment: BBVTTTGTTTACATTDD -AAMATGTTTMAA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00039 Foxj3_primary Original Motif Reverse Complement Backward 5 12 0.021034 Species: Mus musculus Original motif 0.273456 0.257473 0.208488 0.260583 0.338566 0.133379 0.306363 0.221693 0.475488 0.192852 0.156858 0.174803 0.506619 0.132646 0.170373 0.190362 0.349042 0.127275 0.325924 0.197759 0.303850 0.013619 0.678034 0.004497 0.014136 0.015691 0.003073 0.967100 0.913373 0.082928 0.001910 0.001789 0.956294 0.017745 0.000584 0.025378 0.987796 0.001685 0.004159 0.006360 0.002288 0.814764 0.001427 0.181521 0.986707 0.002688 0.003346 0.007259 0.787378 0.065481 0.057961 0.089180 0.572982 0.089910 0.066184 0.270924 0.224167 0.339979 0.258886 0.176968 0.268414 0.272007 0.239541 0.220038 0.241771 0.394748 0.174273 0.189208 Consensus sequence: HDHADGTAAACAAAVVH Reverse complement motif 0.241771 0.174273 0.394748 0.189208 0.268414 0.239541 0.272007 0.220038 0.224167 0.258886 0.339979 0.176968 0.270924 0.089910 0.066184 0.572982 0.089180 0.065481 0.057961 0.787378 0.007259 0.002688 0.003346 0.986707 0.002288 0.001427 0.814764 0.181521 0.006360 0.001685 0.004159 0.987796 0.025378 0.017745 0.000584 0.956294 0.001789 0.082928 0.001910 0.913373 0.967100 0.015691 0.003073 0.014136 0.303850 0.678034 0.013619 0.004497 0.197759 0.127275 0.325924 0.349042 0.190362 0.132646 0.170373 0.506619 0.174803 0.192852 0.156858 0.475488 0.221693 0.133379 0.306363 0.338566 0.260583 0.257473 0.208488 0.273456 Consensus sequence: DVVTTTGTTTACDTHDH Alignment: DVVTTTGTTTACDTHDH -AAMATGTTTMAA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 12 Motif name: Motif 12 Original motif 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 Consensus sequence: ACAACACATTT Reserve complement motif 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 Consensus sequence: AAATGTGTTGT ************************************************************************ Best Matches for Motif ID 12 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00033 Zfp410_primary Reverse Complement Original Motif Backward 5 11 0.018100 Species: Mus musculus Original motif 0.302837 0.133017 0.249940 0.314205 0.378542 0.186425 0.250700 0.184332 0.184780 0.144329 0.262766 0.408125 0.308569 0.039689 0.235695 0.416047 0.817738 0.108938 0.033419 0.039905 0.018996 0.007718 0.013175 0.960112 0.009278 0.002422 0.973921 0.014379 0.005587 0.002693 0.985088 0.006633 0.005874 0.004232 0.976927 0.012967 0.951309 0.011835 0.023187 0.013669 0.005927 0.004521 0.005701 0.983851 0.146443 0.003009 0.840720 0.009829 0.002553 0.044504 0.542059 0.410884 0.406299 0.375782 0.133922 0.083997 0.256884 0.160184 0.271190 0.311742 0.388381 0.141811 0.214600 0.255208 0.340877 0.274387 0.205585 0.179151 Consensus sequence: DVDDATGGGATGKMDDV Reverse complement motif 0.179151 0.274387 0.205585 0.340877 0.255208 0.141811 0.214600 0.388381 0.311742 0.160184 0.271190 0.256884 0.083997 0.375782 0.133922 0.406299 0.002553 0.542059 0.044504 0.410884 0.146443 0.840720 0.003009 0.009829 0.983851 0.004521 0.005701 0.005927 0.013669 0.011835 0.023187 0.951309 0.005874 0.976927 0.004232 0.012967 0.005587 0.985088 0.002693 0.006633 0.009278 0.973921 0.002422 0.014379 0.960112 0.007718 0.013175 0.018996 0.039905 0.108938 0.033419 0.817738 0.416047 0.039689 0.235695 0.308569 0.408125 0.144329 0.262766 0.184780 0.184332 0.186425 0.250700 0.378542 0.314205 0.133017 0.249940 0.302837 Consensus sequence: BDDYYCATCCCATDDBD Alignment: DVDDATGGGATGKMDDV --AAATGTGTTGT---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00068 Eomes_secondary Reverse Complement Original Motif Forward 3 11 0.020281 Species: Mus musculus Original motif 0.253642 0.252604 0.298295 0.195458 0.112892 0.341342 0.341061 0.204704 0.297430 0.215095 0.343350 0.144125 0.241098 0.129378 0.421448 0.208076 0.894201 0.007299 0.061032 0.037468 0.052259 0.054303 0.856609 0.036829 0.005074 0.015048 0.966734 0.013144 0.003258 0.061529 0.002368 0.932845 0.017531 0.005025 0.973155 0.004289 0.116022 0.030172 0.047139 0.806667 0.027749 0.602513 0.009946 0.359792 0.018763 0.048982 0.794648 0.137608 0.177116 0.459591 0.284833 0.078460 0.121483 0.491485 0.148745 0.238287 0.152590 0.245835 0.214717 0.386857 0.221040 0.320773 0.249918 0.208270 Consensus sequence: VBVDAGGTGTYGVBBV Reverse complement motif 0.221040 0.249918 0.320773 0.208270 0.386857 0.245835 0.214717 0.152590 0.121483 0.148745 0.491485 0.238287 0.177116 0.284833 0.459591 0.078460 0.018763 0.794648 0.048982 0.137608 0.027749 0.009946 0.602513 0.359792 0.806667 0.030172 0.047139 0.116022 0.017531 0.973155 0.005025 0.004289 0.932845 0.061529 0.002368 0.003258 0.005074 0.966734 0.015048 0.013144 0.052259 0.856609 0.054303 0.036829 0.037468 0.007299 0.061032 0.894201 0.241098 0.421448 0.129378 0.208076 0.297430 0.343350 0.215095 0.144125 0.112892 0.341061 0.341342 0.204704 0.253642 0.298295 0.252604 0.195458 Consensus sequence: VVBVCKACACCTHVBV Alignment: VBVDAGGTGTYGVBBV --AAATGTGTTGT--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00171 Msx3 Reverse Complement Reverse Complement Backward 2 11 0.021121 Species: Mus musculus Original motif 0.317812 0.352438 0.231628 0.098123 0.601471 0.133830 0.164947 0.099752 0.399508 0.293187 0.098524 0.208781 0.754569 0.054130 0.133622 0.057678 0.770469 0.088090 0.086904 0.054537 0.038689 0.673100 0.189096 0.099115 0.004935 0.522968 0.000482 0.471615 0.986316 0.001484 0.009222 0.002978 0.991636 0.005079 0.001457 0.001828 0.009156 0.001857 0.001081 0.987906 0.013688 0.006588 0.000191 0.979532 0.987635 0.000354 0.005166 0.006845 0.701095 0.027828 0.154852 0.116224 0.181731 0.184800 0.303458 0.330011 0.224816 0.221032 0.182405 0.371747 0.310539 0.208307 0.099081 0.382073 Consensus sequence: VAHAACYAATTAABHH Reverse complement motif 0.382073 0.208307 0.099081 0.310539 0.371747 0.221032 0.182405 0.224816 0.330011 0.184800 0.303458 0.181731 0.116224 0.027828 0.154852 0.701095 0.006845 0.000354 0.005166 0.987635 0.979532 0.006588 0.000191 0.013688 0.987906 0.001857 0.001081 0.009156 0.001828 0.005079 0.001457 0.991636 0.002978 0.001484 0.009222 0.986316 0.004935 0.000482 0.522968 0.471615 0.038689 0.189096 0.673100 0.099115 0.054537 0.088090 0.086904 0.770469 0.057678 0.054130 0.133622 0.754569 0.208781 0.293187 0.098524 0.399508 0.099752 0.133830 0.164947 0.601471 0.317812 0.231628 0.352438 0.098123 Consensus sequence: HHVTTAATTKGTTHTV Alignment: HHVTTAATTKGTTHTV ----AAATGTGTTGT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00072 IRC900814_primary Reverse Complement Reverse Complement Backward 5 11 0.021651 Species: Mus musculus Original motif 0.365594 0.139520 0.170474 0.324412 0.273874 0.192800 0.250453 0.282872 0.161547 0.330332 0.098428 0.409694 0.084003 0.205596 0.098191 0.612210 0.953705 0.016367 0.006314 0.023614 0.003494 0.989648 0.003278 0.003580 0.004722 0.003156 0.988805 0.003317 0.939828 0.001925 0.052151 0.006096 0.183998 0.760396 0.030845 0.024762 0.917564 0.003661 0.065438 0.013337 0.965452 0.006559 0.005183 0.022807 0.730611 0.054369 0.006576 0.208444 0.266519 0.133801 0.067418 0.532262 0.329952 0.210903 0.220319 0.238826 0.250220 0.197954 0.314202 0.237625 0.172311 0.401218 0.189340 0.237131 Consensus sequence: DDHTACGACAAAWDDB Reverse complement motif 0.172311 0.189340 0.401218 0.237131 0.250220 0.314202 0.197954 0.237625 0.238826 0.210903 0.220319 0.329952 0.532262 0.133801 0.067418 0.266519 0.208444 0.054369 0.006576 0.730611 0.022807 0.006559 0.005183 0.965452 0.013337 0.003661 0.065438 0.917564 0.183998 0.030845 0.760396 0.024762 0.006096 0.001925 0.052151 0.939828 0.004722 0.988805 0.003156 0.003317 0.003494 0.003278 0.989648 0.003580 0.023614 0.016367 0.006314 0.953705 0.612210 0.205596 0.098191 0.084003 0.409694 0.330332 0.098428 0.161547 0.282872 0.192800 0.250453 0.273874 0.324412 0.139520 0.170474 0.365594 Consensus sequence: BHDWTTTGTCGTAHDD Alignment: BHDWTTTGTCGTAHDD -AAATGTGTTGT---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00166 Barhl1 Reverse Complement Reverse Complement Backward 2 11 0.023066 Species: Mus musculus Original motif 0.467514 0.210142 0.140580 0.181765 0.607254 0.124874 0.137587 0.130285 0.280889 0.423565 0.125411 0.170135 0.748944 0.067655 0.136796 0.046605 0.723747 0.023732 0.218759 0.033762 0.075749 0.608701 0.182230 0.133321 0.005053 0.764340 0.000825 0.229781 0.951342 0.006010 0.029473 0.013175 0.890431 0.010111 0.000910 0.098548 0.004275 0.001291 0.002113 0.992321 0.005850 0.006608 0.000432 0.987110 0.979314 0.000732 0.001996 0.017957 0.546971 0.034786 0.326876 0.091366 0.120451 0.194359 0.328320 0.356870 0.274765 0.177491 0.231888 0.315855 0.223913 0.420032 0.139775 0.216280 Consensus sequence: HAHAACCAATTARBDH Reverse complement motif 0.223913 0.139775 0.420032 0.216280 0.315855 0.177491 0.231888 0.274765 0.356870 0.194359 0.328320 0.120451 0.091366 0.034786 0.326876 0.546971 0.017957 0.000732 0.001996 0.979314 0.987110 0.006608 0.000432 0.005850 0.992321 0.001291 0.002113 0.004275 0.098548 0.010111 0.000910 0.890431 0.013175 0.006010 0.029473 0.951342 0.005053 0.000825 0.764340 0.229781 0.075749 0.182230 0.608701 0.133321 0.033762 0.023732 0.218759 0.723747 0.046605 0.067655 0.136796 0.748944 0.280889 0.125411 0.423565 0.170135 0.130285 0.124874 0.137587 0.607254 0.181765 0.210142 0.140580 0.467514 Consensus sequence: DDVKTAATTGGTTDTH Alignment: DDVKTAATTGGTTDTH ----AAATGTGTTGT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00045 Mafb_primary Reverse Complement Original Motif Backward 7 11 0.023141 Species: Mus musculus Original motif 0.420301 0.182299 0.161481 0.235919 0.593201 0.055751 0.202477 0.148571 0.653364 0.017008 0.054630 0.274998 0.339176 0.102943 0.050258 0.507622 0.171557 0.078698 0.267471 0.482273 0.044703 0.033212 0.003920 0.918165 0.010333 0.004451 0.972441 0.012775 0.034026 0.949298 0.004788 0.011889 0.016078 0.008878 0.004007 0.971037 0.020331 0.004077 0.929676 0.045916 0.975739 0.007450 0.005991 0.010819 0.012733 0.887375 0.018700 0.081192 0.259981 0.111885 0.243051 0.385083 0.327677 0.149969 0.094895 0.427459 0.541721 0.105923 0.242224 0.110132 0.258689 0.068305 0.493226 0.179779 0.306041 0.306854 0.168308 0.218798 Consensus sequence: HAAWDTGCTGACDWARH Reverse complement motif 0.306041 0.168308 0.306854 0.218798 0.258689 0.493226 0.068305 0.179779 0.110132 0.105923 0.242224 0.541721 0.427459 0.149969 0.094895 0.327677 0.385083 0.111885 0.243051 0.259981 0.012733 0.018700 0.887375 0.081192 0.010819 0.007450 0.005991 0.975739 0.020331 0.929676 0.004077 0.045916 0.971037 0.008878 0.004007 0.016078 0.034026 0.004788 0.949298 0.011889 0.010333 0.972441 0.004451 0.012775 0.918165 0.033212 0.003920 0.044703 0.482273 0.078698 0.267471 0.171557 0.507622 0.102943 0.050258 0.339176 0.274998 0.017008 0.054630 0.653364 0.148571 0.055751 0.202477 0.593201 0.235919 0.182299 0.161481 0.420301 Consensus sequence: DMTWDGTCAGCADWTTH Alignment: HAAWDTGCTGACDWARH AAATGTGTTGT------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v015681_primary Reverse Complement Reverse Complement Backward 10 11 0.027072 Species: Mus musculus Original motif 0.641428 0.180211 0.044767 0.133594 0.171696 0.262981 0.334148 0.231174 0.129726 0.322735 0.243462 0.304077 0.165713 0.175735 0.256108 0.402445 0.146090 0.171890 0.412753 0.269266 0.212837 0.439192 0.280990 0.066980 0.251088 0.275516 0.374380 0.099015 0.575438 0.079656 0.338201 0.006704 0.005634 0.003422 0.972597 0.018348 0.890447 0.077034 0.031851 0.000668 0.007128 0.986862 0.000496 0.005515 0.001445 0.991564 0.001925 0.005066 0.738761 0.190157 0.026399 0.044684 0.013384 0.983783 0.000896 0.001937 0.068077 0.929549 0.000773 0.001602 0.040830 0.933742 0.005283 0.020145 0.730274 0.029225 0.145689 0.094812 0.165032 0.572838 0.162001 0.100129 0.383584 0.129942 0.429497 0.056977 0.455959 0.071959 0.208204 0.263878 0.134271 0.262985 0.222626 0.380117 0.071193 0.346594 0.346081 0.236132 0.445661 0.405278 0.053901 0.095160 Consensus sequence: ABBBBVVRGACCACCCACRDBBM Reverse complement motif 0.095160 0.405278 0.053901 0.445661 0.071193 0.346081 0.346594 0.236132 0.380117 0.262985 0.222626 0.134271 0.263878 0.071959 0.208204 0.455959 0.383584 0.429497 0.129942 0.056977 0.165032 0.162001 0.572838 0.100129 0.094812 0.029225 0.145689 0.730274 0.040830 0.005283 0.933742 0.020145 0.068077 0.000773 0.929549 0.001602 0.013384 0.000896 0.983783 0.001937 0.044684 0.190157 0.026399 0.738761 0.001445 0.001925 0.991564 0.005066 0.007128 0.000496 0.986862 0.005515 0.000668 0.077034 0.031851 0.890447 0.005634 0.972597 0.003422 0.018348 0.006704 0.079656 0.338201 0.575438 0.251088 0.374380 0.275516 0.099015 0.212837 0.280990 0.439192 0.066980 0.146090 0.412753 0.171890 0.269266 0.402445 0.175735 0.256108 0.165713 0.129726 0.243462 0.322735 0.304077 0.171696 0.334148 0.262981 0.231174 0.133594 0.180211 0.044767 0.641428 Consensus sequence: YBVDMGTGGGTGGTCKVVBVBBT Alignment: YBVDMGTGGGTGGTCKVVBVBBT ---AAATGTGTTGT--------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00236 Irx2 Reverse Complement Reverse Complement Backward 1 11 0.027220 Species: Mus musculus Original motif 0.394106 0.081399 0.100827 0.423668 0.466343 0.126236 0.130788 0.276633 0.319347 0.127772 0.257087 0.295794 0.406891 0.139766 0.252855 0.200488 0.219982 0.007245 0.029337 0.743436 0.947280 0.014984 0.012651 0.025086 0.003955 0.974386 0.007466 0.014192 0.956452 0.001229 0.011361 0.030959 0.030959 0.011361 0.001229 0.956452 0.014192 0.007466 0.974386 0.003955 0.025086 0.012651 0.014984 0.947280 0.743436 0.029337 0.007245 0.219982 0.404816 0.174236 0.206626 0.214322 0.295979 0.194049 0.285864 0.224108 0.399608 0.106063 0.123706 0.370623 0.176973 0.196462 0.269004 0.357560 0.339978 0.107593 0.083682 0.468747 Consensus sequence: WDDDTACATGTADDWBW Reverse complement motif 0.468747 0.107593 0.083682 0.339978 0.357560 0.196462 0.269004 0.176973 0.370623 0.106063 0.123706 0.399608 0.224108 0.194049 0.285864 0.295979 0.214322 0.174236 0.206626 0.404816 0.219982 0.029337 0.007245 0.743436 0.947280 0.012651 0.014984 0.025086 0.014192 0.974386 0.007466 0.003955 0.956452 0.011361 0.001229 0.030959 0.030959 0.001229 0.011361 0.956452 0.003955 0.007466 0.974386 0.014192 0.025086 0.014984 0.012651 0.947280 0.743436 0.007245 0.029337 0.219982 0.200488 0.139766 0.252855 0.406891 0.295794 0.127772 0.257087 0.319347 0.276633 0.126236 0.130788 0.466343 0.423668 0.081399 0.100827 0.394106 Consensus sequence: WVWDDTACATGTADDDW Alignment: WVWDDTACATGTADDDW ------AAATGTGTTGT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v016060_primary Original Motif Original Motif Forward 9 11 0.027435 Species: Mus musculus Original motif 0.137831 0.118922 0.394177 0.349070 0.190108 0.163633 0.138507 0.507753 0.346002 0.332315 0.228621 0.093063 0.113254 0.287554 0.373285 0.225908 0.272578 0.125402 0.328963 0.273057 0.333973 0.115165 0.194267 0.356595 0.381054 0.086215 0.501679 0.031052 0.002232 0.007405 0.966087 0.024276 0.834741 0.112115 0.052053 0.001091 0.009034 0.983239 0.000766 0.006960 0.002054 0.988103 0.003138 0.006705 0.805772 0.171299 0.008415 0.014515 0.020076 0.976846 0.000894 0.002183 0.079914 0.917273 0.001179 0.001634 0.013983 0.950545 0.004205 0.031267 0.789407 0.039441 0.108645 0.062507 0.055453 0.161271 0.595249 0.188028 0.333424 0.128169 0.373270 0.165136 0.536103 0.109520 0.062980 0.291397 0.346477 0.090909 0.279533 0.283081 0.045892 0.190183 0.584314 0.179611 0.088294 0.406148 0.251647 0.253912 0.202467 0.447159 0.162802 0.187571 Consensus sequence: DTVBDDRGACCACCCAGDWDGBH Reverse complement motif 0.202467 0.162802 0.447159 0.187571 0.088294 0.251647 0.406148 0.253912 0.045892 0.584314 0.190183 0.179611 0.283081 0.090909 0.279533 0.346477 0.291397 0.109520 0.062980 0.536103 0.333424 0.373270 0.128169 0.165136 0.055453 0.595249 0.161271 0.188028 0.062507 0.039441 0.108645 0.789407 0.013983 0.004205 0.950545 0.031267 0.079914 0.001179 0.917273 0.001634 0.020076 0.000894 0.976846 0.002183 0.014515 0.171299 0.008415 0.805772 0.002054 0.003138 0.988103 0.006705 0.009034 0.000766 0.983239 0.006960 0.001091 0.112115 0.052053 0.834741 0.002232 0.966087 0.007405 0.024276 0.381054 0.501679 0.086215 0.031052 0.356595 0.115165 0.194267 0.333973 0.272578 0.328963 0.125402 0.273057 0.113254 0.373285 0.287554 0.225908 0.093063 0.332315 0.228621 0.346002 0.507753 0.163633 0.138507 0.190108 0.137831 0.394177 0.118922 0.349070 Consensus sequence: DBCDWHCTGGGTGGTCMDHBBAH Alignment: DTVBDDRGACCACCCAGDWDGBH --------ACAACACATTT---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00146 Pou6f1_3733.1 Reverse Complement Original Motif Backward 2 11 0.027581 Species: Mus musculus Original motif 0.380020 0.211224 0.295981 0.112776 0.349734 0.309602 0.075135 0.265530 0.356459 0.226592 0.169646 0.247302 0.229673 0.350174 0.311906 0.108247 0.757838 0.046686 0.016036 0.179440 0.014478 0.002669 0.000464 0.982389 0.984156 0.000563 0.002241 0.013039 0.992195 0.001470 0.001823 0.004511 0.001610 0.002156 0.003120 0.993114 0.008328 0.001327 0.802239 0.188106 0.990155 0.004149 0.002815 0.002881 0.004992 0.004117 0.965215 0.025676 0.091361 0.290495 0.533319 0.084826 0.164763 0.143217 0.028702 0.663317 0.164550 0.118473 0.276288 0.440689 0.152985 0.151847 0.413228 0.281941 0.241185 0.447249 0.135344 0.176222 Consensus sequence: VHHVATAATGAGSTDDH Reverse complement motif 0.241185 0.135344 0.447249 0.176222 0.152985 0.413228 0.151847 0.281941 0.440689 0.118473 0.276288 0.164550 0.663317 0.143217 0.028702 0.164763 0.091361 0.533319 0.290495 0.084826 0.004992 0.965215 0.004117 0.025676 0.002881 0.004149 0.002815 0.990155 0.008328 0.802239 0.001327 0.188106 0.993114 0.002156 0.003120 0.001610 0.004511 0.001470 0.001823 0.992195 0.013039 0.000563 0.002241 0.984156 0.982389 0.002669 0.000464 0.014478 0.179440 0.046686 0.016036 0.757838 0.229673 0.311906 0.350174 0.108247 0.247302 0.226592 0.169646 0.356459 0.265530 0.309602 0.075135 0.349734 0.112776 0.211224 0.295981 0.380020 Consensus sequence: DHDASCTCATTATVHHB Alignment: VHHVATAATGAGSTDDH -----AAATGTGTTGT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 13 Motif name: Motif 13 Original motif 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.000000 0.000000 0.500000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.500000 0.000000 0.500000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 Consensus sequence: AAWATRTATTT Reserve complement motif 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.500000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.500000 0.000000 0.000000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 Consensus sequence: AAATAKATWTT ************************************************************************ Best Matches for Motif ID 13 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00266 Prrx1 Original Motif Reverse Complement Backward 7 11 0.014242 Species: Mus musculus Original motif 0.253670 0.274722 0.311514 0.160094 0.142661 0.147239 0.267582 0.442518 0.550773 0.218031 0.102023 0.129173 0.638511 0.097957 0.200256 0.063275 0.033238 0.630091 0.034920 0.301751 0.010596 0.084792 0.002672 0.901941 0.978487 0.005759 0.012099 0.003655 0.988730 0.002072 0.006630 0.002568 0.003055 0.005516 0.002393 0.989036 0.001886 0.013121 0.004234 0.980759 0.945982 0.000473 0.036032 0.017513 0.492644 0.048622 0.426186 0.032548 0.032076 0.477120 0.163099 0.327705 0.087306 0.062675 0.109007 0.741011 0.398317 0.165475 0.249687 0.186521 0.195630 0.391763 0.253591 0.159016 0.054732 0.179801 0.168037 0.597430 Consensus sequence: VBAACTAATTARYTDVT Reverse complement motif 0.597430 0.179801 0.168037 0.054732 0.195630 0.253591 0.391763 0.159016 0.186521 0.165475 0.249687 0.398317 0.741011 0.062675 0.109007 0.087306 0.032076 0.163099 0.477120 0.327705 0.032548 0.048622 0.426186 0.492644 0.017513 0.000473 0.036032 0.945982 0.980759 0.013121 0.004234 0.001886 0.989036 0.005516 0.002393 0.003055 0.002568 0.002072 0.006630 0.988730 0.003655 0.005759 0.012099 0.978487 0.901941 0.084792 0.002672 0.010596 0.033238 0.034920 0.630091 0.301751 0.063275 0.097957 0.200256 0.638511 0.129173 0.218031 0.102023 0.550773 0.442518 0.147239 0.267582 0.142661 0.253670 0.311514 0.274722 0.160094 Consensus sequence: AVDAKKTAATTAGTTVV Alignment: AVDAKKTAATTAGTTVV AAWATRTATTT------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00150 Irx6 Original Motif Reverse Complement Backward 2 11 0.020069 Species: Mus musculus Original motif 0.356323 0.182245 0.120162 0.341271 0.540549 0.133347 0.119342 0.206762 0.401575 0.161837 0.116292 0.320296 0.311151 0.164568 0.283941 0.240340 0.198376 0.006596 0.030801 0.764227 0.947120 0.014182 0.010382 0.028316 0.006934 0.957983 0.007710 0.027373 0.947314 0.001874 0.016190 0.034622 0.034622 0.016190 0.001874 0.947314 0.027373 0.007710 0.957983 0.006934 0.028316 0.010382 0.014182 0.947120 0.764227 0.030801 0.006596 0.198376 0.372950 0.265937 0.182203 0.178910 0.399793 0.101871 0.214477 0.283859 0.478414 0.110202 0.114534 0.296850 0.317990 0.215498 0.212041 0.254471 0.131398 0.063397 0.070049 0.735156 Consensus sequence: HAHDTACATGTAVDWHT Reverse complement motif 0.735156 0.063397 0.070049 0.131398 0.254471 0.215498 0.212041 0.317990 0.296850 0.110202 0.114534 0.478414 0.283859 0.101871 0.214477 0.399793 0.178910 0.265937 0.182203 0.372950 0.198376 0.030801 0.006596 0.764227 0.947120 0.010382 0.014182 0.028316 0.027373 0.957983 0.007710 0.006934 0.947314 0.016190 0.001874 0.034622 0.034622 0.001874 0.016190 0.947314 0.006934 0.007710 0.957983 0.027373 0.028316 0.014182 0.010382 0.947120 0.764227 0.006596 0.030801 0.198376 0.240340 0.164568 0.283941 0.311151 0.320296 0.161837 0.116292 0.401575 0.206762 0.133347 0.119342 0.540549 0.341271 0.182245 0.120162 0.356323 Consensus sequence: AHWDBTACATGTADHTH Alignment: AHWDBTACATGTADHTH -----AAWATRTATTT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00236 Irx2 Original Motif Reverse Complement Forward 6 11 0.021442 Species: Mus musculus Original motif 0.394106 0.081399 0.100827 0.423668 0.466343 0.126236 0.130788 0.276633 0.319347 0.127772 0.257087 0.295794 0.406891 0.139766 0.252855 0.200488 0.219982 0.007245 0.029337 0.743436 0.947280 0.014984 0.012651 0.025086 0.003955 0.974386 0.007466 0.014192 0.956452 0.001229 0.011361 0.030959 0.030959 0.011361 0.001229 0.956452 0.014192 0.007466 0.974386 0.003955 0.025086 0.012651 0.014984 0.947280 0.743436 0.029337 0.007245 0.219982 0.404816 0.174236 0.206626 0.214322 0.295979 0.194049 0.285864 0.224108 0.399608 0.106063 0.123706 0.370623 0.176973 0.196462 0.269004 0.357560 0.339978 0.107593 0.083682 0.468747 Consensus sequence: WDDDTACATGTADDWBW Reverse complement motif 0.468747 0.107593 0.083682 0.339978 0.357560 0.196462 0.269004 0.176973 0.370623 0.106063 0.123706 0.399608 0.224108 0.194049 0.285864 0.295979 0.214322 0.174236 0.206626 0.404816 0.219982 0.029337 0.007245 0.743436 0.947280 0.012651 0.014984 0.025086 0.014192 0.974386 0.007466 0.003955 0.956452 0.011361 0.001229 0.030959 0.030959 0.001229 0.011361 0.956452 0.003955 0.007466 0.974386 0.014192 0.025086 0.014984 0.012651 0.947280 0.743436 0.007245 0.029337 0.219982 0.200488 0.139766 0.252855 0.406891 0.295794 0.127772 0.257087 0.319347 0.276633 0.126236 0.130788 0.466343 0.423668 0.081399 0.100827 0.394106 Consensus sequence: WVWDDTACATGTADDDW Alignment: WVWDDTACATGTADDDW -----AAWATRTATTT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00261 Lhx4 Reverse Complement Original Motif Backward 1 11 0.023028 Species: Mus musculus Original motif 0.238398 0.103056 0.288106 0.370441 0.528663 0.240528 0.054646 0.176163 0.410472 0.174022 0.180450 0.235056 0.393508 0.221555 0.226049 0.158888 0.076115 0.713665 0.129236 0.080984 0.011391 0.202097 0.000933 0.785579 0.915021 0.010032 0.073911 0.001035 0.986624 0.004305 0.006656 0.002415 0.002415 0.006656 0.004305 0.986624 0.001035 0.073911 0.010032 0.915021 0.785579 0.000933 0.202097 0.011391 0.080984 0.129236 0.713665 0.076115 0.093319 0.422657 0.265078 0.218946 0.088211 0.105808 0.249479 0.556502 0.310164 0.089961 0.144321 0.455554 0.058447 0.084506 0.187743 0.669304 0.180932 0.123294 0.545619 0.150155 Consensus sequence: DADVCTAATTAGBTWTG Reverse complement motif 0.180932 0.545619 0.123294 0.150155 0.669304 0.084506 0.187743 0.058447 0.455554 0.089961 0.144321 0.310164 0.556502 0.105808 0.249479 0.088211 0.093319 0.265078 0.422657 0.218946 0.080984 0.713665 0.129236 0.076115 0.011391 0.000933 0.202097 0.785579 0.915021 0.073911 0.010032 0.001035 0.986624 0.006656 0.004305 0.002415 0.002415 0.004305 0.006656 0.986624 0.001035 0.010032 0.073911 0.915021 0.785579 0.202097 0.000933 0.011391 0.076115 0.129236 0.713665 0.080984 0.158888 0.221555 0.226049 0.393508 0.235056 0.174022 0.180450 0.410472 0.176163 0.240528 0.054646 0.528663 0.370441 0.103056 0.288106 0.238398 Consensus sequence: CAWABCTAATTAGBDTD Alignment: DADVCTAATTAGBTWTG ------AAATAKATWTT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00170 Isl2 Reverse Complement Reverse Complement Forward 5 11 0.023394 Species: Mus musculus Original motif 0.380653 0.464278 0.069710 0.085358 0.372741 0.252485 0.094893 0.279881 0.400406 0.346871 0.119279 0.133444 0.582825 0.148558 0.126868 0.141748 0.743019 0.117598 0.049691 0.089692 0.055277 0.296642 0.093515 0.554566 0.016892 0.507616 0.007671 0.467820 0.599279 0.361703 0.019061 0.019957 0.705284 0.282581 0.005323 0.006811 0.013750 0.013079 0.004736 0.968435 0.013264 0.013804 0.004612 0.968319 0.933004 0.004447 0.005179 0.057370 0.656051 0.041577 0.212432 0.089940 0.145543 0.109863 0.307597 0.436997 0.323514 0.098571 0.137254 0.440660 0.204784 0.284909 0.075638 0.434669 Consensus sequence: MHHAAYYMATTAADWH Reverse complement motif 0.434669 0.284909 0.075638 0.204784 0.440660 0.098571 0.137254 0.323514 0.436997 0.109863 0.307597 0.145543 0.089940 0.041577 0.212432 0.656051 0.057370 0.004447 0.005179 0.933004 0.968319 0.013804 0.004612 0.013264 0.968435 0.013079 0.004736 0.013750 0.006811 0.282581 0.005323 0.705284 0.019957 0.361703 0.019061 0.599279 0.016892 0.007671 0.507616 0.467820 0.554566 0.296642 0.093515 0.055277 0.089692 0.117598 0.049691 0.743019 0.141748 0.148558 0.126868 0.582825 0.133444 0.346871 0.119279 0.400406 0.279881 0.252485 0.094893 0.372741 0.380653 0.069710 0.464278 0.085358 Consensus sequence: HWDTTAATYKMTTHHR Alignment: HWDTTAATYKMTTHHR ----AAATAKATWTT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00212 Lhx5 Original Motif Reverse Complement Backward 7 11 0.023628 Species: Mus musculus Original motif 0.192127 0.348816 0.300474 0.158583 0.251871 0.201197 0.314740 0.232192 0.469240 0.195840 0.137749 0.197171 0.620351 0.063061 0.196615 0.119973 0.026357 0.096838 0.024928 0.851877 0.010301 0.066114 0.000301 0.923283 0.980649 0.007663 0.010886 0.000802 0.981397 0.001294 0.004654 0.012655 0.012655 0.004654 0.001294 0.981397 0.000802 0.010886 0.007663 0.980649 0.923283 0.000301 0.066114 0.010301 0.851877 0.024928 0.096838 0.026357 0.528438 0.142302 0.071537 0.257724 0.296647 0.115284 0.062688 0.525382 0.401193 0.235971 0.157675 0.205160 0.309966 0.315367 0.145959 0.228708 0.089761 0.287439 0.205359 0.417441 Consensus sequence: VDHATTAATTAAAWHHB Reverse complement motif 0.417441 0.287439 0.205359 0.089761 0.309966 0.145959 0.315367 0.228708 0.205160 0.235971 0.157675 0.401193 0.525382 0.115284 0.062688 0.296647 0.257724 0.142302 0.071537 0.528438 0.026357 0.024928 0.096838 0.851877 0.010301 0.000301 0.066114 0.923283 0.980649 0.010886 0.007663 0.000802 0.981397 0.004654 0.001294 0.012655 0.012655 0.001294 0.004654 0.981397 0.000802 0.007663 0.010886 0.980649 0.923283 0.066114 0.000301 0.010301 0.851877 0.096838 0.024928 0.026357 0.119973 0.063061 0.196615 0.620351 0.197171 0.195840 0.137749 0.469240 0.251871 0.314740 0.201197 0.232192 0.192127 0.300474 0.348816 0.158583 Consensus sequence: VDHWTTTAATTAATHHV Alignment: VDHWTTTAATTAATHHV AAWATRTATTT------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00108 Alx3 Original Motif Reverse Complement Forward 1 11 0.024326 Species: Mus musculus Original motif 0.296149 0.033726 0.127017 0.543109 0.366485 0.200783 0.243220 0.189512 0.405110 0.180765 0.159571 0.254554 0.534568 0.154903 0.228026 0.082504 0.039813 0.476598 0.008603 0.474987 0.003992 0.080226 0.001293 0.914489 0.986740 0.006235 0.003288 0.003738 0.985422 0.002561 0.008596 0.003421 0.003421 0.008596 0.002561 0.985422 0.003738 0.003288 0.006235 0.986740 0.914489 0.001293 0.080226 0.003992 0.474987 0.008603 0.476598 0.039813 0.078830 0.442223 0.054744 0.424202 0.068037 0.145671 0.102838 0.683453 0.239872 0.271585 0.339298 0.149245 0.434309 0.190824 0.135524 0.239342 0.262173 0.253994 0.285560 0.198273 Consensus sequence: WVHAYTAATTARYTVHV Reverse complement motif 0.262173 0.285560 0.253994 0.198273 0.239342 0.190824 0.135524 0.434309 0.239872 0.339298 0.271585 0.149245 0.683453 0.145671 0.102838 0.068037 0.078830 0.054744 0.442223 0.424202 0.474987 0.476598 0.008603 0.039813 0.003992 0.001293 0.080226 0.914489 0.986740 0.003288 0.006235 0.003738 0.985422 0.008596 0.002561 0.003421 0.003421 0.002561 0.008596 0.985422 0.003738 0.006235 0.003288 0.986740 0.914489 0.080226 0.001293 0.003992 0.039813 0.008603 0.476598 0.474987 0.082504 0.154903 0.228026 0.534568 0.254554 0.180765 0.159571 0.405110 0.189512 0.200783 0.243220 0.366485 0.543109 0.033726 0.127017 0.296149 Consensus sequence: VHVAKMTAATTAKTHBW Alignment: WVHAYTAATTARYTVHV AAWATRTATTT------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00171 Msx3 Reverse Complement Reverse Complement Backward 2 11 0.025470 Species: Mus musculus Original motif 0.317812 0.352438 0.231628 0.098123 0.601471 0.133830 0.164947 0.099752 0.399508 0.293187 0.098524 0.208781 0.754569 0.054130 0.133622 0.057678 0.770469 0.088090 0.086904 0.054537 0.038689 0.673100 0.189096 0.099115 0.004935 0.522968 0.000482 0.471615 0.986316 0.001484 0.009222 0.002978 0.991636 0.005079 0.001457 0.001828 0.009156 0.001857 0.001081 0.987906 0.013688 0.006588 0.000191 0.979532 0.987635 0.000354 0.005166 0.006845 0.701095 0.027828 0.154852 0.116224 0.181731 0.184800 0.303458 0.330011 0.224816 0.221032 0.182405 0.371747 0.310539 0.208307 0.099081 0.382073 Consensus sequence: VAHAACYAATTAABHH Reverse complement motif 0.382073 0.208307 0.099081 0.310539 0.371747 0.221032 0.182405 0.224816 0.330011 0.184800 0.303458 0.181731 0.116224 0.027828 0.154852 0.701095 0.006845 0.000354 0.005166 0.987635 0.979532 0.006588 0.000191 0.013688 0.987906 0.001857 0.001081 0.009156 0.001828 0.005079 0.001457 0.991636 0.002978 0.001484 0.009222 0.986316 0.004935 0.000482 0.522968 0.471615 0.038689 0.189096 0.673100 0.099115 0.054537 0.088090 0.086904 0.770469 0.057678 0.054130 0.133622 0.754569 0.208781 0.293187 0.098524 0.399508 0.099752 0.133830 0.164947 0.601471 0.317812 0.231628 0.352438 0.098123 Consensus sequence: HHVTTAATTKGTTHTV Alignment: HHVTTAATTKGTTHTV ----AAATAKATWTT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00250 Irx5 Original Motif Reverse Complement Forward 6 11 0.025927 Species: Mus musculus Original motif 0.367463 0.110357 0.154650 0.367530 0.435675 0.104106 0.185653 0.274566 0.309411 0.166534 0.199426 0.324629 0.330171 0.218393 0.207727 0.243708 0.326575 0.006155 0.067531 0.599738 0.934344 0.018417 0.011430 0.035810 0.004941 0.961788 0.005465 0.027806 0.940152 0.001107 0.011177 0.047564 0.047564 0.011177 0.001107 0.940152 0.027806 0.005465 0.961788 0.004941 0.035810 0.011430 0.018417 0.934344 0.599738 0.067531 0.006155 0.326575 0.348557 0.239288 0.195868 0.216288 0.376605 0.112652 0.210787 0.299957 0.540552 0.074408 0.115847 0.269192 0.210439 0.212707 0.245294 0.331559 0.303891 0.113735 0.133741 0.448633 Consensus sequence: DDDHWACATGTWHDABW Reverse complement motif 0.448633 0.113735 0.133741 0.303891 0.331559 0.212707 0.245294 0.210439 0.269192 0.074408 0.115847 0.540552 0.299957 0.112652 0.210787 0.376605 0.216288 0.239288 0.195868 0.348557 0.326575 0.067531 0.006155 0.599738 0.934344 0.011430 0.018417 0.035810 0.027806 0.961788 0.005465 0.004941 0.940152 0.011177 0.001107 0.047564 0.047564 0.001107 0.011177 0.940152 0.004941 0.005465 0.961788 0.027806 0.035810 0.018417 0.011430 0.934344 0.599738 0.006155 0.067531 0.326575 0.243708 0.218393 0.207727 0.330171 0.324629 0.166534 0.199426 0.309411 0.274566 0.104106 0.185653 0.435675 0.367530 0.110357 0.154650 0.367463 Consensus sequence: WVTDHWACATGTWHDDD Alignment: WVTDHWACATGTWHDDD -----AAWATRTATTT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00223 Irx3_2226.1 Original Motif Original Motif Forward 5 11 0.026343 Species: Mus musculus Original motif 0.402654 0.107068 0.157939 0.332339 0.381229 0.129621 0.243277 0.245872 0.271699 0.148903 0.261472 0.317925 0.278393 0.239730 0.235045 0.246831 0.223980 0.006073 0.031227 0.738720 0.952925 0.013731 0.008900 0.024444 0.005380 0.972117 0.004335 0.018169 0.945295 0.001062 0.011429 0.042214 0.042214 0.011429 0.001062 0.945295 0.018169 0.004335 0.972117 0.005380 0.024444 0.008900 0.013731 0.952925 0.738720 0.031227 0.006073 0.223980 0.449438 0.199271 0.196335 0.154956 0.266542 0.085070 0.155050 0.493338 0.412619 0.114771 0.151818 0.320792 0.175351 0.270485 0.162372 0.391791 0.355721 0.130415 0.156633 0.357231 Consensus sequence: DDDHTACATGTAVWDHD Reverse complement motif 0.357231 0.130415 0.156633 0.355721 0.391791 0.270485 0.162372 0.175351 0.320792 0.114771 0.151818 0.412619 0.493338 0.085070 0.155050 0.266542 0.154956 0.199271 0.196335 0.449438 0.223980 0.031227 0.006073 0.738720 0.952925 0.008900 0.013731 0.024444 0.018169 0.972117 0.004335 0.005380 0.945295 0.011429 0.001062 0.042214 0.042214 0.001062 0.011429 0.945295 0.005380 0.004335 0.972117 0.018169 0.024444 0.013731 0.008900 0.952925 0.738720 0.006073 0.031227 0.223980 0.246831 0.239730 0.235045 0.278393 0.317925 0.148903 0.261472 0.271699 0.245872 0.129621 0.243277 0.381229 0.332339 0.107068 0.157939 0.402654 Consensus sequence: DHDWBTACATGTAHDDD Alignment: DDDHTACATGTAVWDHD ----AAWATRTATTT-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 14 Motif name: Motif 14 Original motif 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.500000 0.500000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 Consensus sequence: TAATKATATAA Reserve complement motif 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.500000 0.000000 0.500000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 Consensus sequence: TTATATYATTA ************************************************************************ Best Matches for Motif ID 14 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00264 Hoxa1 Original Motif Reverse Complement Forward 5 11 0.022966 Species: Mus musculus Original motif 0.189557 0.418057 0.185518 0.206868 0.144310 0.147945 0.055643 0.652102 0.268298 0.130092 0.466424 0.135186 0.623662 0.095919 0.152772 0.127647 0.266418 0.075174 0.613390 0.045018 0.076341 0.532879 0.217968 0.172811 0.006893 0.026113 0.001372 0.965621 0.960763 0.031216 0.006700 0.001322 0.990794 0.002636 0.002673 0.003897 0.005841 0.002488 0.001753 0.989917 0.002266 0.004876 0.007199 0.985660 0.956522 0.001370 0.038129 0.003979 0.280035 0.484469 0.167259 0.068237 0.144906 0.449298 0.138450 0.267346 0.107856 0.167050 0.411636 0.313458 0.061823 0.304997 0.175127 0.458054 Consensus sequence: HTDAGCTAATTAMHBY Reverse complement motif 0.458054 0.304997 0.175127 0.061823 0.107856 0.411636 0.167050 0.313458 0.144906 0.138450 0.449298 0.267346 0.280035 0.167259 0.484469 0.068237 0.003979 0.001370 0.038129 0.956522 0.985660 0.004876 0.007199 0.002266 0.989917 0.002488 0.001753 0.005841 0.003897 0.002636 0.002673 0.990794 0.001322 0.031216 0.006700 0.960763 0.965621 0.026113 0.001372 0.006893 0.076341 0.217968 0.532879 0.172811 0.266418 0.613390 0.075174 0.045018 0.127647 0.095919 0.152772 0.623662 0.268298 0.466424 0.130092 0.135186 0.652102 0.147945 0.055643 0.144310 0.189557 0.185518 0.418057 0.206868 Consensus sequence: MBDRTAATTAGCTHAD Alignment: MBDRTAATTAGCTHAD ----TAATKATATAA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00129 Pou3f1 Original Motif Original Motif Forward 4 11 0.027670 Species: Mus musculus Original motif 0.383980 0.129273 0.292995 0.193752 0.347530 0.257268 0.249014 0.146188 0.202288 0.273246 0.214253 0.310213 0.096662 0.048219 0.170550 0.684569 0.817669 0.126839 0.019054 0.036439 0.908384 0.034202 0.022731 0.034683 0.049617 0.009722 0.007610 0.933051 0.030623 0.010272 0.016239 0.942866 0.942866 0.016239 0.010272 0.030623 0.933051 0.007610 0.009722 0.049617 0.034683 0.022731 0.034202 0.908384 0.036439 0.019054 0.126839 0.817669 0.808629 0.107163 0.007221 0.076987 0.658159 0.103835 0.161364 0.076642 0.120399 0.197946 0.334527 0.347128 0.202637 0.115217 0.144762 0.537384 0.269009 0.275163 0.221820 0.234008 Consensus sequence: DVBTAATTAATTAABTH Reverse complement motif 0.269009 0.221820 0.275163 0.234008 0.537384 0.115217 0.144762 0.202637 0.347128 0.197946 0.334527 0.120399 0.076642 0.103835 0.161364 0.658159 0.076987 0.107163 0.007221 0.808629 0.817669 0.019054 0.126839 0.036439 0.908384 0.022731 0.034202 0.034683 0.049617 0.007610 0.009722 0.933051 0.030623 0.016239 0.010272 0.942866 0.942866 0.010272 0.016239 0.030623 0.933051 0.009722 0.007610 0.049617 0.034683 0.034202 0.022731 0.908384 0.036439 0.126839 0.019054 0.817669 0.684569 0.048219 0.170550 0.096662 0.310213 0.273246 0.214253 0.202288 0.146188 0.257268 0.249014 0.347530 0.193752 0.129273 0.292995 0.383980 Consensus sequence: DAVTTAATTAATTAVBD Alignment: DVBTAATTAATTAABTH ---TAATKATATAA--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00212 Lhx5 Original Motif Original Motif Forward 6 11 0.029546 Species: Mus musculus Original motif 0.192127 0.348816 0.300474 0.158583 0.251871 0.201197 0.314740 0.232192 0.469240 0.195840 0.137749 0.197171 0.620351 0.063061 0.196615 0.119973 0.026357 0.096838 0.024928 0.851877 0.010301 0.066114 0.000301 0.923283 0.980649 0.007663 0.010886 0.000802 0.981397 0.001294 0.004654 0.012655 0.012655 0.004654 0.001294 0.981397 0.000802 0.010886 0.007663 0.980649 0.923283 0.000301 0.066114 0.010301 0.851877 0.024928 0.096838 0.026357 0.528438 0.142302 0.071537 0.257724 0.296647 0.115284 0.062688 0.525382 0.401193 0.235971 0.157675 0.205160 0.309966 0.315367 0.145959 0.228708 0.089761 0.287439 0.205359 0.417441 Consensus sequence: VDHATTAATTAAAWHHB Reverse complement motif 0.417441 0.287439 0.205359 0.089761 0.309966 0.145959 0.315367 0.228708 0.205160 0.235971 0.157675 0.401193 0.525382 0.115284 0.062688 0.296647 0.257724 0.142302 0.071537 0.528438 0.026357 0.024928 0.096838 0.851877 0.010301 0.000301 0.066114 0.923283 0.980649 0.010886 0.007663 0.000802 0.981397 0.004654 0.001294 0.012655 0.012655 0.001294 0.004654 0.981397 0.000802 0.007663 0.010886 0.980649 0.923283 0.066114 0.000301 0.010301 0.851877 0.096838 0.024928 0.026357 0.119973 0.063061 0.196615 0.620351 0.197171 0.195840 0.137749 0.469240 0.251871 0.314740 0.201197 0.232192 0.192127 0.300474 0.348816 0.158583 Consensus sequence: VDHWTTTAATTAATHHV Alignment: VDHATTAATTAAAWHHB -----TAATKATATAA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00130 Lhx3 Original Motif Original Motif Forward 6 11 0.029565 Species: Mus musculus Original motif 0.226746 0.289244 0.371785 0.112225 0.256971 0.229670 0.248726 0.264633 0.556784 0.228344 0.038490 0.176382 0.631659 0.088282 0.196624 0.083434 0.021306 0.098213 0.006109 0.874373 0.016974 0.029949 0.000343 0.952734 0.971885 0.004194 0.023228 0.000693 0.983076 0.001653 0.004793 0.010478 0.010478 0.004793 0.001653 0.983076 0.000693 0.023228 0.004194 0.971885 0.952734 0.000343 0.029949 0.016974 0.874373 0.006109 0.098213 0.021306 0.425814 0.086548 0.127397 0.360241 0.343977 0.034349 0.079320 0.542354 0.412597 0.281154 0.077380 0.228869 0.338396 0.315969 0.106509 0.239127 0.112285 0.233324 0.310745 0.343646 Consensus sequence: VDAATTAATTAAWWHHB Reverse complement motif 0.343646 0.233324 0.310745 0.112285 0.239127 0.315969 0.106509 0.338396 0.228869 0.281154 0.077380 0.412597 0.542354 0.034349 0.079320 0.343977 0.360241 0.086548 0.127397 0.425814 0.021306 0.006109 0.098213 0.874373 0.016974 0.000343 0.029949 0.952734 0.971885 0.023228 0.004194 0.000693 0.983076 0.004793 0.001653 0.010478 0.010478 0.001653 0.004793 0.983076 0.000693 0.004194 0.023228 0.971885 0.952734 0.029949 0.000343 0.016974 0.874373 0.098213 0.006109 0.021306 0.083434 0.088282 0.196624 0.631659 0.176382 0.228344 0.038490 0.556784 0.264633 0.229670 0.248726 0.256971 0.226746 0.371785 0.289244 0.112225 Consensus sequence: VHHWWTTAATTAATTDV Alignment: VDAATTAATTAAWWHHB -----TAATKATATAA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00247 Pax4 Original Motif Reverse Complement Backward 1 11 0.030993 Species: Mus musculus Original motif 0.418022 0.079008 0.069207 0.433763 0.227146 0.305729 0.334351 0.132774 0.403563 0.184272 0.244083 0.168082 0.369663 0.142527 0.191981 0.295828 0.017813 0.596801 0.016691 0.368695 0.030042 0.009279 0.044474 0.916205 0.982868 0.002754 0.008192 0.006185 0.986424 0.003358 0.006127 0.004090 0.004090 0.006127 0.003358 0.986424 0.006185 0.008192 0.002754 0.982868 0.916205 0.044474 0.009279 0.030042 0.368695 0.016691 0.596801 0.017813 0.114118 0.515974 0.077464 0.292444 0.138586 0.368674 0.232821 0.259920 0.177848 0.439823 0.318020 0.064310 0.344798 0.096757 0.305287 0.253158 0.284211 0.345130 0.175933 0.194726 Consensus sequence: WVVDYTAATTARYBSDH Reverse complement motif 0.284211 0.175933 0.345130 0.194726 0.253158 0.096757 0.305287 0.344798 0.177848 0.318020 0.439823 0.064310 0.138586 0.232821 0.368674 0.259920 0.114118 0.077464 0.515974 0.292444 0.368695 0.596801 0.016691 0.017813 0.030042 0.044474 0.009279 0.916205 0.982868 0.008192 0.002754 0.006185 0.986424 0.006127 0.003358 0.004090 0.004090 0.003358 0.006127 0.986424 0.006185 0.002754 0.008192 0.982868 0.916205 0.009279 0.044474 0.030042 0.017813 0.016691 0.596801 0.368695 0.295828 0.142527 0.191981 0.369663 0.168082 0.184272 0.244083 0.403563 0.227146 0.334351 0.305729 0.132774 0.433763 0.079008 0.069207 0.418022 Consensus sequence: DDSBKMTAATTAKDBVW Alignment: DDSBKMTAATTAKDBVW ------TAATKATATAA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00108 Alx3 Original Motif Reverse Complement Forward 7 11 0.031908 Species: Mus musculus Original motif 0.296149 0.033726 0.127017 0.543109 0.366485 0.200783 0.243220 0.189512 0.405110 0.180765 0.159571 0.254554 0.534568 0.154903 0.228026 0.082504 0.039813 0.476598 0.008603 0.474987 0.003992 0.080226 0.001293 0.914489 0.986740 0.006235 0.003288 0.003738 0.985422 0.002561 0.008596 0.003421 0.003421 0.008596 0.002561 0.985422 0.003738 0.003288 0.006235 0.986740 0.914489 0.001293 0.080226 0.003992 0.474987 0.008603 0.476598 0.039813 0.078830 0.442223 0.054744 0.424202 0.068037 0.145671 0.102838 0.683453 0.239872 0.271585 0.339298 0.149245 0.434309 0.190824 0.135524 0.239342 0.262173 0.253994 0.285560 0.198273 Consensus sequence: WVHAYTAATTARYTVHV Reverse complement motif 0.262173 0.285560 0.253994 0.198273 0.239342 0.190824 0.135524 0.434309 0.239872 0.339298 0.271585 0.149245 0.683453 0.145671 0.102838 0.068037 0.078830 0.054744 0.442223 0.424202 0.474987 0.476598 0.008603 0.039813 0.003992 0.001293 0.080226 0.914489 0.986740 0.003288 0.006235 0.003738 0.985422 0.008596 0.002561 0.003421 0.003421 0.002561 0.008596 0.985422 0.003738 0.006235 0.003288 0.986740 0.914489 0.080226 0.001293 0.003992 0.039813 0.008603 0.476598 0.474987 0.082504 0.154903 0.228026 0.534568 0.254554 0.180765 0.159571 0.405110 0.189512 0.200783 0.243220 0.366485 0.543109 0.033726 0.127017 0.296149 Consensus sequence: VHVAKMTAATTAKTHBW Alignment: VHVAKMTAATTAKTHBW ------TAATKATATAA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00105 Pou3f4 Original Motif Original Motif Forward 4 11 0.032354 Species: Mus musculus Original motif 0.333256 0.132424 0.289920 0.244400 0.331200 0.265280 0.244521 0.158999 0.206284 0.201415 0.180436 0.411864 0.121526 0.066278 0.220348 0.591848 0.836640 0.078351 0.021503 0.063506 0.916787 0.033485 0.017390 0.032338 0.064856 0.009246 0.006903 0.918996 0.027148 0.008390 0.016874 0.947588 0.947588 0.016874 0.008390 0.027148 0.918996 0.006903 0.009246 0.064856 0.032338 0.017390 0.033485 0.916787 0.063506 0.021503 0.078351 0.836640 0.822585 0.074316 0.009738 0.093361 0.480273 0.158803 0.195041 0.165883 0.248880 0.178794 0.261624 0.310702 0.212936 0.127454 0.166193 0.493416 0.157615 0.478760 0.161072 0.202554 Consensus sequence: DVHTAATTAATTADDDB Reverse complement motif 0.157615 0.161072 0.478760 0.202554 0.493416 0.127454 0.166193 0.212936 0.310702 0.178794 0.261624 0.248880 0.165883 0.158803 0.195041 0.480273 0.093361 0.074316 0.009738 0.822585 0.836640 0.021503 0.078351 0.063506 0.916787 0.017390 0.033485 0.032338 0.064856 0.006903 0.009246 0.918996 0.027148 0.016874 0.008390 0.947588 0.947588 0.008390 0.016874 0.027148 0.918996 0.009246 0.006903 0.064856 0.032338 0.033485 0.017390 0.916787 0.063506 0.078351 0.021503 0.836640 0.591848 0.066278 0.220348 0.121526 0.411864 0.201415 0.180436 0.206284 0.158999 0.265280 0.244521 0.331200 0.244400 0.132424 0.289920 0.333256 Consensus sequence: BDDDTAATTAATTAHBD Alignment: DVHTAATTAATTADDDB ---TAATKATATAA--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00202 Dlx1 Original Motif Reverse Complement Backward 2 11 0.032745 Species: Mus musculus Original motif 0.163842 0.291218 0.273647 0.271293 0.132817 0.241988 0.127403 0.497792 0.169467 0.114132 0.606759 0.109642 0.447414 0.244155 0.212138 0.096293 0.352705 0.065283 0.403228 0.178784 0.285954 0.141939 0.371251 0.200856 0.008260 0.119989 0.001052 0.870700 0.987317 0.005592 0.005756 0.001335 0.990185 0.002369 0.001821 0.005626 0.007233 0.001028 0.002257 0.989482 0.003462 0.007126 0.008135 0.981277 0.942617 0.000920 0.045030 0.011433 0.408909 0.192781 0.197071 0.201240 0.076008 0.358323 0.120230 0.445440 Consensus sequence: BHGVRDTAATTADY Reverse complement motif 0.445440 0.358323 0.120230 0.076008 0.201240 0.192781 0.197071 0.408909 0.011433 0.000920 0.045030 0.942617 0.981277 0.007126 0.008135 0.003462 0.989482 0.001028 0.002257 0.007233 0.005626 0.002369 0.001821 0.990185 0.001335 0.005592 0.005756 0.987317 0.870700 0.119989 0.001052 0.008260 0.285954 0.371251 0.141939 0.200856 0.352705 0.403228 0.065283 0.178784 0.096293 0.244155 0.212138 0.447414 0.169467 0.606759 0.114132 0.109642 0.497792 0.241988 0.127403 0.132817 0.163842 0.273647 0.291218 0.271293 Consensus sequence: MDTAATTAHMBCHB Alignment: MDTAATTAHMBCHB --TAATKATATAA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00128 Pou3f2 Original Motif Reverse Complement Forward 6 11 0.032890 Species: Mus musculus Original motif 0.153980 0.256313 0.453304 0.136403 0.293307 0.185897 0.233506 0.287290 0.231217 0.106311 0.217581 0.444891 0.694066 0.066485 0.110573 0.128876 0.617717 0.144842 0.099112 0.138329 0.070264 0.240528 0.004998 0.684210 0.014444 0.030268 0.005503 0.949784 0.972612 0.013685 0.004717 0.008987 0.980758 0.002352 0.003968 0.012922 0.013839 0.002478 0.003880 0.979802 0.010216 0.005118 0.047808 0.936857 0.955106 0.017358 0.006582 0.020954 0.358783 0.018538 0.532778 0.089901 0.089493 0.164493 0.267539 0.478475 0.247125 0.136760 0.281060 0.335056 0.242054 0.255243 0.206580 0.296122 0.284093 0.145319 0.355081 0.215506 Consensus sequence: VDDAATTAATTARBDHD Reverse complement motif 0.284093 0.355081 0.145319 0.215506 0.296122 0.255243 0.206580 0.242054 0.335056 0.136760 0.281060 0.247125 0.478475 0.164493 0.267539 0.089493 0.358783 0.532778 0.018538 0.089901 0.020954 0.017358 0.006582 0.955106 0.936857 0.005118 0.047808 0.010216 0.979802 0.002478 0.003880 0.013839 0.012922 0.002352 0.003968 0.980758 0.008987 0.013685 0.004717 0.972612 0.949784 0.030268 0.005503 0.014444 0.684210 0.240528 0.004998 0.070264 0.138329 0.144842 0.099112 0.617717 0.128876 0.066485 0.110573 0.694066 0.444891 0.106311 0.217581 0.231217 0.287290 0.185897 0.233506 0.293307 0.153980 0.453304 0.256313 0.136403 Consensus sequence: HHDVMTAATTAATTDDV Alignment: HHDVMTAATTAATTDDV -----TAATKATATAA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00266 Prrx1 Original Motif Reverse Complement Forward 7 11 0.033147 Species: Mus musculus Original motif 0.253670 0.274722 0.311514 0.160094 0.142661 0.147239 0.267582 0.442518 0.550773 0.218031 0.102023 0.129173 0.638511 0.097957 0.200256 0.063275 0.033238 0.630091 0.034920 0.301751 0.010596 0.084792 0.002672 0.901941 0.978487 0.005759 0.012099 0.003655 0.988730 0.002072 0.006630 0.002568 0.003055 0.005516 0.002393 0.989036 0.001886 0.013121 0.004234 0.980759 0.945982 0.000473 0.036032 0.017513 0.492644 0.048622 0.426186 0.032548 0.032076 0.477120 0.163099 0.327705 0.087306 0.062675 0.109007 0.741011 0.398317 0.165475 0.249687 0.186521 0.195630 0.391763 0.253591 0.159016 0.054732 0.179801 0.168037 0.597430 Consensus sequence: VBAACTAATTARYTDVT Reverse complement motif 0.597430 0.179801 0.168037 0.054732 0.195630 0.253591 0.391763 0.159016 0.186521 0.165475 0.249687 0.398317 0.741011 0.062675 0.109007 0.087306 0.032076 0.163099 0.477120 0.327705 0.032548 0.048622 0.426186 0.492644 0.017513 0.000473 0.036032 0.945982 0.980759 0.013121 0.004234 0.001886 0.989036 0.005516 0.002393 0.003055 0.002568 0.002072 0.006630 0.988730 0.003655 0.005759 0.012099 0.978487 0.901941 0.084792 0.002672 0.010596 0.033238 0.034920 0.630091 0.301751 0.063275 0.097957 0.200256 0.638511 0.129173 0.218031 0.102023 0.550773 0.442518 0.147239 0.267582 0.142661 0.253670 0.311514 0.274722 0.160094 Consensus sequence: AVDAKKTAATTAGTTVV Alignment: AVDAKKTAATTAGTTVV ------TAATKATATAA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 15 Motif name: Motif 15 Original motif 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.500000 0.000000 0.500000 0.000000 0.000000 0.000000 0.000000 1.000000 0.500000 0.500000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 Consensus sequence: AAAGRTMAAACTA Reserve complement motif 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.500000 0.000000 0.500000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 Consensus sequence: TAGTTTYAKCTTT ************************************************************************ Best Matches for Motif ID 15 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00074 Isgf3g_primary Reverse Complement Reverse Complement Forward 2 13 0.035956 Species: Mus musculus Original motif 0.276786 0.305435 0.213026 0.204753 0.396362 0.114731 0.248667 0.240240 0.461284 0.092047 0.334734 0.111936 0.775091 0.019703 0.057075 0.148131 0.860742 0.032827 0.020878 0.085553 0.318035 0.134940 0.114054 0.432971 0.031989 0.819436 0.031529 0.117045 0.038741 0.005309 0.945956 0.009995 0.961581 0.018494 0.013401 0.006524 0.943392 0.004223 0.007869 0.044516 0.964748 0.010789 0.003727 0.020735 0.029401 0.875794 0.079869 0.014937 0.034572 0.294928 0.012201 0.658299 0.370121 0.165750 0.227886 0.236243 0.803710 0.072510 0.054519 0.069261 Consensus sequence: VDRAAWCGAAACTDA Reverse complement motif 0.069261 0.072510 0.054519 0.803710 0.236243 0.165750 0.227886 0.370121 0.658299 0.294928 0.012201 0.034572 0.029401 0.079869 0.875794 0.014937 0.020735 0.010789 0.003727 0.964748 0.044516 0.004223 0.007869 0.943392 0.006524 0.018494 0.013401 0.961581 0.038741 0.945956 0.005309 0.009995 0.031989 0.031529 0.819436 0.117045 0.432971 0.134940 0.114054 0.318035 0.085553 0.032827 0.020878 0.860742 0.148131 0.019703 0.057075 0.775091 0.111936 0.092047 0.334734 0.461284 0.240240 0.114731 0.248667 0.396362 0.276786 0.213026 0.305435 0.204753 Consensus sequence: TDAGTTTCGWTTKDV Alignment: TDAGTTTCGWTTKDV -TAGTTTYAKCTTT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00083 Tcf7l2_primary Original Motif Reverse Complement Backward 4 13 0.037114 Species: Mus musculus Original motif 0.285725 0.187143 0.254855 0.272277 0.276264 0.157893 0.258178 0.307665 0.238788 0.161120 0.254018 0.346074 0.076041 0.333901 0.150903 0.439156 0.093376 0.526578 0.180529 0.199517 0.010827 0.880320 0.034150 0.074703 0.016546 0.023834 0.000940 0.958680 0.007166 0.008215 0.001941 0.982678 0.029634 0.001363 0.001379 0.967625 0.010872 0.031751 0.926186 0.031190 0.949407 0.000760 0.002581 0.047253 0.109203 0.001362 0.002094 0.887341 0.044198 0.567994 0.353059 0.034749 0.222623 0.142360 0.041281 0.593736 0.358872 0.167597 0.220534 0.252997 0.233072 0.141480 0.230985 0.394463 0.350703 0.243129 0.233961 0.172207 Consensus sequence: DDDYCCTTTGATSTDDV Reverse complement motif 0.172207 0.243129 0.233961 0.350703 0.394463 0.141480 0.230985 0.233072 0.252997 0.167597 0.220534 0.358872 0.593736 0.142360 0.041281 0.222623 0.044198 0.353059 0.567994 0.034749 0.887341 0.001362 0.002094 0.109203 0.047253 0.000760 0.002581 0.949407 0.010872 0.926186 0.031751 0.031190 0.967625 0.001363 0.001379 0.029634 0.982678 0.008215 0.001941 0.007166 0.958680 0.023834 0.000940 0.016546 0.010827 0.034150 0.880320 0.074703 0.093376 0.180529 0.526578 0.199517 0.439156 0.333901 0.150903 0.076041 0.346074 0.161120 0.254018 0.238788 0.307665 0.157893 0.258178 0.276264 0.272277 0.187143 0.254855 0.285725 Consensus sequence: BDDASATCAAAGGMDDD Alignment: BDDASATCAAAGGMDDD -AAAGRTMAAACTA--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00054 Tcf7_primary Original Motif Original Motif Backward 4 13 0.037717 Species: Mus musculus Original motif 0.170811 0.196976 0.220503 0.411710 0.337231 0.228482 0.140137 0.294150 0.299312 0.173780 0.143426 0.383481 0.603957 0.053557 0.128214 0.214271 0.036338 0.377925 0.534647 0.051091 0.725865 0.010314 0.008501 0.255320 0.067855 0.007849 0.004559 0.919737 0.049387 0.815496 0.098330 0.036787 0.960514 0.005036 0.005137 0.029313 0.960631 0.004550 0.018815 0.016004 0.935245 0.005169 0.023866 0.035720 0.159760 0.060340 0.761341 0.018559 0.228534 0.153897 0.523052 0.094517 0.557984 0.123512 0.254154 0.064350 0.490252 0.211976 0.124557 0.173215 0.310463 0.250279 0.132612 0.306646 0.332720 0.248937 0.120633 0.297711 Consensus sequence: BHHASATCAAAGGAHHH Reverse complement motif 0.297711 0.248937 0.120633 0.332720 0.306646 0.250279 0.132612 0.310463 0.173215 0.211976 0.124557 0.490252 0.064350 0.123512 0.254154 0.557984 0.228534 0.523052 0.153897 0.094517 0.159760 0.761341 0.060340 0.018559 0.035720 0.005169 0.023866 0.935245 0.016004 0.004550 0.018815 0.960631 0.029313 0.005036 0.005137 0.960514 0.049387 0.098330 0.815496 0.036787 0.919737 0.007849 0.004559 0.067855 0.255320 0.010314 0.008501 0.725865 0.036338 0.534647 0.377925 0.051091 0.214271 0.053557 0.128214 0.603957 0.383481 0.173780 0.143426 0.299312 0.294150 0.228482 0.140137 0.337231 0.411710 0.196976 0.220503 0.170811 Consensus sequence: HHHTCCTTTGATSTHHV Alignment: BHHASATCAAAGGAHHH -AAAGRTMAAACTA--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00058 Tcf3_primary Original Motif Original Motif Backward 4 13 0.039468 Species: Mus musculus Original motif 0.185864 0.201179 0.183663 0.429294 0.371100 0.233868 0.122934 0.272098 0.249563 0.171285 0.128851 0.450301 0.582940 0.043382 0.129099 0.244578 0.041400 0.395349 0.497087 0.066163 0.759123 0.009670 0.005936 0.225270 0.056579 0.008662 0.003986 0.930772 0.043968 0.865783 0.056001 0.034249 0.962748 0.003731 0.003265 0.030256 0.971318 0.003542 0.012299 0.012841 0.937558 0.003991 0.020195 0.038256 0.125931 0.057976 0.798081 0.018012 0.209401 0.172342 0.483980 0.134277 0.485703 0.129227 0.309936 0.075134 0.397027 0.195902 0.152395 0.254676 0.311636 0.231510 0.157732 0.299122 0.320965 0.206031 0.164299 0.308705 Consensus sequence: HHHASATCAAAGVRHHH Reverse complement motif 0.308705 0.206031 0.164299 0.320965 0.299122 0.231510 0.157732 0.311636 0.254676 0.195902 0.152395 0.397027 0.075134 0.129227 0.309936 0.485703 0.209401 0.483980 0.172342 0.134277 0.125931 0.798081 0.057976 0.018012 0.038256 0.003991 0.020195 0.937558 0.012841 0.003542 0.012299 0.971318 0.030256 0.003731 0.003265 0.962748 0.043968 0.056001 0.865783 0.034249 0.930772 0.008662 0.003986 0.056579 0.225270 0.009670 0.005936 0.759123 0.041400 0.497087 0.395349 0.066163 0.244578 0.043382 0.129099 0.582940 0.450301 0.171285 0.128851 0.249563 0.272098 0.233868 0.122934 0.371100 0.429294 0.201179 0.183663 0.185864 Consensus sequence: HHHKVCTTTGATSTHHH Alignment: HHHASATCAAAGVRHHH -AAAGRTMAAACTA--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00032 Gata3_primary Reverse Complement Reverse Complement Backward 6 13 0.040601 Species: Mus musculus Original motif 0.151572 0.262753 0.258275 0.327401 0.221834 0.113385 0.275380 0.389400 0.297769 0.136928 0.134678 0.430625 0.270099 0.110415 0.271106 0.348380 0.265471 0.090253 0.223340 0.420936 0.616582 0.090091 0.171960 0.121367 0.197318 0.107541 0.406904 0.288237 0.798258 0.046950 0.001406 0.153385 0.003195 0.002516 0.989707 0.004582 0.991503 0.002748 0.002617 0.003132 0.005015 0.002764 0.003026 0.989195 0.948394 0.008932 0.001344 0.041330 0.973109 0.004100 0.004081 0.018710 0.040365 0.113905 0.828185 0.017545 0.736608 0.130524 0.113464 0.019404 0.415921 0.106101 0.316613 0.161365 0.376582 0.170927 0.155572 0.296919 0.137731 0.197151 0.211055 0.454064 0.324853 0.122747 0.246107 0.306293 0.462490 0.207311 0.159392 0.170807 0.380420 0.188972 0.311990 0.118618 0.222178 0.157873 0.380486 0.239463 Consensus sequence: BDHDDADAGATAAGADHBDHVD Reverse complement motif 0.222178 0.380486 0.157873 0.239463 0.118618 0.188972 0.311990 0.380420 0.170807 0.207311 0.159392 0.462490 0.306293 0.122747 0.246107 0.324853 0.454064 0.197151 0.211055 0.137731 0.296919 0.170927 0.155572 0.376582 0.161365 0.106101 0.316613 0.415921 0.019404 0.130524 0.113464 0.736608 0.040365 0.828185 0.113905 0.017545 0.018710 0.004100 0.004081 0.973109 0.041330 0.008932 0.001344 0.948394 0.989195 0.002764 0.003026 0.005015 0.003132 0.002748 0.002617 0.991503 0.003195 0.989707 0.002516 0.004582 0.153385 0.046950 0.001406 0.798258 0.197318 0.406904 0.107541 0.288237 0.121367 0.090091 0.171960 0.616582 0.420936 0.090253 0.223340 0.265471 0.348380 0.110415 0.271106 0.270099 0.430625 0.136928 0.134678 0.297769 0.389400 0.113385 0.275380 0.221834 0.327401 0.262753 0.258275 0.151572 Consensus sequence: HBHDVHDTCTTATCTHTDDHDV Alignment: HBHDVHDTCTTATCTHTDDHDV ----TAGTTTYAKCTTT----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00067 Lef1_primary Original Motif Reverse Complement Backward 4 13 0.041194 Species: Mus musculus Original motif 0.281920 0.214207 0.278077 0.225796 0.325566 0.151435 0.298797 0.224202 0.290253 0.145824 0.243443 0.320480 0.069286 0.404645 0.141614 0.384454 0.070044 0.621448 0.142647 0.165862 0.007295 0.907657 0.038110 0.046938 0.015587 0.018273 0.000658 0.965482 0.005527 0.005886 0.001905 0.986682 0.024512 0.001189 0.001344 0.972955 0.007384 0.025221 0.952270 0.015125 0.966438 0.000630 0.002693 0.030239 0.082252 0.001173 0.001495 0.915080 0.030255 0.677155 0.275323 0.017267 0.199467 0.118815 0.056814 0.624905 0.345445 0.169597 0.216831 0.268127 0.278106 0.150864 0.173693 0.397336 0.251834 0.339733 0.219703 0.188730 Consensus sequence: DDDYCCTTTGATCTDDV Reverse complement motif 0.251834 0.219703 0.339733 0.188730 0.397336 0.150864 0.173693 0.278106 0.268127 0.169597 0.216831 0.345445 0.624905 0.118815 0.056814 0.199467 0.030255 0.275323 0.677155 0.017267 0.915080 0.001173 0.001495 0.082252 0.030239 0.000630 0.002693 0.966438 0.007384 0.952270 0.025221 0.015125 0.972955 0.001189 0.001344 0.024512 0.986682 0.005886 0.001905 0.005527 0.965482 0.018273 0.000658 0.015587 0.007295 0.038110 0.907657 0.046938 0.070044 0.142647 0.621448 0.165862 0.069286 0.141614 0.404645 0.384454 0.320480 0.145824 0.243443 0.290253 0.224202 0.151435 0.298797 0.325566 0.225796 0.214207 0.278077 0.281920 Consensus sequence: VDDAGATCAAAGGKDDD Alignment: VDDAGATCAAAGGKDDD -AAAGRTMAAACTA--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00079 Esrra_primary Original Motif Original Motif Backward 1 13 0.042799 Species: Mus musculus Original motif 0.212524 0.177958 0.293723 0.315796 0.420838 0.283140 0.144938 0.151084 0.198119 0.196347 0.260353 0.345181 0.117752 0.282184 0.137207 0.462857 0.070125 0.781439 0.138093 0.010344 0.965989 0.000956 0.023828 0.009227 0.977263 0.003066 0.019255 0.000416 0.007404 0.000267 0.938934 0.053395 0.007147 0.000287 0.983377 0.009190 0.039608 0.000730 0.040682 0.918981 0.000685 0.905345 0.021930 0.072040 0.800961 0.001126 0.195791 0.002121 0.245039 0.241263 0.038084 0.475614 0.265397 0.238316 0.304963 0.191325 0.203742 0.286208 0.231002 0.279048 0.194132 0.188854 0.346693 0.270322 0.310711 0.263840 0.184317 0.241132 Consensus sequence: DHDBCAAGGTCAHVBDH Reverse complement motif 0.241132 0.263840 0.184317 0.310711 0.194132 0.346693 0.188854 0.270322 0.203742 0.231002 0.286208 0.279048 0.265397 0.304963 0.238316 0.191325 0.475614 0.241263 0.038084 0.245039 0.002121 0.001126 0.195791 0.800961 0.000685 0.021930 0.905345 0.072040 0.918981 0.000730 0.040682 0.039608 0.007147 0.983377 0.000287 0.009190 0.007404 0.938934 0.000267 0.053395 0.000416 0.003066 0.019255 0.977263 0.009227 0.000956 0.023828 0.965989 0.070125 0.138093 0.781439 0.010344 0.462857 0.282184 0.137207 0.117752 0.345181 0.196347 0.260353 0.198119 0.151084 0.283140 0.144938 0.420838 0.315796 0.177958 0.293723 0.212524 Consensus sequence: HHBVHTGACCTTGVDHD Alignment: DHDBCAAGGTCAHVBDH ----AAAGRTMAAACTA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00061 Foxl1_primary Original Motif Original Motif Forward 2 13 0.047360 Species: Mus musculus Original motif 0.323208 0.152915 0.185111 0.338766 0.428132 0.056109 0.099487 0.416272 0.659386 0.039965 0.035805 0.264843 0.647143 0.049206 0.078984 0.224667 0.208834 0.076592 0.071631 0.642943 0.341077 0.003865 0.649511 0.005547 0.016627 0.001866 0.001715 0.979792 0.952319 0.045294 0.000870 0.001516 0.988834 0.004620 0.000720 0.005826 0.989346 0.001005 0.006467 0.003182 0.001093 0.784230 0.001235 0.213442 0.991209 0.002017 0.001737 0.005037 0.801581 0.037084 0.023060 0.138274 0.528554 0.089350 0.107501 0.274595 0.208802 0.268646 0.368022 0.154530 0.280218 0.221367 0.340497 0.157918 0.146611 0.250725 0.293524 0.309140 Consensus sequence: DWAATRTAAACAAWVVB Reverse complement motif 0.309140 0.250725 0.293524 0.146611 0.280218 0.340497 0.221367 0.157918 0.208802 0.368022 0.268646 0.154530 0.274595 0.089350 0.107501 0.528554 0.138274 0.037084 0.023060 0.801581 0.005037 0.002017 0.001737 0.991209 0.001093 0.001235 0.784230 0.213442 0.003182 0.001005 0.006467 0.989346 0.005826 0.004620 0.000720 0.988834 0.001516 0.045294 0.000870 0.952319 0.979792 0.001866 0.001715 0.016627 0.341077 0.649511 0.003865 0.005547 0.642943 0.076592 0.071631 0.208834 0.224667 0.049206 0.078984 0.647143 0.264843 0.039965 0.035805 0.659386 0.416272 0.056109 0.099487 0.428132 0.338766 0.152915 0.185111 0.323208 Consensus sequence: VVVWTTGTTTAMATTWD Alignment: DWAATRTAAACAAWVVB -AAAGRTMAAACTA--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00040 Irf5_primary Reverse Complement Reverse Complement Backward 2 13 0.047451 Species: Mus musculus Original motif 0.337548 0.193688 0.194039 0.274725 0.279950 0.185928 0.199501 0.334621 0.357304 0.160203 0.278768 0.203725 0.499782 0.069569 0.166858 0.263790 0.832538 0.022992 0.085287 0.059183 0.144788 0.434769 0.040595 0.379848 0.016035 0.943520 0.003379 0.037067 0.014208 0.001713 0.982579 0.001500 0.985572 0.004274 0.008722 0.001432 0.894404 0.001440 0.007585 0.096571 0.991307 0.002706 0.001993 0.003994 0.011143 0.973529 0.013241 0.002087 0.016468 0.532173 0.009621 0.441739 0.462373 0.120288 0.237126 0.180213 0.392685 0.223865 0.229697 0.153753 Consensus sequence: DDDWAYCGAAACYDV Reverse complement motif 0.153753 0.223865 0.229697 0.392685 0.180213 0.120288 0.237126 0.462373 0.016468 0.009621 0.532173 0.441739 0.011143 0.013241 0.973529 0.002087 0.003994 0.002706 0.001993 0.991307 0.096571 0.001440 0.007585 0.894404 0.001432 0.004274 0.008722 0.985572 0.014208 0.982579 0.001713 0.001500 0.016035 0.003379 0.943520 0.037067 0.144788 0.040595 0.434769 0.379848 0.059183 0.022992 0.085287 0.832538 0.263790 0.069569 0.166858 0.499782 0.203725 0.160203 0.278768 0.357304 0.334621 0.185928 0.199501 0.279950 0.274725 0.193688 0.194039 0.337548 Consensus sequence: BDKGTTTCGKTWDDD Alignment: BDKGTTTCGKTWDDD -TAGTTTYAKCTTT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00199 Six4 Reverse Complement Reverse Complement Backward 1 13 0.047702 Species: Mus musculus Original motif 0.523054 0.168817 0.140331 0.167798 0.187385 0.177009 0.246164 0.389442 0.414492 0.118547 0.308876 0.158085 0.345234 0.289795 0.130249 0.234723 0.611522 0.116948 0.098944 0.172586 0.016342 0.029436 0.015062 0.939161 0.014351 0.004796 0.962435 0.018418 0.987454 0.005228 0.002590 0.004727 0.007431 0.812214 0.005849 0.174506 0.969354 0.025386 0.002362 0.002898 0.005123 0.989068 0.003362 0.002447 0.001424 0.969981 0.012011 0.016585 0.209729 0.227411 0.210523 0.352337 0.341679 0.297940 0.104590 0.255792 0.126190 0.288862 0.245018 0.339930 0.173008 0.295896 0.252422 0.278674 0.409639 0.210750 0.296197 0.083415 Consensus sequence: ADDHATGACACCBHBBV Reverse complement motif 0.083415 0.210750 0.296197 0.409639 0.173008 0.252422 0.295896 0.278674 0.339930 0.288862 0.245018 0.126190 0.255792 0.297940 0.104590 0.341679 0.352337 0.227411 0.210523 0.209729 0.001424 0.012011 0.969981 0.016585 0.005123 0.003362 0.989068 0.002447 0.002898 0.025386 0.002362 0.969354 0.007431 0.005849 0.812214 0.174506 0.004727 0.005228 0.002590 0.987454 0.014351 0.962435 0.004796 0.018418 0.939161 0.029436 0.015062 0.016342 0.172586 0.116948 0.098944 0.611522 0.234723 0.289795 0.130249 0.345234 0.158085 0.118547 0.308876 0.414492 0.389442 0.177009 0.246164 0.187385 0.167798 0.168817 0.140331 0.523054 Consensus sequence: BBVHVGGTGTCATHDDT Alignment: BBVHVGGTGTCATHDDT ----TAGTTTYAKCTTT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 16 Motif name: Motif 16 Original motif 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.000000 0.000000 0.500000 1.000000 0.000000 0.000000 0.000000 Consensus sequence: TCTKTGTCAAWA Reserve complement motif 0.000000 0.000000 0.000000 1.000000 0.500000 0.000000 0.000000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.000000 0.500000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 Consensus sequence: TWTTGACAYAGA ************************************************************************ Best Matches for Motif ID 16 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00258 Tgif2 Reverse Complement Reverse Complement Forward 2 12 0.002945 Species: Mus musculus Original motif 0.519684 0.141807 0.112153 0.226356 0.614097 0.079211 0.138045 0.168647 0.186975 0.327654 0.245051 0.240320 0.108289 0.303530 0.219106 0.369076 0.914812 0.012014 0.046628 0.026546 0.070482 0.163253 0.689315 0.076951 0.016354 0.972639 0.003648 0.007359 0.002043 0.018718 0.000384 0.978855 0.006109 0.001408 0.990736 0.001747 0.024783 0.002060 0.000402 0.972755 0.001485 0.991963 0.001756 0.004796 0.989335 0.001052 0.002320 0.007293 0.778804 0.056366 0.037632 0.127198 0.377980 0.094597 0.086888 0.440535 0.458125 0.289431 0.152762 0.099682 0.223103 0.435348 0.216962 0.124587 Consensus sequence: AABBAGCTGTCAAWVV Reverse complement motif 0.223103 0.216962 0.435348 0.124587 0.099682 0.289431 0.152762 0.458125 0.440535 0.094597 0.086888 0.377980 0.127198 0.056366 0.037632 0.778804 0.007293 0.001052 0.002320 0.989335 0.001485 0.001756 0.991963 0.004796 0.972755 0.002060 0.000402 0.024783 0.006109 0.990736 0.001408 0.001747 0.978855 0.018718 0.000384 0.002043 0.016354 0.003648 0.972639 0.007359 0.070482 0.689315 0.163253 0.076951 0.026546 0.012014 0.046628 0.914812 0.369076 0.303530 0.219106 0.108289 0.186975 0.245051 0.327654 0.240320 0.168647 0.079211 0.138045 0.614097 0.226356 0.141807 0.112153 0.519684 Consensus sequence: VBWTTGACAGCTVBTT Alignment: VBWTTGACAGCTVBTT -TWTTGACAYAGA--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00210 Mrg2 Reverse Complement Reverse Complement Backward 4 12 0.007097 Species: Mus musculus Original motif 0.451361 0.129344 0.139593 0.279702 0.590642 0.061045 0.179638 0.168676 0.264848 0.211505 0.252514 0.271134 0.108876 0.280056 0.299987 0.311081 0.771098 0.021050 0.148609 0.059244 0.030292 0.505912 0.423702 0.040094 0.053400 0.869563 0.021964 0.055073 0.001749 0.029333 0.000487 0.968430 0.007267 0.000536 0.989450 0.002747 0.031237 0.006659 0.000558 0.961545 0.001520 0.992342 0.001637 0.004501 0.976582 0.004910 0.010811 0.007697 0.640869 0.062002 0.032830 0.264299 0.318843 0.128253 0.123096 0.429808 0.432137 0.269895 0.155457 0.142512 0.247124 0.427480 0.147164 0.178233 Consensus sequence: DADBASCTGTCAAHVH Reverse complement motif 0.247124 0.147164 0.427480 0.178233 0.142512 0.269895 0.155457 0.432137 0.429808 0.128253 0.123096 0.318843 0.264299 0.062002 0.032830 0.640869 0.007697 0.004910 0.010811 0.976582 0.001520 0.001637 0.992342 0.004501 0.961545 0.006659 0.000558 0.031237 0.007267 0.989450 0.000536 0.002747 0.968430 0.029333 0.000487 0.001749 0.053400 0.021964 0.869563 0.055073 0.030292 0.423702 0.505912 0.040094 0.059244 0.021050 0.148609 0.771098 0.311081 0.280056 0.299987 0.108876 0.271134 0.211505 0.252514 0.264848 0.168676 0.061045 0.179638 0.590642 0.279702 0.129344 0.139593 0.451361 Consensus sequence: DBHTTGACAGSTVDTD Alignment: DBHTTGACAGSTVDTD -TWTTGACAYAGA--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00186 Meis1 Original Motif Original Motif Forward 4 12 0.008839 Species: Mus musculus Original motif 0.432115 0.114994 0.130835 0.322056 0.508081 0.060822 0.214256 0.216841 0.225875 0.276028 0.280982 0.217115 0.092373 0.286687 0.360933 0.260007 0.947172 0.005937 0.028595 0.018297 0.027829 0.439935 0.505051 0.027185 0.023801 0.963424 0.008205 0.004571 0.001548 0.018215 0.000406 0.979831 0.008422 0.001124 0.989007 0.001446 0.025343 0.004094 0.000241 0.970323 0.001451 0.992789 0.002037 0.003724 0.991202 0.001638 0.003159 0.004002 0.695910 0.022145 0.013657 0.268288 0.357895 0.090931 0.093796 0.457378 0.453163 0.204395 0.181067 0.161376 0.200615 0.393437 0.171398 0.234551 Consensus sequence: WAVBASCTGTCAAWVH Reverse complement motif 0.200615 0.171398 0.393437 0.234551 0.161376 0.204395 0.181067 0.453163 0.457378 0.090931 0.093796 0.357895 0.268288 0.022145 0.013657 0.695910 0.004002 0.001638 0.003159 0.991202 0.001451 0.002037 0.992789 0.003724 0.970323 0.004094 0.000241 0.025343 0.008422 0.989007 0.001124 0.001446 0.979831 0.018215 0.000406 0.001548 0.023801 0.008205 0.963424 0.004571 0.027829 0.505051 0.439935 0.027185 0.018297 0.005937 0.028595 0.947172 0.092373 0.360933 0.286687 0.260007 0.225875 0.280982 0.276028 0.217115 0.216841 0.060822 0.214256 0.508081 0.322056 0.114994 0.130835 0.432115 Consensus sequence: DBWTTGACAGSTBVTW Alignment: WAVBASCTGTCAAWVH ---TCTKTGTCAAWA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00226 Mrg1 Original Motif Original Motif Forward 4 12 0.009000 Species: Mus musculus Original motif 0.378836 0.145096 0.102046 0.374022 0.507161 0.090730 0.177058 0.225051 0.277496 0.234581 0.275775 0.212149 0.065300 0.339403 0.360939 0.234358 0.918963 0.010948 0.043262 0.026826 0.017295 0.545133 0.416603 0.020969 0.023391 0.962223 0.007311 0.007075 0.001760 0.020258 0.000360 0.977622 0.013946 0.000586 0.983699 0.001769 0.035910 0.004825 0.000197 0.959068 0.001465 0.991446 0.001338 0.005750 0.986785 0.001158 0.005848 0.006209 0.715894 0.043046 0.018966 0.222093 0.332332 0.084841 0.098421 0.484405 0.473739 0.198580 0.152072 0.175610 0.211505 0.325971 0.212211 0.250313 Consensus sequence: WAVBASCTGTCAAWHB Reverse complement motif 0.211505 0.212211 0.325971 0.250313 0.175610 0.198580 0.152072 0.473739 0.484405 0.084841 0.098421 0.332332 0.222093 0.043046 0.018966 0.715894 0.006209 0.001158 0.005848 0.986785 0.001465 0.001338 0.991446 0.005750 0.959068 0.004825 0.000197 0.035910 0.013946 0.983699 0.000586 0.001769 0.977622 0.020258 0.000360 0.001760 0.023391 0.007311 0.962223 0.007075 0.017295 0.416603 0.545133 0.020969 0.026826 0.010948 0.043262 0.918963 0.065300 0.360939 0.339403 0.234358 0.212149 0.234581 0.275775 0.277496 0.225051 0.090730 0.177058 0.507161 0.374022 0.145096 0.102046 0.378836 Consensus sequence: BHWTTGACAGSTBBTW Alignment: WAVBASCTGTCAAWHB ---TCTKTGTCAAWA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00122 Tgif1 Reverse Complement Original Motif Forward 3 12 0.012804 Species: Mus musculus Original motif 0.272977 0.158875 0.284742 0.283406 0.550609 0.124110 0.169608 0.155673 0.114568 0.207160 0.282464 0.395807 0.560868 0.052907 0.053508 0.332716 0.336500 0.068048 0.114050 0.481403 0.007736 0.003722 0.000495 0.988048 0.004489 0.000729 0.992211 0.002571 0.956618 0.000414 0.000890 0.042078 0.004381 0.990925 0.000538 0.004156 0.982797 0.000366 0.015539 0.001298 0.016760 0.002980 0.969991 0.010269 0.036013 0.725983 0.200022 0.037982 0.064755 0.104386 0.133891 0.696968 0.199404 0.263520 0.410228 0.126848 0.222648 0.351390 0.272575 0.153387 0.087778 0.206043 0.395671 0.310507 0.319643 0.144216 0.196041 0.340100 Consensus sequence: DABWWTGACAGCTVVBD Reverse complement motif 0.340100 0.144216 0.196041 0.319643 0.087778 0.395671 0.206043 0.310507 0.222648 0.272575 0.351390 0.153387 0.199404 0.410228 0.263520 0.126848 0.696968 0.104386 0.133891 0.064755 0.036013 0.200022 0.725983 0.037982 0.016760 0.969991 0.002980 0.010269 0.001298 0.000366 0.015539 0.982797 0.004381 0.000538 0.990925 0.004156 0.042078 0.000414 0.000890 0.956618 0.004489 0.992211 0.000729 0.002571 0.988048 0.003722 0.000495 0.007736 0.481403 0.068048 0.114050 0.336500 0.332716 0.052907 0.053508 0.560868 0.395807 0.207160 0.282464 0.114568 0.155673 0.124110 0.169608 0.550609 0.272977 0.284742 0.158875 0.283406 Consensus sequence: DBVVAGCTGTCAWWVTH Alignment: DABWWTGACAGCTVVBD --TWTTGACAYAGA--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00073 Foxa2_primary Reverse Complement Reverse Complement Backward 1 12 0.014575 Species: Mus musculus Original motif 0.335487 0.205062 0.128957 0.330494 0.411635 0.179625 0.175701 0.233038 0.412976 0.128602 0.091890 0.366532 0.608396 0.079002 0.107142 0.205460 0.433474 0.035203 0.153143 0.378180 0.087552 0.005003 0.894586 0.012858 0.004459 0.038951 0.001109 0.955481 0.924470 0.068560 0.001165 0.005805 0.920483 0.070039 0.001674 0.007805 0.988335 0.001902 0.003155 0.006608 0.001527 0.656726 0.002699 0.339047 0.987505 0.001810 0.004336 0.006349 0.719584 0.065184 0.050384 0.164848 0.535389 0.099997 0.102849 0.261764 0.245215 0.272017 0.301499 0.181269 0.306107 0.209040 0.248687 0.236166 0.223744 0.278668 0.251931 0.245657 Consensus sequence: HHWAWGTAAAYAAAVDB Reverse complement motif 0.223744 0.251931 0.278668 0.245657 0.236166 0.209040 0.248687 0.306107 0.245215 0.301499 0.272017 0.181269 0.261764 0.099997 0.102849 0.535389 0.164848 0.065184 0.050384 0.719584 0.006349 0.001810 0.004336 0.987505 0.001527 0.002699 0.656726 0.339047 0.006608 0.001902 0.003155 0.988335 0.007805 0.070039 0.001674 0.920483 0.005805 0.068560 0.001165 0.924470 0.955481 0.038951 0.001109 0.004459 0.087552 0.894586 0.005003 0.012858 0.378180 0.035203 0.153143 0.433474 0.205460 0.079002 0.107142 0.608396 0.366532 0.128602 0.091890 0.412976 0.233038 0.179625 0.175701 0.411635 0.330494 0.205062 0.128957 0.335487 Consensus sequence: BDVTTTKTTTACWTWHH Alignment: BDVTTTKTTTACWTWHH -----TWTTGACAYAGA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00205 Pknox2 Reverse Complement Reverse Complement Backward 4 12 0.014737 Species: Mus musculus Original motif 0.428425 0.195557 0.163102 0.212916 0.596487 0.103248 0.171370 0.128895 0.255216 0.203813 0.424426 0.116546 0.034183 0.441823 0.347767 0.176227 0.613880 0.025627 0.347719 0.012774 0.028636 0.551817 0.409264 0.010283 0.020873 0.969731 0.003025 0.006371 0.001171 0.039795 0.000323 0.958710 0.004303 0.001241 0.992873 0.001583 0.014490 0.007334 0.000309 0.977866 0.000873 0.991756 0.001920 0.005451 0.979609 0.000960 0.015793 0.003638 0.586289 0.199905 0.051181 0.162625 0.207586 0.157832 0.051564 0.583018 0.295651 0.262238 0.182998 0.259112 0.158213 0.267067 0.215259 0.359461 Consensus sequence: HAVSRSCTGTCAATHB Reverse complement motif 0.359461 0.267067 0.215259 0.158213 0.259112 0.262238 0.182998 0.295651 0.583018 0.157832 0.051564 0.207586 0.162625 0.199905 0.051181 0.586289 0.003638 0.000960 0.015793 0.979609 0.000873 0.001920 0.991756 0.005451 0.977866 0.007334 0.000309 0.014490 0.004303 0.992873 0.001241 0.001583 0.958710 0.039795 0.000323 0.001171 0.020873 0.003025 0.969731 0.006371 0.028636 0.409264 0.551817 0.010283 0.012774 0.025627 0.347719 0.613880 0.034183 0.347767 0.441823 0.176227 0.255216 0.424426 0.203813 0.116546 0.128895 0.103248 0.171370 0.596487 0.212916 0.195557 0.163102 0.428425 Consensus sequence: VHATTGACAGSKSVTH Alignment: VHATTGACAGSKSVTH -TWTTGACAYAGA--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00203 Pknox1 Original Motif Original Motif Forward 4 12 0.014779 Species: Mus musculus Original motif 0.436259 0.086706 0.169714 0.307321 0.433826 0.063296 0.358082 0.144795 0.324190 0.284651 0.208786 0.182372 0.054648 0.285295 0.518967 0.141090 0.922874 0.012239 0.042656 0.022231 0.036668 0.581917 0.338993 0.042422 0.021599 0.968542 0.006920 0.002939 0.001846 0.026071 0.000271 0.971812 0.007232 0.000773 0.989645 0.002350 0.019103 0.005771 0.000209 0.974917 0.001535 0.989111 0.000852 0.008502 0.989698 0.000915 0.004907 0.004480 0.679114 0.077050 0.037931 0.205904 0.330007 0.110122 0.067993 0.491878 0.286458 0.421726 0.186579 0.105236 0.199258 0.473968 0.173008 0.153766 Consensus sequence: DRVSASCTGTCAAWVV Reverse complement motif 0.199258 0.173008 0.473968 0.153766 0.286458 0.186579 0.421726 0.105236 0.491878 0.110122 0.067993 0.330007 0.205904 0.077050 0.037931 0.679114 0.004480 0.000915 0.004907 0.989698 0.001535 0.000852 0.989111 0.008502 0.974917 0.005771 0.000209 0.019103 0.007232 0.989645 0.000773 0.002350 0.971812 0.026071 0.000271 0.001846 0.021599 0.006920 0.968542 0.002939 0.036668 0.338993 0.581917 0.042422 0.022231 0.012239 0.042656 0.922874 0.054648 0.518967 0.285295 0.141090 0.182372 0.284651 0.208786 0.324190 0.144795 0.063296 0.358082 0.433826 0.307321 0.086706 0.169714 0.436259 Consensus sequence: VVWTTGACAGSTSBKD Alignment: DRVSASCTGTCAAWVV ---TCTKTGTCAAWA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00045 Mafb_primary Reverse Complement Original Motif Backward 1 12 0.015047 Species: Mus musculus Original motif 0.420301 0.182299 0.161481 0.235919 0.593201 0.055751 0.202477 0.148571 0.653364 0.017008 0.054630 0.274998 0.339176 0.102943 0.050258 0.507622 0.171557 0.078698 0.267471 0.482273 0.044703 0.033212 0.003920 0.918165 0.010333 0.004451 0.972441 0.012775 0.034026 0.949298 0.004788 0.011889 0.016078 0.008878 0.004007 0.971037 0.020331 0.004077 0.929676 0.045916 0.975739 0.007450 0.005991 0.010819 0.012733 0.887375 0.018700 0.081192 0.259981 0.111885 0.243051 0.385083 0.327677 0.149969 0.094895 0.427459 0.541721 0.105923 0.242224 0.110132 0.258689 0.068305 0.493226 0.179779 0.306041 0.306854 0.168308 0.218798 Consensus sequence: HAAWDTGCTGACDWARH Reverse complement motif 0.306041 0.168308 0.306854 0.218798 0.258689 0.493226 0.068305 0.179779 0.110132 0.105923 0.242224 0.541721 0.427459 0.149969 0.094895 0.327677 0.385083 0.111885 0.243051 0.259981 0.012733 0.018700 0.887375 0.081192 0.010819 0.007450 0.005991 0.975739 0.020331 0.929676 0.004077 0.045916 0.971037 0.008878 0.004007 0.016078 0.034026 0.004788 0.949298 0.011889 0.010333 0.972441 0.004451 0.012775 0.918165 0.033212 0.003920 0.044703 0.482273 0.078698 0.267471 0.171557 0.507622 0.102943 0.050258 0.339176 0.274998 0.017008 0.054630 0.653364 0.148571 0.055751 0.202477 0.593201 0.235919 0.182299 0.161481 0.420301 Consensus sequence: DMTWDGTCAGCADWTTH Alignment: HAAWDTGCTGACDWARH -----TWTTGACAYAGA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00103 Jundm2_secondary Reverse Complement Reverse Complement Backward 4 12 0.016711 Species: Mus musculus Original motif 0.330782 0.277751 0.217248 0.174219 0.254084 0.133750 0.268028 0.344139 0.102715 0.138642 0.266735 0.491907 0.211090 0.115754 0.489453 0.183704 0.634392 0.029243 0.325725 0.010641 0.004585 0.006792 0.004564 0.984059 0.003235 0.005036 0.896873 0.094857 0.914016 0.069061 0.002354 0.014569 0.011308 0.444033 0.533844 0.010815 0.007986 0.005770 0.003251 0.982993 0.043876 0.948120 0.005054 0.002950 0.985583 0.003417 0.008056 0.002944 0.017035 0.521313 0.032053 0.429599 0.331412 0.414679 0.097833 0.156076 0.317623 0.218390 0.235348 0.228638 0.308376 0.291095 0.191412 0.209116 Consensus sequence: VDKDRTGASTCAYHDH Reverse complement motif 0.209116 0.291095 0.191412 0.308376 0.228638 0.218390 0.235348 0.317623 0.331412 0.097833 0.414679 0.156076 0.017035 0.032053 0.521313 0.429599 0.002944 0.003417 0.008056 0.985583 0.043876 0.005054 0.948120 0.002950 0.982993 0.005770 0.003251 0.007986 0.011308 0.533844 0.444033 0.010815 0.014569 0.069061 0.002354 0.914016 0.003235 0.896873 0.005036 0.094857 0.984059 0.006792 0.004564 0.004585 0.010641 0.029243 0.325725 0.634392 0.211090 0.489453 0.115754 0.183704 0.491907 0.138642 0.266735 0.102715 0.344139 0.133750 0.268028 0.254084 0.174219 0.277751 0.217248 0.330782 Consensus sequence: HDDKTGASTCAKHRDB Alignment: HDDKTGASTCAKHRDB -TWTTGACAYAGA--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 17 Motif name: Motif 17 Original motif 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 Consensus sequence: CTTCTGACCTC Reserve complement motif 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 Consensus sequence: GAGGTCAGAAG ************************************************************************ Best Matches for Motif ID 17 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00079 Esrra_secondary Reverse Complement Original Motif Forward 6 11 0.000000 Species: Mus musculus Original motif 0.252126 0.268706 0.351590 0.127578 0.158171 0.083434 0.389646 0.368749 0.180010 0.290882 0.279192 0.249916 0.206905 0.249360 0.275438 0.268296 0.756588 0.046202 0.023921 0.173289 0.018262 0.022596 0.949143 0.010000 0.206468 0.046491 0.745475 0.001566 0.005511 0.001141 0.983152 0.010196 0.004791 0.001893 0.985951 0.007365 0.027643 0.001133 0.008565 0.962659 0.002459 0.970934 0.007826 0.018780 0.924387 0.003164 0.071225 0.001224 0.419387 0.230189 0.111588 0.238836 0.290954 0.163823 0.341233 0.203991 0.196768 0.281307 0.313868 0.208056 0.128428 0.260428 0.378607 0.232537 0.269305 0.378895 0.123480 0.228320 Consensus sequence: VKBBAGGGGTCAHDBBH Reverse complement motif 0.269305 0.123480 0.378895 0.228320 0.128428 0.378607 0.260428 0.232537 0.196768 0.313868 0.281307 0.208056 0.290954 0.341233 0.163823 0.203991 0.238836 0.230189 0.111588 0.419387 0.001224 0.003164 0.071225 0.924387 0.002459 0.007826 0.970934 0.018780 0.962659 0.001133 0.008565 0.027643 0.004791 0.985951 0.001893 0.007365 0.005511 0.983152 0.001141 0.010196 0.206468 0.745475 0.046491 0.001566 0.018262 0.949143 0.022596 0.010000 0.173289 0.046202 0.023921 0.756588 0.206905 0.275438 0.249360 0.268296 0.180010 0.279192 0.290882 0.249916 0.158171 0.389646 0.083434 0.368749 0.252126 0.351590 0.268706 0.127578 Consensus sequence: DBBHHTGACCCCTBBYV Alignment: VKBBAGGGGTCAHDBBH -----GAGGTCAGAAG- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00045 Mafb_primary Reverse Complement Reverse Complement Backward 5 11 0.003154 Species: Mus musculus Original motif 0.420301 0.182299 0.161481 0.235919 0.593201 0.055751 0.202477 0.148571 0.653364 0.017008 0.054630 0.274998 0.339176 0.102943 0.050258 0.507622 0.171557 0.078698 0.267471 0.482273 0.044703 0.033212 0.003920 0.918165 0.010333 0.004451 0.972441 0.012775 0.034026 0.949298 0.004788 0.011889 0.016078 0.008878 0.004007 0.971037 0.020331 0.004077 0.929676 0.045916 0.975739 0.007450 0.005991 0.010819 0.012733 0.887375 0.018700 0.081192 0.259981 0.111885 0.243051 0.385083 0.327677 0.149969 0.094895 0.427459 0.541721 0.105923 0.242224 0.110132 0.258689 0.068305 0.493226 0.179779 0.306041 0.306854 0.168308 0.218798 Consensus sequence: HAAWDTGCTGACDWARH Reverse complement motif 0.306041 0.168308 0.306854 0.218798 0.258689 0.493226 0.068305 0.179779 0.110132 0.105923 0.242224 0.541721 0.427459 0.149969 0.094895 0.327677 0.385083 0.111885 0.243051 0.259981 0.012733 0.018700 0.887375 0.081192 0.010819 0.007450 0.005991 0.975739 0.020331 0.929676 0.004077 0.045916 0.971037 0.008878 0.004007 0.016078 0.034026 0.004788 0.949298 0.011889 0.010333 0.972441 0.004451 0.012775 0.918165 0.033212 0.003920 0.044703 0.482273 0.078698 0.267471 0.171557 0.507622 0.102943 0.050258 0.339176 0.274998 0.017008 0.054630 0.653364 0.148571 0.055751 0.202477 0.593201 0.235919 0.182299 0.161481 0.420301 Consensus sequence: DMTWDGTCAGCADWTTH Alignment: DMTWDGTCAGCADWTTH --GAGGTCAGAAG---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00009 Nr2f2_primary Reverse Complement Original Motif Backward 1 11 0.004350 Species: Mus musculus Original motif 0.253408 0.181904 0.273186 0.291502 0.262827 0.381870 0.153734 0.201569 0.143383 0.243233 0.242562 0.370823 0.247498 0.336892 0.176114 0.239496 0.856654 0.037068 0.049492 0.056786 0.797369 0.012935 0.176463 0.013233 0.808222 0.001309 0.189796 0.000674 0.002583 0.000536 0.989167 0.007714 0.002421 0.000283 0.972777 0.024519 0.000270 0.003650 0.019038 0.977041 0.000184 0.956654 0.005329 0.037833 0.925587 0.000706 0.072434 0.001273 0.307028 0.327297 0.079126 0.286549 0.238576 0.245847 0.384025 0.131552 0.281599 0.234987 0.226211 0.257204 0.211511 0.212695 0.363980 0.211815 Consensus sequence: DHBHAAAGGTCAHVHB Reverse complement motif 0.211511 0.363980 0.212695 0.211815 0.257204 0.234987 0.226211 0.281599 0.238576 0.384025 0.245847 0.131552 0.307028 0.079126 0.327297 0.286549 0.001273 0.000706 0.072434 0.925587 0.000184 0.005329 0.956654 0.037833 0.977041 0.003650 0.019038 0.000270 0.002421 0.972777 0.000283 0.024519 0.002583 0.989167 0.000536 0.007714 0.000674 0.001309 0.189796 0.808222 0.013233 0.012935 0.176463 0.797369 0.056786 0.037068 0.049492 0.856654 0.247498 0.176114 0.336892 0.239496 0.370823 0.243233 0.242562 0.143383 0.262827 0.153734 0.381870 0.201569 0.291502 0.181904 0.273186 0.253408 Consensus sequence: BHVDTGACCTTTDVDD Alignment: DHBHAAAGGTCAHVHB -----GAGGTCAGAAG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00048 Rara Reverse Complement Original Motif Forward 6 11 0.004996 Species: Mus musculus Original motif 0.222478 0.177331 0.266395 0.333797 0.276222 0.360097 0.118354 0.245327 0.106047 0.268455 0.234217 0.391281 0.244163 0.407141 0.146864 0.201832 0.852083 0.050643 0.039941 0.057332 0.814108 0.012894 0.165984 0.007015 0.905198 0.005648 0.088378 0.000776 0.002783 0.000555 0.988205 0.008457 0.001289 0.000626 0.898209 0.099877 0.002878 0.001631 0.008910 0.986582 0.000499 0.975550 0.005264 0.018687 0.963627 0.000883 0.034432 0.001058 0.181490 0.517766 0.077094 0.223650 0.183789 0.384790 0.308350 0.123071 0.229801 0.228801 0.224468 0.316930 0.218244 0.170273 0.366746 0.244736 Consensus sequence: DHBHAAAGGTCACVHD Reverse complement motif 0.218244 0.366746 0.170273 0.244736 0.316930 0.228801 0.224468 0.229801 0.183789 0.308350 0.384790 0.123071 0.181490 0.077094 0.517766 0.223650 0.001058 0.000883 0.034432 0.963627 0.000499 0.005264 0.975550 0.018687 0.986582 0.001631 0.008910 0.002878 0.001289 0.898209 0.000626 0.099877 0.002783 0.988205 0.000555 0.008457 0.000776 0.005648 0.088378 0.905198 0.007015 0.012894 0.165984 0.814108 0.057332 0.050643 0.039941 0.852083 0.244163 0.146864 0.407141 0.201832 0.391281 0.268455 0.234217 0.106047 0.276222 0.118354 0.360097 0.245327 0.333797 0.177331 0.266395 0.222478 Consensus sequence: HHVGTGACCTTTDVDD Alignment: DHBHAAAGGTCACVHD -----GAGGTCAGAAG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00053 Rxra_primary Original Motif Original Motif Backward 6 11 0.005037 Species: Mus musculus Original motif 0.235299 0.222264 0.237416 0.305021 0.144778 0.278902 0.341673 0.234648 0.261127 0.261904 0.191591 0.285378 0.119943 0.410774 0.218940 0.250343 0.222672 0.075554 0.365253 0.336521 0.001838 0.046904 0.002828 0.948430 0.030410 0.006359 0.960821 0.002410 0.987391 0.007562 0.002810 0.002237 0.105188 0.888650 0.001163 0.004998 0.006475 0.987074 0.001793 0.004659 0.001816 0.765138 0.003092 0.229953 0.010354 0.846496 0.029899 0.113251 0.328732 0.039382 0.265510 0.366377 0.209638 0.262628 0.145613 0.382121 0.385390 0.177695 0.299828 0.137087 0.403452 0.268924 0.096028 0.231595 0.203082 0.231812 0.213520 0.351585 Consensus sequence: DBHBDTGACCCCDHVHB Reverse complement motif 0.351585 0.231812 0.213520 0.203082 0.231595 0.268924 0.096028 0.403452 0.137087 0.177695 0.299828 0.385390 0.382121 0.262628 0.145613 0.209638 0.366377 0.039382 0.265510 0.328732 0.010354 0.029899 0.846496 0.113251 0.001816 0.003092 0.765138 0.229953 0.006475 0.001793 0.987074 0.004659 0.105188 0.001163 0.888650 0.004998 0.002237 0.007562 0.002810 0.987391 0.030410 0.960821 0.006359 0.002410 0.948430 0.046904 0.002828 0.001838 0.222672 0.365253 0.075554 0.336521 0.119943 0.218940 0.410774 0.250343 0.285378 0.261904 0.191591 0.261127 0.144778 0.341673 0.278902 0.234648 0.305021 0.222264 0.237416 0.235299 Consensus sequence: VHBHDGGGGTCAHBHBD Alignment: DBHBDTGACCCCDHVHB -CTTCTGACCTC----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00079 Esrra_primary Original Motif Reverse Complement Forward 2 11 0.008556 Species: Mus musculus Original motif 0.212524 0.177958 0.293723 0.315796 0.420838 0.283140 0.144938 0.151084 0.198119 0.196347 0.260353 0.345181 0.117752 0.282184 0.137207 0.462857 0.070125 0.781439 0.138093 0.010344 0.965989 0.000956 0.023828 0.009227 0.977263 0.003066 0.019255 0.000416 0.007404 0.000267 0.938934 0.053395 0.007147 0.000287 0.983377 0.009190 0.039608 0.000730 0.040682 0.918981 0.000685 0.905345 0.021930 0.072040 0.800961 0.001126 0.195791 0.002121 0.245039 0.241263 0.038084 0.475614 0.265397 0.238316 0.304963 0.191325 0.203742 0.286208 0.231002 0.279048 0.194132 0.188854 0.346693 0.270322 0.310711 0.263840 0.184317 0.241132 Consensus sequence: DHDBCAAGGTCAHVBDH Reverse complement motif 0.241132 0.263840 0.184317 0.310711 0.194132 0.346693 0.188854 0.270322 0.203742 0.231002 0.286208 0.279048 0.265397 0.304963 0.238316 0.191325 0.475614 0.241263 0.038084 0.245039 0.002121 0.001126 0.195791 0.800961 0.000685 0.021930 0.905345 0.072040 0.918981 0.000730 0.040682 0.039608 0.007147 0.983377 0.000287 0.009190 0.007404 0.938934 0.000267 0.053395 0.000416 0.003066 0.019255 0.977263 0.009227 0.000956 0.023828 0.965989 0.070125 0.138093 0.781439 0.010344 0.462857 0.282184 0.137207 0.117752 0.345181 0.196347 0.260353 0.198119 0.151084 0.283140 0.144938 0.420838 0.315796 0.177958 0.293723 0.212524 Consensus sequence: HHBVHTGACCTTGVDHD Alignment: HHBVHTGACCTTGVDHD -CTTCTGACCTC----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00020 Atf1_primary Reverse Complement Reverse Complement Backward 1 11 0.010647 Species: Mus musculus Original motif 0.381335 0.135129 0.244887 0.238648 0.139538 0.419619 0.195665 0.245178 0.158070 0.098493 0.409974 0.333462 0.472756 0.096594 0.388246 0.042403 0.008868 0.028811 0.005332 0.956990 0.014102 0.014269 0.863476 0.108153 0.962594 0.004653 0.011816 0.020937 0.003091 0.949099 0.003165 0.044646 0.044646 0.003165 0.949099 0.003091 0.020937 0.011816 0.004653 0.962594 0.108153 0.863476 0.014269 0.014102 0.956990 0.005332 0.028811 0.008868 0.049761 0.357863 0.144826 0.447550 0.225769 0.448432 0.142340 0.183460 0.264766 0.097627 0.493031 0.144576 0.352319 0.180279 0.236767 0.230635 Consensus sequence: DBDRTGACGTCAYHRD Reverse complement motif 0.230635 0.180279 0.236767 0.352319 0.264766 0.493031 0.097627 0.144576 0.225769 0.142340 0.448432 0.183460 0.447550 0.357863 0.144826 0.049761 0.008868 0.005332 0.028811 0.956990 0.108153 0.014269 0.863476 0.014102 0.962594 0.011816 0.004653 0.020937 0.044646 0.949099 0.003165 0.003091 0.003091 0.003165 0.949099 0.044646 0.020937 0.004653 0.011816 0.962594 0.014102 0.863476 0.014269 0.108153 0.956990 0.028811 0.005332 0.008868 0.042403 0.096594 0.388246 0.472756 0.158070 0.409974 0.098493 0.333462 0.139538 0.195665 0.419619 0.245178 0.238648 0.135129 0.244887 0.381335 Consensus sequence: DMDMTGACGTCAKHBD Alignment: DMDMTGACGTCAKHBD -----GAGGTCAGAAG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00066 Hnf4a_primary Reverse Complement Original Motif Backward 2 11 0.010819 Species: Mus musculus Original motif 0.223704 0.280688 0.251889 0.243719 0.198683 0.190981 0.267970 0.342366 0.150012 0.319579 0.206063 0.324347 0.274896 0.302572 0.238597 0.183935 0.438853 0.331148 0.021186 0.208812 0.133937 0.027342 0.832490 0.006231 0.141462 0.002336 0.854359 0.001843 0.003464 0.000753 0.987433 0.008349 0.004388 0.000692 0.884494 0.110426 0.003808 0.001605 0.016793 0.977794 0.001992 0.976605 0.003739 0.017664 0.881237 0.089981 0.026017 0.002764 0.735041 0.106592 0.083260 0.075107 0.164419 0.315518 0.181031 0.339032 0.228285 0.176364 0.157583 0.437768 0.233407 0.193567 0.327076 0.245951 0.320479 0.312566 0.195701 0.171254 Consensus sequence: BDBVMGGGGTCAABHDV Reverse complement motif 0.171254 0.312566 0.195701 0.320479 0.233407 0.327076 0.193567 0.245951 0.437768 0.176364 0.157583 0.228285 0.339032 0.315518 0.181031 0.164419 0.075107 0.106592 0.083260 0.735041 0.002764 0.089981 0.026017 0.881237 0.001992 0.003739 0.976605 0.017664 0.977794 0.001605 0.016793 0.003808 0.004388 0.884494 0.000692 0.110426 0.003464 0.987433 0.000753 0.008349 0.141462 0.854359 0.002336 0.001843 0.133937 0.832490 0.027342 0.006231 0.208812 0.331148 0.021186 0.438853 0.274896 0.238597 0.302572 0.183935 0.324347 0.319579 0.206063 0.150012 0.342366 0.190981 0.267970 0.198683 0.223704 0.251889 0.280688 0.243719 Consensus sequence: BHHVTTGACCCCYVVDB Alignment: BDBVMGGGGTCAABHDV -----GAGGTCAGAAG- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00068 Eomes_primary Reverse Complement Original Motif Backward 4 11 0.013118 Species: Mus musculus Original motif 0.186316 0.215541 0.297644 0.300499 0.300381 0.234276 0.266283 0.199061 0.317841 0.211418 0.183235 0.287507 0.482598 0.095323 0.245062 0.177017 0.654197 0.008988 0.261951 0.074864 0.095656 0.022883 0.843364 0.038097 0.002655 0.008355 0.976390 0.012600 0.003287 0.080755 0.001057 0.914900 0.006753 0.001517 0.989917 0.001813 0.039940 0.098800 0.003305 0.857955 0.009015 0.039036 0.844029 0.107921 0.984070 0.002369 0.008852 0.004709 0.789505 0.101528 0.029294 0.079672 0.649685 0.139882 0.090466 0.119966 0.421759 0.205595 0.073074 0.299573 0.214779 0.290522 0.134050 0.360649 0.202141 0.270323 0.176798 0.350738 Consensus sequence: BVHDAGGTGTGAAAHHH Reverse complement motif 0.350738 0.270323 0.176798 0.202141 0.360649 0.290522 0.134050 0.214779 0.299573 0.205595 0.073074 0.421759 0.119966 0.139882 0.090466 0.649685 0.079672 0.101528 0.029294 0.789505 0.004709 0.002369 0.008852 0.984070 0.009015 0.844029 0.039036 0.107921 0.857955 0.098800 0.003305 0.039940 0.006753 0.989917 0.001517 0.001813 0.914900 0.080755 0.001057 0.003287 0.002655 0.976390 0.008355 0.012600 0.095656 0.843364 0.022883 0.038097 0.074864 0.008988 0.261951 0.654197 0.177017 0.095323 0.245062 0.482598 0.287507 0.211418 0.183235 0.317841 0.199061 0.234276 0.266283 0.300381 0.300499 0.215541 0.297644 0.186316 Consensus sequence: HHHTTTCACACCTDHBV Alignment: BVHDAGGTGTGAAAHHH ---GAGGTCAGAAG--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00103 Jundm2_primary Original Motif Reverse Complement Backward 6 11 0.013220 Species: Mus musculus Original motif 0.213023 0.312553 0.241727 0.232696 0.126878 0.453780 0.251405 0.167937 0.127927 0.138541 0.528637 0.204895 0.572671 0.136079 0.242107 0.049142 0.004569 0.015235 0.003215 0.976981 0.004594 0.008024 0.836426 0.150956 0.966548 0.003255 0.009947 0.020250 0.001636 0.899650 0.004880 0.093834 0.093834 0.004880 0.899650 0.001636 0.020250 0.009947 0.003255 0.966548 0.150956 0.836426 0.008024 0.004594 0.976981 0.003215 0.015235 0.004569 0.006508 0.324308 0.040126 0.629058 0.170728 0.554933 0.116757 0.157582 0.255966 0.170983 0.430910 0.142142 0.228601 0.267456 0.166199 0.337744 Consensus sequence: BBGATGACGTCAYCVH Reverse complement motif 0.337744 0.267456 0.166199 0.228601 0.255966 0.430910 0.170983 0.142142 0.170728 0.116757 0.554933 0.157582 0.629058 0.324308 0.040126 0.006508 0.004569 0.003215 0.015235 0.976981 0.150956 0.008024 0.836426 0.004594 0.966548 0.009947 0.003255 0.020250 0.093834 0.899650 0.004880 0.001636 0.001636 0.004880 0.899650 0.093834 0.020250 0.003255 0.009947 0.966548 0.004594 0.836426 0.008024 0.150956 0.976981 0.015235 0.003215 0.004569 0.049142 0.136079 0.242107 0.572671 0.127927 0.528637 0.138541 0.204895 0.126878 0.251405 0.453780 0.167937 0.213023 0.241727 0.312553 0.232696 Consensus sequence: HVGMTGACGTCATCBB Alignment: HVGMTGACGTCATCBB CTTCTGACCTC----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 18 Motif name: Motif 18 Original motif 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 Consensus sequence: CAAAGTCCAGC Reserve complement motif 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 Consensus sequence: GCTGGACTTTG ************************************************************************ Best Matches for Motif ID 18 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00066 Hnf4a_secondary Reverse Complement Reverse Complement Forward 3 11 0.000000 Species: Mus musculus Original motif 0.131680 0.169949 0.346277 0.352094 0.109910 0.144258 0.373681 0.372151 0.196671 0.411335 0.159689 0.232305 0.311086 0.307077 0.122332 0.259505 0.895155 0.013238 0.038874 0.052733 0.779629 0.018399 0.171269 0.030703 0.950546 0.002649 0.041825 0.004980 0.004769 0.002646 0.985847 0.006739 0.004458 0.002117 0.012011 0.981414 0.016789 0.969626 0.003890 0.009695 0.002468 0.982852 0.004754 0.009926 0.891448 0.003193 0.097548 0.007811 0.513330 0.308971 0.070467 0.107232 0.179371 0.115514 0.130898 0.574217 0.285826 0.277536 0.166982 0.269655 0.319407 0.227783 0.129020 0.323790 Consensus sequence: BBHHAAAGTCCAMTHH Reverse complement motif 0.323790 0.227783 0.129020 0.319407 0.269655 0.277536 0.166982 0.285826 0.574217 0.115514 0.130898 0.179371 0.107232 0.308971 0.070467 0.513330 0.007811 0.003193 0.097548 0.891448 0.002468 0.004754 0.982852 0.009926 0.016789 0.003890 0.969626 0.009695 0.981414 0.002117 0.012011 0.004458 0.004769 0.985847 0.002646 0.006739 0.004980 0.002649 0.041825 0.950546 0.030703 0.018399 0.171269 0.779629 0.052733 0.013238 0.038874 0.895155 0.259505 0.307077 0.122332 0.311086 0.196671 0.159689 0.411335 0.232305 0.109910 0.373681 0.144258 0.372151 0.352094 0.169949 0.346277 0.131680 Consensus sequence: HHAYTGGACTTTHDBV Alignment: HHAYTGGACTTTHDBV --GCTGGACTTTG--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00079 Esrra_primary Reverse Complement Reverse Complement Forward 3 11 0.031385 Species: Mus musculus Original motif 0.212524 0.177958 0.293723 0.315796 0.420838 0.283140 0.144938 0.151084 0.198119 0.196347 0.260353 0.345181 0.117752 0.282184 0.137207 0.462857 0.070125 0.781439 0.138093 0.010344 0.965989 0.000956 0.023828 0.009227 0.977263 0.003066 0.019255 0.000416 0.007404 0.000267 0.938934 0.053395 0.007147 0.000287 0.983377 0.009190 0.039608 0.000730 0.040682 0.918981 0.000685 0.905345 0.021930 0.072040 0.800961 0.001126 0.195791 0.002121 0.245039 0.241263 0.038084 0.475614 0.265397 0.238316 0.304963 0.191325 0.203742 0.286208 0.231002 0.279048 0.194132 0.188854 0.346693 0.270322 0.310711 0.263840 0.184317 0.241132 Consensus sequence: DHDBCAAGGTCAHVBDH Reverse complement motif 0.241132 0.263840 0.184317 0.310711 0.194132 0.346693 0.188854 0.270322 0.203742 0.231002 0.286208 0.279048 0.265397 0.304963 0.238316 0.191325 0.475614 0.241263 0.038084 0.245039 0.002121 0.001126 0.195791 0.800961 0.000685 0.021930 0.905345 0.072040 0.918981 0.000730 0.040682 0.039608 0.007147 0.983377 0.000287 0.009190 0.007404 0.938934 0.000267 0.053395 0.000416 0.003066 0.019255 0.977263 0.009227 0.000956 0.023828 0.965989 0.070125 0.138093 0.781439 0.010344 0.462857 0.282184 0.137207 0.117752 0.345181 0.196347 0.260353 0.198119 0.151084 0.283140 0.144938 0.420838 0.315796 0.177958 0.293723 0.212524 Consensus sequence: HHBVHTGACCTTGVDHD Alignment: HHBVHTGACCTTGVDHD --GCTGGACTTTG---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00048 Rara Original Motif Original Motif Backward 3 11 0.034759 Species: Mus musculus Original motif 0.222478 0.177331 0.266395 0.333797 0.276222 0.360097 0.118354 0.245327 0.106047 0.268455 0.234217 0.391281 0.244163 0.407141 0.146864 0.201832 0.852083 0.050643 0.039941 0.057332 0.814108 0.012894 0.165984 0.007015 0.905198 0.005648 0.088378 0.000776 0.002783 0.000555 0.988205 0.008457 0.001289 0.000626 0.898209 0.099877 0.002878 0.001631 0.008910 0.986582 0.000499 0.975550 0.005264 0.018687 0.963627 0.000883 0.034432 0.001058 0.181490 0.517766 0.077094 0.223650 0.183789 0.384790 0.308350 0.123071 0.229801 0.228801 0.224468 0.316930 0.218244 0.170273 0.366746 0.244736 Consensus sequence: DHBHAAAGGTCACVHD Reverse complement motif 0.218244 0.366746 0.170273 0.244736 0.316930 0.228801 0.224468 0.229801 0.183789 0.308350 0.384790 0.123071 0.181490 0.077094 0.517766 0.223650 0.001058 0.000883 0.034432 0.963627 0.000499 0.005264 0.975550 0.018687 0.986582 0.001631 0.008910 0.002878 0.001289 0.898209 0.000626 0.099877 0.002783 0.988205 0.000555 0.008457 0.000776 0.005648 0.088378 0.905198 0.007015 0.012894 0.165984 0.814108 0.057332 0.050643 0.039941 0.852083 0.244163 0.146864 0.407141 0.201832 0.391281 0.268455 0.234217 0.106047 0.276222 0.118354 0.360097 0.245327 0.333797 0.177331 0.266395 0.222478 Consensus sequence: HHVGTGACCTTTDVDD Alignment: DHBHAAAGGTCACVHD ---CAAAGTCCAGC-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00009 Nr2f2_primary Original Motif Original Motif Backward 3 11 0.044887 Species: Mus musculus Original motif 0.253408 0.181904 0.273186 0.291502 0.262827 0.381870 0.153734 0.201569 0.143383 0.243233 0.242562 0.370823 0.247498 0.336892 0.176114 0.239496 0.856654 0.037068 0.049492 0.056786 0.797369 0.012935 0.176463 0.013233 0.808222 0.001309 0.189796 0.000674 0.002583 0.000536 0.989167 0.007714 0.002421 0.000283 0.972777 0.024519 0.000270 0.003650 0.019038 0.977041 0.000184 0.956654 0.005329 0.037833 0.925587 0.000706 0.072434 0.001273 0.307028 0.327297 0.079126 0.286549 0.238576 0.245847 0.384025 0.131552 0.281599 0.234987 0.226211 0.257204 0.211511 0.212695 0.363980 0.211815 Consensus sequence: DHBHAAAGGTCAHVHB Reverse complement motif 0.211511 0.363980 0.212695 0.211815 0.257204 0.234987 0.226211 0.281599 0.238576 0.384025 0.245847 0.131552 0.307028 0.079126 0.327297 0.286549 0.001273 0.000706 0.072434 0.925587 0.000184 0.005329 0.956654 0.037833 0.977041 0.003650 0.019038 0.000270 0.002421 0.972777 0.000283 0.024519 0.002583 0.989167 0.000536 0.007714 0.000674 0.001309 0.189796 0.808222 0.013233 0.012935 0.176463 0.797369 0.056786 0.037068 0.049492 0.856654 0.247498 0.176114 0.336892 0.239496 0.370823 0.243233 0.242562 0.143383 0.262827 0.153734 0.381870 0.201569 0.291502 0.181904 0.273186 0.253408 Consensus sequence: BHVDTGACCTTTDVDD Alignment: DHBHAAAGGTCAHVHB ---CAAAGTCCAGC-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v016060_primary Reverse Complement Original Motif Forward 10 11 0.046168 Species: Mus musculus Original motif 0.204923 0.208846 0.365383 0.220848 0.294304 0.300143 0.167287 0.238266 0.109711 0.619514 0.117379 0.153396 0.178979 0.378580 0.230177 0.212264 0.159594 0.542602 0.118178 0.179627 0.125206 0.430074 0.151826 0.292894 0.097692 0.709845 0.116956 0.075506 0.148292 0.565912 0.037632 0.248164 0.077951 0.034190 0.855503 0.032356 0.001657 0.001061 0.971877 0.025405 0.001926 0.001084 0.991712 0.005278 0.033031 0.012001 0.057796 0.897171 0.002723 0.002647 0.993348 0.001281 0.003261 0.000963 0.987199 0.008577 0.000611 0.090925 0.074857 0.833608 0.015299 0.978878 0.004949 0.000874 0.013368 0.600902 0.033485 0.352245 0.231949 0.149575 0.118804 0.499672 0.267580 0.186002 0.371242 0.175176 0.264884 0.223483 0.110082 0.401551 0.221365 0.170121 0.179559 0.428955 0.112997 0.692930 0.139981 0.054092 0.460305 0.207883 0.155111 0.176702 Consensus sequence: BHCBCBCCGGGTGGTCYHVHDCH Reverse complement motif 0.176702 0.207883 0.155111 0.460305 0.112997 0.139981 0.692930 0.054092 0.428955 0.170121 0.179559 0.221365 0.401551 0.223483 0.110082 0.264884 0.267580 0.371242 0.186002 0.175176 0.499672 0.149575 0.118804 0.231949 0.013368 0.033485 0.600902 0.352245 0.015299 0.004949 0.978878 0.000874 0.833608 0.090925 0.074857 0.000611 0.003261 0.987199 0.000963 0.008577 0.002723 0.993348 0.002647 0.001281 0.897171 0.012001 0.057796 0.033031 0.001926 0.991712 0.001084 0.005278 0.001657 0.971877 0.001061 0.025405 0.077951 0.855503 0.034190 0.032356 0.148292 0.037632 0.565912 0.248164 0.097692 0.116956 0.709845 0.075506 0.125206 0.151826 0.430074 0.292894 0.159594 0.118178 0.542602 0.179627 0.178979 0.230177 0.378580 0.212264 0.109711 0.117379 0.619514 0.153396 0.294304 0.167287 0.300143 0.238266 0.204923 0.365383 0.208846 0.220848 Consensus sequence: HGDHVHKGACCACCCGGBGBGDB Alignment: BHCBCBCCGGGTGGTCYHVHDCH ---------GCTGGACTTTG--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v016060_primary Original Motif Original Motif Forward 4 11 0.046843 Species: Mus musculus Original motif 0.137831 0.118922 0.394177 0.349070 0.190108 0.163633 0.138507 0.507753 0.346002 0.332315 0.228621 0.093063 0.113254 0.287554 0.373285 0.225908 0.272578 0.125402 0.328963 0.273057 0.333973 0.115165 0.194267 0.356595 0.381054 0.086215 0.501679 0.031052 0.002232 0.007405 0.966087 0.024276 0.834741 0.112115 0.052053 0.001091 0.009034 0.983239 0.000766 0.006960 0.002054 0.988103 0.003138 0.006705 0.805772 0.171299 0.008415 0.014515 0.020076 0.976846 0.000894 0.002183 0.079914 0.917273 0.001179 0.001634 0.013983 0.950545 0.004205 0.031267 0.789407 0.039441 0.108645 0.062507 0.055453 0.161271 0.595249 0.188028 0.333424 0.128169 0.373270 0.165136 0.536103 0.109520 0.062980 0.291397 0.346477 0.090909 0.279533 0.283081 0.045892 0.190183 0.584314 0.179611 0.088294 0.406148 0.251647 0.253912 0.202467 0.447159 0.162802 0.187571 Consensus sequence: DTVBDDRGACCACCCAGDWDGBH Reverse complement motif 0.202467 0.162802 0.447159 0.187571 0.088294 0.251647 0.406148 0.253912 0.045892 0.584314 0.190183 0.179611 0.283081 0.090909 0.279533 0.346477 0.291397 0.109520 0.062980 0.536103 0.333424 0.373270 0.128169 0.165136 0.055453 0.595249 0.161271 0.188028 0.062507 0.039441 0.108645 0.789407 0.013983 0.004205 0.950545 0.031267 0.079914 0.001179 0.917273 0.001634 0.020076 0.000894 0.976846 0.002183 0.014515 0.171299 0.008415 0.805772 0.002054 0.003138 0.988103 0.006705 0.009034 0.000766 0.983239 0.006960 0.001091 0.112115 0.052053 0.834741 0.002232 0.966087 0.007405 0.024276 0.381054 0.501679 0.086215 0.031052 0.356595 0.115165 0.194267 0.333973 0.272578 0.328963 0.125402 0.273057 0.113254 0.373285 0.287554 0.225908 0.093063 0.332315 0.228621 0.346002 0.507753 0.163633 0.138507 0.190108 0.137831 0.394177 0.118922 0.349070 Consensus sequence: DBCDWHCTGGGTGGTCMDHBBAH Alignment: DTVBDDRGACCACCCAGDWDGBH ---CAAAGTCCAGC--------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00047 Zbtb7b_secondary Reverse Complement Reverse Complement Backward 2 11 0.047455 Species: Mus musculus Original motif 0.203365 0.307129 0.203712 0.285795 0.306328 0.182359 0.203143 0.308170 0.220878 0.174035 0.265341 0.339746 0.475421 0.085294 0.281054 0.158231 0.395971 0.330114 0.260810 0.013104 0.001970 0.006366 0.962058 0.029606 0.907785 0.081900 0.001279 0.009036 0.008745 0.981422 0.002970 0.006863 0.006791 0.966163 0.017605 0.009441 0.894233 0.081139 0.004949 0.019679 0.007553 0.970771 0.004892 0.016783 0.016719 0.797465 0.011842 0.173974 0.415678 0.189952 0.165207 0.229163 0.092707 0.182206 0.346121 0.378967 0.175722 0.130498 0.215118 0.478662 0.365762 0.163282 0.315788 0.155168 0.214734 0.272805 0.243194 0.269267 Consensus sequence: BDDRVGACCACCHBDVB Reverse complement motif 0.214734 0.243194 0.272805 0.269267 0.155168 0.163282 0.315788 0.365762 0.478662 0.130498 0.215118 0.175722 0.378967 0.182206 0.346121 0.092707 0.229163 0.189952 0.165207 0.415678 0.016719 0.011842 0.797465 0.173974 0.007553 0.004892 0.970771 0.016783 0.019679 0.081139 0.004949 0.894233 0.006791 0.017605 0.966163 0.009441 0.008745 0.002970 0.981422 0.006863 0.009036 0.081900 0.001279 0.907785 0.001970 0.962058 0.006366 0.029606 0.013104 0.330114 0.260810 0.395971 0.158231 0.085294 0.281054 0.475421 0.339746 0.174035 0.265341 0.220878 0.308170 0.182359 0.203143 0.306328 0.203365 0.203712 0.307129 0.285795 Consensus sequence: BBDVHGGTGGTCBKDDB Alignment: BBDVHGGTGGTCBKDDB -----GCTGGACTTTG- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00416 Fli1 Reverse Complement Reverse Complement Forward 4 11 0.047526 Species: Mus musculus Original motif 0.306248 0.320757 0.227284 0.145711 0.154859 0.254523 0.255295 0.335323 0.131261 0.300255 0.356247 0.212237 0.349545 0.222549 0.254062 0.173844 0.736280 0.006475 0.242691 0.014555 0.001696 0.522360 0.010544 0.465399 0.082657 0.000819 0.004666 0.911858 0.007818 0.001869 0.001302 0.989011 0.002303 0.992768 0.002361 0.002568 0.002417 0.992259 0.003375 0.001949 0.000360 0.004820 0.907484 0.087336 0.004749 0.022225 0.959164 0.013862 0.197948 0.147167 0.034749 0.620136 0.340568 0.182434 0.187068 0.289930 0.240105 0.146975 0.344334 0.268587 0.189372 0.384338 0.143385 0.282906 Consensus sequence: VBBVAYTTCCGGTDDH Reverse complement motif 0.189372 0.143385 0.384338 0.282906 0.240105 0.344334 0.146975 0.268587 0.289930 0.182434 0.187068 0.340568 0.620136 0.147167 0.034749 0.197948 0.004749 0.959164 0.022225 0.013862 0.000360 0.907484 0.004820 0.087336 0.002417 0.003375 0.992259 0.001949 0.002303 0.002361 0.992768 0.002568 0.989011 0.001869 0.001302 0.007818 0.911858 0.000819 0.004666 0.082657 0.001696 0.010544 0.522360 0.465399 0.014555 0.006475 0.242691 0.736280 0.173844 0.222549 0.254062 0.349545 0.131261 0.356247 0.300255 0.212237 0.335323 0.254523 0.255295 0.154859 0.306248 0.227284 0.320757 0.145711 Consensus sequence: DHDACCGGAAKTBBVV Alignment: DHDACCGGAAKTBBVV ---GCTGGACTTTG-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v016060_primary Original Motif Original Motif Forward 5 11 0.047631 Species: Mus musculus Original motif 0.180868 0.321661 0.134642 0.362829 0.232215 0.134289 0.315356 0.318141 0.065068 0.093681 0.569842 0.271408 0.370822 0.229680 0.154738 0.244759 0.323039 0.182873 0.173588 0.320500 0.175039 0.266898 0.276080 0.281984 0.412669 0.147730 0.146326 0.293275 0.325953 0.028805 0.629596 0.015646 0.003017 0.001766 0.979711 0.015507 0.888973 0.040666 0.069420 0.000941 0.017309 0.979155 0.000899 0.002637 0.001732 0.988816 0.004856 0.004596 0.889763 0.078125 0.010384 0.021729 0.007566 0.987081 0.001421 0.003932 0.027797 0.966593 0.000878 0.004731 0.025816 0.867003 0.065749 0.041433 0.220658 0.075256 0.582904 0.121182 0.088946 0.283695 0.565345 0.062015 0.328012 0.241332 0.305901 0.124755 0.307302 0.137589 0.375928 0.179181 0.298752 0.231470 0.315255 0.154524 0.094565 0.142901 0.705696 0.056838 Consensus sequence: HDGHHBHRGACCACCCGSVDVG Reverse complement motif 0.094565 0.705696 0.142901 0.056838 0.298752 0.315255 0.231470 0.154524 0.307302 0.375928 0.137589 0.179181 0.124755 0.241332 0.305901 0.328012 0.088946 0.565345 0.283695 0.062015 0.220658 0.582904 0.075256 0.121182 0.025816 0.065749 0.867003 0.041433 0.027797 0.000878 0.966593 0.004731 0.007566 0.001421 0.987081 0.003932 0.021729 0.078125 0.010384 0.889763 0.001732 0.004856 0.988816 0.004596 0.017309 0.000899 0.979155 0.002637 0.000941 0.040666 0.069420 0.888973 0.003017 0.979711 0.001766 0.015507 0.325953 0.629596 0.028805 0.015646 0.293275 0.147730 0.146326 0.412669 0.281984 0.266898 0.276080 0.175039 0.320500 0.182873 0.173588 0.323039 0.244759 0.229680 0.154738 0.370822 0.065068 0.569842 0.093681 0.271408 0.318141 0.134289 0.315356 0.232215 0.362829 0.321661 0.134642 0.180868 Consensus sequence: CVHBSCGGGTGGTCMHVHHCDH Alignment: HDGHHBHRGACCACCCGSVDVG ----CAAAGTCCAGC------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v015681_primary Original Motif Original Motif Forward 5 11 0.049240 Species: Mus musculus Original motif 0.641428 0.180211 0.044767 0.133594 0.171696 0.262981 0.334148 0.231174 0.129726 0.322735 0.243462 0.304077 0.165713 0.175735 0.256108 0.402445 0.146090 0.171890 0.412753 0.269266 0.212837 0.439192 0.280990 0.066980 0.251088 0.275516 0.374380 0.099015 0.575438 0.079656 0.338201 0.006704 0.005634 0.003422 0.972597 0.018348 0.890447 0.077034 0.031851 0.000668 0.007128 0.986862 0.000496 0.005515 0.001445 0.991564 0.001925 0.005066 0.738761 0.190157 0.026399 0.044684 0.013384 0.983783 0.000896 0.001937 0.068077 0.929549 0.000773 0.001602 0.040830 0.933742 0.005283 0.020145 0.730274 0.029225 0.145689 0.094812 0.165032 0.572838 0.162001 0.100129 0.383584 0.129942 0.429497 0.056977 0.455959 0.071959 0.208204 0.263878 0.134271 0.262985 0.222626 0.380117 0.071193 0.346594 0.346081 0.236132 0.445661 0.405278 0.053901 0.095160 Consensus sequence: ABBBBVVRGACCACCCACRDBBM Reverse complement motif 0.095160 0.405278 0.053901 0.445661 0.071193 0.346081 0.346594 0.236132 0.380117 0.262985 0.222626 0.134271 0.263878 0.071959 0.208204 0.455959 0.383584 0.429497 0.129942 0.056977 0.165032 0.162001 0.572838 0.100129 0.094812 0.029225 0.145689 0.730274 0.040830 0.005283 0.933742 0.020145 0.068077 0.000773 0.929549 0.001602 0.013384 0.000896 0.983783 0.001937 0.044684 0.190157 0.026399 0.738761 0.001445 0.001925 0.991564 0.005066 0.007128 0.000496 0.986862 0.005515 0.000668 0.077034 0.031851 0.890447 0.005634 0.972597 0.003422 0.018348 0.006704 0.079656 0.338201 0.575438 0.251088 0.374380 0.275516 0.099015 0.212837 0.280990 0.439192 0.066980 0.146090 0.412753 0.171890 0.269266 0.402445 0.175735 0.256108 0.165713 0.129726 0.243462 0.322735 0.304077 0.171696 0.334148 0.262981 0.231174 0.133594 0.180211 0.044767 0.641428 Consensus sequence: YBVDMGTGGGTGGTCKVVBVBBT Alignment: ABBBBVVRGACCACCCACRDBBM ----CAAAGTCCAGC-------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 19 Motif name: Motif 19 Original motif 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 Consensus sequence: AGAGAAAG Reserve complement motif 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 Consensus sequence: CTTTCTCT ************************************************************************ Best Matches for Motif ID 19 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00101 Sox12_secondary Original Motif Original Motif Backward 5 8 0.000000 Species: Mus musculus Original motif 0.378898 0.318901 0.205859 0.096341 0.352524 0.321236 0.224504 0.101736 0.323551 0.182056 0.210897 0.283496 0.135539 0.325230 0.208031 0.331200 0.663106 0.055471 0.154459 0.126963 0.051748 0.292567 0.537307 0.118378 0.886489 0.042361 0.035742 0.035408 0.043647 0.688744 0.094358 0.173252 0.882052 0.039818 0.018899 0.059231 0.864171 0.036011 0.068363 0.031455 0.790158 0.046868 0.041594 0.121379 0.087447 0.143905 0.707798 0.060849 0.295919 0.132479 0.485703 0.085899 0.653156 0.133004 0.110012 0.103828 0.351764 0.131771 0.217730 0.298736 0.203977 0.196773 0.099958 0.499292 Consensus sequence: VVDBASACAAAGRADH Reverse complement motif 0.499292 0.196773 0.099958 0.203977 0.298736 0.131771 0.217730 0.351764 0.103828 0.133004 0.110012 0.653156 0.295919 0.485703 0.132479 0.085899 0.087447 0.707798 0.143905 0.060849 0.121379 0.046868 0.041594 0.790158 0.031455 0.036011 0.068363 0.864171 0.059231 0.039818 0.018899 0.882052 0.043647 0.094358 0.688744 0.173252 0.035408 0.042361 0.035742 0.886489 0.051748 0.537307 0.292567 0.118378 0.126963 0.055471 0.154459 0.663106 0.331200 0.325230 0.208031 0.135539 0.283496 0.182056 0.210897 0.323551 0.101736 0.321236 0.224504 0.352524 0.096341 0.318901 0.205859 0.378898 Consensus sequence: HDTMCTTTGTSTVDBB Alignment: VVDBASACAAAGRADH ----AGAGAAAG---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00419 Spic Original Motif Original Motif Backward 4 8 0.002185 Species: Mus musculus Original motif 0.372554 0.181557 0.296001 0.149888 0.734552 0.057250 0.044752 0.163446 0.707604 0.045049 0.110341 0.137006 0.637848 0.057252 0.071934 0.232966 0.125449 0.108933 0.689441 0.076176 0.266215 0.517339 0.207018 0.009428 0.015016 0.002582 0.979670 0.002732 0.004303 0.002322 0.989973 0.003401 0.982327 0.003552 0.003393 0.010727 0.974155 0.001662 0.003294 0.020889 0.040023 0.128522 0.821560 0.009894 0.027635 0.045828 0.016297 0.910239 0.317500 0.045635 0.172234 0.464631 0.342838 0.107812 0.284775 0.264576 Consensus sequence: VAAAGMGGAAGTWD Reverse complement motif 0.264576 0.107812 0.284775 0.342838 0.464631 0.045635 0.172234 0.317500 0.910239 0.045828 0.016297 0.027635 0.040023 0.821560 0.128522 0.009894 0.020889 0.001662 0.003294 0.974155 0.010727 0.003552 0.003393 0.982327 0.004303 0.989973 0.002322 0.003401 0.015016 0.979670 0.002582 0.002732 0.266215 0.207018 0.517339 0.009428 0.125449 0.689441 0.108933 0.076176 0.232966 0.057252 0.071934 0.637848 0.137006 0.045049 0.110341 0.707604 0.163446 0.057250 0.044752 0.734552 0.149888 0.181557 0.296001 0.372554 Consensus sequence: DWACTTCCRCTTTB Alignment: VAAAGMGGAAGTWD ---AGAGAAAG--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00074 Isgf3g_primary Reverse Complement Reverse Complement Forward 4 8 0.013036 Species: Mus musculus Original motif 0.276786 0.305435 0.213026 0.204753 0.396362 0.114731 0.248667 0.240240 0.461284 0.092047 0.334734 0.111936 0.775091 0.019703 0.057075 0.148131 0.860742 0.032827 0.020878 0.085553 0.318035 0.134940 0.114054 0.432971 0.031989 0.819436 0.031529 0.117045 0.038741 0.005309 0.945956 0.009995 0.961581 0.018494 0.013401 0.006524 0.943392 0.004223 0.007869 0.044516 0.964748 0.010789 0.003727 0.020735 0.029401 0.875794 0.079869 0.014937 0.034572 0.294928 0.012201 0.658299 0.370121 0.165750 0.227886 0.236243 0.803710 0.072510 0.054519 0.069261 Consensus sequence: VDRAAWCGAAACTDA Reverse complement motif 0.069261 0.072510 0.054519 0.803710 0.236243 0.165750 0.227886 0.370121 0.658299 0.294928 0.012201 0.034572 0.029401 0.079869 0.875794 0.014937 0.020735 0.010789 0.003727 0.964748 0.044516 0.004223 0.007869 0.943392 0.006524 0.018494 0.013401 0.961581 0.038741 0.945956 0.005309 0.009995 0.031989 0.031529 0.819436 0.117045 0.432971 0.134940 0.114054 0.318035 0.085553 0.032827 0.020878 0.860742 0.148131 0.019703 0.057075 0.775091 0.111936 0.092047 0.334734 0.461284 0.240240 0.114731 0.248667 0.396362 0.276786 0.213026 0.305435 0.204753 Consensus sequence: TDAGTTTCGWTTKDV Alignment: TDAGTTTCGWTTKDV ---CTTTCTCT---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00085 Sfpi1_primary Original Motif Original Motif Forward 4 8 0.013531 Species: Mus musculus Original motif 0.211586 0.273653 0.234763 0.279998 0.298032 0.104818 0.290385 0.306764 0.593467 0.048056 0.154602 0.203875 0.459746 0.052697 0.169949 0.317608 0.188623 0.155357 0.591543 0.064477 0.402746 0.286227 0.290285 0.020742 0.048569 0.001240 0.946397 0.003793 0.004354 0.001387 0.990819 0.003441 0.974272 0.001416 0.001466 0.022847 0.938748 0.003090 0.000833 0.057329 0.045831 0.270321 0.674644 0.009204 0.055664 0.092552 0.026061 0.825722 0.301235 0.122653 0.267039 0.309073 0.278680 0.276099 0.219159 0.226061 Consensus sequence: BDAWGVGGAAGTDH Reverse complement motif 0.226061 0.276099 0.219159 0.278680 0.309073 0.122653 0.267039 0.301235 0.825722 0.092552 0.026061 0.055664 0.045831 0.674644 0.270321 0.009204 0.057329 0.003090 0.000833 0.938748 0.022847 0.001416 0.001466 0.974272 0.004354 0.990819 0.001387 0.003441 0.048569 0.946397 0.001240 0.003793 0.020742 0.286227 0.290285 0.402746 0.188623 0.591543 0.155357 0.064477 0.317608 0.052697 0.169949 0.459746 0.203875 0.048056 0.154602 0.593467 0.306764 0.104818 0.290385 0.298032 0.279998 0.273653 0.234763 0.211586 Consensus sequence: HDACTTCCBCWTDV Alignment: BDAWGVGGAAGTDH ---AGAGAAAG--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00018 Irf4_primary Reverse Complement Reverse Complement Forward 5 8 0.015051 Species: Mus musculus Original motif 0.302723 0.390309 0.162248 0.144720 0.263298 0.109753 0.466266 0.160683 0.314007 0.079943 0.170722 0.435328 0.657943 0.042407 0.054822 0.244828 0.175125 0.281452 0.069422 0.474000 0.014866 0.891988 0.005489 0.087657 0.012252 0.001771 0.982933 0.003044 0.985642 0.006248 0.005379 0.002731 0.933526 0.002109 0.003143 0.061222 0.988146 0.003436 0.001669 0.006749 0.021771 0.945675 0.026522 0.006032 0.029305 0.568908 0.017908 0.383879 0.396869 0.133807 0.324146 0.145178 0.326865 0.278882 0.198196 0.196056 0.506287 0.142988 0.165503 0.185222 Consensus sequence: VDDAYCGAAACYDVA Reverse complement motif 0.185222 0.142988 0.165503 0.506287 0.196056 0.278882 0.198196 0.326865 0.145178 0.133807 0.324146 0.396869 0.029305 0.017908 0.568908 0.383879 0.021771 0.026522 0.945675 0.006032 0.006749 0.003436 0.001669 0.988146 0.061222 0.002109 0.003143 0.933526 0.002731 0.006248 0.005379 0.985642 0.012252 0.982933 0.001771 0.003044 0.014866 0.005489 0.891988 0.087657 0.474000 0.281452 0.069422 0.175125 0.244828 0.042407 0.054822 0.657943 0.435328 0.079943 0.170722 0.314007 0.263298 0.466266 0.109753 0.160683 0.302723 0.162248 0.390309 0.144720 Consensus sequence: TBDKGTTTCGMTDHV Alignment: TBDKGTTTCGMTDHV ----CTTTCTCT--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00409 Elf5 Original Motif Original Motif Backward 4 8 0.015365 Species: Mus musculus Original motif 0.179167 0.229135 0.279326 0.312372 0.421239 0.102900 0.145609 0.330252 0.791978 0.009721 0.028951 0.169350 0.237609 0.375543 0.161526 0.225321 0.145845 0.325411 0.516045 0.012699 0.431007 0.516333 0.051679 0.000982 0.005750 0.001408 0.990928 0.001915 0.002025 0.001886 0.992021 0.004068 0.986405 0.001705 0.001039 0.010851 0.950652 0.003619 0.000482 0.045248 0.165221 0.013897 0.819076 0.001805 0.032042 0.049374 0.014632 0.903953 0.285325 0.108010 0.127373 0.479292 0.366131 0.141246 0.290661 0.201963 Consensus sequence: BWAHSMGGAAGTWD Reverse complement motif 0.201963 0.141246 0.290661 0.366131 0.479292 0.108010 0.127373 0.285325 0.903953 0.049374 0.014632 0.032042 0.165221 0.819076 0.013897 0.001805 0.045248 0.003619 0.000482 0.950652 0.010851 0.001705 0.001039 0.986405 0.002025 0.992021 0.001886 0.004068 0.005750 0.990928 0.001408 0.001915 0.431007 0.051679 0.516333 0.000982 0.145845 0.516045 0.325411 0.012699 0.237609 0.161526 0.375543 0.225321 0.169350 0.009721 0.028951 0.791978 0.330252 0.102900 0.145609 0.421239 0.312372 0.229135 0.279326 0.179167 Consensus sequence: DWACTTCCRSDTWV Alignment: BWAHSMGGAAGTWD ---AGAGAAAG--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00032 Gata3_primary Original Motif Original Motif Forward 8 8 0.017738 Species: Mus musculus Original motif 0.151572 0.262753 0.258275 0.327401 0.221834 0.113385 0.275380 0.389400 0.297769 0.136928 0.134678 0.430625 0.270099 0.110415 0.271106 0.348380 0.265471 0.090253 0.223340 0.420936 0.616582 0.090091 0.171960 0.121367 0.197318 0.107541 0.406904 0.288237 0.798258 0.046950 0.001406 0.153385 0.003195 0.002516 0.989707 0.004582 0.991503 0.002748 0.002617 0.003132 0.005015 0.002764 0.003026 0.989195 0.948394 0.008932 0.001344 0.041330 0.973109 0.004100 0.004081 0.018710 0.040365 0.113905 0.828185 0.017545 0.736608 0.130524 0.113464 0.019404 0.415921 0.106101 0.316613 0.161365 0.376582 0.170927 0.155572 0.296919 0.137731 0.197151 0.211055 0.454064 0.324853 0.122747 0.246107 0.306293 0.462490 0.207311 0.159392 0.170807 0.380420 0.188972 0.311990 0.118618 0.222178 0.157873 0.380486 0.239463 Consensus sequence: BDHDDADAGATAAGADHBDHVD Reverse complement motif 0.222178 0.380486 0.157873 0.239463 0.118618 0.188972 0.311990 0.380420 0.170807 0.207311 0.159392 0.462490 0.306293 0.122747 0.246107 0.324853 0.454064 0.197151 0.211055 0.137731 0.296919 0.170927 0.155572 0.376582 0.161365 0.106101 0.316613 0.415921 0.019404 0.130524 0.113464 0.736608 0.040365 0.828185 0.113905 0.017545 0.018710 0.004100 0.004081 0.973109 0.041330 0.008932 0.001344 0.948394 0.989195 0.002764 0.003026 0.005015 0.003132 0.002748 0.002617 0.991503 0.003195 0.989707 0.002516 0.004582 0.153385 0.046950 0.001406 0.798258 0.197318 0.406904 0.107541 0.288237 0.121367 0.090091 0.171960 0.616582 0.420936 0.090253 0.223340 0.265471 0.348380 0.110415 0.271106 0.270099 0.430625 0.136928 0.134678 0.297769 0.389400 0.113385 0.275380 0.221834 0.327401 0.262753 0.258275 0.151572 Consensus sequence: HBHDVHDTCTTATCTHTDDHDV Alignment: BDHDDADAGATAAGADHBDHVD -------AGAGAAAG------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00062 Sox4_primary Original Motif Original Motif Backward 6 8 0.017774 Species: Mus musculus Original motif 0.427843 0.231210 0.119424 0.221523 0.196506 0.239531 0.304906 0.259057 0.302488 0.156922 0.290190 0.250401 0.433872 0.149126 0.196496 0.220506 0.258426 0.076511 0.475100 0.189963 0.841714 0.046453 0.099915 0.011918 0.983853 0.001612 0.001362 0.013174 0.003460 0.982032 0.005728 0.008780 0.989743 0.002253 0.002020 0.005984 0.990761 0.003397 0.002843 0.003000 0.770864 0.003540 0.001549 0.224048 0.235342 0.002598 0.757383 0.004677 0.371426 0.089574 0.529959 0.009040 0.480804 0.196949 0.240413 0.081833 0.187158 0.355102 0.216599 0.241142 0.248006 0.232182 0.157452 0.362360 0.403367 0.177684 0.164649 0.254300 Consensus sequence: HBDDDAACAAAGRVBHH Reverse complement motif 0.254300 0.177684 0.164649 0.403367 0.362360 0.232182 0.157452 0.248006 0.187158 0.216599 0.355102 0.241142 0.081833 0.196949 0.240413 0.480804 0.371426 0.529959 0.089574 0.009040 0.235342 0.757383 0.002598 0.004677 0.224048 0.003540 0.001549 0.770864 0.003000 0.003397 0.002843 0.990761 0.005984 0.002253 0.002020 0.989743 0.003460 0.005728 0.982032 0.008780 0.013174 0.001612 0.001362 0.983853 0.011918 0.046453 0.099915 0.841714 0.258426 0.475100 0.076511 0.189963 0.220506 0.149126 0.196496 0.433872 0.250401 0.156922 0.290190 0.302488 0.196506 0.304906 0.239531 0.259057 0.221523 0.231210 0.119424 0.427843 Consensus sequence: HHBBMCTTTGTTHDDBH Alignment: HBDDDAACAAAGRVBHH ----AGAGAAAG----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00030 Sox11_primary Original Motif Original Motif Backward 6 8 0.019138 Species: Mus musculus Original motif 0.351812 0.238467 0.143954 0.265768 0.195246 0.235838 0.281473 0.287443 0.349478 0.172616 0.210739 0.267167 0.484061 0.110438 0.173131 0.232370 0.276692 0.070713 0.479604 0.172991 0.859124 0.044167 0.083951 0.012758 0.975608 0.002029 0.002285 0.020079 0.006422 0.978485 0.007124 0.007969 0.987489 0.003025 0.002868 0.006617 0.987739 0.005463 0.002730 0.004067 0.693013 0.004067 0.002445 0.300475 0.189100 0.003677 0.801408 0.005814 0.352090 0.072517 0.567737 0.007656 0.542316 0.176545 0.192768 0.088371 0.196382 0.304176 0.205985 0.293457 0.289415 0.201358 0.182937 0.326290 0.385801 0.216362 0.152363 0.245475 Consensus sequence: HBDDRAACAAAGRABHH Reverse complement motif 0.245475 0.216362 0.152363 0.385801 0.326290 0.201358 0.182937 0.289415 0.196382 0.205985 0.304176 0.293457 0.088371 0.176545 0.192768 0.542316 0.352090 0.567737 0.072517 0.007656 0.189100 0.801408 0.003677 0.005814 0.300475 0.004067 0.002445 0.693013 0.004067 0.005463 0.002730 0.987739 0.006617 0.003025 0.002868 0.987489 0.006422 0.007124 0.978485 0.007969 0.020079 0.002029 0.002285 0.975608 0.012758 0.044167 0.083951 0.859124 0.276692 0.479604 0.070713 0.172991 0.232370 0.110438 0.173131 0.484061 0.267167 0.172616 0.210739 0.349478 0.287443 0.235838 0.281473 0.195246 0.265768 0.238467 0.143954 0.351812 Consensus sequence: HHBTMCTTTGTTMDDVH Alignment: HBDDRAACAAAGRABHH ----AGAGAAAG----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00040 Irf5_primary Reverse Complement Reverse Complement Backward 5 8 0.020254 Species: Mus musculus Original motif 0.337548 0.193688 0.194039 0.274725 0.279950 0.185928 0.199501 0.334621 0.357304 0.160203 0.278768 0.203725 0.499782 0.069569 0.166858 0.263790 0.832538 0.022992 0.085287 0.059183 0.144788 0.434769 0.040595 0.379848 0.016035 0.943520 0.003379 0.037067 0.014208 0.001713 0.982579 0.001500 0.985572 0.004274 0.008722 0.001432 0.894404 0.001440 0.007585 0.096571 0.991307 0.002706 0.001993 0.003994 0.011143 0.973529 0.013241 0.002087 0.016468 0.532173 0.009621 0.441739 0.462373 0.120288 0.237126 0.180213 0.392685 0.223865 0.229697 0.153753 Consensus sequence: DDDWAYCGAAACYDV Reverse complement motif 0.153753 0.223865 0.229697 0.392685 0.180213 0.120288 0.237126 0.462373 0.016468 0.009621 0.532173 0.441739 0.011143 0.013241 0.973529 0.002087 0.003994 0.002706 0.001993 0.991307 0.096571 0.001440 0.007585 0.894404 0.001432 0.004274 0.008722 0.985572 0.014208 0.982579 0.001713 0.001500 0.016035 0.003379 0.943520 0.037067 0.144788 0.040595 0.434769 0.379848 0.059183 0.022992 0.085287 0.832538 0.263790 0.069569 0.166858 0.499782 0.203725 0.160203 0.278768 0.357304 0.334621 0.185928 0.199501 0.279950 0.274725 0.193688 0.194039 0.337548 Consensus sequence: BDKGTTTCGKTWDDD Alignment: BDKGTTTCGKTWDDD ---CTTTCTCT---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 20 Motif name: Motif 20 Original motif 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 Consensus sequence: TCCTCCTGGAA Reserve complement motif 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 Consensus sequence: TTCCAGGAGGA ************************************************************************ Best Matches for Motif ID 20 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00050 Bhlhb2_secondary Reverse Complement Original Motif Backward 8 11 0.014251 Species: Mus musculus Original motif 0.120938 0.344851 0.124072 0.410138 0.220931 0.169844 0.422396 0.186829 0.127752 0.260812 0.103811 0.507625 0.140641 0.405473 0.287668 0.166218 0.296957 0.155579 0.301094 0.246370 0.219647 0.287193 0.154072 0.339087 0.049294 0.026059 0.121789 0.802859 0.520042 0.289284 0.173423 0.017251 0.049190 0.943472 0.004308 0.003030 0.902609 0.006767 0.074770 0.015854 0.003221 0.971329 0.005512 0.019937 0.019937 0.005512 0.971329 0.003221 0.015854 0.074770 0.006767 0.902609 0.003030 0.004308 0.943472 0.049190 0.003497 0.088920 0.685942 0.221641 0.802859 0.121789 0.026059 0.049294 0.334544 0.155170 0.275193 0.235092 0.275957 0.132104 0.454982 0.136957 0.134097 0.254352 0.422940 0.188611 0.396163 0.432784 0.051281 0.119772 0.276474 0.115627 0.419844 0.188056 0.160759 0.088061 0.649863 0.101318 0.203314 0.166595 0.106821 0.523270 Consensus sequence: YDYBDHTMCACGTGGADDBMDGT Reverse complement motif 0.523270 0.166595 0.106821 0.203314 0.160759 0.649863 0.088061 0.101318 0.276474 0.419844 0.115627 0.188056 0.396163 0.051281 0.432784 0.119772 0.134097 0.422940 0.254352 0.188611 0.275957 0.454982 0.132104 0.136957 0.235092 0.155170 0.275193 0.334544 0.049294 0.121789 0.026059 0.802859 0.003497 0.685942 0.088920 0.221641 0.003030 0.943472 0.004308 0.049190 0.902609 0.074770 0.006767 0.015854 0.019937 0.971329 0.005512 0.003221 0.003221 0.005512 0.971329 0.019937 0.015854 0.006767 0.074770 0.902609 0.049190 0.004308 0.943472 0.003030 0.017251 0.289284 0.173423 0.520042 0.802859 0.026059 0.121789 0.049294 0.339087 0.287193 0.154072 0.219647 0.296957 0.301094 0.155579 0.246370 0.140641 0.287668 0.405473 0.166218 0.507625 0.260812 0.103811 0.127752 0.220931 0.422396 0.169844 0.186829 0.410138 0.344851 0.124072 0.120938 Consensus sequence: ACHRBHDTCCACGTGYAHHBMHM Alignment: YDYBDHTMCACGTGGADDBMDGT -----TTCCAGGAGGA------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00043 Bcl6b_primary Original Motif Reverse Complement Forward 3 11 0.021979 Species: Mus musculus Original motif 0.346550 0.082299 0.202982 0.368169 0.169328 0.599178 0.046508 0.184986 0.085619 0.105820 0.059390 0.749172 0.128756 0.084682 0.076780 0.709782 0.032381 0.009923 0.016477 0.941220 0.013184 0.868651 0.009399 0.108766 0.018397 0.104497 0.450474 0.426632 0.800902 0.010911 0.015982 0.172205 0.141166 0.055397 0.762379 0.041059 0.073467 0.021239 0.811630 0.093665 0.878497 0.015031 0.044964 0.061509 0.875924 0.027013 0.013780 0.083283 0.205684 0.213313 0.040936 0.540067 0.244336 0.228277 0.168227 0.359160 0.208971 0.304437 0.148473 0.338119 0.201607 0.294079 0.334889 0.169425 Consensus sequence: DCTTTCKAGGAATHHV Reverse complement motif 0.201607 0.334889 0.294079 0.169425 0.338119 0.304437 0.148473 0.208971 0.359160 0.228277 0.168227 0.244336 0.540067 0.213313 0.040936 0.205684 0.083283 0.027013 0.013780 0.875924 0.061509 0.015031 0.044964 0.878497 0.073467 0.811630 0.021239 0.093665 0.141166 0.762379 0.055397 0.041059 0.172205 0.010911 0.015982 0.800902 0.018397 0.450474 0.104497 0.426632 0.013184 0.009399 0.868651 0.108766 0.941220 0.009923 0.016477 0.032381 0.709782 0.084682 0.076780 0.128756 0.749172 0.105820 0.059390 0.085619 0.169328 0.046508 0.599178 0.184986 0.368169 0.082299 0.202982 0.346550 Consensus sequence: VHHATTCCTYGAAAGD Alignment: VHHATTCCTYGAAAGD --TCCTCCTGGAA--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00102 Zic1_secondary Original Motif Reverse Complement Forward 3 11 0.022091 Species: Mus musculus Original motif 0.161683 0.405114 0.171743 0.261460 0.259478 0.357988 0.146793 0.235741 0.371334 0.026439 0.283598 0.318630 0.092229 0.883389 0.018758 0.005623 0.419591 0.169874 0.253266 0.157270 0.002985 0.976375 0.002722 0.017918 0.909381 0.021357 0.013299 0.055963 0.039418 0.007014 0.948302 0.005266 0.001711 0.845894 0.005756 0.146640 0.803792 0.003049 0.148687 0.044472 0.015314 0.017153 0.680239 0.287294 0.003793 0.011414 0.937403 0.047390 0.431916 0.266291 0.144154 0.157638 0.269331 0.239338 0.366817 0.124513 0.395873 0.103980 0.214796 0.285351 Consensus sequence: BHDCVCAGCAGGHVD Reverse complement motif 0.285351 0.103980 0.214796 0.395873 0.269331 0.366817 0.239338 0.124513 0.157638 0.266291 0.144154 0.431916 0.003793 0.937403 0.011414 0.047390 0.015314 0.680239 0.017153 0.287294 0.044472 0.003049 0.148687 0.803792 0.001711 0.005756 0.845894 0.146640 0.039418 0.948302 0.007014 0.005266 0.055963 0.021357 0.013299 0.909381 0.002985 0.002722 0.976375 0.017918 0.157270 0.169874 0.253266 0.419591 0.092229 0.018758 0.883389 0.005623 0.318630 0.026439 0.283598 0.371334 0.259478 0.146793 0.357988 0.235741 0.161683 0.171743 0.405114 0.261460 Consensus sequence: DVHCCTGCTGBGDDB Alignment: DVHCCTGCTGBGDDB --TCCTCCTGGAA-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00022 Zfp740_secondary Original Motif Original Motif Forward 5 11 0.024028 Species: Mus musculus Original motif 0.398967 0.071604 0.323957 0.205472 0.457709 0.058192 0.267218 0.216881 0.393346 0.032365 0.329533 0.244756 0.119528 0.091191 0.190078 0.599202 0.273933 0.123548 0.073075 0.529444 0.068935 0.812883 0.015245 0.102937 0.029664 0.907790 0.024804 0.037742 0.020725 0.933422 0.016796 0.029057 0.015086 0.948448 0.018030 0.018436 0.015628 0.884941 0.061172 0.038259 0.067508 0.744063 0.107305 0.081125 0.108097 0.140614 0.650174 0.101115 0.065696 0.247239 0.506149 0.180916 0.395005 0.077185 0.345914 0.181895 0.527081 0.093650 0.281853 0.097416 0.289378 0.245159 0.348803 0.116660 0.147136 0.260117 0.145993 0.446754 Consensus sequence: DDDTWCCCCCCGGDRVH Reverse complement motif 0.446754 0.260117 0.145993 0.147136 0.289378 0.348803 0.245159 0.116660 0.097416 0.093650 0.281853 0.527081 0.181895 0.077185 0.345914 0.395005 0.065696 0.506149 0.247239 0.180916 0.108097 0.650174 0.140614 0.101115 0.067508 0.107305 0.744063 0.081125 0.015628 0.061172 0.884941 0.038259 0.015086 0.018030 0.948448 0.018436 0.020725 0.016796 0.933422 0.029057 0.029664 0.024804 0.907790 0.037742 0.068935 0.015245 0.812883 0.102937 0.529444 0.123548 0.073075 0.273933 0.599202 0.091191 0.190078 0.119528 0.244756 0.032365 0.329533 0.393346 0.216881 0.058192 0.267218 0.457709 0.205472 0.071604 0.323957 0.398967 Consensus sequence: HVKDCCGGGGGGWADDD Alignment: DDDTWCCCCCCGGDRVH ----TCCTCCTGGAA-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00057 Zic2_secondary Original Motif Reverse Complement Backward 3 11 0.025516 Species: Mus musculus Original motif 0.201522 0.336845 0.183740 0.277892 0.238705 0.354378 0.165332 0.241585 0.350858 0.031427 0.308482 0.309233 0.104423 0.870794 0.018676 0.006107 0.313246 0.259944 0.277570 0.149241 0.003590 0.973377 0.002520 0.020513 0.899716 0.025489 0.015458 0.059336 0.049224 0.006415 0.938214 0.006147 0.002021 0.859631 0.007903 0.130445 0.772818 0.002659 0.187334 0.037190 0.008456 0.015170 0.594695 0.381679 0.004118 0.009188 0.961506 0.025188 0.367151 0.230955 0.204475 0.197419 0.267508 0.193660 0.430070 0.108762 0.444449 0.099127 0.212182 0.244241 Consensus sequence: HHDCVCAGCAKGVVD Reverse complement motif 0.244241 0.099127 0.212182 0.444449 0.267508 0.430070 0.193660 0.108762 0.197419 0.230955 0.204475 0.367151 0.004118 0.961506 0.009188 0.025188 0.008456 0.594695 0.015170 0.381679 0.037190 0.002659 0.187334 0.772818 0.002021 0.007903 0.859631 0.130445 0.049224 0.938214 0.006415 0.006147 0.059336 0.025489 0.015458 0.899716 0.003590 0.002520 0.973377 0.020513 0.149241 0.259944 0.277570 0.313246 0.104423 0.018676 0.870794 0.006107 0.309233 0.031427 0.308482 0.350858 0.238705 0.165332 0.354378 0.241585 0.201522 0.183740 0.336845 0.277892 Consensus sequence: DVBCYTGCTGBGDDD Alignment: DVBCYTGCTGBGDDD --TCCTCCTGGAA-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00420 Elk3 Reverse Complement Reverse Complement Forward 7 11 0.025883 Species: Mus musculus Original motif 0.418636 0.167911 0.195103 0.218350 0.246759 0.378552 0.216618 0.158071 0.170474 0.198507 0.329732 0.301287 0.153827 0.338948 0.166531 0.340694 0.680337 0.052303 0.181512 0.085848 0.019707 0.916463 0.055898 0.007932 0.087081 0.910099 0.002387 0.000433 0.007321 0.001499 0.990022 0.001157 0.002298 0.001866 0.993126 0.002710 0.982141 0.000524 0.001717 0.015617 0.903999 0.006376 0.001427 0.088198 0.079522 0.183730 0.730171 0.006577 0.009983 0.341624 0.056464 0.591929 0.329404 0.110758 0.301227 0.258611 0.263984 0.375830 0.189175 0.171012 0.415962 0.256170 0.174350 0.153518 0.208242 0.316512 0.281982 0.193264 Consensus sequence: DVBBACCGGAAGYDVVV Reverse complement motif 0.208242 0.281982 0.316512 0.193264 0.153518 0.256170 0.174350 0.415962 0.263984 0.189175 0.375830 0.171012 0.258611 0.110758 0.301227 0.329404 0.591929 0.341624 0.056464 0.009983 0.079522 0.730171 0.183730 0.006577 0.088198 0.006376 0.001427 0.903999 0.015617 0.000524 0.001717 0.982141 0.002298 0.993126 0.001866 0.002710 0.007321 0.990022 0.001499 0.001157 0.087081 0.002387 0.910099 0.000433 0.019707 0.055898 0.916463 0.007932 0.085848 0.052303 0.181512 0.680337 0.340694 0.338948 0.166531 0.153827 0.170474 0.329732 0.198507 0.301287 0.246759 0.216618 0.378552 0.158071 0.218350 0.167911 0.195103 0.418636 Consensus sequence: VBVDMCTTCCGGTVBVD Alignment: VBVDMCTTCCGGTVBVD ------TTCCAGGAGGA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00006 Zic3_secondary Original Motif Reverse Complement Backward 3 11 0.026127 Species: Mus musculus Original motif 0.225537 0.223459 0.280507 0.270498 0.332396 0.181810 0.207290 0.278505 0.309873 0.017922 0.386135 0.286070 0.101947 0.871607 0.020267 0.006179 0.541366 0.089100 0.242170 0.127364 0.003307 0.969997 0.002414 0.024283 0.903286 0.021590 0.015872 0.059253 0.039887 0.009732 0.945083 0.005298 0.001704 0.827209 0.006276 0.164810 0.723052 0.003102 0.221051 0.052795 0.011758 0.024398 0.560633 0.403211 0.003656 0.012952 0.939586 0.043807 0.477846 0.270399 0.113113 0.138642 0.225706 0.298505 0.258523 0.217266 0.365251 0.191780 0.197411 0.245557 Consensus sequence: DDDCACAGCAKGHVD Reverse complement motif 0.245557 0.191780 0.197411 0.365251 0.225706 0.258523 0.298505 0.217266 0.138642 0.270399 0.113113 0.477846 0.003656 0.939586 0.012952 0.043807 0.011758 0.560633 0.024398 0.403211 0.052795 0.003102 0.221051 0.723052 0.001704 0.006276 0.827209 0.164810 0.039887 0.945083 0.009732 0.005298 0.059253 0.021590 0.015872 0.903286 0.003307 0.002414 0.969997 0.024283 0.127364 0.089100 0.242170 0.541366 0.101947 0.020267 0.871607 0.006179 0.309873 0.386135 0.017922 0.286070 0.278505 0.181810 0.207290 0.332396 0.225537 0.280507 0.223459 0.270498 Consensus sequence: DVHCYTGCTGTGHDH Alignment: DVHCYTGCTGTGHDH --TCCTCCTGGAA-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00013 Gabpa_primary Reverse Complement Reverse Complement Backward 1 11 0.028019 Species: Mus musculus Original motif 0.347579 0.362501 0.122567 0.167353 0.291516 0.289483 0.243331 0.175670 0.444682 0.202283 0.117720 0.235315 0.286823 0.160493 0.154998 0.397686 0.777207 0.031168 0.138668 0.052958 0.020187 0.935458 0.041166 0.003190 0.044954 0.947416 0.006517 0.001112 0.004962 0.002315 0.991007 0.001716 0.002572 0.002766 0.992355 0.002307 0.989037 0.001723 0.001769 0.007471 0.898665 0.004213 0.001115 0.096007 0.219936 0.020606 0.754552 0.004906 0.021686 0.134459 0.014432 0.829423 0.197325 0.176901 0.362465 0.263309 0.245978 0.264865 0.197336 0.291821 0.323340 0.203013 0.195793 0.277854 0.279355 0.250354 0.250472 0.219819 Consensus sequence: HVHHACCGGAAGTDHHV Reverse complement motif 0.219819 0.250354 0.250472 0.279355 0.277854 0.203013 0.195793 0.323340 0.291821 0.264865 0.197336 0.245978 0.197325 0.362465 0.176901 0.263309 0.829423 0.134459 0.014432 0.021686 0.219936 0.754552 0.020606 0.004906 0.096007 0.004213 0.001115 0.898665 0.007471 0.001723 0.001769 0.989037 0.002572 0.992355 0.002766 0.002307 0.004962 0.991007 0.002315 0.001716 0.044954 0.006517 0.947416 0.001112 0.020187 0.041166 0.935458 0.003190 0.052958 0.031168 0.138668 0.777207 0.397686 0.160493 0.154998 0.286823 0.235315 0.202283 0.117720 0.444682 0.175670 0.289483 0.243331 0.291516 0.347579 0.122567 0.362501 0.167353 Consensus sequence: BHHHACTTCCGGTHHBD Alignment: BHHHACTTCCGGTHHBD ------TTCCAGGAGGA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00410 Elk1 Reverse Complement Reverse Complement Backward 1 11 0.029275 Species: Mus musculus Original motif 0.430685 0.247184 0.200279 0.121853 0.170474 0.344859 0.320328 0.164339 0.289040 0.209865 0.151683 0.349412 0.153609 0.191266 0.230615 0.424510 0.717152 0.035619 0.128912 0.118318 0.015844 0.931939 0.044019 0.008198 0.074710 0.923143 0.001579 0.000568 0.005662 0.001876 0.991367 0.001095 0.002915 0.001618 0.993221 0.002246 0.986317 0.000532 0.001970 0.011180 0.891841 0.003746 0.000912 0.103501 0.077493 0.231881 0.682573 0.008053 0.012287 0.247896 0.024535 0.715282 0.291287 0.134464 0.256360 0.317889 0.223530 0.285605 0.253558 0.237306 0.373509 0.307981 0.133817 0.184693 0.294043 0.208400 0.267829 0.229728 Consensus sequence: VVHBACCGGAAGTDBHD Reverse complement motif 0.229728 0.208400 0.267829 0.294043 0.184693 0.307981 0.133817 0.373509 0.223530 0.253558 0.285605 0.237306 0.317889 0.134464 0.256360 0.291287 0.715282 0.247896 0.024535 0.012287 0.077493 0.682573 0.231881 0.008053 0.103501 0.003746 0.000912 0.891841 0.011180 0.000532 0.001970 0.986317 0.002915 0.993221 0.001618 0.002246 0.005662 0.991367 0.001876 0.001095 0.074710 0.001579 0.923143 0.000568 0.015844 0.044019 0.931939 0.008198 0.118318 0.035619 0.128912 0.717152 0.424510 0.191266 0.230615 0.153609 0.349412 0.209865 0.151683 0.289040 0.170474 0.320328 0.344859 0.164339 0.121853 0.247184 0.200279 0.430685 Consensus sequence: DHBDACTTCCGGTVHVB Alignment: DHBDACTTCCGGTVHVB ------TTCCAGGAGGA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00183 Hoxa13 Original Motif Original Motif Forward 3 11 0.030718 Species: Mus musculus Original motif 0.349550 0.172903 0.163906 0.313641 0.315011 0.194211 0.195948 0.294830 0.368766 0.201805 0.178542 0.250887 0.145880 0.295376 0.295376 0.263368 0.015331 0.929453 0.054675 0.000540 0.001365 0.028771 0.001559 0.968304 0.010908 0.940311 0.000350 0.048431 0.197963 0.000370 0.796987 0.004680 0.001758 0.010551 0.000808 0.986883 0.926536 0.000378 0.002732 0.070353 0.969248 0.000662 0.000790 0.029301 0.981050 0.005733 0.000805 0.012411 0.621561 0.122585 0.047087 0.208767 0.297436 0.133532 0.093665 0.475368 0.178579 0.227666 0.232495 0.361260 0.234668 0.133863 0.220639 0.410829 Consensus sequence: HDHBCTCGTAAAAWBD Reverse complement motif 0.410829 0.133863 0.220639 0.234668 0.361260 0.227666 0.232495 0.178579 0.475368 0.133532 0.093665 0.297436 0.208767 0.122585 0.047087 0.621561 0.012411 0.005733 0.000805 0.981050 0.029301 0.000662 0.000790 0.969248 0.070353 0.000378 0.002732 0.926536 0.986883 0.010551 0.000808 0.001758 0.197963 0.796987 0.000370 0.004680 0.010908 0.000350 0.940311 0.048431 0.968304 0.028771 0.001559 0.001365 0.015331 0.054675 0.929453 0.000540 0.145880 0.295376 0.295376 0.263368 0.250887 0.201805 0.178542 0.368766 0.294830 0.194211 0.195948 0.315011 0.313641 0.172903 0.163906 0.349550 Consensus sequence: DVWTTTTACGAGBHDH Alignment: HDHBCTCGTAAAAWBD --TCCTCCTGGAA--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 21 Motif name: Motif 21 Original motif 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 Consensus sequence: CTGCTTTCCMAA Reserve complement motif 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.500000 0.000000 0.500000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 Consensus sequence: TTYGGAAAGCAG ************************************************************************ Best Matches for Motif ID 21 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00018 Irf4_primary Original Motif Reverse Complement Forward 2 12 0.032857 Species: Mus musculus Original motif 0.302723 0.390309 0.162248 0.144720 0.263298 0.109753 0.466266 0.160683 0.314007 0.079943 0.170722 0.435328 0.657943 0.042407 0.054822 0.244828 0.175125 0.281452 0.069422 0.474000 0.014866 0.891988 0.005489 0.087657 0.012252 0.001771 0.982933 0.003044 0.985642 0.006248 0.005379 0.002731 0.933526 0.002109 0.003143 0.061222 0.988146 0.003436 0.001669 0.006749 0.021771 0.945675 0.026522 0.006032 0.029305 0.568908 0.017908 0.383879 0.396869 0.133807 0.324146 0.145178 0.326865 0.278882 0.198196 0.196056 0.506287 0.142988 0.165503 0.185222 Consensus sequence: VDDAYCGAAACYDVA Reverse complement motif 0.185222 0.142988 0.165503 0.506287 0.196056 0.278882 0.198196 0.326865 0.145178 0.133807 0.324146 0.396869 0.029305 0.017908 0.568908 0.383879 0.021771 0.026522 0.945675 0.006032 0.006749 0.003436 0.001669 0.988146 0.061222 0.002109 0.003143 0.933526 0.002731 0.006248 0.005379 0.985642 0.012252 0.982933 0.001771 0.003044 0.014866 0.005489 0.891988 0.087657 0.474000 0.281452 0.069422 0.175125 0.244828 0.042407 0.054822 0.657943 0.435328 0.079943 0.170722 0.314007 0.263298 0.466266 0.109753 0.160683 0.302723 0.162248 0.390309 0.144720 Consensus sequence: TBDKGTTTCGMTDHV Alignment: TBDKGTTTCGMTDHV -CTGCTTTCCMAA-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00015 Ehf_secondary Reverse Complement Reverse Complement Forward 4 12 0.033930 Species: Mus musculus Original motif 0.307205 0.034440 0.106635 0.551720 0.363403 0.109044 0.178564 0.348988 0.296409 0.241179 0.359666 0.102746 0.239304 0.113815 0.274725 0.372156 0.742404 0.063158 0.121573 0.072864 0.160692 0.233592 0.260062 0.345653 0.073999 0.014007 0.012486 0.899508 0.074874 0.014298 0.009907 0.900921 0.022623 0.925966 0.008378 0.043033 0.027723 0.921907 0.020088 0.030282 0.029405 0.074965 0.595500 0.300130 0.776422 0.083024 0.041124 0.099429 0.270188 0.158044 0.134940 0.436827 0.070564 0.545506 0.345463 0.038467 0.316962 0.128938 0.151826 0.402274 0.327940 0.106122 0.104097 0.461841 Consensus sequence: WDVDABTTCCKAHSDW Reverse complement motif 0.461841 0.106122 0.104097 0.327940 0.402274 0.128938 0.151826 0.316962 0.070564 0.345463 0.545506 0.038467 0.436827 0.158044 0.134940 0.270188 0.099429 0.083024 0.041124 0.776422 0.029405 0.595500 0.074965 0.300130 0.027723 0.020088 0.921907 0.030282 0.022623 0.008378 0.925966 0.043033 0.900921 0.014298 0.009907 0.074874 0.899508 0.014007 0.012486 0.073999 0.345653 0.233592 0.260062 0.160692 0.072864 0.063158 0.121573 0.742404 0.372156 0.113815 0.274725 0.239304 0.296409 0.359666 0.241179 0.102746 0.348988 0.109044 0.178564 0.363403 0.551720 0.034440 0.106635 0.307205 Consensus sequence: WDSHTYGGAAVTDVDW Alignment: WDSHTYGGAAVTDVDW ---TTYGGAAAGCAG- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00045 Mafb_primary Reverse Complement Reverse Complement Forward 2 12 0.036261 Species: Mus musculus Original motif 0.420301 0.182299 0.161481 0.235919 0.593201 0.055751 0.202477 0.148571 0.653364 0.017008 0.054630 0.274998 0.339176 0.102943 0.050258 0.507622 0.171557 0.078698 0.267471 0.482273 0.044703 0.033212 0.003920 0.918165 0.010333 0.004451 0.972441 0.012775 0.034026 0.949298 0.004788 0.011889 0.016078 0.008878 0.004007 0.971037 0.020331 0.004077 0.929676 0.045916 0.975739 0.007450 0.005991 0.010819 0.012733 0.887375 0.018700 0.081192 0.259981 0.111885 0.243051 0.385083 0.327677 0.149969 0.094895 0.427459 0.541721 0.105923 0.242224 0.110132 0.258689 0.068305 0.493226 0.179779 0.306041 0.306854 0.168308 0.218798 Consensus sequence: HAAWDTGCTGACDWARH Reverse complement motif 0.306041 0.168308 0.306854 0.218798 0.258689 0.493226 0.068305 0.179779 0.110132 0.105923 0.242224 0.541721 0.427459 0.149969 0.094895 0.327677 0.385083 0.111885 0.243051 0.259981 0.012733 0.018700 0.887375 0.081192 0.010819 0.007450 0.005991 0.975739 0.020331 0.929676 0.004077 0.045916 0.971037 0.008878 0.004007 0.016078 0.034026 0.004788 0.949298 0.011889 0.010333 0.972441 0.004451 0.012775 0.918165 0.033212 0.003920 0.044703 0.482273 0.078698 0.267471 0.171557 0.507622 0.102943 0.050258 0.339176 0.274998 0.017008 0.054630 0.653364 0.148571 0.055751 0.202477 0.593201 0.235919 0.182299 0.161481 0.420301 Consensus sequence: DMTWDGTCAGCADWTTH Alignment: DMTWDGTCAGCADWTTH -TTYGGAAAGCAG---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00122 Tgif1 Original Motif Reverse Complement Backward 3 12 0.037318 Species: Mus musculus Original motif 0.272977 0.158875 0.284742 0.283406 0.550609 0.124110 0.169608 0.155673 0.114568 0.207160 0.282464 0.395807 0.560868 0.052907 0.053508 0.332716 0.336500 0.068048 0.114050 0.481403 0.007736 0.003722 0.000495 0.988048 0.004489 0.000729 0.992211 0.002571 0.956618 0.000414 0.000890 0.042078 0.004381 0.990925 0.000538 0.004156 0.982797 0.000366 0.015539 0.001298 0.016760 0.002980 0.969991 0.010269 0.036013 0.725983 0.200022 0.037982 0.064755 0.104386 0.133891 0.696968 0.199404 0.263520 0.410228 0.126848 0.222648 0.351390 0.272575 0.153387 0.087778 0.206043 0.395671 0.310507 0.319643 0.144216 0.196041 0.340100 Consensus sequence: DABWWTGACAGCTVVBD Reverse complement motif 0.340100 0.144216 0.196041 0.319643 0.087778 0.395671 0.206043 0.310507 0.222648 0.272575 0.351390 0.153387 0.199404 0.410228 0.263520 0.126848 0.696968 0.104386 0.133891 0.064755 0.036013 0.200022 0.725983 0.037982 0.016760 0.969991 0.002980 0.010269 0.001298 0.000366 0.015539 0.982797 0.004381 0.000538 0.990925 0.004156 0.042078 0.000414 0.000890 0.956618 0.004489 0.992211 0.000729 0.002571 0.988048 0.003722 0.000495 0.007736 0.481403 0.068048 0.114050 0.336500 0.332716 0.052907 0.053508 0.560868 0.395807 0.207160 0.282464 0.114568 0.155673 0.124110 0.169608 0.550609 0.272977 0.284742 0.158875 0.283406 Consensus sequence: DBVVAGCTGTCAWWVTH Alignment: DBVVAGCTGTCAWWVTH ---CTGCTTTCCMAA-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00258 Tgif2 Original Motif Original Motif Backward 2 12 0.038517 Species: Mus musculus Original motif 0.519684 0.141807 0.112153 0.226356 0.614097 0.079211 0.138045 0.168647 0.186975 0.327654 0.245051 0.240320 0.108289 0.303530 0.219106 0.369076 0.914812 0.012014 0.046628 0.026546 0.070482 0.163253 0.689315 0.076951 0.016354 0.972639 0.003648 0.007359 0.002043 0.018718 0.000384 0.978855 0.006109 0.001408 0.990736 0.001747 0.024783 0.002060 0.000402 0.972755 0.001485 0.991963 0.001756 0.004796 0.989335 0.001052 0.002320 0.007293 0.778804 0.056366 0.037632 0.127198 0.377980 0.094597 0.086888 0.440535 0.458125 0.289431 0.152762 0.099682 0.223103 0.435348 0.216962 0.124587 Consensus sequence: AABBAGCTGTCAAWVV Reverse complement motif 0.223103 0.216962 0.435348 0.124587 0.099682 0.289431 0.152762 0.458125 0.440535 0.094597 0.086888 0.377980 0.127198 0.056366 0.037632 0.778804 0.007293 0.001052 0.002320 0.989335 0.001485 0.001756 0.991963 0.004796 0.972755 0.002060 0.000402 0.024783 0.006109 0.990736 0.001408 0.001747 0.978855 0.018718 0.000384 0.002043 0.016354 0.003648 0.972639 0.007359 0.070482 0.689315 0.163253 0.076951 0.026546 0.012014 0.046628 0.914812 0.369076 0.303530 0.219106 0.108289 0.186975 0.245051 0.327654 0.240320 0.168647 0.079211 0.138045 0.614097 0.226356 0.141807 0.112153 0.519684 Consensus sequence: VBWTTGACAGCTVBTT Alignment: AABBAGCTGTCAAWVV ---CTGCTTTCCMAA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00148 Hdx Reverse Complement Original Motif Forward 2 12 0.039168 Species: Mus musculus Original motif 0.311640 0.203273 0.213311 0.271776 0.341055 0.177799 0.257310 0.223836 0.047573 0.089551 0.516163 0.346713 0.195776 0.119326 0.352322 0.332576 0.295379 0.306027 0.157574 0.241020 0.213770 0.018770 0.724927 0.042533 0.702123 0.228608 0.050137 0.019133 0.826735 0.011735 0.061646 0.099884 0.920071 0.005458 0.026253 0.048218 0.018655 0.024240 0.028915 0.928190 0.029929 0.896758 0.043300 0.030013 0.864548 0.044943 0.013744 0.076766 0.177175 0.216931 0.155519 0.450375 0.228403 0.325164 0.203649 0.242785 0.140135 0.298665 0.306153 0.255047 0.338324 0.345500 0.057864 0.258313 0.402538 0.228867 0.191777 0.176818 Consensus sequence: DDKDHGAAATCAHHBHV Reverse complement motif 0.176818 0.228867 0.191777 0.402538 0.338324 0.057864 0.345500 0.258313 0.140135 0.306153 0.298665 0.255047 0.228403 0.203649 0.325164 0.242785 0.450375 0.216931 0.155519 0.177175 0.076766 0.044943 0.013744 0.864548 0.029929 0.043300 0.896758 0.030013 0.928190 0.024240 0.028915 0.018655 0.048218 0.005458 0.026253 0.920071 0.099884 0.011735 0.061646 0.826735 0.019133 0.228608 0.050137 0.702123 0.213770 0.724927 0.018770 0.042533 0.295379 0.157574 0.306027 0.241020 0.195776 0.352322 0.119326 0.332576 0.047573 0.516163 0.089551 0.346713 0.223836 0.177799 0.257310 0.341055 0.271776 0.203273 0.213311 0.311640 Consensus sequence: BDBDHTGATTTCDHYDD Alignment: DDKDHGAAATCAHHBHV -TTYGGAAAGCAG---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00040 Irf5_primary Reverse Complement Original Motif Forward 4 12 0.040570 Species: Mus musculus Original motif 0.337548 0.193688 0.194039 0.274725 0.279950 0.185928 0.199501 0.334621 0.357304 0.160203 0.278768 0.203725 0.499782 0.069569 0.166858 0.263790 0.832538 0.022992 0.085287 0.059183 0.144788 0.434769 0.040595 0.379848 0.016035 0.943520 0.003379 0.037067 0.014208 0.001713 0.982579 0.001500 0.985572 0.004274 0.008722 0.001432 0.894404 0.001440 0.007585 0.096571 0.991307 0.002706 0.001993 0.003994 0.011143 0.973529 0.013241 0.002087 0.016468 0.532173 0.009621 0.441739 0.462373 0.120288 0.237126 0.180213 0.392685 0.223865 0.229697 0.153753 Consensus sequence: DDDWAYCGAAACYDV Reverse complement motif 0.153753 0.223865 0.229697 0.392685 0.180213 0.120288 0.237126 0.462373 0.016468 0.009621 0.532173 0.441739 0.011143 0.013241 0.973529 0.002087 0.003994 0.002706 0.001993 0.991307 0.096571 0.001440 0.007585 0.894404 0.001432 0.004274 0.008722 0.985572 0.014208 0.982579 0.001713 0.001500 0.016035 0.003379 0.943520 0.037067 0.144788 0.040595 0.434769 0.379848 0.059183 0.022992 0.085287 0.832538 0.263790 0.069569 0.166858 0.499782 0.203725 0.160203 0.278768 0.357304 0.334621 0.185928 0.199501 0.279950 0.274725 0.193688 0.194039 0.337548 Consensus sequence: BDKGTTTCGKTWDDD Alignment: DDDWAYCGAAACYDV ---TTYGGAAAGCAG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00192 Six1 Original Motif Reverse Complement Forward 5 12 0.041417 Species: Mus musculus Original motif 0.319306 0.130147 0.399309 0.151238 0.482636 0.211172 0.085871 0.220321 0.214292 0.085504 0.207353 0.492851 0.392819 0.136859 0.403883 0.066438 0.215886 0.049341 0.685932 0.048842 0.039793 0.053756 0.870240 0.036211 0.202525 0.005026 0.791396 0.001053 0.001092 0.001021 0.052968 0.944919 0.963185 0.001738 0.033596 0.001480 0.002017 0.001886 0.002847 0.993250 0.009914 0.974962 0.001987 0.013137 0.909252 0.021586 0.037899 0.031263 0.177851 0.274190 0.117998 0.429961 0.228906 0.159459 0.303955 0.307681 0.330938 0.158106 0.118706 0.392251 0.160453 0.267920 0.280244 0.291383 0.176707 0.068175 0.229538 0.525580 Consensus sequence: DHDRGGGTATCAHDHBT Reverse complement motif 0.525580 0.068175 0.229538 0.176707 0.291383 0.267920 0.280244 0.160453 0.392251 0.158106 0.118706 0.330938 0.307681 0.159459 0.303955 0.228906 0.429961 0.274190 0.117998 0.177851 0.031263 0.021586 0.037899 0.909252 0.009914 0.001987 0.974962 0.013137 0.993250 0.001886 0.002847 0.002017 0.001480 0.001738 0.033596 0.963185 0.944919 0.001021 0.052968 0.001092 0.202525 0.791396 0.005026 0.001053 0.039793 0.870240 0.053756 0.036211 0.215886 0.685932 0.049341 0.048842 0.392819 0.403883 0.136859 0.066438 0.492851 0.085504 0.207353 0.214292 0.220321 0.211172 0.085871 0.482636 0.319306 0.399309 0.130147 0.151238 Consensus sequence: AVHDHTGATACCCMDHH Alignment: AVHDHTGATACCCMDHH ----CTGCTTTCCMAA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00159 Six2 Original Motif Reverse Complement Forward 5 12 0.042052 Species: Mus musculus Original motif 0.452545 0.099192 0.290852 0.157411 0.587199 0.117373 0.086707 0.208721 0.191837 0.044362 0.256539 0.507262 0.299111 0.107464 0.518651 0.074774 0.118226 0.040974 0.797168 0.043631 0.010113 0.030311 0.923661 0.035916 0.126925 0.002828 0.869144 0.001103 0.001338 0.000719 0.046297 0.951646 0.958864 0.001525 0.038365 0.001246 0.003353 0.001741 0.001927 0.992979 0.007665 0.981087 0.001717 0.009531 0.903866 0.022768 0.054074 0.019292 0.165996 0.505327 0.077238 0.251439 0.252666 0.168847 0.288545 0.289942 0.336830 0.080857 0.058862 0.523451 0.234102 0.268721 0.215252 0.281925 0.172036 0.083695 0.223889 0.520379 Consensus sequence: DAKRGGGTATCACDWHT Reverse complement motif 0.520379 0.083695 0.223889 0.172036 0.281925 0.268721 0.215252 0.234102 0.523451 0.080857 0.058862 0.336830 0.289942 0.168847 0.288545 0.252666 0.165996 0.077238 0.505327 0.251439 0.019292 0.022768 0.054074 0.903866 0.007665 0.001717 0.981087 0.009531 0.992979 0.001741 0.001927 0.003353 0.001246 0.001525 0.038365 0.958864 0.951646 0.000719 0.046297 0.001338 0.126925 0.869144 0.002828 0.001103 0.010113 0.923661 0.030311 0.035916 0.118226 0.797168 0.040974 0.043631 0.299111 0.518651 0.107464 0.074774 0.507262 0.044362 0.256539 0.191837 0.208721 0.117373 0.086707 0.587199 0.157411 0.099192 0.290852 0.452545 Consensus sequence: AHWDGTGATACCCMRTD Alignment: AHWDGTGATACCCMRTD ----CTGCTTTCCMAA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00235 Hoxc11 Reverse Complement Original Motif Forward 5 12 0.042144 Species: Mus musculus Original motif 0.233269 0.248491 0.135443 0.382797 0.530699 0.117734 0.196458 0.155109 0.520162 0.128349 0.129047 0.222442 0.383288 0.142763 0.265367 0.208581 0.082604 0.036330 0.879729 0.001337 0.001490 0.025603 0.000959 0.971949 0.011271 0.977559 0.000430 0.010739 0.234170 0.001531 0.762912 0.001387 0.002139 0.001352 0.004590 0.991918 0.858371 0.001955 0.000717 0.138958 0.981016 0.000748 0.001915 0.016321 0.985345 0.003895 0.001793 0.008967 0.542364 0.130700 0.106606 0.220330 0.222953 0.268192 0.191329 0.317526 0.353019 0.168556 0.262332 0.216093 0.196584 0.119005 0.352701 0.331710 Consensus sequence: HAADGTCGTAAAAHDD Reverse complement motif 0.196584 0.352701 0.119005 0.331710 0.216093 0.168556 0.262332 0.353019 0.317526 0.268192 0.191329 0.222953 0.220330 0.130700 0.106606 0.542364 0.008967 0.003895 0.001793 0.985345 0.016321 0.000748 0.001915 0.981016 0.138958 0.001955 0.000717 0.858371 0.991918 0.001352 0.004590 0.002139 0.234170 0.762912 0.001531 0.001387 0.011271 0.000430 0.977559 0.010739 0.971949 0.025603 0.000959 0.001490 0.082604 0.879729 0.036330 0.001337 0.208581 0.142763 0.265367 0.383288 0.222442 0.128349 0.129047 0.520162 0.155109 0.117734 0.196458 0.530699 0.382797 0.248491 0.135443 0.233269 Consensus sequence: HDHTTTTACGACDTTH Alignment: HAADGTCGTAAAAHDD ----TTYGGAAAGCAG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 22 Motif name: Motif 22 Original motif 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 Consensus sequence: TTTATGGTGAGCAT Reserve complement motif 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 Consensus sequence: ATGCTCACCATAAA ************************************************************************ Best Matches for Motif ID 22 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00146 Pou6f1_3733.1 Reverse Complement Reverse Complement Forward 3 14 0.026920 Species: Mus musculus Original motif 0.380020 0.211224 0.295981 0.112776 0.349734 0.309602 0.075135 0.265530 0.356459 0.226592 0.169646 0.247302 0.229673 0.350174 0.311906 0.108247 0.757838 0.046686 0.016036 0.179440 0.014478 0.002669 0.000464 0.982389 0.984156 0.000563 0.002241 0.013039 0.992195 0.001470 0.001823 0.004511 0.001610 0.002156 0.003120 0.993114 0.008328 0.001327 0.802239 0.188106 0.990155 0.004149 0.002815 0.002881 0.004992 0.004117 0.965215 0.025676 0.091361 0.290495 0.533319 0.084826 0.164763 0.143217 0.028702 0.663317 0.164550 0.118473 0.276288 0.440689 0.152985 0.151847 0.413228 0.281941 0.241185 0.447249 0.135344 0.176222 Consensus sequence: VHHVATAATGAGSTDDH Reverse complement motif 0.241185 0.135344 0.447249 0.176222 0.152985 0.413228 0.151847 0.281941 0.440689 0.118473 0.276288 0.164550 0.663317 0.143217 0.028702 0.164763 0.091361 0.533319 0.290495 0.084826 0.004992 0.965215 0.004117 0.025676 0.002881 0.004149 0.002815 0.990155 0.008328 0.802239 0.001327 0.188106 0.993114 0.002156 0.003120 0.001610 0.004511 0.001470 0.001823 0.992195 0.013039 0.000563 0.002241 0.984156 0.982389 0.002669 0.000464 0.014478 0.179440 0.046686 0.016036 0.757838 0.229673 0.311906 0.350174 0.108247 0.247302 0.226592 0.169646 0.356459 0.265530 0.309602 0.075135 0.349734 0.112776 0.211224 0.295981 0.380020 Consensus sequence: DHDASCTCATTATVHHB Alignment: DHDASCTCATTATVHHB --ATGCTCACCATAAA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00528 Foxm1_secondary Original Motif Reverse Complement Backward 10 13 0.511393 Species: Mus musculus Original motif 0.399785 0.446658 0.111435 0.042122 0.535175 0.103991 0.089706 0.271128 0.078171 0.387987 0.375083 0.158759 0.309001 0.519142 0.070618 0.101239 0.201844 0.255818 0.323149 0.219190 0.534101 0.109845 0.235026 0.121028 0.656038 0.037473 0.261484 0.045006 0.315713 0.164290 0.471815 0.048182 0.651960 0.009412 0.328237 0.010391 0.937365 0.017313 0.007516 0.037807 0.019983 0.044238 0.012387 0.923392 0.061195 0.021485 0.881645 0.035675 0.017521 0.952998 0.013139 0.016342 0.254160 0.029735 0.493023 0.223082 0.239200 0.593324 0.114503 0.052973 0.610822 0.071539 0.099169 0.218470 0.166610 0.389712 0.204400 0.239278 0.227752 0.361626 0.178497 0.232125 0.537030 0.182466 0.026035 0.254470 0.235902 0.151006 0.043788 0.569304 0.081851 0.250397 0.590059 0.077693 0.340417 0.189613 0.272075 0.197895 Consensus sequence: MWSMBAARRATGCDCABHATGD Reverse complement motif 0.197895 0.189613 0.272075 0.340417 0.081851 0.590059 0.250397 0.077693 0.569304 0.151006 0.043788 0.235902 0.254470 0.182466 0.026035 0.537030 0.227752 0.178497 0.361626 0.232125 0.166610 0.204400 0.389712 0.239278 0.218470 0.071539 0.099169 0.610822 0.239200 0.114503 0.593324 0.052973 0.254160 0.493023 0.029735 0.223082 0.017521 0.013139 0.952998 0.016342 0.061195 0.881645 0.021485 0.035675 0.923392 0.044238 0.012387 0.019983 0.037807 0.017313 0.007516 0.937365 0.010391 0.009412 0.328237 0.651960 0.315713 0.471815 0.164290 0.048182 0.045006 0.037473 0.261484 0.656038 0.121028 0.109845 0.235026 0.534101 0.201844 0.323149 0.255818 0.219190 0.309001 0.070618 0.519142 0.101239 0.078171 0.375083 0.387987 0.158759 0.271128 0.103991 0.089706 0.535175 0.399785 0.111435 0.446658 0.042122 Consensus sequence: DCATDBTGHGCATKMTTBRSWR Alignment: -DCATDBTGHGCATKMTTBRSWR TTTATGGTGAGCAT--------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00045 Mafb_primary Reverse Complement Original Motif Forward 5 13 0.520342 Species: Mus musculus Original motif 0.420301 0.182299 0.161481 0.235919 0.593201 0.055751 0.202477 0.148571 0.653364 0.017008 0.054630 0.274998 0.339176 0.102943 0.050258 0.507622 0.171557 0.078698 0.267471 0.482273 0.044703 0.033212 0.003920 0.918165 0.010333 0.004451 0.972441 0.012775 0.034026 0.949298 0.004788 0.011889 0.016078 0.008878 0.004007 0.971037 0.020331 0.004077 0.929676 0.045916 0.975739 0.007450 0.005991 0.010819 0.012733 0.887375 0.018700 0.081192 0.259981 0.111885 0.243051 0.385083 0.327677 0.149969 0.094895 0.427459 0.541721 0.105923 0.242224 0.110132 0.258689 0.068305 0.493226 0.179779 0.306041 0.306854 0.168308 0.218798 Consensus sequence: HAAWDTGCTGACDWARH Reverse complement motif 0.306041 0.168308 0.306854 0.218798 0.258689 0.493226 0.068305 0.179779 0.110132 0.105923 0.242224 0.541721 0.427459 0.149969 0.094895 0.327677 0.385083 0.111885 0.243051 0.259981 0.012733 0.018700 0.887375 0.081192 0.010819 0.007450 0.005991 0.975739 0.020331 0.929676 0.004077 0.045916 0.971037 0.008878 0.004007 0.016078 0.034026 0.004788 0.949298 0.011889 0.010333 0.972441 0.004451 0.012775 0.918165 0.033212 0.003920 0.044703 0.482273 0.078698 0.267471 0.171557 0.507622 0.102943 0.050258 0.339176 0.274998 0.017008 0.054630 0.653364 0.148571 0.055751 0.202477 0.593201 0.235919 0.182299 0.161481 0.420301 Consensus sequence: DMTWDGTCAGCADWTTH Alignment: HAAWDTGCTGACDWARH- ----ATGCTCACCATAAA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00097 Mtf1_primary Original Motif Original Motif Forward 2 13 0.520462 Species: Mus musculus Original motif 0.220880 0.102939 0.418146 0.258035 0.154303 0.210788 0.420671 0.214238 0.229141 0.160788 0.412818 0.197253 0.167193 0.404248 0.092489 0.336070 0.025978 0.931335 0.023830 0.018857 0.009150 0.002023 0.977342 0.011485 0.044768 0.024113 0.039091 0.892028 0.007577 0.008370 0.973767 0.010286 0.005251 0.264996 0.004018 0.725735 0.009165 0.002428 0.980566 0.007841 0.021296 0.956027 0.008893 0.013784 0.982532 0.003341 0.005773 0.008353 0.500983 0.226027 0.143944 0.129045 0.544466 0.285936 0.044719 0.124879 0.321158 0.168428 0.261827 0.248587 0.271460 0.263221 0.199083 0.266236 Consensus sequence: DBDHCGTGTGCAAMDH Reverse complement motif 0.266236 0.263221 0.199083 0.271460 0.248587 0.168428 0.261827 0.321158 0.124879 0.285936 0.044719 0.544466 0.129045 0.226027 0.143944 0.500983 0.008353 0.003341 0.005773 0.982532 0.021296 0.008893 0.956027 0.013784 0.009165 0.980566 0.002428 0.007841 0.725735 0.264996 0.004018 0.005251 0.007577 0.973767 0.008370 0.010286 0.892028 0.024113 0.039091 0.044768 0.009150 0.977342 0.002023 0.011485 0.025978 0.023830 0.931335 0.018857 0.167193 0.092489 0.404248 0.336070 0.229141 0.412818 0.160788 0.197253 0.154303 0.420671 0.210788 0.214238 0.220880 0.418146 0.102939 0.258035 Consensus sequence: HDYTTGCACACGDHBH Alignment: DBDHCGTGTGCAAMDH- -TTTATGGTGAGCAT-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00035 Hic1_primary Original Motif Reverse Complement Backward 4 13 0.524109 Species: Mus musculus Original motif 0.275207 0.211375 0.250277 0.263141 0.135064 0.327571 0.217556 0.319808 0.145659 0.242586 0.267179 0.344576 0.656519 0.009712 0.315174 0.018595 0.002265 0.004755 0.001656 0.991325 0.041873 0.001128 0.955340 0.001659 0.001306 0.974834 0.022215 0.001645 0.001978 0.992066 0.002638 0.003317 0.921032 0.072388 0.001237 0.005344 0.582027 0.211694 0.115736 0.090542 0.005990 0.927450 0.028306 0.038254 0.027374 0.799879 0.053667 0.119080 0.203510 0.191263 0.168997 0.436229 0.402253 0.154087 0.291346 0.152314 0.201201 0.414412 0.145330 0.239056 0.241094 0.332661 0.143464 0.282781 Consensus sequence: DBBATGCCAACCHVHH Reverse complement motif 0.241094 0.143464 0.332661 0.282781 0.201201 0.145330 0.414412 0.239056 0.152314 0.154087 0.291346 0.402253 0.436229 0.191263 0.168997 0.203510 0.027374 0.053667 0.799879 0.119080 0.005990 0.028306 0.927450 0.038254 0.090542 0.211694 0.115736 0.582027 0.005344 0.072388 0.001237 0.921032 0.001978 0.002638 0.992066 0.003317 0.001306 0.022215 0.974834 0.001645 0.041873 0.955340 0.001128 0.001659 0.991325 0.004755 0.001656 0.002265 0.018595 0.009712 0.315174 0.656519 0.344576 0.242586 0.267179 0.145659 0.135064 0.217556 0.327571 0.319808 0.263141 0.211375 0.250277 0.275207 Consensus sequence: DDBHGGTTGGCATVBD Alignment: -DDBHGGTTGGCATVBD TTTATGGTGAGCAT--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00072 IRC900814_primary Original Motif Reverse Complement Backward 3 12 1.017146 Species: Mus musculus Original motif 0.365594 0.139520 0.170474 0.324412 0.273874 0.192800 0.250453 0.282872 0.161547 0.330332 0.098428 0.409694 0.084003 0.205596 0.098191 0.612210 0.953705 0.016367 0.006314 0.023614 0.003494 0.989648 0.003278 0.003580 0.004722 0.003156 0.988805 0.003317 0.939828 0.001925 0.052151 0.006096 0.183998 0.760396 0.030845 0.024762 0.917564 0.003661 0.065438 0.013337 0.965452 0.006559 0.005183 0.022807 0.730611 0.054369 0.006576 0.208444 0.266519 0.133801 0.067418 0.532262 0.329952 0.210903 0.220319 0.238826 0.250220 0.197954 0.314202 0.237625 0.172311 0.401218 0.189340 0.237131 Consensus sequence: DDHTACGACAAAWDDB Reverse complement motif 0.172311 0.189340 0.401218 0.237131 0.250220 0.314202 0.197954 0.237625 0.238826 0.210903 0.220319 0.329952 0.532262 0.133801 0.067418 0.266519 0.208444 0.054369 0.006576 0.730611 0.022807 0.006559 0.005183 0.965452 0.013337 0.003661 0.065438 0.917564 0.183998 0.030845 0.760396 0.024762 0.006096 0.001925 0.052151 0.939828 0.004722 0.988805 0.003156 0.003317 0.003494 0.003278 0.989648 0.003580 0.023614 0.016367 0.006314 0.953705 0.612210 0.205596 0.098191 0.084003 0.409694 0.330332 0.098428 0.161547 0.282872 0.192800 0.250453 0.273874 0.324412 0.139520 0.170474 0.365594 Consensus sequence: BHDWTTTGTCGTAHDD Alignment: --DDHTACGACAAAWDDB --TTTATGGTGAGCAT-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00191 Pou2f2 Original Motif Reverse Complement Forward 3 12 1.017403 Species: Mus musculus Original motif 0.143441 0.268530 0.212213 0.375817 0.267386 0.204043 0.174256 0.354316 0.230583 0.148604 0.348518 0.272295 0.127633 0.095216 0.030997 0.746154 0.987721 0.002410 0.003474 0.006395 0.003588 0.019280 0.002951 0.974182 0.005844 0.003199 0.919428 0.071529 0.004446 0.890754 0.005987 0.098813 0.743311 0.001562 0.003671 0.251456 0.893912 0.003008 0.014228 0.088852 0.982166 0.003049 0.002708 0.012076 0.027054 0.005668 0.023977 0.943301 0.197736 0.122428 0.271727 0.408108 0.496910 0.196661 0.105572 0.200857 0.347287 0.129915 0.369062 0.153737 0.409641 0.236160 0.215425 0.138774 Consensus sequence: BHDTATGCAAATDHDV Reverse complement motif 0.138774 0.236160 0.215425 0.409641 0.347287 0.369062 0.129915 0.153737 0.200857 0.196661 0.105572 0.496910 0.408108 0.122428 0.271727 0.197736 0.943301 0.005668 0.023977 0.027054 0.012076 0.003049 0.002708 0.982166 0.088852 0.003008 0.014228 0.893912 0.251456 0.001562 0.003671 0.743311 0.004446 0.005987 0.890754 0.098813 0.005844 0.919428 0.003199 0.071529 0.974182 0.019280 0.002951 0.003588 0.006395 0.002410 0.003474 0.987721 0.746154 0.095216 0.030997 0.127633 0.230583 0.348518 0.148604 0.272295 0.354316 0.204043 0.174256 0.267386 0.375817 0.268530 0.212213 0.143441 Consensus sequence: BHHDATTTGCATAHHV Alignment: BHDTATGCAAATDHDV-- --TTTATGGTGAGCAT-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00179 Pou2f3 Original Motif Reverse Complement Forward 3 12 1.017817 Species: Mus musculus Original motif 0.163923 0.199410 0.196283 0.440385 0.244854 0.217834 0.151102 0.386210 0.185934 0.134662 0.398787 0.280618 0.090352 0.119462 0.037157 0.753030 0.990346 0.001754 0.001818 0.006083 0.002450 0.011715 0.002154 0.983680 0.002638 0.001114 0.938678 0.057569 0.002016 0.911319 0.003818 0.082847 0.740177 0.001090 0.002005 0.256728 0.905415 0.001757 0.014660 0.078168 0.987356 0.003190 0.001846 0.007608 0.016362 0.004807 0.016312 0.962520 0.153576 0.155400 0.290074 0.400950 0.455331 0.242511 0.111337 0.190822 0.293425 0.163528 0.350203 0.192844 0.411723 0.243796 0.182398 0.162083 Consensus sequence: BHDTATGCAAATBHDV Reverse complement motif 0.162083 0.243796 0.182398 0.411723 0.293425 0.350203 0.163528 0.192844 0.190822 0.242511 0.111337 0.455331 0.400950 0.155400 0.290074 0.153576 0.962520 0.004807 0.016312 0.016362 0.007608 0.003190 0.001846 0.987356 0.078168 0.001757 0.014660 0.905415 0.256728 0.001090 0.002005 0.740177 0.002016 0.003818 0.911319 0.082847 0.002638 0.938678 0.001114 0.057569 0.983680 0.011715 0.002154 0.002450 0.006083 0.001754 0.001818 0.990346 0.753030 0.119462 0.037157 0.090352 0.185934 0.398787 0.134662 0.280618 0.386210 0.217834 0.151102 0.244854 0.440385 0.199410 0.196283 0.163923 Consensus sequence: BHHVATTTGCATAHHV Alignment: BHDTATGCAAATBHDV-- --TTTATGGTGAGCAT-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00133 Cdx2 Reverse Complement Original Motif Backward 5 12 1.022114 Species: Mus musculus Original motif 0.314704 0.147028 0.248638 0.289630 0.358628 0.179740 0.325491 0.136141 0.298646 0.303363 0.300590 0.097401 0.188478 0.055557 0.664045 0.091921 0.171259 0.033449 0.790542 0.004751 0.002849 0.464940 0.000596 0.531615 0.576948 0.399193 0.001565 0.022295 0.968872 0.001511 0.028582 0.001035 0.006970 0.003535 0.000486 0.989010 0.878078 0.003399 0.000389 0.118134 0.951183 0.000842 0.001555 0.046419 0.939504 0.006021 0.000818 0.053657 0.567732 0.151536 0.050535 0.230197 0.172713 0.264434 0.122553 0.440299 0.142175 0.107265 0.258247 0.492313 0.215178 0.302818 0.133613 0.348391 Consensus sequence: DVVGGYMATAAAAHKH Reverse complement motif 0.348391 0.302818 0.133613 0.215178 0.492313 0.107265 0.258247 0.142175 0.440299 0.264434 0.122553 0.172713 0.230197 0.151536 0.050535 0.567732 0.053657 0.006021 0.000818 0.939504 0.046419 0.000842 0.001555 0.951183 0.118134 0.003399 0.000389 0.878078 0.989010 0.003535 0.000486 0.006970 0.001035 0.001511 0.028582 0.968872 0.022295 0.399193 0.001565 0.576948 0.531615 0.464940 0.000596 0.002849 0.171259 0.790542 0.033449 0.004751 0.188478 0.664045 0.055557 0.091921 0.298646 0.300590 0.303363 0.097401 0.136141 0.179740 0.325491 0.358628 0.289630 0.147028 0.248638 0.314704 Consensus sequence: HRHTTTTATYMCCVBD Alignment: --DVVGGYMATAAAAHKH ATGCTCACCATAAA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00173 Hoxc13 Reverse Complement Original Motif Forward 3 12 1.029208 Species: Mus musculus Original motif 0.329750 0.218875 0.126085 0.325290 0.359529 0.208886 0.161839 0.269746 0.422361 0.147886 0.154953 0.274800 0.109858 0.231755 0.365475 0.292912 0.026731 0.838331 0.133884 0.001054 0.001860 0.034063 0.001665 0.962411 0.018979 0.887508 0.000421 0.093092 0.394654 0.000419 0.598992 0.005935 0.001269 0.017200 0.000611 0.980919 0.897441 0.000397 0.003712 0.098450 0.958993 0.000593 0.000873 0.039541 0.981006 0.004963 0.001000 0.013032 0.645464 0.081310 0.051136 0.222090 0.298300 0.138406 0.094463 0.468832 0.158954 0.229153 0.156589 0.455305 0.325279 0.092193 0.241621 0.340907 Consensus sequence: HHDBCTCRTAAAAWHD Reverse complement motif 0.340907 0.092193 0.241621 0.325279 0.455305 0.229153 0.156589 0.158954 0.468832 0.138406 0.094463 0.298300 0.222090 0.081310 0.051136 0.645464 0.013032 0.004963 0.001000 0.981006 0.039541 0.000593 0.000873 0.958993 0.098450 0.000397 0.003712 0.897441 0.980919 0.017200 0.000611 0.001269 0.394654 0.598992 0.000419 0.005935 0.018979 0.000421 0.887508 0.093092 0.962411 0.034063 0.001665 0.001860 0.026731 0.133884 0.838331 0.001054 0.109858 0.365475 0.231755 0.292912 0.274800 0.147886 0.154953 0.422361 0.269746 0.208886 0.161839 0.359529 0.325290 0.218875 0.126085 0.329750 Consensus sequence: DHWTTTTAMGAGBDHH Alignment: DHWTTTTAMGAGBDHH-- --ATGCTCACCATAAA-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 23 Motif name: Motif 23 Original motif 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.500000 0.000000 0.000000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.500000 0.500000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 Consensus sequence: ATGTWTTCATTMAT Reserve complement motif 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.500000 0.000000 0.500000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.000000 0.000000 0.500000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 Consensus sequence: ATYAATGAAWACAT ************************************************************************ Best Matches for Motif ID 23 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00130 Lhx3 Reverse Complement Original Motif Backward 1 14 0.028564 Species: Mus musculus Original motif 0.226746 0.289244 0.371785 0.112225 0.256971 0.229670 0.248726 0.264633 0.556784 0.228344 0.038490 0.176382 0.631659 0.088282 0.196624 0.083434 0.021306 0.098213 0.006109 0.874373 0.016974 0.029949 0.000343 0.952734 0.971885 0.004194 0.023228 0.000693 0.983076 0.001653 0.004793 0.010478 0.010478 0.004793 0.001653 0.983076 0.000693 0.023228 0.004194 0.971885 0.952734 0.000343 0.029949 0.016974 0.874373 0.006109 0.098213 0.021306 0.425814 0.086548 0.127397 0.360241 0.343977 0.034349 0.079320 0.542354 0.412597 0.281154 0.077380 0.228869 0.338396 0.315969 0.106509 0.239127 0.112285 0.233324 0.310745 0.343646 Consensus sequence: VDAATTAATTAAWWHHB Reverse complement motif 0.343646 0.233324 0.310745 0.112285 0.239127 0.315969 0.106509 0.338396 0.228869 0.281154 0.077380 0.412597 0.542354 0.034349 0.079320 0.343977 0.360241 0.086548 0.127397 0.425814 0.021306 0.006109 0.098213 0.874373 0.016974 0.000343 0.029949 0.952734 0.971885 0.023228 0.004194 0.000693 0.983076 0.004793 0.001653 0.010478 0.010478 0.001653 0.004793 0.983076 0.000693 0.004194 0.023228 0.971885 0.952734 0.029949 0.000343 0.016974 0.874373 0.098213 0.006109 0.021306 0.083434 0.088282 0.196624 0.631659 0.176382 0.228344 0.038490 0.556784 0.264633 0.229670 0.248726 0.256971 0.226746 0.371785 0.289244 0.112225 Consensus sequence: VHHWWTTAATTAATTDV Alignment: VDAATTAATTAAWWHHB ---ATYAATGAAWACAT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00212 Lhx5 Reverse Complement Original Motif Forward 4 14 0.030639 Species: Mus musculus Original motif 0.192127 0.348816 0.300474 0.158583 0.251871 0.201197 0.314740 0.232192 0.469240 0.195840 0.137749 0.197171 0.620351 0.063061 0.196615 0.119973 0.026357 0.096838 0.024928 0.851877 0.010301 0.066114 0.000301 0.923283 0.980649 0.007663 0.010886 0.000802 0.981397 0.001294 0.004654 0.012655 0.012655 0.004654 0.001294 0.981397 0.000802 0.010886 0.007663 0.980649 0.923283 0.000301 0.066114 0.010301 0.851877 0.024928 0.096838 0.026357 0.528438 0.142302 0.071537 0.257724 0.296647 0.115284 0.062688 0.525382 0.401193 0.235971 0.157675 0.205160 0.309966 0.315367 0.145959 0.228708 0.089761 0.287439 0.205359 0.417441 Consensus sequence: VDHATTAATTAAAWHHB Reverse complement motif 0.417441 0.287439 0.205359 0.089761 0.309966 0.145959 0.315367 0.228708 0.205160 0.235971 0.157675 0.401193 0.525382 0.115284 0.062688 0.296647 0.257724 0.142302 0.071537 0.528438 0.026357 0.024928 0.096838 0.851877 0.010301 0.000301 0.066114 0.923283 0.980649 0.010886 0.007663 0.000802 0.981397 0.004654 0.001294 0.012655 0.012655 0.001294 0.004654 0.981397 0.000802 0.007663 0.010886 0.980649 0.923283 0.066114 0.000301 0.010301 0.851877 0.096838 0.024928 0.026357 0.119973 0.063061 0.196615 0.620351 0.197171 0.195840 0.137749 0.469240 0.251871 0.314740 0.201197 0.232192 0.192127 0.300474 0.348816 0.158583 Consensus sequence: VDHWTTTAATTAATHHV Alignment: VDHATTAATTAAAWHHB ---ATYAATGAAWACAT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00169 Lmx1b Original Motif Original Motif Forward 1 14 0.034320 Species: Mus musculus Original motif 0.336931 0.220707 0.306671 0.135692 0.251068 0.126246 0.394767 0.227919 0.318914 0.086872 0.150663 0.443551 0.368649 0.051170 0.092361 0.487819 0.359682 0.088506 0.064771 0.487041 0.019535 0.162692 0.015925 0.801848 0.015902 0.024224 0.000652 0.959222 0.974698 0.006086 0.002334 0.016882 0.978085 0.001281 0.005421 0.015214 0.015214 0.005421 0.001281 0.978085 0.016882 0.002334 0.006086 0.974698 0.959222 0.000652 0.024224 0.015902 0.801848 0.015925 0.162692 0.019535 0.242323 0.115688 0.116364 0.525625 0.283782 0.097563 0.188384 0.430271 0.252386 0.255982 0.135946 0.355686 0.141430 0.249462 0.350759 0.258349 Consensus sequence: VDWWWTTAATTAATDHB Reverse complement motif 0.141430 0.350759 0.249462 0.258349 0.355686 0.255982 0.135946 0.252386 0.430271 0.097563 0.188384 0.283782 0.525625 0.115688 0.116364 0.242323 0.019535 0.015925 0.162692 0.801848 0.015902 0.000652 0.024224 0.959222 0.974698 0.002334 0.006086 0.016882 0.978085 0.005421 0.001281 0.015214 0.015214 0.001281 0.005421 0.978085 0.016882 0.006086 0.002334 0.974698 0.959222 0.024224 0.000652 0.015902 0.801848 0.162692 0.015925 0.019535 0.487041 0.088506 0.064771 0.359682 0.487819 0.051170 0.092361 0.368649 0.443551 0.086872 0.150663 0.318914 0.251068 0.394767 0.126246 0.227919 0.135692 0.220707 0.306671 0.336931 Consensus sequence: BHDATTAATTAAWWWHB Alignment: VDWWWTTAATTAATDHB ATGTWTTCATTMAT--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00262 Lhx1 Reverse Complement Original Motif Forward 4 14 0.034957 Species: Mus musculus Original motif 0.315209 0.366241 0.224448 0.094102 0.226797 0.179144 0.492088 0.101972 0.381904 0.174944 0.190109 0.253043 0.579946 0.093451 0.164863 0.161740 0.033857 0.165951 0.023937 0.776255 0.010562 0.080337 0.000382 0.908720 0.983678 0.007671 0.007262 0.001389 0.976701 0.001039 0.004283 0.017977 0.017977 0.004283 0.001039 0.976701 0.001389 0.007262 0.007671 0.983678 0.908720 0.000382 0.080337 0.010562 0.776255 0.023937 0.165951 0.033857 0.372268 0.146397 0.084885 0.396450 0.497647 0.117799 0.091325 0.293229 0.643159 0.113094 0.055630 0.188117 0.275637 0.292310 0.136698 0.295355 0.149905 0.181595 0.349326 0.319174 Consensus sequence: VVDATTAATTAAWWAHB Reverse complement motif 0.149905 0.349326 0.181595 0.319174 0.295355 0.292310 0.136698 0.275637 0.188117 0.113094 0.055630 0.643159 0.293229 0.117799 0.091325 0.497647 0.396450 0.146397 0.084885 0.372268 0.033857 0.023937 0.165951 0.776255 0.010562 0.000382 0.080337 0.908720 0.983678 0.007262 0.007671 0.001389 0.976701 0.004283 0.001039 0.017977 0.017977 0.001039 0.004283 0.976701 0.001389 0.007671 0.007262 0.983678 0.908720 0.080337 0.000382 0.010562 0.776255 0.165951 0.023937 0.033857 0.161740 0.093451 0.164863 0.579946 0.253043 0.174944 0.190109 0.381904 0.226797 0.492088 0.179144 0.101972 0.315209 0.224448 0.366241 0.094102 Consensus sequence: BHTWWTTAATTAATDVV Alignment: VVDATTAATTAAWWAHB ---ATYAATGAAWACAT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00244 Tlx2 Original Motif Reverse Complement Backward 3 14 0.036191 Species: Mus musculus Original motif 0.105929 0.200768 0.276304 0.416999 0.605737 0.082484 0.045449 0.266331 0.616140 0.070870 0.219578 0.093411 0.207168 0.101768 0.138909 0.552155 0.205588 0.314073 0.063564 0.416776 0.753104 0.060249 0.064598 0.122049 0.785626 0.028841 0.041793 0.143739 0.035001 0.038504 0.018619 0.907876 0.039875 0.038526 0.009504 0.912095 0.920557 0.010057 0.045031 0.024356 0.806507 0.031077 0.030857 0.131559 0.170184 0.056552 0.043413 0.729851 0.630114 0.051409 0.080078 0.238398 0.554265 0.093528 0.223411 0.128796 0.183854 0.390999 0.093847 0.331300 0.289988 0.101149 0.103803 0.505061 0.400594 0.061089 0.136478 0.401839 Consensus sequence: BAATHAATTAATAAHWW Reverse complement motif 0.401839 0.061089 0.136478 0.400594 0.505061 0.101149 0.103803 0.289988 0.183854 0.093847 0.390999 0.331300 0.128796 0.093528 0.223411 0.554265 0.238398 0.051409 0.080078 0.630114 0.729851 0.056552 0.043413 0.170184 0.131559 0.031077 0.030857 0.806507 0.024356 0.010057 0.045031 0.920557 0.912095 0.038526 0.009504 0.039875 0.907876 0.038504 0.018619 0.035001 0.143739 0.028841 0.041793 0.785626 0.122049 0.060249 0.064598 0.753104 0.416776 0.314073 0.063564 0.205588 0.552155 0.101768 0.138909 0.207168 0.093411 0.070870 0.219578 0.616140 0.266331 0.082484 0.045449 0.605737 0.416999 0.200768 0.276304 0.105929 Consensus sequence: WWDTTATTAATTHATTV Alignment: WWDTTATTAATTHATTV -ATGTWTTCATTMAT-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00188 Lmx1a Reverse Complement Original Motif Backward 1 14 0.037513 Species: Mus musculus Original motif 0.163027 0.506393 0.246327 0.084254 0.173471 0.211164 0.477036 0.138330 0.431859 0.182416 0.155298 0.230427 0.420560 0.127574 0.126915 0.324951 0.060842 0.128686 0.037075 0.773398 0.032236 0.035967 0.001358 0.930439 0.938541 0.008352 0.007051 0.046057 0.964464 0.001596 0.003362 0.030579 0.030579 0.003362 0.001596 0.964464 0.046057 0.007051 0.008352 0.938541 0.930439 0.001358 0.035967 0.032236 0.773398 0.037075 0.128686 0.060842 0.498149 0.057242 0.091924 0.352686 0.520755 0.121277 0.054120 0.303848 0.483290 0.175070 0.069683 0.271957 0.221557 0.366894 0.153619 0.257930 0.167920 0.342643 0.169856 0.319581 Consensus sequence: CVHHTTAATTAAWWWHB Reverse complement motif 0.167920 0.169856 0.342643 0.319581 0.221557 0.153619 0.366894 0.257930 0.271957 0.175070 0.069683 0.483290 0.303848 0.121277 0.054120 0.520755 0.352686 0.057242 0.091924 0.498149 0.060842 0.037075 0.128686 0.773398 0.032236 0.001358 0.035967 0.930439 0.938541 0.007051 0.008352 0.046057 0.964464 0.003362 0.001596 0.030579 0.030579 0.001596 0.003362 0.964464 0.046057 0.008352 0.007051 0.938541 0.930439 0.035967 0.001358 0.032236 0.773398 0.128686 0.037075 0.060842 0.324951 0.127574 0.126915 0.420560 0.230427 0.182416 0.155298 0.431859 0.173471 0.477036 0.211164 0.138330 0.163027 0.246327 0.506393 0.084254 Consensus sequence: BDWWWTTAATTAAHHVG Alignment: CVHHTTAATTAAWWWHB ---ATYAATGAAWACAT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00155 Hmx2 Reverse Complement Original Motif Backward 1 14 0.038600 Species: Mus musculus Original motif 0.496013 0.201439 0.234082 0.068466 0.187731 0.442491 0.232786 0.136992 0.546269 0.190140 0.171225 0.092365 0.766900 0.055660 0.121480 0.055959 0.166703 0.152146 0.573689 0.107463 0.008586 0.974989 0.003194 0.013231 0.847648 0.001099 0.146478 0.004775 0.851907 0.131324 0.006893 0.009877 0.005053 0.003719 0.001092 0.990135 0.015092 0.055361 0.000333 0.929213 0.934792 0.001369 0.011244 0.052595 0.890982 0.010911 0.022703 0.075405 0.360898 0.185917 0.109871 0.343315 0.248362 0.207536 0.407845 0.136257 0.413889 0.266826 0.266667 0.052618 0.472173 0.104750 0.246154 0.176923 0.094095 0.071488 0.092888 0.741528 Consensus sequence: VVAAGCAATTAAHVVDT Reverse complement motif 0.741528 0.071488 0.092888 0.094095 0.176923 0.104750 0.246154 0.472173 0.052618 0.266826 0.266667 0.413889 0.248362 0.407845 0.207536 0.136257 0.343315 0.185917 0.109871 0.360898 0.075405 0.010911 0.022703 0.890982 0.052595 0.001369 0.011244 0.934792 0.929213 0.055361 0.000333 0.015092 0.990135 0.003719 0.001092 0.005053 0.009877 0.131324 0.006893 0.851907 0.004775 0.001099 0.146478 0.847648 0.008586 0.003194 0.974989 0.013231 0.166703 0.573689 0.152146 0.107463 0.055959 0.055660 0.121480 0.766900 0.092365 0.190140 0.171225 0.546269 0.187731 0.232786 0.442491 0.136992 0.068466 0.201439 0.234082 0.496013 Consensus sequence: ADBVHTTAATTGCTTVB Alignment: ADBVHTTAATTGCTTVB ---ATYAATGAAWACAT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00157 Hmx3 Reverse Complement Original Motif Forward 4 14 0.039022 Species: Mus musculus Original motif 0.493883 0.207908 0.206555 0.091654 0.124338 0.490519 0.252638 0.132506 0.482613 0.229280 0.188509 0.099597 0.758821 0.067165 0.111206 0.062809 0.154132 0.098232 0.594074 0.153562 0.015565 0.938529 0.001667 0.044239 0.835485 0.001163 0.156926 0.006426 0.869937 0.118961 0.001666 0.009435 0.005815 0.004470 0.001031 0.988683 0.014066 0.042296 0.000378 0.943259 0.924765 0.001168 0.024126 0.049941 0.873425 0.020468 0.034636 0.071470 0.387156 0.148327 0.115500 0.349017 0.256863 0.183824 0.381900 0.177413 0.472131 0.208576 0.255773 0.063519 0.524326 0.109150 0.180486 0.186038 0.125721 0.103316 0.133298 0.637666 Consensus sequence: VBVAGCAATTAAHVVAT Reverse complement motif 0.637666 0.103316 0.133298 0.125721 0.186038 0.109150 0.180486 0.524326 0.063519 0.208576 0.255773 0.472131 0.256863 0.381900 0.183824 0.177413 0.349017 0.148327 0.115500 0.387156 0.071470 0.020468 0.034636 0.873425 0.049941 0.001168 0.024126 0.924765 0.943259 0.042296 0.000378 0.014066 0.988683 0.004470 0.001031 0.005815 0.009435 0.118961 0.001666 0.869937 0.006426 0.001163 0.156926 0.835485 0.015565 0.001667 0.938529 0.044239 0.154132 0.594074 0.098232 0.153562 0.062809 0.067165 0.111206 0.758821 0.099597 0.229280 0.188509 0.482613 0.124338 0.252638 0.490519 0.132506 0.091654 0.207908 0.206555 0.493883 Consensus sequence: ATBVHTTAATTGCTBBB Alignment: VBVAGCAATTAAHVVAT ---ATYAATGAAWACAT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00172 Prop1 Reverse Complement Original Motif Forward 4 14 0.039792 Species: Mus musculus Original motif 0.239694 0.382964 0.212782 0.164560 0.211105 0.192638 0.471186 0.125071 0.361402 0.251084 0.217415 0.170099 0.474402 0.180412 0.249562 0.095624 0.015257 0.155181 0.007371 0.822191 0.011633 0.033757 0.000947 0.953662 0.984150 0.005351 0.005253 0.005247 0.982857 0.001638 0.005309 0.010196 0.010196 0.005309 0.001638 0.982857 0.005247 0.005253 0.005351 0.984150 0.953662 0.000947 0.033757 0.011633 0.822191 0.007371 0.155181 0.015257 0.159439 0.160044 0.349613 0.330903 0.454571 0.111567 0.175216 0.258646 0.305750 0.183822 0.246269 0.264159 0.351726 0.178703 0.236408 0.233163 0.142463 0.525857 0.103778 0.227902 Consensus sequence: VVVVTTAATTAABDDDC Reverse complement motif 0.142463 0.103778 0.525857 0.227902 0.233163 0.178703 0.236408 0.351726 0.264159 0.183822 0.246269 0.305750 0.258646 0.111567 0.175216 0.454571 0.159439 0.349613 0.160044 0.330903 0.015257 0.007371 0.155181 0.822191 0.011633 0.000947 0.033757 0.953662 0.984150 0.005253 0.005351 0.005247 0.982857 0.005309 0.001638 0.010196 0.010196 0.001638 0.005309 0.982857 0.005247 0.005351 0.005253 0.984150 0.953662 0.033757 0.000947 0.011633 0.822191 0.155181 0.007371 0.015257 0.095624 0.180412 0.249562 0.474402 0.170099 0.251084 0.217415 0.361402 0.211105 0.471186 0.192638 0.125071 0.239694 0.212782 0.382964 0.164560 Consensus sequence: GDDDBTTAATTAABBVV Alignment: VVVVTTAATTAABDDDC ---ATYAATGAAWACAT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00237 Otp Reverse Complement Reverse Complement Backward 1 14 0.041444 Species: Mus musculus Original motif 0.230993 0.375169 0.212909 0.180928 0.308053 0.197960 0.335842 0.158144 0.146999 0.355311 0.118315 0.379375 0.411189 0.175886 0.183790 0.229135 0.473168 0.101553 0.388483 0.036796 0.007589 0.115608 0.001555 0.875248 0.008817 0.035417 0.000301 0.955465 0.983825 0.008430 0.006604 0.001141 0.983066 0.001256 0.010977 0.004701 0.004701 0.010977 0.001256 0.983066 0.001141 0.006604 0.008430 0.983825 0.955465 0.000301 0.035417 0.008817 0.875248 0.001555 0.115608 0.007589 0.059530 0.422614 0.086819 0.431037 0.234910 0.104731 0.282998 0.377362 0.222053 0.180868 0.345763 0.251316 0.124269 0.122352 0.604547 0.148832 Consensus sequence: VVHDRTTAATTAAYDDG Reverse complement motif 0.124269 0.604547 0.122352 0.148832 0.222053 0.345763 0.180868 0.251316 0.377362 0.104731 0.282998 0.234910 0.431037 0.422614 0.086819 0.059530 0.007589 0.001555 0.115608 0.875248 0.008817 0.000301 0.035417 0.955465 0.983825 0.006604 0.008430 0.001141 0.983066 0.010977 0.001256 0.004701 0.004701 0.001256 0.010977 0.983066 0.001141 0.008430 0.006604 0.983825 0.955465 0.035417 0.000301 0.008817 0.875248 0.115608 0.001555 0.007589 0.036796 0.101553 0.388483 0.473168 0.229135 0.175886 0.183790 0.411189 0.379375 0.355311 0.118315 0.146999 0.308053 0.335842 0.197960 0.158144 0.230993 0.212909 0.375169 0.180928 Consensus sequence: CHDMTTAATTAAKDHVV Alignment: CHDMTTAATTAAKDHVV ---ATYAATGAAWACAT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 24 Motif name: Motif 24 Original motif 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.500000 0.000000 0.000000 0.500000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.500000 0.000000 0.000000 0.500000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 Consensus sequence: AAAGWCATWAA Reserve complement motif 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.500000 0.000000 0.000000 0.500000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.500000 0.000000 0.000000 0.500000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 Consensus sequence: TTWATGWCTTT ************************************************************************ Best Matches for Motif ID 24 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00246 Hoxa11 Original Motif Original Motif Backward 5 11 0.011591 Species: Mus musculus Original motif 0.250495 0.214554 0.138272 0.396679 0.492850 0.123424 0.196803 0.186923 0.540281 0.151603 0.140529 0.167586 0.428463 0.099563 0.270775 0.201200 0.102254 0.050731 0.845038 0.001977 0.001884 0.019008 0.001029 0.978079 0.016931 0.973797 0.000596 0.008676 0.258728 0.001705 0.738135 0.001431 0.003545 0.001680 0.003370 0.991405 0.832666 0.002250 0.000866 0.164218 0.983610 0.001278 0.002546 0.012566 0.980677 0.005645 0.001242 0.012435 0.599219 0.090422 0.088183 0.222176 0.212685 0.399896 0.114218 0.273202 0.287588 0.220283 0.249419 0.242710 0.152138 0.145873 0.312609 0.389380 Consensus sequence: HDADGTCGTAAAAHDD Reverse complement motif 0.389380 0.145873 0.312609 0.152138 0.242710 0.220283 0.249419 0.287588 0.212685 0.114218 0.399896 0.273202 0.222176 0.090422 0.088183 0.599219 0.012435 0.005645 0.001242 0.980677 0.012566 0.001278 0.002546 0.983610 0.164218 0.002250 0.000866 0.832666 0.991405 0.001680 0.003370 0.003545 0.258728 0.738135 0.001705 0.001431 0.016931 0.000596 0.973797 0.008676 0.978079 0.019008 0.001029 0.001884 0.102254 0.845038 0.050731 0.001977 0.201200 0.099563 0.270775 0.428463 0.167586 0.151603 0.140529 0.540281 0.186923 0.123424 0.196803 0.492850 0.396679 0.214554 0.138272 0.250495 Consensus sequence: DDDTTTTACGACDTDH Alignment: HDADGTCGTAAAAHDD -AAAGWCATWAA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00235 Hoxc11 Original Motif Original Motif Backward 5 11 0.012423 Species: Mus musculus Original motif 0.233269 0.248491 0.135443 0.382797 0.530699 0.117734 0.196458 0.155109 0.520162 0.128349 0.129047 0.222442 0.383288 0.142763 0.265367 0.208581 0.082604 0.036330 0.879729 0.001337 0.001490 0.025603 0.000959 0.971949 0.011271 0.977559 0.000430 0.010739 0.234170 0.001531 0.762912 0.001387 0.002139 0.001352 0.004590 0.991918 0.858371 0.001955 0.000717 0.138958 0.981016 0.000748 0.001915 0.016321 0.985345 0.003895 0.001793 0.008967 0.542364 0.130700 0.106606 0.220330 0.222953 0.268192 0.191329 0.317526 0.353019 0.168556 0.262332 0.216093 0.196584 0.119005 0.352701 0.331710 Consensus sequence: HAADGTCGTAAAAHDD Reverse complement motif 0.196584 0.352701 0.119005 0.331710 0.216093 0.168556 0.262332 0.353019 0.317526 0.268192 0.191329 0.222953 0.220330 0.130700 0.106606 0.542364 0.008967 0.003895 0.001793 0.985345 0.016321 0.000748 0.001915 0.981016 0.138958 0.001955 0.000717 0.858371 0.991918 0.001352 0.004590 0.002139 0.234170 0.762912 0.001531 0.001387 0.011271 0.000430 0.977559 0.010739 0.971949 0.025603 0.000959 0.001490 0.082604 0.879729 0.036330 0.001337 0.208581 0.142763 0.265367 0.383288 0.222442 0.128349 0.129047 0.520162 0.155109 0.117734 0.196458 0.530699 0.382797 0.248491 0.135443 0.233269 Consensus sequence: HDHTTTTACGACDTTH Alignment: HAADGTCGTAAAAHDD -AAAGWCATWAA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00207 Hoxb9 Original Motif Original Motif Forward 1 11 0.016352 Species: Mus musculus Original motif 0.369205 0.191401 0.373182 0.066211 0.357429 0.160246 0.408701 0.073624 0.576965 0.069294 0.310696 0.043045 0.103797 0.127691 0.646641 0.121871 0.023188 0.657132 0.005598 0.314082 0.420260 0.543925 0.009350 0.026464 0.944117 0.003851 0.047375 0.004658 0.007642 0.006158 0.004106 0.982094 0.728623 0.003283 0.002505 0.265589 0.958302 0.002642 0.002614 0.036442 0.969909 0.004265 0.002650 0.023176 0.869075 0.011516 0.028466 0.090943 0.336102 0.198102 0.075230 0.390566 0.203557 0.271818 0.098338 0.426287 0.226605 0.448090 0.146026 0.179278 0.252426 0.177812 0.357334 0.212429 Consensus sequence: VRRGCMATAAAAHHHD Reverse complement motif 0.252426 0.357334 0.177812 0.212429 0.226605 0.146026 0.448090 0.179278 0.426287 0.271818 0.098338 0.203557 0.390566 0.198102 0.075230 0.336102 0.090943 0.011516 0.028466 0.869075 0.023176 0.004265 0.002650 0.969909 0.036442 0.002642 0.002614 0.958302 0.265589 0.003283 0.002505 0.728623 0.982094 0.006158 0.004106 0.007642 0.004658 0.003851 0.047375 0.944117 0.420260 0.009350 0.543925 0.026464 0.023188 0.005598 0.657132 0.314082 0.103797 0.646641 0.127691 0.121871 0.043045 0.069294 0.310696 0.576965 0.357429 0.408701 0.160246 0.073624 0.369205 0.373182 0.191401 0.066211 Consensus sequence: HDHHTTTTATRGCKMV Alignment: VRRGCMATAAAAHHHD AAAGWCATWAA----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00197 Hoxc9 Reverse Complement Reverse Complement Forward 5 11 0.017626 Species: Mus musculus Original motif 0.279588 0.205946 0.337877 0.176588 0.212819 0.121136 0.376165 0.289881 0.371836 0.224291 0.240111 0.163762 0.200999 0.056254 0.589311 0.153436 0.141203 0.048864 0.796449 0.013484 0.026376 0.197045 0.009146 0.767433 0.286968 0.688278 0.011985 0.012769 0.890619 0.006181 0.098071 0.005129 0.019680 0.011114 0.002539 0.966668 0.287238 0.007432 0.002166 0.703164 0.975510 0.006204 0.005667 0.012620 0.949137 0.017111 0.006224 0.027528 0.241729 0.296577 0.052768 0.408926 0.212400 0.269675 0.090007 0.427918 0.333376 0.091783 0.259582 0.315259 0.182024 0.203528 0.245531 0.368917 Consensus sequence: VDVGGTCATTAAHHDB Reverse complement motif 0.368917 0.203528 0.245531 0.182024 0.315259 0.091783 0.259582 0.333376 0.427918 0.269675 0.090007 0.212400 0.408926 0.296577 0.052768 0.241729 0.027528 0.017111 0.006224 0.949137 0.012620 0.006204 0.005667 0.975510 0.703164 0.007432 0.002166 0.287238 0.966668 0.011114 0.002539 0.019680 0.005129 0.006181 0.098071 0.890619 0.286968 0.011985 0.688278 0.012769 0.767433 0.197045 0.009146 0.026376 0.141203 0.796449 0.048864 0.013484 0.200999 0.589311 0.056254 0.153436 0.163762 0.224291 0.240111 0.371836 0.212819 0.376165 0.121136 0.289881 0.279588 0.337877 0.205946 0.176588 Consensus sequence: VDHHTTAATGACCBHV Alignment: VDHHTTAATGACCBHV ----TTWATGWCTTT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00245 Hoxc10 Original Motif Original Motif Forward 2 11 0.017810 Species: Mus musculus Original motif 0.239959 0.241480 0.127526 0.391035 0.393451 0.123294 0.236504 0.246751 0.425440 0.162608 0.183192 0.228759 0.342619 0.136379 0.294758 0.226245 0.081913 0.061733 0.855044 0.001310 0.001643 0.036832 0.001170 0.960355 0.018825 0.976078 0.000606 0.004492 0.295691 0.001892 0.701303 0.001114 0.002726 0.002441 0.002823 0.992011 0.854003 0.002752 0.000601 0.142644 0.986219 0.001475 0.002415 0.009891 0.976476 0.009547 0.001650 0.012327 0.495998 0.130830 0.145385 0.227787 0.217852 0.326165 0.152819 0.303164 0.206308 0.256598 0.289657 0.247436 0.137871 0.148598 0.304153 0.409378 Consensus sequence: HDDDGTCGTAAADHBB Reverse complement motif 0.409378 0.148598 0.304153 0.137871 0.206308 0.289657 0.256598 0.247436 0.217852 0.152819 0.326165 0.303164 0.227787 0.130830 0.145385 0.495998 0.012327 0.009547 0.001650 0.976476 0.009891 0.001475 0.002415 0.986219 0.142644 0.002752 0.000601 0.854003 0.992011 0.002441 0.002823 0.002726 0.295691 0.701303 0.001892 0.001114 0.018825 0.000606 0.976078 0.004492 0.960355 0.036832 0.001170 0.001643 0.081913 0.855044 0.061733 0.001310 0.226245 0.136379 0.294758 0.342619 0.228759 0.162608 0.183192 0.425440 0.246751 0.123294 0.236504 0.393451 0.391035 0.241480 0.127526 0.239959 Consensus sequence: VBDDTTTACGACDDDH Alignment: HDDDGTCGTAAADHBB -AAAGWCATWAA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00117 Hoxd11 Original Motif Original Motif Backward 6 11 0.020657 Species: Mus musculus Original motif 0.195240 0.299581 0.070392 0.434787 0.383232 0.235789 0.118316 0.262663 0.433734 0.150531 0.233498 0.182237 0.318929 0.193275 0.329287 0.158509 0.078189 0.058494 0.861977 0.001340 0.001639 0.021863 0.001515 0.974983 0.011232 0.978821 0.000755 0.009192 0.171564 0.002240 0.824311 0.001885 0.003418 0.002620 0.003016 0.990946 0.839934 0.002566 0.000872 0.156628 0.984574 0.001197 0.003120 0.011109 0.979994 0.007524 0.001223 0.011259 0.626288 0.164042 0.022338 0.187331 0.276342 0.192595 0.122578 0.408484 0.228871 0.351280 0.153929 0.265920 0.249434 0.303271 0.170797 0.276498 0.179262 0.157831 0.195784 0.467122 Consensus sequence: HHDVGTCGTAAAAHHHD Reverse complement motif 0.467122 0.157831 0.195784 0.179262 0.249434 0.170797 0.303271 0.276498 0.228871 0.153929 0.351280 0.265920 0.408484 0.192595 0.122578 0.276342 0.187331 0.164042 0.022338 0.626288 0.011259 0.007524 0.001223 0.979994 0.011109 0.001197 0.003120 0.984574 0.156628 0.002566 0.000872 0.839934 0.990946 0.002620 0.003016 0.003418 0.171564 0.824311 0.002240 0.001885 0.011232 0.000755 0.978821 0.009192 0.974983 0.021863 0.001515 0.001639 0.078189 0.861977 0.058494 0.001340 0.318929 0.329287 0.193275 0.158509 0.182237 0.150531 0.233498 0.433734 0.262663 0.235789 0.118316 0.383232 0.434787 0.299581 0.070392 0.195240 Consensus sequence: DDDHTTTTACGACVDHH Alignment: HHDVGTCGTAAAAHHHD -AAAGWCATWAA----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00240 Cdx1 Original Motif Original Motif Backward 5 11 0.023127 Species: Mus musculus Original motif 0.291355 0.151940 0.179692 0.377013 0.387797 0.102678 0.306996 0.202529 0.400923 0.248207 0.238260 0.112610 0.142484 0.055838 0.727508 0.074170 0.126833 0.033479 0.828628 0.011060 0.009027 0.282657 0.002261 0.706056 0.492447 0.469548 0.001666 0.036340 0.819860 0.003148 0.174822 0.002170 0.006463 0.003298 0.003083 0.987157 0.738256 0.008651 0.001939 0.251154 0.918083 0.001651 0.003667 0.076598 0.938710 0.007660 0.003592 0.050038 0.643683 0.109772 0.051867 0.194678 0.163809 0.229090 0.173213 0.433888 0.137902 0.107611 0.261515 0.492971 0.357358 0.214435 0.101054 0.327153 Consensus sequence: DDVGGTMATAAAABKH Reverse complement motif 0.327153 0.214435 0.101054 0.357358 0.492971 0.107611 0.261515 0.137902 0.433888 0.229090 0.173213 0.163809 0.194678 0.109772 0.051867 0.643683 0.050038 0.007660 0.003592 0.938710 0.076598 0.001651 0.003667 0.918083 0.251154 0.008651 0.001939 0.738256 0.987157 0.003298 0.003083 0.006463 0.002170 0.003148 0.174822 0.819860 0.036340 0.469548 0.001666 0.492447 0.706056 0.282657 0.002261 0.009027 0.126833 0.828628 0.033479 0.011060 0.142484 0.727508 0.055838 0.074170 0.112610 0.248207 0.238260 0.400923 0.202529 0.102678 0.306996 0.387797 0.377013 0.151940 0.179692 0.291355 Consensus sequence: HRVTTTTATYACCBDD Alignment: DDVGGTMATAAAABKH -AAAGWCATWAA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00213 Hoxa9 Original Motif Original Motif Backward 7 11 0.024118 Species: Mus musculus Original motif 0.386110 0.122124 0.336396 0.155370 0.214951 0.503652 0.200027 0.081370 0.227199 0.070231 0.558705 0.143864 0.087364 0.155173 0.659970 0.097493 0.088468 0.597073 0.010847 0.303611 0.237567 0.630916 0.020446 0.111071 0.883692 0.003551 0.103622 0.009135 0.022994 0.004161 0.003712 0.969134 0.630635 0.007085 0.003697 0.358584 0.954551 0.003419 0.003818 0.038212 0.932582 0.012322 0.005304 0.049792 0.758713 0.022612 0.031347 0.187327 0.320450 0.163437 0.062031 0.454082 0.174953 0.127720 0.167458 0.529870 0.511837 0.131729 0.146649 0.209785 0.382191 0.090904 0.276475 0.250430 0.383323 0.080173 0.111038 0.425465 Consensus sequence: DCGGYCATWAAAWTADW Reverse complement motif 0.425465 0.080173 0.111038 0.383323 0.250430 0.090904 0.276475 0.382191 0.209785 0.131729 0.146649 0.511837 0.529870 0.127720 0.167458 0.174953 0.454082 0.163437 0.062031 0.320450 0.187327 0.022612 0.031347 0.758713 0.049792 0.012322 0.005304 0.932582 0.038212 0.003419 0.003818 0.954551 0.358584 0.007085 0.003697 0.630635 0.969134 0.004161 0.003712 0.022994 0.009135 0.003551 0.103622 0.883692 0.237567 0.020446 0.630916 0.111071 0.088468 0.010847 0.597073 0.303611 0.087364 0.659970 0.155173 0.097493 0.227199 0.558705 0.070231 0.143864 0.214951 0.200027 0.503652 0.081370 0.155370 0.122124 0.336396 0.386110 Consensus sequence: WDTAWTTTWATGKCCGD Alignment: DCGGYCATWAAAWTADW AAAGWCATWAA------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00133 Cdx2 Original Motif Original Motif Forward 2 11 0.026498 Species: Mus musculus Original motif 0.314704 0.147028 0.248638 0.289630 0.358628 0.179740 0.325491 0.136141 0.298646 0.303363 0.300590 0.097401 0.188478 0.055557 0.664045 0.091921 0.171259 0.033449 0.790542 0.004751 0.002849 0.464940 0.000596 0.531615 0.576948 0.399193 0.001565 0.022295 0.968872 0.001511 0.028582 0.001035 0.006970 0.003535 0.000486 0.989010 0.878078 0.003399 0.000389 0.118134 0.951183 0.000842 0.001555 0.046419 0.939504 0.006021 0.000818 0.053657 0.567732 0.151536 0.050535 0.230197 0.172713 0.264434 0.122553 0.440299 0.142175 0.107265 0.258247 0.492313 0.215178 0.302818 0.133613 0.348391 Consensus sequence: DVVGGYMATAAAAHKH Reverse complement motif 0.348391 0.302818 0.133613 0.215178 0.492313 0.107265 0.258247 0.142175 0.440299 0.264434 0.122553 0.172713 0.230197 0.151536 0.050535 0.567732 0.053657 0.006021 0.000818 0.939504 0.046419 0.000842 0.001555 0.951183 0.118134 0.003399 0.000389 0.878078 0.989010 0.003535 0.000486 0.006970 0.001035 0.001511 0.028582 0.968872 0.022295 0.399193 0.001565 0.576948 0.531615 0.464940 0.000596 0.002849 0.171259 0.790542 0.033449 0.004751 0.188478 0.664045 0.055557 0.091921 0.298646 0.300590 0.303363 0.097401 0.136141 0.179740 0.325491 0.358628 0.289630 0.147028 0.248638 0.314704 Consensus sequence: HRHTTTTATYMCCVBD Alignment: DVVGGYMATAAAAHKH -AAAGWCATWAA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00177 Hoxd12 Original Motif Original Motif Backward 6 11 0.027190 Species: Mus musculus Original motif 0.191103 0.352101 0.107327 0.349468 0.402272 0.197071 0.150917 0.249740 0.368769 0.193398 0.226932 0.210901 0.257933 0.260778 0.380702 0.100587 0.106950 0.067191 0.825021 0.000838 0.001086 0.021564 0.000853 0.976497 0.020082 0.968082 0.000327 0.011509 0.118319 0.000920 0.879436 0.001326 0.003172 0.002130 0.001866 0.992832 0.922156 0.002796 0.000429 0.074620 0.983503 0.000923 0.001373 0.014202 0.982158 0.003892 0.000954 0.012996 0.575374 0.149674 0.027141 0.247811 0.191390 0.208793 0.100368 0.499449 0.189094 0.369025 0.180904 0.260976 0.265714 0.203403 0.179754 0.351130 0.215918 0.141705 0.246047 0.396330 Consensus sequence: HHDVGTCGTAAAAHHHD Reverse complement motif 0.396330 0.141705 0.246047 0.215918 0.351130 0.203403 0.179754 0.265714 0.189094 0.180904 0.369025 0.260976 0.499449 0.208793 0.100368 0.191390 0.247811 0.149674 0.027141 0.575374 0.012996 0.003892 0.000954 0.982158 0.014202 0.000923 0.001373 0.983503 0.074620 0.002796 0.000429 0.922156 0.992832 0.002130 0.001866 0.003172 0.118319 0.879436 0.000920 0.001326 0.020082 0.000327 0.968082 0.011509 0.976497 0.021564 0.000853 0.001086 0.106950 0.825021 0.067191 0.000838 0.257933 0.380702 0.260778 0.100587 0.210901 0.193398 0.226932 0.368769 0.249740 0.197071 0.150917 0.402272 0.191103 0.107327 0.352101 0.349468 Consensus sequence: DHDHTTTTACGACVDHD Alignment: HHDVGTCGTAAAAHHHD -AAAGWCATWAA----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 25 Motif name: Motif 25 Original motif 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 Consensus sequence: AATAACAGATT Reserve complement motif 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 Consensus sequence: AATCTGTTATT ************************************************************************ Best Matches for Motif ID 25 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00186 Meis1 Original Motif Reverse Complement Backward 4 11 0.033697 Species: Mus musculus Original motif 0.432115 0.114994 0.130835 0.322056 0.508081 0.060822 0.214256 0.216841 0.225875 0.276028 0.280982 0.217115 0.092373 0.286687 0.360933 0.260007 0.947172 0.005937 0.028595 0.018297 0.027829 0.439935 0.505051 0.027185 0.023801 0.963424 0.008205 0.004571 0.001548 0.018215 0.000406 0.979831 0.008422 0.001124 0.989007 0.001446 0.025343 0.004094 0.000241 0.970323 0.001451 0.992789 0.002037 0.003724 0.991202 0.001638 0.003159 0.004002 0.695910 0.022145 0.013657 0.268288 0.357895 0.090931 0.093796 0.457378 0.453163 0.204395 0.181067 0.161376 0.200615 0.393437 0.171398 0.234551 Consensus sequence: WAVBASCTGTCAAWVH Reverse complement motif 0.200615 0.171398 0.393437 0.234551 0.161376 0.204395 0.181067 0.453163 0.457378 0.090931 0.093796 0.357895 0.268288 0.022145 0.013657 0.695910 0.004002 0.001638 0.003159 0.991202 0.001451 0.002037 0.992789 0.003724 0.970323 0.004094 0.000241 0.025343 0.008422 0.989007 0.001124 0.001446 0.979831 0.018215 0.000406 0.001548 0.023801 0.008205 0.963424 0.004571 0.027829 0.505051 0.439935 0.027185 0.018297 0.005937 0.028595 0.947172 0.092373 0.360933 0.286687 0.260007 0.225875 0.280982 0.276028 0.217115 0.216841 0.060822 0.214256 0.508081 0.322056 0.114994 0.130835 0.432115 Consensus sequence: DBWTTGACAGSTBVTW Alignment: DBWTTGACAGSTBVTW --AATAACAGATT--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00226 Mrg1 Original Motif Reverse Complement Forward 3 11 0.036150 Species: Mus musculus Original motif 0.378836 0.145096 0.102046 0.374022 0.507161 0.090730 0.177058 0.225051 0.277496 0.234581 0.275775 0.212149 0.065300 0.339403 0.360939 0.234358 0.918963 0.010948 0.043262 0.026826 0.017295 0.545133 0.416603 0.020969 0.023391 0.962223 0.007311 0.007075 0.001760 0.020258 0.000360 0.977622 0.013946 0.000586 0.983699 0.001769 0.035910 0.004825 0.000197 0.959068 0.001465 0.991446 0.001338 0.005750 0.986785 0.001158 0.005848 0.006209 0.715894 0.043046 0.018966 0.222093 0.332332 0.084841 0.098421 0.484405 0.473739 0.198580 0.152072 0.175610 0.211505 0.325971 0.212211 0.250313 Consensus sequence: WAVBASCTGTCAAWHB Reverse complement motif 0.211505 0.212211 0.325971 0.250313 0.175610 0.198580 0.152072 0.473739 0.484405 0.084841 0.098421 0.332332 0.222093 0.043046 0.018966 0.715894 0.006209 0.001158 0.005848 0.986785 0.001465 0.001338 0.991446 0.005750 0.959068 0.004825 0.000197 0.035910 0.013946 0.983699 0.000586 0.001769 0.977622 0.020258 0.000360 0.001760 0.023391 0.007311 0.962223 0.007075 0.017295 0.416603 0.545133 0.020969 0.026826 0.010948 0.043262 0.918963 0.065300 0.360939 0.339403 0.234358 0.212149 0.234581 0.275775 0.277496 0.225051 0.090730 0.177058 0.507161 0.374022 0.145096 0.102046 0.378836 Consensus sequence: BHWTTGACAGSTBBTW Alignment: BHWTTGACAGSTBBTW --AATAACAGATT--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00122 Tgif1 Reverse Complement Reverse Complement Backward 4 11 0.036726 Species: Mus musculus Original motif 0.272977 0.158875 0.284742 0.283406 0.550609 0.124110 0.169608 0.155673 0.114568 0.207160 0.282464 0.395807 0.560868 0.052907 0.053508 0.332716 0.336500 0.068048 0.114050 0.481403 0.007736 0.003722 0.000495 0.988048 0.004489 0.000729 0.992211 0.002571 0.956618 0.000414 0.000890 0.042078 0.004381 0.990925 0.000538 0.004156 0.982797 0.000366 0.015539 0.001298 0.016760 0.002980 0.969991 0.010269 0.036013 0.725983 0.200022 0.037982 0.064755 0.104386 0.133891 0.696968 0.199404 0.263520 0.410228 0.126848 0.222648 0.351390 0.272575 0.153387 0.087778 0.206043 0.395671 0.310507 0.319643 0.144216 0.196041 0.340100 Consensus sequence: DABWWTGACAGCTVVBD Reverse complement motif 0.340100 0.144216 0.196041 0.319643 0.087778 0.395671 0.206043 0.310507 0.222648 0.272575 0.351390 0.153387 0.199404 0.410228 0.263520 0.126848 0.696968 0.104386 0.133891 0.064755 0.036013 0.200022 0.725983 0.037982 0.016760 0.969991 0.002980 0.010269 0.001298 0.000366 0.015539 0.982797 0.004381 0.000538 0.990925 0.004156 0.042078 0.000414 0.000890 0.956618 0.004489 0.992211 0.000729 0.002571 0.988048 0.003722 0.000495 0.007736 0.481403 0.068048 0.114050 0.336500 0.332716 0.052907 0.053508 0.560868 0.395807 0.207160 0.282464 0.114568 0.155673 0.124110 0.169608 0.550609 0.272977 0.284742 0.158875 0.283406 Consensus sequence: DBVVAGCTGTCAWWVTH Alignment: DBVVAGCTGTCAWWVTH ---AATCTGTTATT--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00203 Pknox1 Original Motif Reverse Complement Backward 4 11 0.037364 Species: Mus musculus Original motif 0.436259 0.086706 0.169714 0.307321 0.433826 0.063296 0.358082 0.144795 0.324190 0.284651 0.208786 0.182372 0.054648 0.285295 0.518967 0.141090 0.922874 0.012239 0.042656 0.022231 0.036668 0.581917 0.338993 0.042422 0.021599 0.968542 0.006920 0.002939 0.001846 0.026071 0.000271 0.971812 0.007232 0.000773 0.989645 0.002350 0.019103 0.005771 0.000209 0.974917 0.001535 0.989111 0.000852 0.008502 0.989698 0.000915 0.004907 0.004480 0.679114 0.077050 0.037931 0.205904 0.330007 0.110122 0.067993 0.491878 0.286458 0.421726 0.186579 0.105236 0.199258 0.473968 0.173008 0.153766 Consensus sequence: DRVSASCTGTCAAWVV Reverse complement motif 0.199258 0.173008 0.473968 0.153766 0.286458 0.186579 0.421726 0.105236 0.491878 0.110122 0.067993 0.330007 0.205904 0.077050 0.037931 0.679114 0.004480 0.000915 0.004907 0.989698 0.001535 0.000852 0.989111 0.008502 0.974917 0.005771 0.000209 0.019103 0.007232 0.989645 0.000773 0.002350 0.971812 0.026071 0.000271 0.001846 0.021599 0.006920 0.968542 0.002939 0.036668 0.338993 0.581917 0.042422 0.022231 0.012239 0.042656 0.922874 0.054648 0.518967 0.285295 0.141090 0.182372 0.284651 0.208786 0.324190 0.144795 0.063296 0.358082 0.433826 0.307321 0.086706 0.169714 0.436259 Consensus sequence: VVWTTGACAGSTSBKD Alignment: VVWTTGACAGSTSBKD --AATAACAGATT--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00258 Tgif2 Reverse Complement Original Motif Forward 4 11 0.040039 Species: Mus musculus Original motif 0.519684 0.141807 0.112153 0.226356 0.614097 0.079211 0.138045 0.168647 0.186975 0.327654 0.245051 0.240320 0.108289 0.303530 0.219106 0.369076 0.914812 0.012014 0.046628 0.026546 0.070482 0.163253 0.689315 0.076951 0.016354 0.972639 0.003648 0.007359 0.002043 0.018718 0.000384 0.978855 0.006109 0.001408 0.990736 0.001747 0.024783 0.002060 0.000402 0.972755 0.001485 0.991963 0.001756 0.004796 0.989335 0.001052 0.002320 0.007293 0.778804 0.056366 0.037632 0.127198 0.377980 0.094597 0.086888 0.440535 0.458125 0.289431 0.152762 0.099682 0.223103 0.435348 0.216962 0.124587 Consensus sequence: AABBAGCTGTCAAWVV Reverse complement motif 0.223103 0.216962 0.435348 0.124587 0.099682 0.289431 0.152762 0.458125 0.440535 0.094597 0.086888 0.377980 0.127198 0.056366 0.037632 0.778804 0.007293 0.001052 0.002320 0.989335 0.001485 0.001756 0.991963 0.004796 0.972755 0.002060 0.000402 0.024783 0.006109 0.990736 0.001408 0.001747 0.978855 0.018718 0.000384 0.002043 0.016354 0.003648 0.972639 0.007359 0.070482 0.689315 0.163253 0.076951 0.026546 0.012014 0.046628 0.914812 0.369076 0.303530 0.219106 0.108289 0.186975 0.245051 0.327654 0.240320 0.168647 0.079211 0.138045 0.614097 0.226356 0.141807 0.112153 0.519684 Consensus sequence: VBWTTGACAGCTVBTT Alignment: AABBAGCTGTCAAWVV ---AATCTGTTATT-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00166 Barhl1 Reverse Complement Reverse Complement Backward 1 11 0.040816 Species: Mus musculus Original motif 0.467514 0.210142 0.140580 0.181765 0.607254 0.124874 0.137587 0.130285 0.280889 0.423565 0.125411 0.170135 0.748944 0.067655 0.136796 0.046605 0.723747 0.023732 0.218759 0.033762 0.075749 0.608701 0.182230 0.133321 0.005053 0.764340 0.000825 0.229781 0.951342 0.006010 0.029473 0.013175 0.890431 0.010111 0.000910 0.098548 0.004275 0.001291 0.002113 0.992321 0.005850 0.006608 0.000432 0.987110 0.979314 0.000732 0.001996 0.017957 0.546971 0.034786 0.326876 0.091366 0.120451 0.194359 0.328320 0.356870 0.274765 0.177491 0.231888 0.315855 0.223913 0.420032 0.139775 0.216280 Consensus sequence: HAHAACCAATTARBDH Reverse complement motif 0.223913 0.139775 0.420032 0.216280 0.315855 0.177491 0.231888 0.274765 0.356870 0.194359 0.328320 0.120451 0.091366 0.034786 0.326876 0.546971 0.017957 0.000732 0.001996 0.979314 0.987110 0.006608 0.000432 0.005850 0.992321 0.001291 0.002113 0.004275 0.098548 0.010111 0.000910 0.890431 0.013175 0.006010 0.029473 0.951342 0.005053 0.000825 0.764340 0.229781 0.075749 0.182230 0.608701 0.133321 0.033762 0.023732 0.218759 0.723747 0.046605 0.067655 0.136796 0.748944 0.280889 0.125411 0.423565 0.170135 0.130285 0.124874 0.137587 0.607254 0.181765 0.210142 0.140580 0.467514 Consensus sequence: DDVKTAATTGGTTDTH Alignment: DDVKTAATTGGTTDTH -----AATCTGTTATT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00171 Msx3 Reverse Complement Reverse Complement Backward 1 11 0.040907 Species: Mus musculus Original motif 0.317812 0.352438 0.231628 0.098123 0.601471 0.133830 0.164947 0.099752 0.399508 0.293187 0.098524 0.208781 0.754569 0.054130 0.133622 0.057678 0.770469 0.088090 0.086904 0.054537 0.038689 0.673100 0.189096 0.099115 0.004935 0.522968 0.000482 0.471615 0.986316 0.001484 0.009222 0.002978 0.991636 0.005079 0.001457 0.001828 0.009156 0.001857 0.001081 0.987906 0.013688 0.006588 0.000191 0.979532 0.987635 0.000354 0.005166 0.006845 0.701095 0.027828 0.154852 0.116224 0.181731 0.184800 0.303458 0.330011 0.224816 0.221032 0.182405 0.371747 0.310539 0.208307 0.099081 0.382073 Consensus sequence: VAHAACYAATTAABHH Reverse complement motif 0.382073 0.208307 0.099081 0.310539 0.371747 0.221032 0.182405 0.224816 0.330011 0.184800 0.303458 0.181731 0.116224 0.027828 0.154852 0.701095 0.006845 0.000354 0.005166 0.987635 0.979532 0.006588 0.000191 0.013688 0.987906 0.001857 0.001081 0.009156 0.001828 0.005079 0.001457 0.991636 0.002978 0.001484 0.009222 0.986316 0.004935 0.000482 0.522968 0.471615 0.038689 0.189096 0.673100 0.099115 0.054537 0.088090 0.086904 0.770469 0.057678 0.054130 0.133622 0.754569 0.208781 0.293187 0.098524 0.399508 0.099752 0.133830 0.164947 0.601471 0.317812 0.231628 0.352438 0.098123 Consensus sequence: HHVTTAATTKGTTHTV Alignment: HHVTTAATTKGTTHTV -----AATCTGTTATT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00109 Obox6 Original Motif Original Motif Backward 5 11 0.041100 Species: Mus musculus Original motif 0.505449 0.243908 0.109355 0.141288 0.297413 0.206507 0.201510 0.294571 0.691300 0.037294 0.141216 0.130190 0.680730 0.092257 0.036853 0.190160 0.348071 0.118125 0.345388 0.188416 0.140809 0.605582 0.189427 0.064182 0.039008 0.001848 0.956724 0.002420 0.003771 0.000570 0.983421 0.012238 0.969153 0.028918 0.000574 0.001355 0.003106 0.002396 0.001479 0.993019 0.009026 0.012438 0.000393 0.978144 0.969731 0.000460 0.002034 0.027774 0.444629 0.020696 0.076200 0.458475 0.254738 0.341763 0.053351 0.350148 0.119131 0.226982 0.464626 0.189261 Consensus sequence: AHAADCGGATTAWHB Reverse complement motif 0.119131 0.464626 0.226982 0.189261 0.350148 0.341763 0.053351 0.254738 0.458475 0.020696 0.076200 0.444629 0.027774 0.000460 0.002034 0.969731 0.978144 0.012438 0.000393 0.009026 0.993019 0.002396 0.001479 0.003106 0.001355 0.028918 0.000574 0.969153 0.003771 0.983421 0.000570 0.012238 0.039008 0.956724 0.001848 0.002420 0.140809 0.189427 0.605582 0.064182 0.188416 0.118125 0.345388 0.348071 0.190160 0.092257 0.036853 0.680730 0.130190 0.037294 0.141216 0.691300 0.294571 0.206507 0.201510 0.297413 0.141288 0.243908 0.109355 0.505449 Consensus sequence: BHWTAATCCGDTTHT Alignment: AHAADCGGATTAWHB AATAACAGATT---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00205 Pknox2 Original Motif Reverse Complement Forward 3 11 0.043058 Species: Mus musculus Original motif 0.428425 0.195557 0.163102 0.212916 0.596487 0.103248 0.171370 0.128895 0.255216 0.203813 0.424426 0.116546 0.034183 0.441823 0.347767 0.176227 0.613880 0.025627 0.347719 0.012774 0.028636 0.551817 0.409264 0.010283 0.020873 0.969731 0.003025 0.006371 0.001171 0.039795 0.000323 0.958710 0.004303 0.001241 0.992873 0.001583 0.014490 0.007334 0.000309 0.977866 0.000873 0.991756 0.001920 0.005451 0.979609 0.000960 0.015793 0.003638 0.586289 0.199905 0.051181 0.162625 0.207586 0.157832 0.051564 0.583018 0.295651 0.262238 0.182998 0.259112 0.158213 0.267067 0.215259 0.359461 Consensus sequence: HAVSRSCTGTCAATHB Reverse complement motif 0.359461 0.267067 0.215259 0.158213 0.259112 0.262238 0.182998 0.295651 0.583018 0.157832 0.051564 0.207586 0.162625 0.199905 0.051181 0.586289 0.003638 0.000960 0.015793 0.979609 0.000873 0.001920 0.991756 0.005451 0.977866 0.007334 0.000309 0.014490 0.004303 0.992873 0.001241 0.001583 0.958710 0.039795 0.000323 0.001171 0.020873 0.003025 0.969731 0.006371 0.028636 0.409264 0.551817 0.010283 0.012774 0.025627 0.347719 0.613880 0.034183 0.347767 0.441823 0.176227 0.255216 0.424426 0.203813 0.116546 0.128895 0.103248 0.171370 0.596487 0.212916 0.195557 0.163102 0.428425 Consensus sequence: VHATTGACAGSKSVTH Alignment: VHATTGACAGSKSVTH --AATAACAGATT--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00081 Mybl1_primary Reverse Complement Original Motif Forward 5 11 0.043115 Species: Mus musculus Original motif 0.219490 0.243488 0.196239 0.340783 0.242096 0.094435 0.234242 0.429226 0.242319 0.155536 0.366023 0.236122 0.369837 0.185801 0.219486 0.224876 0.390568 0.211210 0.098244 0.299978 0.782192 0.011783 0.158354 0.047671 0.837985 0.006254 0.084522 0.071239 0.027255 0.965067 0.001360 0.006318 0.006706 0.831051 0.151462 0.010782 0.003491 0.002829 0.991758 0.001921 0.004195 0.009136 0.009776 0.976893 0.009860 0.166761 0.002159 0.821220 0.709623 0.006957 0.204415 0.079005 0.316262 0.239384 0.140024 0.304330 0.254660 0.237146 0.090326 0.417868 0.289939 0.309708 0.068038 0.332316 0.262670 0.214791 0.217375 0.305164 Consensus sequence: HDDDHAACCGTTAHHHD Reverse complement motif 0.305164 0.214791 0.217375 0.262670 0.332316 0.309708 0.068038 0.289939 0.417868 0.237146 0.090326 0.254660 0.304330 0.239384 0.140024 0.316262 0.079005 0.006957 0.204415 0.709623 0.821220 0.166761 0.002159 0.009860 0.976893 0.009136 0.009776 0.004195 0.003491 0.991758 0.002829 0.001921 0.006706 0.151462 0.831051 0.010782 0.027255 0.001360 0.965067 0.006318 0.071239 0.006254 0.084522 0.837985 0.047671 0.011783 0.158354 0.782192 0.299978 0.211210 0.098244 0.390568 0.224876 0.185801 0.219486 0.369837 0.242319 0.366023 0.155536 0.236122 0.429226 0.094435 0.234242 0.242096 0.340783 0.243488 0.196239 0.219490 Consensus sequence: DHHHTAACGGTTHDHDH Alignment: HDDDHAACCGTTAHHHD ----AATCTGTTATT-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 26 Motif name: Motif 26 Original motif 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.500000 0.000000 0.000000 0.500000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 Consensus sequence: CTGTTTTWAT Reserve complement motif 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.500000 0.000000 0.000000 0.500000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 Consensus sequence: ATWAAAACAG ************************************************************************ Best Matches for Motif ID 26 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00207 Hoxb9 Reverse Complement Original Motif Backward 1 10 0.030167 Species: Mus musculus Original motif 0.369205 0.191401 0.373182 0.066211 0.357429 0.160246 0.408701 0.073624 0.576965 0.069294 0.310696 0.043045 0.103797 0.127691 0.646641 0.121871 0.023188 0.657132 0.005598 0.314082 0.420260 0.543925 0.009350 0.026464 0.944117 0.003851 0.047375 0.004658 0.007642 0.006158 0.004106 0.982094 0.728623 0.003283 0.002505 0.265589 0.958302 0.002642 0.002614 0.036442 0.969909 0.004265 0.002650 0.023176 0.869075 0.011516 0.028466 0.090943 0.336102 0.198102 0.075230 0.390566 0.203557 0.271818 0.098338 0.426287 0.226605 0.448090 0.146026 0.179278 0.252426 0.177812 0.357334 0.212429 Consensus sequence: VRRGCMATAAAAHHHD Reverse complement motif 0.252426 0.357334 0.177812 0.212429 0.226605 0.146026 0.448090 0.179278 0.426287 0.271818 0.098338 0.203557 0.390566 0.198102 0.075230 0.336102 0.090943 0.011516 0.028466 0.869075 0.023176 0.004265 0.002650 0.969909 0.036442 0.002642 0.002614 0.958302 0.265589 0.003283 0.002505 0.728623 0.982094 0.006158 0.004106 0.007642 0.004658 0.003851 0.047375 0.944117 0.420260 0.009350 0.543925 0.026464 0.023188 0.005598 0.657132 0.314082 0.103797 0.646641 0.127691 0.121871 0.043045 0.069294 0.310696 0.576965 0.357429 0.408701 0.160246 0.073624 0.369205 0.373182 0.191401 0.066211 Consensus sequence: HDHHTTTTATRGCKMV Alignment: HDHHTTTTATRGCKMV ------ATWAAAACAG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00213 Hoxa9 Reverse Complement Original Motif Backward 2 10 0.032347 Species: Mus musculus Original motif 0.386110 0.122124 0.336396 0.155370 0.214951 0.503652 0.200027 0.081370 0.227199 0.070231 0.558705 0.143864 0.087364 0.155173 0.659970 0.097493 0.088468 0.597073 0.010847 0.303611 0.237567 0.630916 0.020446 0.111071 0.883692 0.003551 0.103622 0.009135 0.022994 0.004161 0.003712 0.969134 0.630635 0.007085 0.003697 0.358584 0.954551 0.003419 0.003818 0.038212 0.932582 0.012322 0.005304 0.049792 0.758713 0.022612 0.031347 0.187327 0.320450 0.163437 0.062031 0.454082 0.174953 0.127720 0.167458 0.529870 0.511837 0.131729 0.146649 0.209785 0.382191 0.090904 0.276475 0.250430 0.383323 0.080173 0.111038 0.425465 Consensus sequence: DCGGYCATWAAAWTADW Reverse complement motif 0.425465 0.080173 0.111038 0.383323 0.250430 0.090904 0.276475 0.382191 0.209785 0.131729 0.146649 0.511837 0.529870 0.127720 0.167458 0.174953 0.454082 0.163437 0.062031 0.320450 0.187327 0.022612 0.031347 0.758713 0.049792 0.012322 0.005304 0.932582 0.038212 0.003419 0.003818 0.954551 0.358584 0.007085 0.003697 0.630635 0.969134 0.004161 0.003712 0.022994 0.009135 0.003551 0.103622 0.883692 0.237567 0.020446 0.630916 0.111071 0.088468 0.010847 0.597073 0.303611 0.087364 0.659970 0.155173 0.097493 0.227199 0.558705 0.070231 0.143864 0.214951 0.200027 0.503652 0.081370 0.155370 0.122124 0.336396 0.386110 Consensus sequence: WDTAWTTTWATGKCCGD Alignment: DCGGYCATWAAAWTADW ------ATWAAAACAG- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00134 Hoxb13 Original Motif Reverse Complement Forward 1 10 0.036266 Species: Mus musculus Original motif 0.376100 0.272625 0.202253 0.149021 0.479072 0.116315 0.274952 0.129661 0.297412 0.328646 0.182054 0.191889 0.052067 0.771717 0.088083 0.088133 0.018222 0.666056 0.006952 0.308770 0.755568 0.122362 0.001339 0.120731 0.915413 0.001023 0.052340 0.031225 0.002612 0.028396 0.000695 0.968297 0.831092 0.001851 0.005615 0.161442 0.927869 0.001839 0.001169 0.069123 0.967747 0.009603 0.002871 0.019778 0.843186 0.073812 0.055868 0.027134 0.371084 0.143031 0.086222 0.399662 0.264976 0.212885 0.118960 0.403179 0.215633 0.345186 0.105518 0.333663 0.221910 0.297212 0.329310 0.151568 Consensus sequence: VRHCCAATAAAAWHHV Reverse complement motif 0.221910 0.329310 0.297212 0.151568 0.215633 0.105518 0.345186 0.333663 0.403179 0.212885 0.118960 0.264976 0.399662 0.143031 0.086222 0.371084 0.027134 0.073812 0.055868 0.843186 0.019778 0.009603 0.002871 0.967747 0.069123 0.001839 0.001169 0.927869 0.161442 0.001851 0.005615 0.831092 0.968297 0.028396 0.000695 0.002612 0.031225 0.001023 0.052340 0.915413 0.120731 0.122362 0.001339 0.755568 0.018222 0.006952 0.666056 0.308770 0.052067 0.088083 0.771717 0.088133 0.297412 0.182054 0.328646 0.191889 0.129661 0.116315 0.274952 0.479072 0.149021 0.272625 0.202253 0.376100 Consensus sequence: VDHWTTTTATTGGDKB Alignment: VRHCCAATAAAAWHHV CTGTTTTWAT------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00061 Foxl1_primary Original Motif Reverse Complement Forward 5 10 0.037282 Species: Mus musculus Original motif 0.323208 0.152915 0.185111 0.338766 0.428132 0.056109 0.099487 0.416272 0.659386 0.039965 0.035805 0.264843 0.647143 0.049206 0.078984 0.224667 0.208834 0.076592 0.071631 0.642943 0.341077 0.003865 0.649511 0.005547 0.016627 0.001866 0.001715 0.979792 0.952319 0.045294 0.000870 0.001516 0.988834 0.004620 0.000720 0.005826 0.989346 0.001005 0.006467 0.003182 0.001093 0.784230 0.001235 0.213442 0.991209 0.002017 0.001737 0.005037 0.801581 0.037084 0.023060 0.138274 0.528554 0.089350 0.107501 0.274595 0.208802 0.268646 0.368022 0.154530 0.280218 0.221367 0.340497 0.157918 0.146611 0.250725 0.293524 0.309140 Consensus sequence: DWAATRTAAACAAWVVB Reverse complement motif 0.309140 0.250725 0.293524 0.146611 0.280218 0.340497 0.221367 0.157918 0.208802 0.368022 0.268646 0.154530 0.274595 0.089350 0.107501 0.528554 0.138274 0.037084 0.023060 0.801581 0.005037 0.002017 0.001737 0.991209 0.001093 0.001235 0.784230 0.213442 0.003182 0.001005 0.006467 0.989346 0.005826 0.004620 0.000720 0.988834 0.001516 0.045294 0.000870 0.952319 0.979792 0.001866 0.001715 0.016627 0.341077 0.649511 0.003865 0.005547 0.642943 0.076592 0.071631 0.208834 0.224667 0.049206 0.078984 0.647143 0.264843 0.039965 0.035805 0.659386 0.416272 0.056109 0.099487 0.428132 0.338766 0.152915 0.185111 0.323208 Consensus sequence: VVVWTTGTTTAMATTWD Alignment: VVVWTTGTTTAMATTWD ----CTGTTTTWAT--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00025 Foxk1_primary Original Motif Reverse Complement Forward 5 10 0.038678 Species: Mus musculus Original motif 0.338172 0.192194 0.207817 0.261817 0.407924 0.117261 0.278236 0.196580 0.595570 0.070480 0.119221 0.214729 0.710845 0.038748 0.052600 0.197807 0.124647 0.116138 0.178053 0.581162 0.201602 0.005514 0.792110 0.000774 0.024590 0.004193 0.001331 0.969886 0.919465 0.077871 0.000760 0.001904 0.972342 0.010395 0.000580 0.016683 0.991045 0.001495 0.003585 0.003875 0.001358 0.885197 0.000980 0.112465 0.990318 0.001846 0.002968 0.004867 0.804563 0.063147 0.023496 0.108795 0.564824 0.087976 0.102865 0.244336 0.269947 0.300278 0.285008 0.144767 0.337905 0.220102 0.253694 0.188299 0.153781 0.274135 0.318343 0.253741 Consensus sequence: DDAATGTAAACAAAVVB Reverse complement motif 0.153781 0.318343 0.274135 0.253741 0.188299 0.220102 0.253694 0.337905 0.269947 0.285008 0.300278 0.144767 0.244336 0.087976 0.102865 0.564824 0.108795 0.063147 0.023496 0.804563 0.004867 0.001846 0.002968 0.990318 0.001358 0.000980 0.885197 0.112465 0.003875 0.001495 0.003585 0.991045 0.016683 0.010395 0.000580 0.972342 0.001904 0.077871 0.000760 0.919465 0.969886 0.004193 0.001331 0.024590 0.201602 0.792110 0.005514 0.000774 0.581162 0.116138 0.178053 0.124647 0.197807 0.038748 0.052600 0.710845 0.214729 0.070480 0.119221 0.595570 0.196580 0.117261 0.278236 0.407924 0.261817 0.192194 0.207817 0.338172 Consensus sequence: BBVTTTGTTTACATTDD Alignment: BBVTTTGTTTACATTDD ----CTGTTTTWAT--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00180 Hoxd13 Reverse Complement Original Motif Backward 1 10 0.039027 Species: Mus musculus Original motif 0.279189 0.316791 0.190404 0.213616 0.297705 0.175638 0.191020 0.335637 0.333485 0.203858 0.174034 0.288623 0.046444 0.540349 0.083237 0.329969 0.016780 0.648667 0.003870 0.330682 0.679959 0.116873 0.002745 0.200422 0.936496 0.002013 0.026876 0.034615 0.004741 0.008734 0.003861 0.982665 0.904624 0.000869 0.005345 0.089162 0.967883 0.002295 0.001003 0.028819 0.980087 0.004768 0.002887 0.012258 0.898523 0.041633 0.022776 0.037069 0.246903 0.292446 0.069240 0.391411 0.192528 0.300908 0.105655 0.400908 0.247610 0.343317 0.190760 0.218313 0.246702 0.253595 0.176298 0.323404 Consensus sequence: HDHYYAATAAAAHHHH Reverse complement motif 0.323404 0.253595 0.176298 0.246702 0.247610 0.190760 0.343317 0.218313 0.400908 0.300908 0.105655 0.192528 0.391411 0.292446 0.069240 0.246903 0.037069 0.041633 0.022776 0.898523 0.012258 0.004768 0.002887 0.980087 0.028819 0.002295 0.001003 0.967883 0.089162 0.000869 0.005345 0.904624 0.982665 0.008734 0.003861 0.004741 0.034615 0.002013 0.026876 0.936496 0.200422 0.116873 0.002745 0.679959 0.016780 0.003870 0.648667 0.330682 0.046444 0.083237 0.540349 0.329969 0.288623 0.203858 0.174034 0.333485 0.335637 0.175638 0.191020 0.297705 0.279189 0.190404 0.316791 0.213616 Consensus sequence: HDHHTTTTATTKKHDD Alignment: HDHHTTTTATTKKHDD ------ATWAAAACAG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00025 Foxk1_secondary Original Motif Reverse Complement Forward 3 10 0.039676 Species: Mus musculus Original motif 0.240753 0.425595 0.141281 0.192371 0.367715 0.247224 0.117353 0.267708 0.489169 0.220343 0.113844 0.176644 0.742256 0.042809 0.146704 0.068231 0.078936 0.546144 0.032328 0.342592 0.588419 0.293580 0.082117 0.035885 0.913924 0.026256 0.050778 0.009042 0.009007 0.565680 0.010683 0.414630 0.947562 0.020878 0.018821 0.012739 0.901384 0.021519 0.030204 0.046893 0.077157 0.797900 0.026432 0.098511 0.824314 0.040128 0.051910 0.083648 0.254436 0.342235 0.143789 0.259539 0.319400 0.338163 0.129746 0.212691 0.231014 0.260719 0.169042 0.339225 Consensus sequence: HHHAYAAYAACAHHH Reverse complement motif 0.339225 0.260719 0.169042 0.231014 0.319400 0.129746 0.338163 0.212691 0.254436 0.143789 0.342235 0.259539 0.083648 0.040128 0.051910 0.824314 0.077157 0.026432 0.797900 0.098511 0.046893 0.021519 0.030204 0.901384 0.012739 0.020878 0.018821 0.947562 0.009007 0.010683 0.565680 0.414630 0.009042 0.026256 0.050778 0.913924 0.035885 0.293580 0.082117 0.588419 0.078936 0.032328 0.546144 0.342592 0.068231 0.042809 0.146704 0.742256 0.176644 0.220343 0.113844 0.489169 0.267708 0.247224 0.117353 0.367715 0.240753 0.141281 0.425595 0.192371 Consensus sequence: HDDTGTTKTTKTHHD Alignment: HDDTGTTKTTKTHHD --CTGTTTTWAT--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00121 Hoxd10 Original Motif Reverse Complement Backward 7 10 0.045026 Species: Mus musculus Original motif 0.405345 0.293266 0.220907 0.080482 0.398063 0.099034 0.333525 0.169378 0.049753 0.190411 0.336789 0.423048 0.243698 0.226261 0.324346 0.205696 0.030873 0.549741 0.008321 0.411065 0.714225 0.228092 0.020960 0.036723 0.833992 0.010944 0.021918 0.133146 0.008898 0.026169 0.008341 0.956591 0.811684 0.004889 0.004751 0.178676 0.952107 0.004322 0.004587 0.038984 0.925365 0.008360 0.006811 0.059464 0.850659 0.058250 0.065237 0.025855 0.193369 0.242985 0.049515 0.514131 0.266774 0.080601 0.239781 0.412844 0.335522 0.125500 0.188170 0.350809 0.407171 0.120540 0.187300 0.284989 0.281181 0.242348 0.160247 0.316224 Consensus sequence: VDKVYAATAAAATDDDH Reverse complement motif 0.316224 0.242348 0.160247 0.281181 0.284989 0.120540 0.187300 0.407171 0.350809 0.125500 0.188170 0.335522 0.412844 0.080601 0.239781 0.266774 0.514131 0.242985 0.049515 0.193369 0.025855 0.058250 0.065237 0.850659 0.059464 0.008360 0.006811 0.925365 0.038984 0.004322 0.004587 0.952107 0.178676 0.004889 0.004751 0.811684 0.956591 0.026169 0.008341 0.008898 0.133146 0.010944 0.021918 0.833992 0.036723 0.228092 0.020960 0.714225 0.030873 0.008321 0.549741 0.411065 0.243698 0.324346 0.226261 0.205696 0.423048 0.190411 0.336789 0.049753 0.169378 0.099034 0.333525 0.398063 0.080482 0.293266 0.220907 0.405345 Consensus sequence: HDDDATTTTATTKVRDB Alignment: HDDDATTTTATTKVRDB -CTGTTTTWAT------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00061 Foxl1_secondary Reverse Complement Original Motif Forward 3 10 0.045144 Species: Mus musculus Original motif 0.560226 0.121586 0.083231 0.234957 0.318077 0.149137 0.179955 0.352831 0.482497 0.118420 0.173594 0.225488 0.200166 0.160901 0.191493 0.447440 0.033691 0.569719 0.018901 0.377690 0.638020 0.166545 0.021254 0.174181 0.573953 0.105729 0.009308 0.311010 0.890518 0.053364 0.013424 0.042694 0.910758 0.028166 0.032648 0.028428 0.013358 0.738707 0.023981 0.223953 0.911783 0.018754 0.031898 0.037564 0.702891 0.068940 0.076823 0.151346 0.445507 0.320769 0.057216 0.176507 0.587798 0.129586 0.140592 0.142024 0.258981 0.330939 0.167334 0.242747 0.362022 0.333796 0.145861 0.158320 Consensus sequence: ADDDYAWAACAAMAHH Reverse complement motif 0.158320 0.333796 0.145861 0.362022 0.258981 0.167334 0.330939 0.242747 0.142024 0.129586 0.140592 0.587798 0.176507 0.320769 0.057216 0.445507 0.151346 0.068940 0.076823 0.702891 0.037564 0.018754 0.031898 0.911783 0.013358 0.023981 0.738707 0.223953 0.028428 0.028166 0.032648 0.910758 0.042694 0.053364 0.013424 0.890518 0.311010 0.105729 0.009308 0.573953 0.174181 0.166545 0.021254 0.638020 0.033691 0.018901 0.569719 0.377690 0.447440 0.160901 0.191493 0.200166 0.225488 0.118420 0.173594 0.482497 0.352831 0.149137 0.179955 0.318077 0.234957 0.121586 0.083231 0.560226 Consensus sequence: HDTYTTGTTWTKDDDT Alignment: ADDDYAWAACAAMAHH --ATWAAAACAG---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00101 Sox12_primary Reverse Complement Reverse Complement Backward 4 10 0.045236 Species: Mus musculus Original motif 0.124600 0.227558 0.113860 0.533982 0.416814 0.237036 0.025428 0.320722 0.844859 0.004610 0.009822 0.140710 0.010799 0.012156 0.010273 0.966772 0.021911 0.002662 0.007268 0.968159 0.047515 0.012476 0.926393 0.013616 0.024161 0.004368 0.005622 0.965849 0.035551 0.063776 0.023058 0.877615 0.227803 0.424131 0.175089 0.172976 0.158486 0.110477 0.070431 0.660606 0.290539 0.259108 0.202704 0.247648 0.565848 0.109529 0.105361 0.219261 0.421399 0.149322 0.091821 0.337459 0.272834 0.280517 0.197403 0.249246 Consensus sequence: THATTGTTVTHAWH Reverse complement motif 0.272834 0.197403 0.280517 0.249246 0.337459 0.149322 0.091821 0.421399 0.219261 0.109529 0.105361 0.565848 0.247648 0.259108 0.202704 0.290539 0.660606 0.110477 0.070431 0.158486 0.227803 0.175089 0.424131 0.172976 0.877615 0.063776 0.023058 0.035551 0.965849 0.004368 0.005622 0.024161 0.047515 0.926393 0.012476 0.013616 0.968159 0.002662 0.007268 0.021911 0.966772 0.012156 0.010273 0.010799 0.140710 0.004610 0.009822 0.844859 0.320722 0.237036 0.025428 0.416814 0.533982 0.227558 0.113860 0.124600 Consensus sequence: DWTHAVAACAATHA Alignment: DWTHAVAACAATHA -ATWAAAACAG--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 27 Motif name: Motif 27 Original motif 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.500000 0.000000 0.500000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 Consensus sequence: ATTCTGTRAAG Reserve complement motif 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.500000 0.500000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 Consensus sequence: CTTKACAGAAT ************************************************************************ Best Matches for Motif ID 27 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00193 Rhox11_2205.1 Original Motif Original Motif Backward 4 11 0.022933 Species: Mus musculus Original motif 0.504898 0.140204 0.135418 0.219480 0.282348 0.244881 0.300572 0.172199 0.183939 0.100670 0.384783 0.330608 0.326709 0.269523 0.194043 0.209724 0.142989 0.557393 0.066826 0.232792 0.038356 0.014052 0.932450 0.015142 0.092102 0.778844 0.125082 0.003972 0.010254 0.001252 0.005231 0.983263 0.033486 0.000891 0.947486 0.018137 0.005360 0.007407 0.003729 0.983504 0.603485 0.007179 0.003482 0.385853 0.798026 0.029788 0.032370 0.139816 0.529622 0.100632 0.016507 0.353238 0.243581 0.126094 0.401402 0.228923 0.207484 0.285456 0.353715 0.153346 0.282413 0.188410 0.441463 0.087715 0.422774 0.152965 0.094106 0.330155 Consensus sequence: AVDHCGCTGTWAWDVVW Reverse complement motif 0.330155 0.152965 0.094106 0.422774 0.282413 0.441463 0.188410 0.087715 0.207484 0.353715 0.285456 0.153346 0.243581 0.401402 0.126094 0.228923 0.353238 0.100632 0.016507 0.529622 0.139816 0.029788 0.032370 0.798026 0.385853 0.007179 0.003482 0.603485 0.983504 0.007407 0.003729 0.005360 0.033486 0.947486 0.000891 0.018137 0.983263 0.001252 0.005231 0.010254 0.092102 0.125082 0.778844 0.003972 0.038356 0.932450 0.014052 0.015142 0.142989 0.066826 0.557393 0.232792 0.209724 0.269523 0.194043 0.326709 0.183939 0.384783 0.100670 0.330608 0.282348 0.300572 0.244881 0.172199 0.219480 0.140204 0.135418 0.504898 Consensus sequence: WVVHWTWACAGCGHHVT Alignment: AVDHCGCTGTWAWDVVW ---ATTCTGTRAAG--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00186 Meis1 Reverse Complement Reverse Complement Backward 4 11 0.023155 Species: Mus musculus Original motif 0.432115 0.114994 0.130835 0.322056 0.508081 0.060822 0.214256 0.216841 0.225875 0.276028 0.280982 0.217115 0.092373 0.286687 0.360933 0.260007 0.947172 0.005937 0.028595 0.018297 0.027829 0.439935 0.505051 0.027185 0.023801 0.963424 0.008205 0.004571 0.001548 0.018215 0.000406 0.979831 0.008422 0.001124 0.989007 0.001446 0.025343 0.004094 0.000241 0.970323 0.001451 0.992789 0.002037 0.003724 0.991202 0.001638 0.003159 0.004002 0.695910 0.022145 0.013657 0.268288 0.357895 0.090931 0.093796 0.457378 0.453163 0.204395 0.181067 0.161376 0.200615 0.393437 0.171398 0.234551 Consensus sequence: WAVBASCTGTCAAWVH Reverse complement motif 0.200615 0.171398 0.393437 0.234551 0.161376 0.204395 0.181067 0.453163 0.457378 0.090931 0.093796 0.357895 0.268288 0.022145 0.013657 0.695910 0.004002 0.001638 0.003159 0.991202 0.001451 0.002037 0.992789 0.003724 0.970323 0.004094 0.000241 0.025343 0.008422 0.989007 0.001124 0.001446 0.979831 0.018215 0.000406 0.001548 0.023801 0.008205 0.963424 0.004571 0.027829 0.505051 0.439935 0.027185 0.018297 0.005937 0.028595 0.947172 0.092373 0.360933 0.286687 0.260007 0.225875 0.280982 0.276028 0.217115 0.216841 0.060822 0.214256 0.508081 0.322056 0.114994 0.130835 0.432115 Consensus sequence: DBWTTGACAGSTBVTW Alignment: DBWTTGACAGSTBVTW --CTTKACAGAAT--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00258 Tgif2 Reverse Complement Reverse Complement Forward 3 11 0.023216 Species: Mus musculus Original motif 0.519684 0.141807 0.112153 0.226356 0.614097 0.079211 0.138045 0.168647 0.186975 0.327654 0.245051 0.240320 0.108289 0.303530 0.219106 0.369076 0.914812 0.012014 0.046628 0.026546 0.070482 0.163253 0.689315 0.076951 0.016354 0.972639 0.003648 0.007359 0.002043 0.018718 0.000384 0.978855 0.006109 0.001408 0.990736 0.001747 0.024783 0.002060 0.000402 0.972755 0.001485 0.991963 0.001756 0.004796 0.989335 0.001052 0.002320 0.007293 0.778804 0.056366 0.037632 0.127198 0.377980 0.094597 0.086888 0.440535 0.458125 0.289431 0.152762 0.099682 0.223103 0.435348 0.216962 0.124587 Consensus sequence: AABBAGCTGTCAAWVV Reverse complement motif 0.223103 0.216962 0.435348 0.124587 0.099682 0.289431 0.152762 0.458125 0.440535 0.094597 0.086888 0.377980 0.127198 0.056366 0.037632 0.778804 0.007293 0.001052 0.002320 0.989335 0.001485 0.001756 0.991963 0.004796 0.972755 0.002060 0.000402 0.024783 0.006109 0.990736 0.001408 0.001747 0.978855 0.018718 0.000384 0.002043 0.016354 0.003648 0.972639 0.007359 0.070482 0.689315 0.163253 0.076951 0.026546 0.012014 0.046628 0.914812 0.369076 0.303530 0.219106 0.108289 0.186975 0.245051 0.327654 0.240320 0.168647 0.079211 0.138045 0.614097 0.226356 0.141807 0.112153 0.519684 Consensus sequence: VBWTTGACAGCTVBTT Alignment: VBWTTGACAGCTVBTT --CTTKACAGAAT--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00012 Bbx_primary Original Motif Original Motif Forward 3 11 0.023325 Species: Mus musculus Original motif 0.243561 0.194936 0.123150 0.438353 0.606538 0.159878 0.056476 0.177109 0.460256 0.141315 0.215237 0.183192 0.134434 0.033508 0.053304 0.778753 0.091333 0.019966 0.020704 0.867997 0.136284 0.753571 0.062560 0.047585 0.917109 0.031475 0.015472 0.035944 0.452244 0.084890 0.121698 0.341168 0.035944 0.015472 0.031475 0.917109 0.047585 0.062560 0.753571 0.136284 0.867997 0.020704 0.019966 0.091333 0.778753 0.053304 0.033508 0.134434 0.123705 0.284125 0.353361 0.238808 0.291282 0.126574 0.120737 0.461406 0.330626 0.062565 0.348868 0.257941 Consensus sequence: HADTTCAWTGAABWD Reverse complement motif 0.330626 0.348868 0.062565 0.257941 0.461406 0.126574 0.120737 0.291282 0.123705 0.353361 0.284125 0.238808 0.134434 0.053304 0.033508 0.778753 0.091333 0.020704 0.019966 0.867997 0.047585 0.753571 0.062560 0.136284 0.917109 0.015472 0.031475 0.035944 0.341168 0.084890 0.121698 0.452244 0.035944 0.031475 0.015472 0.917109 0.136284 0.062560 0.753571 0.047585 0.867997 0.019966 0.020704 0.091333 0.778753 0.033508 0.053304 0.134434 0.183192 0.141315 0.215237 0.460256 0.177109 0.159878 0.056476 0.606538 0.438353 0.194936 0.123150 0.243561 Consensus sequence: HWBTTCAWTGAADTH Alignment: HADTTCAWTGAABWD --ATTCTGTRAAG-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00226 Mrg1 Reverse Complement Reverse Complement Backward 4 11 0.023976 Species: Mus musculus Original motif 0.378836 0.145096 0.102046 0.374022 0.507161 0.090730 0.177058 0.225051 0.277496 0.234581 0.275775 0.212149 0.065300 0.339403 0.360939 0.234358 0.918963 0.010948 0.043262 0.026826 0.017295 0.545133 0.416603 0.020969 0.023391 0.962223 0.007311 0.007075 0.001760 0.020258 0.000360 0.977622 0.013946 0.000586 0.983699 0.001769 0.035910 0.004825 0.000197 0.959068 0.001465 0.991446 0.001338 0.005750 0.986785 0.001158 0.005848 0.006209 0.715894 0.043046 0.018966 0.222093 0.332332 0.084841 0.098421 0.484405 0.473739 0.198580 0.152072 0.175610 0.211505 0.325971 0.212211 0.250313 Consensus sequence: WAVBASCTGTCAAWHB Reverse complement motif 0.211505 0.212211 0.325971 0.250313 0.175610 0.198580 0.152072 0.473739 0.484405 0.084841 0.098421 0.332332 0.222093 0.043046 0.018966 0.715894 0.006209 0.001158 0.005848 0.986785 0.001465 0.001338 0.991446 0.005750 0.959068 0.004825 0.000197 0.035910 0.013946 0.983699 0.000586 0.001769 0.977622 0.020258 0.000360 0.001760 0.023391 0.007311 0.962223 0.007075 0.017295 0.416603 0.545133 0.020969 0.026826 0.010948 0.043262 0.918963 0.065300 0.360939 0.339403 0.234358 0.212149 0.234581 0.275775 0.277496 0.225051 0.090730 0.177058 0.507161 0.374022 0.145096 0.102046 0.378836 Consensus sequence: BHWTTGACAGSTBBTW Alignment: BHWTTGACAGSTBBTW --CTTKACAGAAT--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00203 Pknox1 Reverse Complement Reverse Complement Backward 4 11 0.025386 Species: Mus musculus Original motif 0.436259 0.086706 0.169714 0.307321 0.433826 0.063296 0.358082 0.144795 0.324190 0.284651 0.208786 0.182372 0.054648 0.285295 0.518967 0.141090 0.922874 0.012239 0.042656 0.022231 0.036668 0.581917 0.338993 0.042422 0.021599 0.968542 0.006920 0.002939 0.001846 0.026071 0.000271 0.971812 0.007232 0.000773 0.989645 0.002350 0.019103 0.005771 0.000209 0.974917 0.001535 0.989111 0.000852 0.008502 0.989698 0.000915 0.004907 0.004480 0.679114 0.077050 0.037931 0.205904 0.330007 0.110122 0.067993 0.491878 0.286458 0.421726 0.186579 0.105236 0.199258 0.473968 0.173008 0.153766 Consensus sequence: DRVSASCTGTCAAWVV Reverse complement motif 0.199258 0.173008 0.473968 0.153766 0.286458 0.186579 0.421726 0.105236 0.491878 0.110122 0.067993 0.330007 0.205904 0.077050 0.037931 0.679114 0.004480 0.000915 0.004907 0.989698 0.001535 0.000852 0.989111 0.008502 0.974917 0.005771 0.000209 0.019103 0.007232 0.989645 0.000773 0.002350 0.971812 0.026071 0.000271 0.001846 0.021599 0.006920 0.968542 0.002939 0.036668 0.338993 0.581917 0.042422 0.022231 0.012239 0.042656 0.922874 0.054648 0.518967 0.285295 0.141090 0.182372 0.284651 0.208786 0.324190 0.144795 0.063296 0.358082 0.433826 0.307321 0.086706 0.169714 0.436259 Consensus sequence: VVWTTGACAGSTSBKD Alignment: VVWTTGACAGSTSBKD --CTTKACAGAAT--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00193 Rhox11_1765.2 Original Motif Original Motif Backward 4 11 0.025945 Species: Mus musculus Original motif 0.538735 0.129821 0.147336 0.184107 0.331267 0.275123 0.227609 0.166001 0.174654 0.113319 0.383610 0.328417 0.296734 0.281670 0.230068 0.191527 0.128222 0.561296 0.062928 0.247554 0.027028 0.014676 0.949335 0.008962 0.087209 0.761581 0.147964 0.003246 0.006796 0.000741 0.006037 0.986427 0.039496 0.000533 0.943453 0.016517 0.005541 0.005164 0.002805 0.986489 0.561957 0.002761 0.004207 0.431075 0.780197 0.037155 0.031222 0.151425 0.518642 0.104220 0.012670 0.364468 0.314451 0.111366 0.333508 0.240676 0.236936 0.357992 0.280813 0.124259 0.314846 0.163774 0.426195 0.095185 0.408340 0.134111 0.102987 0.354562 Consensus sequence: AVDVCGCTGTWAWDVVW Reverse complement motif 0.354562 0.134111 0.102987 0.408340 0.314846 0.426195 0.163774 0.095185 0.236936 0.280813 0.357992 0.124259 0.314451 0.333508 0.111366 0.240676 0.364468 0.104220 0.012670 0.518642 0.151425 0.037155 0.031222 0.780197 0.431075 0.002761 0.004207 0.561957 0.986489 0.005164 0.002805 0.005541 0.039496 0.943453 0.000533 0.016517 0.986427 0.000741 0.006037 0.006796 0.087209 0.147964 0.761581 0.003246 0.027028 0.949335 0.014676 0.008962 0.128222 0.062928 0.561296 0.247554 0.191527 0.281670 0.230068 0.296734 0.174654 0.383610 0.113319 0.328417 0.166001 0.275123 0.227609 0.331267 0.184107 0.129821 0.147336 0.538735 Consensus sequence: WVVHWTWACAGCGBHBT Alignment: AVDVCGCTGTWAWDVVW ---ATTCTGTRAAG--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00205 Pknox2 Reverse Complement Reverse Complement Forward 3 11 0.026439 Species: Mus musculus Original motif 0.428425 0.195557 0.163102 0.212916 0.596487 0.103248 0.171370 0.128895 0.255216 0.203813 0.424426 0.116546 0.034183 0.441823 0.347767 0.176227 0.613880 0.025627 0.347719 0.012774 0.028636 0.551817 0.409264 0.010283 0.020873 0.969731 0.003025 0.006371 0.001171 0.039795 0.000323 0.958710 0.004303 0.001241 0.992873 0.001583 0.014490 0.007334 0.000309 0.977866 0.000873 0.991756 0.001920 0.005451 0.979609 0.000960 0.015793 0.003638 0.586289 0.199905 0.051181 0.162625 0.207586 0.157832 0.051564 0.583018 0.295651 0.262238 0.182998 0.259112 0.158213 0.267067 0.215259 0.359461 Consensus sequence: HAVSRSCTGTCAATHB Reverse complement motif 0.359461 0.267067 0.215259 0.158213 0.259112 0.262238 0.182998 0.295651 0.583018 0.157832 0.051564 0.207586 0.162625 0.199905 0.051181 0.586289 0.003638 0.000960 0.015793 0.979609 0.000873 0.001920 0.991756 0.005451 0.977866 0.007334 0.000309 0.014490 0.004303 0.992873 0.001241 0.001583 0.958710 0.039795 0.000323 0.001171 0.020873 0.003025 0.969731 0.006371 0.028636 0.409264 0.551817 0.010283 0.012774 0.025627 0.347719 0.613880 0.034183 0.347767 0.441823 0.176227 0.255216 0.424426 0.203813 0.116546 0.128895 0.103248 0.171370 0.596487 0.212916 0.195557 0.163102 0.428425 Consensus sequence: VHATTGACAGSKSVTH Alignment: VHATTGACAGSKSVTH --CTTKACAGAAT--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00055 Hbp1_primary Reverse Complement Original Motif Backward 4 11 0.028797 Species: Mus musculus Original motif 0.348694 0.177225 0.158977 0.315104 0.241477 0.301470 0.225252 0.231801 0.299530 0.177310 0.188699 0.334462 0.413829 0.141414 0.102784 0.341973 0.032644 0.017968 0.004577 0.944811 0.021091 0.330699 0.642563 0.005647 0.969224 0.001914 0.005956 0.022906 0.969063 0.003485 0.003398 0.024054 0.013104 0.003523 0.002842 0.980532 0.005485 0.020244 0.932599 0.041672 0.757494 0.002617 0.231695 0.008193 0.865658 0.039206 0.073039 0.022097 0.110535 0.114879 0.043620 0.730965 0.186322 0.154540 0.442471 0.216667 0.366490 0.152622 0.256688 0.224200 0.216146 0.261309 0.238703 0.283842 Consensus sequence: HHDWTSAATGAATDDB Reverse complement motif 0.283842 0.261309 0.238703 0.216146 0.224200 0.152622 0.256688 0.366490 0.186322 0.442471 0.154540 0.216667 0.730965 0.114879 0.043620 0.110535 0.022097 0.039206 0.073039 0.865658 0.008193 0.002617 0.231695 0.757494 0.005485 0.932599 0.020244 0.041672 0.980532 0.003523 0.002842 0.013104 0.024054 0.003485 0.003398 0.969063 0.022906 0.001914 0.005956 0.969224 0.021091 0.642563 0.330699 0.005647 0.944811 0.017968 0.004577 0.032644 0.341973 0.141414 0.102784 0.413829 0.334462 0.177310 0.188699 0.299530 0.241477 0.225252 0.301470 0.231801 0.315104 0.177225 0.158977 0.348694 Consensus sequence: VDHATTCATTSAWDDH Alignment: HHDWTSAATGAATDDB --CTTKACAGAAT--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00210 Mrg2 Reverse Complement Reverse Complement Forward 3 11 0.028903 Species: Mus musculus Original motif 0.451361 0.129344 0.139593 0.279702 0.590642 0.061045 0.179638 0.168676 0.264848 0.211505 0.252514 0.271134 0.108876 0.280056 0.299987 0.311081 0.771098 0.021050 0.148609 0.059244 0.030292 0.505912 0.423702 0.040094 0.053400 0.869563 0.021964 0.055073 0.001749 0.029333 0.000487 0.968430 0.007267 0.000536 0.989450 0.002747 0.031237 0.006659 0.000558 0.961545 0.001520 0.992342 0.001637 0.004501 0.976582 0.004910 0.010811 0.007697 0.640869 0.062002 0.032830 0.264299 0.318843 0.128253 0.123096 0.429808 0.432137 0.269895 0.155457 0.142512 0.247124 0.427480 0.147164 0.178233 Consensus sequence: DADBASCTGTCAAHVH Reverse complement motif 0.247124 0.147164 0.427480 0.178233 0.142512 0.269895 0.155457 0.432137 0.429808 0.128253 0.123096 0.318843 0.264299 0.062002 0.032830 0.640869 0.007697 0.004910 0.010811 0.976582 0.001520 0.001637 0.992342 0.004501 0.961545 0.006659 0.000558 0.031237 0.007267 0.989450 0.000536 0.002747 0.968430 0.029333 0.000487 0.001749 0.053400 0.021964 0.869563 0.055073 0.030292 0.423702 0.505912 0.040094 0.059244 0.021050 0.148609 0.771098 0.311081 0.280056 0.299987 0.108876 0.271134 0.211505 0.252514 0.264848 0.168676 0.061045 0.179638 0.590642 0.279702 0.129344 0.139593 0.451361 Consensus sequence: DBHTTGACAGSTVDTD Alignment: DBHTTGACAGSTVDTD --CTTKACAGAAT--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 28 Motif name: Motif 28 Original motif 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 Consensus sequence: ATTTAGTAAA Reserve complement motif 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 Consensus sequence: TTTACTAAAT ************************************************************************ Best Matches for Motif ID 28 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00130 Lhx3 Reverse Complement Reverse Complement Backward 4 10 0.002713 Species: Mus musculus Original motif 0.226746 0.289244 0.371785 0.112225 0.256971 0.229670 0.248726 0.264633 0.556784 0.228344 0.038490 0.176382 0.631659 0.088282 0.196624 0.083434 0.021306 0.098213 0.006109 0.874373 0.016974 0.029949 0.000343 0.952734 0.971885 0.004194 0.023228 0.000693 0.983076 0.001653 0.004793 0.010478 0.010478 0.004793 0.001653 0.983076 0.000693 0.023228 0.004194 0.971885 0.952734 0.000343 0.029949 0.016974 0.874373 0.006109 0.098213 0.021306 0.425814 0.086548 0.127397 0.360241 0.343977 0.034349 0.079320 0.542354 0.412597 0.281154 0.077380 0.228869 0.338396 0.315969 0.106509 0.239127 0.112285 0.233324 0.310745 0.343646 Consensus sequence: VDAATTAATTAAWWHHB Reverse complement motif 0.343646 0.233324 0.310745 0.112285 0.239127 0.315969 0.106509 0.338396 0.228869 0.281154 0.077380 0.412597 0.542354 0.034349 0.079320 0.343977 0.360241 0.086548 0.127397 0.425814 0.021306 0.006109 0.098213 0.874373 0.016974 0.000343 0.029949 0.952734 0.971885 0.023228 0.004194 0.000693 0.983076 0.004793 0.001653 0.010478 0.010478 0.001653 0.004793 0.983076 0.000693 0.004194 0.023228 0.971885 0.952734 0.029949 0.000343 0.016974 0.874373 0.098213 0.006109 0.021306 0.083434 0.088282 0.196624 0.631659 0.176382 0.228344 0.038490 0.556784 0.264633 0.229670 0.248726 0.256971 0.226746 0.371785 0.289244 0.112225 Consensus sequence: VHHWWTTAATTAATTDV Alignment: VHHWWTTAATTAATTDV ----TTTACTAAAT--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00082 Zfp187_primary Original Motif Reverse Complement Backward 4 10 0.002754 Species: Mus musculus Original motif 0.190539 0.277187 0.240231 0.292043 0.132707 0.187246 0.111293 0.568754 0.936112 0.021141 0.033932 0.008815 0.012721 0.023350 0.004164 0.959765 0.007185 0.002386 0.987110 0.003318 0.059134 0.009005 0.034016 0.897845 0.900906 0.002575 0.086677 0.009842 0.003163 0.941371 0.002196 0.053270 0.034631 0.265318 0.037179 0.662873 0.967171 0.007014 0.003028 0.022787 0.980796 0.002228 0.010049 0.006927 0.020630 0.005755 0.005408 0.968208 0.427020 0.122682 0.118347 0.331951 0.447075 0.284990 0.061633 0.206303 Consensus sequence: BTATGTACTAATWH Reverse complement motif 0.206303 0.284990 0.061633 0.447075 0.331951 0.122682 0.118347 0.427020 0.968208 0.005755 0.005408 0.020630 0.006927 0.002228 0.010049 0.980796 0.022787 0.007014 0.003028 0.967171 0.662873 0.265318 0.037179 0.034631 0.003163 0.002196 0.941371 0.053270 0.009842 0.002575 0.086677 0.900906 0.897845 0.009005 0.034016 0.059134 0.007185 0.987110 0.002386 0.003318 0.959765 0.023350 0.004164 0.012721 0.008815 0.021141 0.033932 0.936112 0.568754 0.187246 0.111293 0.132707 0.292043 0.277187 0.240231 0.190539 Consensus sequence: HWATTAGTACATAV Alignment: HWATTAGTACATAV -ATTTAGTAAA--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00212 Lhx5 Reverse Complement Reverse Complement Backward 4 10 0.002851 Species: Mus musculus Original motif 0.192127 0.348816 0.300474 0.158583 0.251871 0.201197 0.314740 0.232192 0.469240 0.195840 0.137749 0.197171 0.620351 0.063061 0.196615 0.119973 0.026357 0.096838 0.024928 0.851877 0.010301 0.066114 0.000301 0.923283 0.980649 0.007663 0.010886 0.000802 0.981397 0.001294 0.004654 0.012655 0.012655 0.004654 0.001294 0.981397 0.000802 0.010886 0.007663 0.980649 0.923283 0.000301 0.066114 0.010301 0.851877 0.024928 0.096838 0.026357 0.528438 0.142302 0.071537 0.257724 0.296647 0.115284 0.062688 0.525382 0.401193 0.235971 0.157675 0.205160 0.309966 0.315367 0.145959 0.228708 0.089761 0.287439 0.205359 0.417441 Consensus sequence: VDHATTAATTAAAWHHB Reverse complement motif 0.417441 0.287439 0.205359 0.089761 0.309966 0.145959 0.315367 0.228708 0.205160 0.235971 0.157675 0.401193 0.525382 0.115284 0.062688 0.296647 0.257724 0.142302 0.071537 0.528438 0.026357 0.024928 0.096838 0.851877 0.010301 0.000301 0.066114 0.923283 0.980649 0.010886 0.007663 0.000802 0.981397 0.004654 0.001294 0.012655 0.012655 0.001294 0.004654 0.981397 0.000802 0.007663 0.010886 0.980649 0.923283 0.066114 0.000301 0.010301 0.851877 0.096838 0.024928 0.026357 0.119973 0.063061 0.196615 0.620351 0.197171 0.195840 0.137749 0.469240 0.251871 0.314740 0.201197 0.232192 0.192127 0.300474 0.348816 0.158583 Consensus sequence: VDHWTTTAATTAATHHV Alignment: VDHWTTTAATTAATHHV ----TTTACTAAAT--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00169 Lmx1b Original Motif Reverse Complement Forward 4 10 0.006769 Species: Mus musculus Original motif 0.336931 0.220707 0.306671 0.135692 0.251068 0.126246 0.394767 0.227919 0.318914 0.086872 0.150663 0.443551 0.368649 0.051170 0.092361 0.487819 0.359682 0.088506 0.064771 0.487041 0.019535 0.162692 0.015925 0.801848 0.015902 0.024224 0.000652 0.959222 0.974698 0.006086 0.002334 0.016882 0.978085 0.001281 0.005421 0.015214 0.015214 0.005421 0.001281 0.978085 0.016882 0.002334 0.006086 0.974698 0.959222 0.000652 0.024224 0.015902 0.801848 0.015925 0.162692 0.019535 0.242323 0.115688 0.116364 0.525625 0.283782 0.097563 0.188384 0.430271 0.252386 0.255982 0.135946 0.355686 0.141430 0.249462 0.350759 0.258349 Consensus sequence: VDWWWTTAATTAATDHB Reverse complement motif 0.141430 0.350759 0.249462 0.258349 0.355686 0.255982 0.135946 0.252386 0.430271 0.097563 0.188384 0.283782 0.525625 0.115688 0.116364 0.242323 0.019535 0.015925 0.162692 0.801848 0.015902 0.000652 0.024224 0.959222 0.974698 0.002334 0.006086 0.016882 0.978085 0.005421 0.001281 0.015214 0.015214 0.001281 0.005421 0.978085 0.016882 0.006086 0.002334 0.974698 0.959222 0.024224 0.000652 0.015902 0.801848 0.162692 0.015925 0.019535 0.487041 0.088506 0.064771 0.359682 0.487819 0.051170 0.092361 0.368649 0.443551 0.086872 0.150663 0.318914 0.251068 0.394767 0.126246 0.227919 0.135692 0.220707 0.306671 0.336931 Consensus sequence: BHDATTAATTAAWWWHB Alignment: BHDATTAATTAAWWWHB ---ATTTAGTAAA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00177 Hoxd12 Reverse Complement Reverse Complement Forward 6 10 0.007472 Species: Mus musculus Original motif 0.191103 0.352101 0.107327 0.349468 0.402272 0.197071 0.150917 0.249740 0.368769 0.193398 0.226932 0.210901 0.257933 0.260778 0.380702 0.100587 0.106950 0.067191 0.825021 0.000838 0.001086 0.021564 0.000853 0.976497 0.020082 0.968082 0.000327 0.011509 0.118319 0.000920 0.879436 0.001326 0.003172 0.002130 0.001866 0.992832 0.922156 0.002796 0.000429 0.074620 0.983503 0.000923 0.001373 0.014202 0.982158 0.003892 0.000954 0.012996 0.575374 0.149674 0.027141 0.247811 0.191390 0.208793 0.100368 0.499449 0.189094 0.369025 0.180904 0.260976 0.265714 0.203403 0.179754 0.351130 0.215918 0.141705 0.246047 0.396330 Consensus sequence: HHDVGTCGTAAAAHHHD Reverse complement motif 0.396330 0.141705 0.246047 0.215918 0.351130 0.203403 0.179754 0.265714 0.189094 0.180904 0.369025 0.260976 0.499449 0.208793 0.100368 0.191390 0.247811 0.149674 0.027141 0.575374 0.012996 0.003892 0.000954 0.982158 0.014202 0.000923 0.001373 0.983503 0.074620 0.002796 0.000429 0.922156 0.992832 0.002130 0.001866 0.003172 0.118319 0.879436 0.000920 0.001326 0.020082 0.000327 0.968082 0.011509 0.976497 0.021564 0.000853 0.001086 0.106950 0.825021 0.067191 0.000838 0.257933 0.380702 0.260778 0.100587 0.210901 0.193398 0.226932 0.368769 0.249740 0.197071 0.150917 0.402272 0.191103 0.107327 0.352101 0.349468 Consensus sequence: DHDHTTTTACGACVDHD Alignment: DHDHTTTTACGACVDHD -----TTTACTAAAT-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00135 Hoxc12 Reverse Complement Reverse Complement Forward 6 10 0.007640 Species: Mus musculus Original motif 0.183093 0.256705 0.106645 0.453557 0.293699 0.196292 0.123477 0.386533 0.412013 0.124988 0.381422 0.081576 0.195091 0.186106 0.527371 0.091431 0.152495 0.041951 0.802926 0.002628 0.001867 0.030137 0.001608 0.966389 0.042259 0.939178 0.001204 0.017359 0.130196 0.001627 0.865068 0.003109 0.003366 0.001436 0.003067 0.992131 0.922191 0.005824 0.000528 0.071457 0.973219 0.001857 0.001299 0.023624 0.979071 0.008898 0.002615 0.009416 0.503130 0.138484 0.031998 0.326389 0.337928 0.242816 0.070564 0.348692 0.182884 0.251308 0.190482 0.375326 0.307728 0.135074 0.240871 0.316326 0.189821 0.425134 0.167065 0.217980 Consensus sequence: HHRGGTCGTAAAWHBDH Reverse complement motif 0.189821 0.167065 0.425134 0.217980 0.316326 0.135074 0.240871 0.307728 0.375326 0.251308 0.190482 0.182884 0.348692 0.242816 0.070564 0.337928 0.326389 0.138484 0.031998 0.503130 0.009416 0.008898 0.002615 0.979071 0.023624 0.001857 0.001299 0.973219 0.071457 0.005824 0.000528 0.922191 0.992131 0.001436 0.003067 0.003366 0.130196 0.865068 0.001627 0.003109 0.042259 0.001204 0.939178 0.017359 0.966389 0.030137 0.001608 0.001867 0.152495 0.802926 0.041951 0.002628 0.195091 0.527371 0.186106 0.091431 0.081576 0.124988 0.381422 0.412013 0.386533 0.196292 0.123477 0.293699 0.453557 0.256705 0.106645 0.183093 Consensus sequence: DDVHWTTTACGACCKHH Alignment: DDVHWTTTACGACCKHH -----TTTACTAAAT-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00117 Hoxd11 Reverse Complement Reverse Complement Backward 3 10 0.008646 Species: Mus musculus Original motif 0.195240 0.299581 0.070392 0.434787 0.383232 0.235789 0.118316 0.262663 0.433734 0.150531 0.233498 0.182237 0.318929 0.193275 0.329287 0.158509 0.078189 0.058494 0.861977 0.001340 0.001639 0.021863 0.001515 0.974983 0.011232 0.978821 0.000755 0.009192 0.171564 0.002240 0.824311 0.001885 0.003418 0.002620 0.003016 0.990946 0.839934 0.002566 0.000872 0.156628 0.984574 0.001197 0.003120 0.011109 0.979994 0.007524 0.001223 0.011259 0.626288 0.164042 0.022338 0.187331 0.276342 0.192595 0.122578 0.408484 0.228871 0.351280 0.153929 0.265920 0.249434 0.303271 0.170797 0.276498 0.179262 0.157831 0.195784 0.467122 Consensus sequence: HHDVGTCGTAAAAHHHD Reverse complement motif 0.467122 0.157831 0.195784 0.179262 0.249434 0.170797 0.303271 0.276498 0.228871 0.153929 0.351280 0.265920 0.408484 0.192595 0.122578 0.276342 0.187331 0.164042 0.022338 0.626288 0.011259 0.007524 0.001223 0.979994 0.011109 0.001197 0.003120 0.984574 0.156628 0.002566 0.000872 0.839934 0.990946 0.002620 0.003016 0.003418 0.171564 0.824311 0.002240 0.001885 0.011232 0.000755 0.978821 0.009192 0.974983 0.021863 0.001515 0.001639 0.078189 0.861977 0.058494 0.001340 0.318929 0.329287 0.193275 0.158509 0.182237 0.150531 0.233498 0.433734 0.262663 0.235789 0.118316 0.383232 0.434787 0.299581 0.070392 0.195240 Consensus sequence: DDDHTTTTACGACVDHH Alignment: DDDHTTTTACGACVDHH -----TTTACTAAAT-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00142 Uncx4.1 Reverse Complement Reverse Complement Forward 4 10 0.010097 Species: Mus musculus Original motif 0.304380 0.311795 0.268876 0.114949 0.351118 0.211470 0.225202 0.212210 0.231585 0.174454 0.127484 0.466477 0.479229 0.157540 0.203780 0.159451 0.625673 0.170623 0.111368 0.092336 0.010242 0.148179 0.010210 0.831370 0.009608 0.062829 0.000911 0.926652 0.980815 0.008055 0.009383 0.001746 0.980244 0.001172 0.005903 0.012681 0.012681 0.005903 0.001172 0.980244 0.001746 0.009383 0.008055 0.980815 0.926652 0.000911 0.062829 0.009608 0.831370 0.010210 0.148179 0.010242 0.148058 0.361669 0.223929 0.266344 0.178551 0.183863 0.465801 0.171785 0.170980 0.366501 0.305559 0.156960 0.125744 0.153063 0.556137 0.165056 Consensus sequence: VDHDATTAATTAABVVG Reverse complement motif 0.125744 0.556137 0.153063 0.165056 0.170980 0.305559 0.366501 0.156960 0.178551 0.465801 0.183863 0.171785 0.148058 0.223929 0.361669 0.266344 0.010242 0.010210 0.148179 0.831370 0.009608 0.000911 0.062829 0.926652 0.980815 0.009383 0.008055 0.001746 0.980244 0.005903 0.001172 0.012681 0.012681 0.001172 0.005903 0.980244 0.001746 0.008055 0.009383 0.980815 0.926652 0.062829 0.000911 0.009608 0.831370 0.148179 0.010210 0.010242 0.092336 0.170623 0.111368 0.625673 0.159451 0.157540 0.203780 0.479229 0.466477 0.174454 0.127484 0.231585 0.212210 0.211470 0.225202 0.351118 0.304380 0.268876 0.311795 0.114949 Consensus sequence: CVVBTTAATTAATDHDV Alignment: CVVBTTAATTAATDHDV ---TTTACTAAAT---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00235 Hoxc11 Reverse Complement Reverse Complement Forward 5 10 0.010176 Species: Mus musculus Original motif 0.233269 0.248491 0.135443 0.382797 0.530699 0.117734 0.196458 0.155109 0.520162 0.128349 0.129047 0.222442 0.383288 0.142763 0.265367 0.208581 0.082604 0.036330 0.879729 0.001337 0.001490 0.025603 0.000959 0.971949 0.011271 0.977559 0.000430 0.010739 0.234170 0.001531 0.762912 0.001387 0.002139 0.001352 0.004590 0.991918 0.858371 0.001955 0.000717 0.138958 0.981016 0.000748 0.001915 0.016321 0.985345 0.003895 0.001793 0.008967 0.542364 0.130700 0.106606 0.220330 0.222953 0.268192 0.191329 0.317526 0.353019 0.168556 0.262332 0.216093 0.196584 0.119005 0.352701 0.331710 Consensus sequence: HAADGTCGTAAAAHDD Reverse complement motif 0.196584 0.352701 0.119005 0.331710 0.216093 0.168556 0.262332 0.353019 0.317526 0.268192 0.191329 0.222953 0.220330 0.130700 0.106606 0.542364 0.008967 0.003895 0.001793 0.985345 0.016321 0.000748 0.001915 0.981016 0.138958 0.001955 0.000717 0.858371 0.991918 0.001352 0.004590 0.002139 0.234170 0.762912 0.001531 0.001387 0.011271 0.000430 0.977559 0.010739 0.971949 0.025603 0.000959 0.001490 0.082604 0.879729 0.036330 0.001337 0.208581 0.142763 0.265367 0.383288 0.222442 0.128349 0.129047 0.520162 0.155109 0.117734 0.196458 0.530699 0.382797 0.248491 0.135443 0.233269 Consensus sequence: HDHTTTTACGACDTTH Alignment: HDHTTTTACGACDTTH ----TTTACTAAAT-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00246 Hoxa11 Reverse Complement Reverse Complement Forward 5 10 0.010591 Species: Mus musculus Original motif 0.250495 0.214554 0.138272 0.396679 0.492850 0.123424 0.196803 0.186923 0.540281 0.151603 0.140529 0.167586 0.428463 0.099563 0.270775 0.201200 0.102254 0.050731 0.845038 0.001977 0.001884 0.019008 0.001029 0.978079 0.016931 0.973797 0.000596 0.008676 0.258728 0.001705 0.738135 0.001431 0.003545 0.001680 0.003370 0.991405 0.832666 0.002250 0.000866 0.164218 0.983610 0.001278 0.002546 0.012566 0.980677 0.005645 0.001242 0.012435 0.599219 0.090422 0.088183 0.222176 0.212685 0.399896 0.114218 0.273202 0.287588 0.220283 0.249419 0.242710 0.152138 0.145873 0.312609 0.389380 Consensus sequence: HDADGTCGTAAAAHDD Reverse complement motif 0.389380 0.145873 0.312609 0.152138 0.242710 0.220283 0.249419 0.287588 0.212685 0.114218 0.399896 0.273202 0.222176 0.090422 0.088183 0.599219 0.012435 0.005645 0.001242 0.980677 0.012566 0.001278 0.002546 0.983610 0.164218 0.002250 0.000866 0.832666 0.991405 0.001680 0.003370 0.003545 0.258728 0.738135 0.001705 0.001431 0.016931 0.000596 0.973797 0.008676 0.978079 0.019008 0.001029 0.001884 0.102254 0.845038 0.050731 0.001977 0.201200 0.099563 0.270775 0.428463 0.167586 0.151603 0.140529 0.540281 0.186923 0.123424 0.196803 0.492850 0.396679 0.214554 0.138272 0.250495 Consensus sequence: DDDTTTTACGACDTDH Alignment: DDDTTTTACGACDTDH ----TTTACTAAAT-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 29 Motif name: Motif 29 Original motif 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 Consensus sequence: ATTTATTGCTA Reserve complement motif 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 Consensus sequence: TAGCAATAAAT ************************************************************************ Best Matches for Motif ID 29 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00104 Hmx1 Reverse Complement Original Motif Forward 3 11 0.001154 Species: Mus musculus Original motif 0.337664 0.289755 0.240849 0.131733 0.174054 0.429800 0.269860 0.126285 0.361513 0.293469 0.259412 0.085606 0.688902 0.063629 0.159397 0.088071 0.130715 0.078148 0.720459 0.070678 0.007798 0.951453 0.001184 0.039564 0.869502 0.001154 0.122137 0.007207 0.882397 0.105995 0.002423 0.009185 0.004826 0.003049 0.001449 0.990676 0.017571 0.055020 0.000547 0.926863 0.950722 0.002312 0.012883 0.034083 0.883290 0.014130 0.042169 0.060412 0.251540 0.149359 0.169226 0.429875 0.140326 0.224608 0.501552 0.133514 0.384995 0.294702 0.277751 0.042551 0.327315 0.131428 0.235873 0.305384 0.177654 0.200822 0.219372 0.402152 Consensus sequence: VVVAGCAATTAADGVDB Reverse complement motif 0.402152 0.200822 0.219372 0.177654 0.305384 0.131428 0.235873 0.327315 0.042551 0.294702 0.277751 0.384995 0.140326 0.501552 0.224608 0.133514 0.429875 0.149359 0.169226 0.251540 0.060412 0.014130 0.042169 0.883290 0.034083 0.002312 0.012883 0.950722 0.926863 0.055020 0.000547 0.017571 0.990676 0.003049 0.001449 0.004826 0.009185 0.105995 0.002423 0.882397 0.007207 0.001154 0.122137 0.869502 0.007798 0.001184 0.951453 0.039564 0.130715 0.720459 0.078148 0.070678 0.088071 0.063629 0.159397 0.688902 0.085606 0.293469 0.259412 0.361513 0.174054 0.269860 0.429800 0.126285 0.131733 0.289755 0.240849 0.337664 Consensus sequence: VDBCDTTAATTGCTBVB Alignment: VVVAGCAATTAADGVDB --TAGCAATAAAT---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00155 Hmx2 Reverse Complement Original Motif Forward 3 11 0.005441 Species: Mus musculus Original motif 0.496013 0.201439 0.234082 0.068466 0.187731 0.442491 0.232786 0.136992 0.546269 0.190140 0.171225 0.092365 0.766900 0.055660 0.121480 0.055959 0.166703 0.152146 0.573689 0.107463 0.008586 0.974989 0.003194 0.013231 0.847648 0.001099 0.146478 0.004775 0.851907 0.131324 0.006893 0.009877 0.005053 0.003719 0.001092 0.990135 0.015092 0.055361 0.000333 0.929213 0.934792 0.001369 0.011244 0.052595 0.890982 0.010911 0.022703 0.075405 0.360898 0.185917 0.109871 0.343315 0.248362 0.207536 0.407845 0.136257 0.413889 0.266826 0.266667 0.052618 0.472173 0.104750 0.246154 0.176923 0.094095 0.071488 0.092888 0.741528 Consensus sequence: VVAAGCAATTAAHVVDT Reverse complement motif 0.741528 0.071488 0.092888 0.094095 0.176923 0.104750 0.246154 0.472173 0.052618 0.266826 0.266667 0.413889 0.248362 0.407845 0.207536 0.136257 0.343315 0.185917 0.109871 0.360898 0.075405 0.010911 0.022703 0.890982 0.052595 0.001369 0.011244 0.934792 0.929213 0.055361 0.000333 0.015092 0.990135 0.003719 0.001092 0.005053 0.009877 0.131324 0.006893 0.851907 0.004775 0.001099 0.146478 0.847648 0.008586 0.003194 0.974989 0.013231 0.166703 0.573689 0.152146 0.107463 0.055959 0.055660 0.121480 0.766900 0.092365 0.190140 0.171225 0.546269 0.187731 0.232786 0.442491 0.136992 0.068466 0.201439 0.234082 0.496013 Consensus sequence: ADBVHTTAATTGCTTVB Alignment: VVAAGCAATTAAHVVDT --TAGCAATAAAT---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00157 Hmx3 Reverse Complement Original Motif Forward 3 11 0.006246 Species: Mus musculus Original motif 0.493883 0.207908 0.206555 0.091654 0.124338 0.490519 0.252638 0.132506 0.482613 0.229280 0.188509 0.099597 0.758821 0.067165 0.111206 0.062809 0.154132 0.098232 0.594074 0.153562 0.015565 0.938529 0.001667 0.044239 0.835485 0.001163 0.156926 0.006426 0.869937 0.118961 0.001666 0.009435 0.005815 0.004470 0.001031 0.988683 0.014066 0.042296 0.000378 0.943259 0.924765 0.001168 0.024126 0.049941 0.873425 0.020468 0.034636 0.071470 0.387156 0.148327 0.115500 0.349017 0.256863 0.183824 0.381900 0.177413 0.472131 0.208576 0.255773 0.063519 0.524326 0.109150 0.180486 0.186038 0.125721 0.103316 0.133298 0.637666 Consensus sequence: VBVAGCAATTAAHVVAT Reverse complement motif 0.637666 0.103316 0.133298 0.125721 0.186038 0.109150 0.180486 0.524326 0.063519 0.208576 0.255773 0.472131 0.256863 0.381900 0.183824 0.177413 0.349017 0.148327 0.115500 0.387156 0.071470 0.020468 0.034636 0.873425 0.049941 0.001168 0.024126 0.924765 0.943259 0.042296 0.000378 0.014066 0.988683 0.004470 0.001031 0.005815 0.009435 0.118961 0.001666 0.869937 0.006426 0.001163 0.156926 0.835485 0.015565 0.001667 0.938529 0.044239 0.154132 0.594074 0.098232 0.153562 0.062809 0.067165 0.111206 0.758821 0.099597 0.229280 0.188509 0.482613 0.124338 0.252638 0.490519 0.132506 0.091654 0.207908 0.206555 0.493883 Consensus sequence: ATBVHTTAATTGCTBBB Alignment: VBVAGCAATTAAHVVAT --TAGCAATAAAT---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00263 Hoxb8 Reverse Complement Original Motif Backward 4 11 0.007422 Species: Mus musculus Original motif 0.395439 0.233274 0.085406 0.285882 0.169037 0.428782 0.301430 0.100751 0.176714 0.358169 0.199215 0.265903 0.227183 0.169543 0.343798 0.259476 0.112609 0.030442 0.819979 0.036970 0.014892 0.617477 0.003187 0.364444 0.781596 0.159728 0.015153 0.043523 0.969644 0.010155 0.012495 0.007707 0.015401 0.004393 0.001778 0.978428 0.190099 0.006299 0.002977 0.800624 0.960962 0.004895 0.005559 0.028584 0.788404 0.040876 0.023563 0.147158 0.098061 0.235899 0.071056 0.594983 0.596589 0.139706 0.131891 0.131815 0.402309 0.134941 0.319039 0.143711 0.452002 0.102421 0.123562 0.322014 Consensus sequence: HVBDGYAATTAATADW Reverse complement motif 0.322014 0.102421 0.123562 0.452002 0.143711 0.134941 0.319039 0.402309 0.131815 0.139706 0.131891 0.596589 0.594983 0.235899 0.071056 0.098061 0.147158 0.040876 0.023563 0.788404 0.028584 0.004895 0.005559 0.960962 0.800624 0.006299 0.002977 0.190099 0.978428 0.004393 0.001778 0.015401 0.007707 0.010155 0.012495 0.969644 0.043523 0.159728 0.015153 0.781596 0.014892 0.003187 0.617477 0.364444 0.112609 0.819979 0.030442 0.036970 0.227183 0.343798 0.169543 0.259476 0.176714 0.199215 0.358169 0.265903 0.169037 0.301430 0.428782 0.100751 0.285882 0.233274 0.085406 0.395439 Consensus sequence: WDTATTAATTKCHBVH Alignment: HVBDGYAATTAATADW --TAGCAATAAAT--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00133 Cdx2 Reverse Complement Original Motif Backward 4 11 0.010138 Species: Mus musculus Original motif 0.314704 0.147028 0.248638 0.289630 0.358628 0.179740 0.325491 0.136141 0.298646 0.303363 0.300590 0.097401 0.188478 0.055557 0.664045 0.091921 0.171259 0.033449 0.790542 0.004751 0.002849 0.464940 0.000596 0.531615 0.576948 0.399193 0.001565 0.022295 0.968872 0.001511 0.028582 0.001035 0.006970 0.003535 0.000486 0.989010 0.878078 0.003399 0.000389 0.118134 0.951183 0.000842 0.001555 0.046419 0.939504 0.006021 0.000818 0.053657 0.567732 0.151536 0.050535 0.230197 0.172713 0.264434 0.122553 0.440299 0.142175 0.107265 0.258247 0.492313 0.215178 0.302818 0.133613 0.348391 Consensus sequence: DVVGGYMATAAAAHKH Reverse complement motif 0.348391 0.302818 0.133613 0.215178 0.492313 0.107265 0.258247 0.142175 0.440299 0.264434 0.122553 0.172713 0.230197 0.151536 0.050535 0.567732 0.053657 0.006021 0.000818 0.939504 0.046419 0.000842 0.001555 0.951183 0.118134 0.003399 0.000389 0.878078 0.989010 0.003535 0.000486 0.006970 0.001035 0.001511 0.028582 0.968872 0.022295 0.399193 0.001565 0.576948 0.531615 0.464940 0.000596 0.002849 0.171259 0.790542 0.033449 0.004751 0.188478 0.664045 0.055557 0.091921 0.298646 0.300590 0.303363 0.097401 0.136141 0.179740 0.325491 0.358628 0.289630 0.147028 0.248638 0.314704 Consensus sequence: HRHTTTTATYMCCVBD Alignment: DVVGGYMATAAAAHKH --TAGCAATAAAT--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00207 Hoxb9 Reverse Complement Original Motif Backward 5 11 0.010741 Species: Mus musculus Original motif 0.369205 0.191401 0.373182 0.066211 0.357429 0.160246 0.408701 0.073624 0.576965 0.069294 0.310696 0.043045 0.103797 0.127691 0.646641 0.121871 0.023188 0.657132 0.005598 0.314082 0.420260 0.543925 0.009350 0.026464 0.944117 0.003851 0.047375 0.004658 0.007642 0.006158 0.004106 0.982094 0.728623 0.003283 0.002505 0.265589 0.958302 0.002642 0.002614 0.036442 0.969909 0.004265 0.002650 0.023176 0.869075 0.011516 0.028466 0.090943 0.336102 0.198102 0.075230 0.390566 0.203557 0.271818 0.098338 0.426287 0.226605 0.448090 0.146026 0.179278 0.252426 0.177812 0.357334 0.212429 Consensus sequence: VRRGCMATAAAAHHHD Reverse complement motif 0.252426 0.357334 0.177812 0.212429 0.226605 0.146026 0.448090 0.179278 0.426287 0.271818 0.098338 0.203557 0.390566 0.198102 0.075230 0.336102 0.090943 0.011516 0.028466 0.869075 0.023176 0.004265 0.002650 0.969909 0.036442 0.002642 0.002614 0.958302 0.265589 0.003283 0.002505 0.728623 0.982094 0.006158 0.004106 0.007642 0.004658 0.003851 0.047375 0.944117 0.420260 0.009350 0.543925 0.026464 0.023188 0.005598 0.657132 0.314082 0.103797 0.646641 0.127691 0.121871 0.043045 0.069294 0.310696 0.576965 0.357429 0.408701 0.160246 0.073624 0.369205 0.373182 0.191401 0.066211 Consensus sequence: HDHHTTTTATRGCKMV Alignment: VRRGCMATAAAAHHHD -TAGCAATAAAT---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00145 Barhl2 Reverse Complement Original Motif Forward 4 11 0.013818 Species: Mus musculus Original motif 0.461695 0.224449 0.118884 0.194972 0.573918 0.178052 0.084607 0.163423 0.509202 0.299283 0.046830 0.144686 0.781754 0.035879 0.132996 0.049371 0.909629 0.018003 0.066327 0.006042 0.185305 0.442819 0.168153 0.203723 0.004152 0.938941 0.000741 0.056166 0.952728 0.004094 0.036915 0.006262 0.962648 0.006522 0.001095 0.029735 0.002949 0.002007 0.002143 0.992902 0.002773 0.003794 0.001682 0.991751 0.985960 0.000635 0.003183 0.010222 0.728479 0.023198 0.141457 0.106866 0.100754 0.330009 0.347597 0.221641 0.392007 0.211701 0.147142 0.249150 0.323968 0.271247 0.123950 0.280834 Consensus sequence: HAMAAHCAATTAABHH Reverse complement motif 0.280834 0.271247 0.123950 0.323968 0.249150 0.211701 0.147142 0.392007 0.100754 0.347597 0.330009 0.221641 0.106866 0.023198 0.141457 0.728479 0.010222 0.000635 0.003183 0.985960 0.991751 0.003794 0.001682 0.002773 0.992902 0.002007 0.002143 0.002949 0.029735 0.006522 0.001095 0.962648 0.006262 0.004094 0.036915 0.952728 0.004152 0.000741 0.938941 0.056166 0.185305 0.168153 0.442819 0.203723 0.006042 0.018003 0.066327 0.909629 0.049371 0.035879 0.132996 0.781754 0.144686 0.299283 0.046830 0.509202 0.163423 0.178052 0.084607 0.573918 0.194972 0.224449 0.118884 0.461695 Consensus sequence: HHBTTAATTGDTTYTH Alignment: HAMAAHCAATTAABHH ---TAGCAATAAAT-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00098 Rfx3_primary Reverse Complement Original Motif Forward 10 11 0.014251 Species: Mus musculus Original motif 0.218345 0.231533 0.152528 0.397594 0.264604 0.126115 0.320860 0.288421 0.117304 0.186844 0.172946 0.522906 0.111929 0.277908 0.409084 0.201079 0.343319 0.311376 0.123612 0.221692 0.193354 0.374280 0.157338 0.275028 0.166348 0.578991 0.130872 0.123789 0.006937 0.931183 0.046809 0.015072 0.255581 0.289587 0.125513 0.329319 0.002582 0.012615 0.002782 0.982021 0.850584 0.007973 0.140639 0.000803 0.037792 0.002285 0.957277 0.002646 0.009414 0.921481 0.001636 0.067469 0.943403 0.000980 0.042401 0.013216 0.991166 0.002931 0.003540 0.002364 0.003651 0.987110 0.001106 0.008133 0.208873 0.369705 0.319129 0.102292 0.322535 0.186617 0.374187 0.116660 0.326738 0.179486 0.226374 0.267402 0.299697 0.185329 0.133025 0.381949 0.300824 0.266836 0.096437 0.335904 0.418443 0.191068 0.127183 0.263306 0.386727 0.204062 0.126050 0.283161 Consensus sequence: HDTBHHCCHTAGCAACVVDHHHH Reverse complement motif 0.283161 0.204062 0.126050 0.386727 0.263306 0.191068 0.127183 0.418443 0.335904 0.266836 0.096437 0.300824 0.381949 0.185329 0.133025 0.299697 0.267402 0.179486 0.226374 0.326738 0.322535 0.374187 0.186617 0.116660 0.208873 0.319129 0.369705 0.102292 0.003651 0.001106 0.987110 0.008133 0.002364 0.002931 0.003540 0.991166 0.013216 0.000980 0.042401 0.943403 0.009414 0.001636 0.921481 0.067469 0.037792 0.957277 0.002285 0.002646 0.000803 0.007973 0.140639 0.850584 0.982021 0.012615 0.002782 0.002582 0.329319 0.289587 0.125513 0.255581 0.006937 0.046809 0.931183 0.015072 0.166348 0.130872 0.578991 0.123789 0.193354 0.157338 0.374280 0.275028 0.221692 0.311376 0.123612 0.343319 0.111929 0.409084 0.277908 0.201079 0.522906 0.186844 0.172946 0.117304 0.264604 0.320860 0.126115 0.288421 0.397594 0.231533 0.152528 0.218345 Consensus sequence: HHHHDVVGTTGCTAHGGDHBAHH Alignment: HDTBHHCCHTAGCAACVVDHHHH ---------TAGCAATAAAT--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00180 Hoxd13 Original Motif Reverse Complement Backward 2 11 0.014350 Species: Mus musculus Original motif 0.279189 0.316791 0.190404 0.213616 0.297705 0.175638 0.191020 0.335637 0.333485 0.203858 0.174034 0.288623 0.046444 0.540349 0.083237 0.329969 0.016780 0.648667 0.003870 0.330682 0.679959 0.116873 0.002745 0.200422 0.936496 0.002013 0.026876 0.034615 0.004741 0.008734 0.003861 0.982665 0.904624 0.000869 0.005345 0.089162 0.967883 0.002295 0.001003 0.028819 0.980087 0.004768 0.002887 0.012258 0.898523 0.041633 0.022776 0.037069 0.246903 0.292446 0.069240 0.391411 0.192528 0.300908 0.105655 0.400908 0.247610 0.343317 0.190760 0.218313 0.246702 0.253595 0.176298 0.323404 Consensus sequence: HDHYYAATAAAAHHHH Reverse complement motif 0.323404 0.253595 0.176298 0.246702 0.247610 0.190760 0.343317 0.218313 0.400908 0.300908 0.105655 0.192528 0.391411 0.292446 0.069240 0.246903 0.037069 0.041633 0.022776 0.898523 0.012258 0.004768 0.002887 0.980087 0.028819 0.002295 0.001003 0.967883 0.089162 0.000869 0.005345 0.904624 0.982665 0.008734 0.003861 0.004741 0.034615 0.002013 0.026876 0.936496 0.200422 0.116873 0.002745 0.679959 0.016780 0.003870 0.648667 0.330682 0.046444 0.083237 0.540349 0.329969 0.288623 0.203858 0.174034 0.333485 0.335637 0.175638 0.191020 0.297705 0.279189 0.190404 0.316791 0.213616 Consensus sequence: HDHHTTTTATTKKHDD Alignment: HDHHTTTTATTKKHDD ----ATTTATTGCTA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00168 Hoxd8 Reverse Complement Reverse Complement Forward 1 11 0.016911 Species: Mus musculus Original motif 0.125413 0.120907 0.200343 0.553338 0.604959 0.122401 0.108041 0.164599 0.599593 0.081965 0.204643 0.113798 0.330015 0.048408 0.286845 0.334731 0.068575 0.230328 0.014323 0.686773 0.723431 0.122426 0.030752 0.123391 0.916525 0.021756 0.022396 0.039322 0.035230 0.013256 0.012130 0.939384 0.047433 0.010794 0.004827 0.936946 0.952666 0.003486 0.012288 0.031560 0.794645 0.051496 0.022269 0.131590 0.070711 0.089139 0.049811 0.790338 0.354541 0.041255 0.466791 0.137412 0.243842 0.065460 0.563307 0.127391 0.186363 0.499738 0.076726 0.237174 0.187640 0.091571 0.135427 0.585362 0.364787 0.207143 0.182549 0.245520 Consensus sequence: TAADTAATTAATRGHTH Reverse complement motif 0.245520 0.207143 0.182549 0.364787 0.585362 0.091571 0.135427 0.187640 0.186363 0.076726 0.499738 0.237174 0.243842 0.563307 0.065460 0.127391 0.354541 0.466791 0.041255 0.137412 0.790338 0.089139 0.049811 0.070711 0.131590 0.051496 0.022269 0.794645 0.031560 0.003486 0.012288 0.952666 0.936946 0.010794 0.004827 0.047433 0.939384 0.013256 0.012130 0.035230 0.039322 0.021756 0.022396 0.916525 0.123391 0.122426 0.030752 0.723431 0.686773 0.230328 0.014323 0.068575 0.334731 0.048408 0.286845 0.330015 0.113798 0.081965 0.204643 0.599593 0.164599 0.122401 0.108041 0.604959 0.553338 0.120907 0.200343 0.125413 Consensus sequence: HADCMATTAATTADTTA Alignment: HADCMATTAATTADTTA TAGCAATAAAT------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 30 Motif name: Motif 30 Original motif 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 Consensus sequence: TTGCTGCTTTT Reserve complement motif 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 Consensus sequence: AAAAGCAGCAA ************************************************************************ Best Matches for Motif ID 30 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00027 Osr1_primary Original Motif Reverse Complement Backward 4 11 0.007707 Species: Mus musculus Original motif 0.260366 0.252887 0.224273 0.262474 0.239931 0.233883 0.190643 0.335543 0.257637 0.188706 0.242480 0.311177 0.323833 0.165978 0.161144 0.349046 0.824983 0.119267 0.027014 0.028736 0.009055 0.974108 0.000889 0.015947 0.659219 0.001516 0.337361 0.001905 0.002965 0.001643 0.993070 0.002321 0.047380 0.001758 0.009593 0.941269 0.974073 0.000741 0.023187 0.001999 0.006256 0.001341 0.990114 0.002290 0.001372 0.921382 0.010719 0.066527 0.449788 0.160658 0.105504 0.284050 0.392727 0.304490 0.187448 0.115335 0.361758 0.209213 0.175805 0.253224 0.420972 0.108912 0.289406 0.180710 Consensus sequence: HHDHACRGTAGCHVHD Reverse complement motif 0.180710 0.108912 0.289406 0.420972 0.253224 0.209213 0.175805 0.361758 0.115335 0.304490 0.187448 0.392727 0.284050 0.160658 0.105504 0.449788 0.001372 0.010719 0.921382 0.066527 0.006256 0.990114 0.001341 0.002290 0.001999 0.000741 0.023187 0.974073 0.941269 0.001758 0.009593 0.047380 0.002965 0.993070 0.001643 0.002321 0.001905 0.001516 0.337361 0.659219 0.009055 0.000889 0.974108 0.015947 0.028736 0.119267 0.027014 0.824983 0.349046 0.165978 0.161144 0.323833 0.311177 0.188706 0.242480 0.257637 0.335543 0.233883 0.190643 0.239931 0.262474 0.252887 0.224273 0.260366 Consensus sequence: DHBHGCTACKGTHDHH Alignment: DHBHGCTACKGTHDHH --TTGCTGCTTTT--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00044 Mafk_secondary Original Motif Reverse Complement Backward 3 11 0.011344 Species: Mus musculus Original motif 0.289934 0.244974 0.342021 0.123071 0.317105 0.250774 0.206169 0.225952 0.589909 0.146264 0.176464 0.087364 0.805648 0.031025 0.116712 0.046614 0.859239 0.012630 0.068740 0.059391 0.877855 0.017270 0.013520 0.091354 0.822443 0.051458 0.029433 0.096666 0.175032 0.076822 0.256419 0.491726 0.028231 0.131221 0.031440 0.809107 0.050608 0.039418 0.847824 0.062150 0.041983 0.868232 0.042708 0.047077 0.757931 0.111841 0.090214 0.040013 0.451956 0.283644 0.033652 0.230747 0.058765 0.285975 0.414514 0.240747 0.391919 0.133805 0.407813 0.066464 Consensus sequence: VHAAAAADTGCAHBR Reverse complement motif 0.391919 0.407813 0.133805 0.066464 0.058765 0.414514 0.285975 0.240747 0.230747 0.283644 0.033652 0.451956 0.040013 0.111841 0.090214 0.757931 0.041983 0.042708 0.868232 0.047077 0.050608 0.847824 0.039418 0.062150 0.809107 0.131221 0.031440 0.028231 0.491726 0.076822 0.256419 0.175032 0.096666 0.051458 0.029433 0.822443 0.091354 0.017270 0.013520 0.877855 0.059391 0.012630 0.068740 0.859239 0.046614 0.031025 0.116712 0.805648 0.087364 0.146264 0.176464 0.589909 0.225952 0.250774 0.206169 0.317105 0.289934 0.342021 0.244974 0.123071 Consensus sequence: MBHTGCADTTTTTHV Alignment: MBHTGCADTTTTTHV --TTGCTGCTTTT-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00052 Osr2_primary Original Motif Reverse Complement Forward 3 11 0.011717 Species: Mus musculus Original motif 0.295210 0.230759 0.178832 0.295199 0.286163 0.186772 0.186150 0.340915 0.287577 0.235045 0.329453 0.147924 0.263264 0.191325 0.081978 0.463433 0.839420 0.118123 0.018788 0.023669 0.005488 0.984397 0.000830 0.009284 0.660134 0.001532 0.336574 0.001760 0.003020 0.001773 0.993144 0.002063 0.039664 0.001060 0.005054 0.954222 0.980339 0.000636 0.016776 0.002249 0.003849 0.001418 0.992166 0.002568 0.000858 0.950172 0.007228 0.041743 0.342840 0.230712 0.133570 0.292878 0.342486 0.316980 0.167294 0.173240 0.362426 0.178913 0.146709 0.311952 0.266586 0.140406 0.435643 0.157365 Consensus sequence: HHVHACRGTAGCHHHD Reverse complement motif 0.266586 0.435643 0.140406 0.157365 0.311952 0.178913 0.146709 0.362426 0.173240 0.316980 0.167294 0.342486 0.292878 0.230712 0.133570 0.342840 0.000858 0.007228 0.950172 0.041743 0.003849 0.992166 0.001418 0.002568 0.002249 0.000636 0.016776 0.980339 0.954222 0.001060 0.005054 0.039664 0.003020 0.993144 0.001773 0.002063 0.001760 0.001532 0.336574 0.660134 0.005488 0.000830 0.984397 0.009284 0.023669 0.118123 0.018788 0.839420 0.463433 0.191325 0.081978 0.263264 0.287577 0.329453 0.235045 0.147924 0.340915 0.186772 0.186150 0.286163 0.295199 0.230759 0.178832 0.295210 Consensus sequence: HHHHGCTACKGTHVHH Alignment: HHHHGCTACKGTHVHH --TTGCTGCTTTT--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00045 Mafb_primary Original Motif Original Motif Forward 5 11 0.014992 Species: Mus musculus Original motif 0.420301 0.182299 0.161481 0.235919 0.593201 0.055751 0.202477 0.148571 0.653364 0.017008 0.054630 0.274998 0.339176 0.102943 0.050258 0.507622 0.171557 0.078698 0.267471 0.482273 0.044703 0.033212 0.003920 0.918165 0.010333 0.004451 0.972441 0.012775 0.034026 0.949298 0.004788 0.011889 0.016078 0.008878 0.004007 0.971037 0.020331 0.004077 0.929676 0.045916 0.975739 0.007450 0.005991 0.010819 0.012733 0.887375 0.018700 0.081192 0.259981 0.111885 0.243051 0.385083 0.327677 0.149969 0.094895 0.427459 0.541721 0.105923 0.242224 0.110132 0.258689 0.068305 0.493226 0.179779 0.306041 0.306854 0.168308 0.218798 Consensus sequence: HAAWDTGCTGACDWARH Reverse complement motif 0.306041 0.168308 0.306854 0.218798 0.258689 0.493226 0.068305 0.179779 0.110132 0.105923 0.242224 0.541721 0.427459 0.149969 0.094895 0.327677 0.385083 0.111885 0.243051 0.259981 0.012733 0.018700 0.887375 0.081192 0.010819 0.007450 0.005991 0.975739 0.020331 0.929676 0.004077 0.045916 0.971037 0.008878 0.004007 0.016078 0.034026 0.004788 0.949298 0.011889 0.010333 0.972441 0.004451 0.012775 0.918165 0.033212 0.003920 0.044703 0.482273 0.078698 0.267471 0.171557 0.507622 0.102943 0.050258 0.339176 0.274998 0.017008 0.054630 0.653364 0.148571 0.055751 0.202477 0.593201 0.235919 0.182299 0.161481 0.420301 Consensus sequence: DMTWDGTCAGCADWTTH Alignment: HAAWDTGCTGACDWARH ----TTGCTGCTTTT-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00037 Zfp105_primary Original Motif Reverse Complement Backward 2 11 0.020418 Species: Mus musculus Original motif 0.363104 0.182807 0.145232 0.308856 0.419707 0.133742 0.222546 0.224005 0.164481 0.418263 0.052397 0.364858 0.715575 0.117639 0.064914 0.101872 0.883836 0.026985 0.032584 0.056596 0.558797 0.151280 0.033120 0.256803 0.267037 0.403488 0.026746 0.302729 0.939762 0.013627 0.034579 0.012032 0.897072 0.009878 0.035642 0.057408 0.305904 0.516040 0.055311 0.122746 0.880940 0.027958 0.048350 0.042752 0.710082 0.052464 0.040250 0.197204 0.246712 0.125155 0.318627 0.309506 0.429749 0.181755 0.176892 0.211603 0.339643 0.097216 0.355250 0.207891 Consensus sequence: HDYAAAHAAMAADHD Reverse complement motif 0.339643 0.355250 0.097216 0.207891 0.211603 0.181755 0.176892 0.429749 0.246712 0.318627 0.125155 0.309506 0.197204 0.052464 0.040250 0.710082 0.042752 0.027958 0.048350 0.880940 0.305904 0.055311 0.516040 0.122746 0.057408 0.009878 0.035642 0.897072 0.012032 0.013627 0.034579 0.939762 0.267037 0.026746 0.403488 0.302729 0.256803 0.151280 0.033120 0.558797 0.056596 0.026985 0.032584 0.883836 0.101872 0.117639 0.064914 0.715575 0.164481 0.052397 0.418263 0.364858 0.224005 0.133742 0.222546 0.419707 0.308856 0.182807 0.145232 0.363104 Consensus sequence: HHHTTRTTDTTTKDH Alignment: HHHTTRTTDTTTKDH ---TTGCTGCTTTT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00057 Zic2_secondary Original Motif Reverse Complement Forward 5 11 0.021182 Species: Mus musculus Original motif 0.201522 0.336845 0.183740 0.277892 0.238705 0.354378 0.165332 0.241585 0.350858 0.031427 0.308482 0.309233 0.104423 0.870794 0.018676 0.006107 0.313246 0.259944 0.277570 0.149241 0.003590 0.973377 0.002520 0.020513 0.899716 0.025489 0.015458 0.059336 0.049224 0.006415 0.938214 0.006147 0.002021 0.859631 0.007903 0.130445 0.772818 0.002659 0.187334 0.037190 0.008456 0.015170 0.594695 0.381679 0.004118 0.009188 0.961506 0.025188 0.367151 0.230955 0.204475 0.197419 0.267508 0.193660 0.430070 0.108762 0.444449 0.099127 0.212182 0.244241 Consensus sequence: HHDCVCAGCAKGVVD Reverse complement motif 0.244241 0.099127 0.212182 0.444449 0.267508 0.430070 0.193660 0.108762 0.197419 0.230955 0.204475 0.367151 0.004118 0.961506 0.009188 0.025188 0.008456 0.594695 0.015170 0.381679 0.037190 0.002659 0.187334 0.772818 0.002021 0.007903 0.859631 0.130445 0.049224 0.938214 0.006415 0.006147 0.059336 0.025489 0.015458 0.899716 0.003590 0.002520 0.973377 0.020513 0.149241 0.259944 0.277570 0.313246 0.104423 0.018676 0.870794 0.006107 0.309233 0.031427 0.308482 0.350858 0.238705 0.165332 0.354378 0.241585 0.201522 0.183740 0.336845 0.277892 Consensus sequence: DVBCYTGCTGBGDDD Alignment: DVBCYTGCTGBGDDD ----TTGCTGCTTTT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00145 Barhl2 Original Motif Reverse Complement Backward 2 11 0.024139 Species: Mus musculus Original motif 0.461695 0.224449 0.118884 0.194972 0.573918 0.178052 0.084607 0.163423 0.509202 0.299283 0.046830 0.144686 0.781754 0.035879 0.132996 0.049371 0.909629 0.018003 0.066327 0.006042 0.185305 0.442819 0.168153 0.203723 0.004152 0.938941 0.000741 0.056166 0.952728 0.004094 0.036915 0.006262 0.962648 0.006522 0.001095 0.029735 0.002949 0.002007 0.002143 0.992902 0.002773 0.003794 0.001682 0.991751 0.985960 0.000635 0.003183 0.010222 0.728479 0.023198 0.141457 0.106866 0.100754 0.330009 0.347597 0.221641 0.392007 0.211701 0.147142 0.249150 0.323968 0.271247 0.123950 0.280834 Consensus sequence: HAMAAHCAATTAABHH Reverse complement motif 0.280834 0.271247 0.123950 0.323968 0.249150 0.211701 0.147142 0.392007 0.100754 0.347597 0.330009 0.221641 0.106866 0.023198 0.141457 0.728479 0.010222 0.000635 0.003183 0.985960 0.991751 0.003794 0.001682 0.002773 0.992902 0.002007 0.002143 0.002949 0.029735 0.006522 0.001095 0.962648 0.006262 0.004094 0.036915 0.952728 0.004152 0.000741 0.938941 0.056166 0.185305 0.168153 0.442819 0.203723 0.006042 0.018003 0.066327 0.909629 0.049371 0.035879 0.132996 0.781754 0.144686 0.299283 0.046830 0.509202 0.163423 0.178052 0.084607 0.573918 0.194972 0.224449 0.118884 0.461695 Consensus sequence: HHBTTAATTGDTTYTH Alignment: HHBTTAATTGDTTYTH ----TTGCTGCTTTT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00527 Foxn4_primary Reverse Complement Reverse Complement Backward 9 11 0.024174 Species: Mus musculus Original motif 0.397468 0.109792 0.196359 0.296381 0.102928 0.480888 0.250249 0.165936 0.141925 0.173586 0.377365 0.307124 0.337385 0.368225 0.188518 0.105872 0.354789 0.067393 0.345343 0.232475 0.299392 0.109745 0.215552 0.375311 0.242937 0.170264 0.189245 0.397554 0.461680 0.013180 0.358677 0.166463 0.067089 0.063048 0.008045 0.861819 0.431756 0.128671 0.436022 0.003551 0.006559 0.001814 0.988272 0.003355 0.012929 0.983600 0.001468 0.002003 0.018768 0.000766 0.976433 0.004033 0.003776 0.005554 0.002991 0.987679 0.002737 0.981589 0.009028 0.006646 0.126509 0.273800 0.413161 0.186530 0.100613 0.337225 0.212034 0.350128 0.123741 0.284683 0.060914 0.530661 0.204454 0.143533 0.100462 0.551551 0.202290 0.482197 0.148368 0.167145 0.191625 0.101330 0.607860 0.099185 0.507546 0.086532 0.219554 0.186368 Consensus sequence: DBBVDDDRTRGCGTCBBYTHGA Reverse complement motif 0.186368 0.086532 0.219554 0.507546 0.191625 0.607860 0.101330 0.099185 0.202290 0.148368 0.482197 0.167145 0.551551 0.143533 0.100462 0.204454 0.530661 0.284683 0.060914 0.123741 0.350128 0.337225 0.212034 0.100613 0.126509 0.413161 0.273800 0.186530 0.002737 0.009028 0.981589 0.006646 0.987679 0.005554 0.002991 0.003776 0.018768 0.976433 0.000766 0.004033 0.012929 0.001468 0.983600 0.002003 0.006559 0.988272 0.001814 0.003355 0.431756 0.436022 0.128671 0.003551 0.861819 0.063048 0.008045 0.067089 0.166463 0.013180 0.358677 0.461680 0.397554 0.170264 0.189245 0.242937 0.375311 0.109745 0.215552 0.299392 0.232475 0.067393 0.345343 0.354789 0.337385 0.188518 0.368225 0.105872 0.141925 0.377365 0.173586 0.307124 0.102928 0.250249 0.480888 0.165936 0.296381 0.109792 0.196359 0.397468 Consensus sequence: TCDAMVBGACGCMAKDDDVBBD Alignment: TCDAMVBGACGCMAKDDDVBBD ---AAAAGCAGCAA-------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00102 Zic1_secondary Original Motif Reverse Complement Forward 5 11 0.024518 Species: Mus musculus Original motif 0.161683 0.405114 0.171743 0.261460 0.259478 0.357988 0.146793 0.235741 0.371334 0.026439 0.283598 0.318630 0.092229 0.883389 0.018758 0.005623 0.419591 0.169874 0.253266 0.157270 0.002985 0.976375 0.002722 0.017918 0.909381 0.021357 0.013299 0.055963 0.039418 0.007014 0.948302 0.005266 0.001711 0.845894 0.005756 0.146640 0.803792 0.003049 0.148687 0.044472 0.015314 0.017153 0.680239 0.287294 0.003793 0.011414 0.937403 0.047390 0.431916 0.266291 0.144154 0.157638 0.269331 0.239338 0.366817 0.124513 0.395873 0.103980 0.214796 0.285351 Consensus sequence: BHDCVCAGCAGGHVD Reverse complement motif 0.285351 0.103980 0.214796 0.395873 0.269331 0.366817 0.239338 0.124513 0.157638 0.266291 0.144154 0.431916 0.003793 0.937403 0.011414 0.047390 0.015314 0.680239 0.017153 0.287294 0.044472 0.003049 0.148687 0.803792 0.001711 0.005756 0.845894 0.146640 0.039418 0.948302 0.007014 0.005266 0.055963 0.021357 0.013299 0.909381 0.002985 0.002722 0.976375 0.017918 0.157270 0.169874 0.253266 0.419591 0.092229 0.018758 0.883389 0.005623 0.318630 0.026439 0.283598 0.371334 0.259478 0.146793 0.357988 0.235741 0.161683 0.171743 0.405114 0.261460 Consensus sequence: DVHCCTGCTGBGDDB Alignment: DVHCCTGCTGBGDDB ----TTGCTGCTTTT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00185 Pbx1 Original Motif Reverse Complement Forward 7 11 0.024546 Species: Mus musculus Original motif 0.212132 0.278490 0.152736 0.356642 0.063933 0.492543 0.152064 0.291460 0.587031 0.034623 0.144307 0.234038 0.117053 0.398145 0.094881 0.389921 0.373322 0.389731 0.108286 0.128661 0.108687 0.734731 0.088065 0.068518 0.859559 0.019872 0.072249 0.048320 0.030137 0.010645 0.008436 0.950782 0.031271 0.947906 0.008587 0.012236 0.931443 0.030353 0.020847 0.017358 0.740694 0.063345 0.026296 0.169665 0.314246 0.050461 0.058593 0.576700 0.324258 0.320852 0.146988 0.207902 0.392891 0.139295 0.090383 0.377432 0.356442 0.139564 0.146747 0.357247 0.260742 0.286138 0.240467 0.212652 0.366956 0.354615 0.205968 0.072461 Consensus sequence: HYAYMCATCAAWHWDVV Reverse complement motif 0.072461 0.354615 0.205968 0.366956 0.260742 0.240467 0.286138 0.212652 0.357247 0.139564 0.146747 0.356442 0.377432 0.139295 0.090383 0.392891 0.207902 0.320852 0.146988 0.324258 0.576700 0.050461 0.058593 0.314246 0.169665 0.063345 0.026296 0.740694 0.017358 0.030353 0.020847 0.931443 0.031271 0.008587 0.947906 0.012236 0.950782 0.010645 0.008436 0.030137 0.048320 0.019872 0.072249 0.859559 0.108687 0.088065 0.734731 0.068518 0.373322 0.108286 0.389731 0.128661 0.117053 0.094881 0.398145 0.389921 0.234038 0.034623 0.144307 0.587031 0.063933 0.152064 0.492543 0.291460 0.356642 0.278490 0.152736 0.212132 Consensus sequence: BVDWHWTTGATGRKTKH Alignment: BVDWHWTTGATGRKTKH ------TTGCTGCTTTT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 31 Motif name: Motif 31 Original motif 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 Consensus sequence: TTGTTGATTTT Reserve complement motif 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 Consensus sequence: AAAATCAACAA ************************************************************************ Best Matches for Motif ID 31 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00061 Foxl1_primary Reverse Complement Original Motif Forward 3 11 0.000000 Species: Mus musculus Original motif 0.323208 0.152915 0.185111 0.338766 0.428132 0.056109 0.099487 0.416272 0.659386 0.039965 0.035805 0.264843 0.647143 0.049206 0.078984 0.224667 0.208834 0.076592 0.071631 0.642943 0.341077 0.003865 0.649511 0.005547 0.016627 0.001866 0.001715 0.979792 0.952319 0.045294 0.000870 0.001516 0.988834 0.004620 0.000720 0.005826 0.989346 0.001005 0.006467 0.003182 0.001093 0.784230 0.001235 0.213442 0.991209 0.002017 0.001737 0.005037 0.801581 0.037084 0.023060 0.138274 0.528554 0.089350 0.107501 0.274595 0.208802 0.268646 0.368022 0.154530 0.280218 0.221367 0.340497 0.157918 0.146611 0.250725 0.293524 0.309140 Consensus sequence: DWAATRTAAACAAWVVB Reverse complement motif 0.309140 0.250725 0.293524 0.146611 0.280218 0.340497 0.221367 0.157918 0.208802 0.368022 0.268646 0.154530 0.274595 0.089350 0.107501 0.528554 0.138274 0.037084 0.023060 0.801581 0.005037 0.002017 0.001737 0.991209 0.001093 0.001235 0.784230 0.213442 0.003182 0.001005 0.006467 0.989346 0.005826 0.004620 0.000720 0.988834 0.001516 0.045294 0.000870 0.952319 0.979792 0.001866 0.001715 0.016627 0.341077 0.649511 0.003865 0.005547 0.642943 0.076592 0.071631 0.208834 0.224667 0.049206 0.078984 0.647143 0.264843 0.039965 0.035805 0.659386 0.416272 0.056109 0.099487 0.428132 0.338766 0.152915 0.185111 0.323208 Consensus sequence: VVVWTTGTTTAMATTWD Alignment: DWAATRTAAACAAWVVB --AAAATCAACAA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00025 Foxk1_primary Reverse Complement Original Motif Backward 5 11 0.002565 Species: Mus musculus Original motif 0.338172 0.192194 0.207817 0.261817 0.407924 0.117261 0.278236 0.196580 0.595570 0.070480 0.119221 0.214729 0.710845 0.038748 0.052600 0.197807 0.124647 0.116138 0.178053 0.581162 0.201602 0.005514 0.792110 0.000774 0.024590 0.004193 0.001331 0.969886 0.919465 0.077871 0.000760 0.001904 0.972342 0.010395 0.000580 0.016683 0.991045 0.001495 0.003585 0.003875 0.001358 0.885197 0.000980 0.112465 0.990318 0.001846 0.002968 0.004867 0.804563 0.063147 0.023496 0.108795 0.564824 0.087976 0.102865 0.244336 0.269947 0.300278 0.285008 0.144767 0.337905 0.220102 0.253694 0.188299 0.153781 0.274135 0.318343 0.253741 Consensus sequence: DDAATGTAAACAAAVVB Reverse complement motif 0.153781 0.318343 0.274135 0.253741 0.188299 0.220102 0.253694 0.337905 0.269947 0.285008 0.300278 0.144767 0.244336 0.087976 0.102865 0.564824 0.108795 0.063147 0.023496 0.804563 0.004867 0.001846 0.002968 0.990318 0.001358 0.000980 0.885197 0.112465 0.003875 0.001495 0.003585 0.991045 0.016683 0.010395 0.000580 0.972342 0.001904 0.077871 0.000760 0.919465 0.969886 0.004193 0.001331 0.024590 0.201602 0.792110 0.005514 0.000774 0.581162 0.116138 0.178053 0.124647 0.197807 0.038748 0.052600 0.710845 0.214729 0.070480 0.119221 0.595570 0.196580 0.117261 0.278236 0.407924 0.261817 0.192194 0.207817 0.338172 Consensus sequence: BBVTTTGTTTACATTDD Alignment: DDAATGTAAACAAAVVB --AAAATCAACAA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00039 Foxj3_primary Reverse Complement Original Motif Backward 5 11 0.004972 Species: Mus musculus Original motif 0.273456 0.257473 0.208488 0.260583 0.338566 0.133379 0.306363 0.221693 0.475488 0.192852 0.156858 0.174803 0.506619 0.132646 0.170373 0.190362 0.349042 0.127275 0.325924 0.197759 0.303850 0.013619 0.678034 0.004497 0.014136 0.015691 0.003073 0.967100 0.913373 0.082928 0.001910 0.001789 0.956294 0.017745 0.000584 0.025378 0.987796 0.001685 0.004159 0.006360 0.002288 0.814764 0.001427 0.181521 0.986707 0.002688 0.003346 0.007259 0.787378 0.065481 0.057961 0.089180 0.572982 0.089910 0.066184 0.270924 0.224167 0.339979 0.258886 0.176968 0.268414 0.272007 0.239541 0.220038 0.241771 0.394748 0.174273 0.189208 Consensus sequence: HDHADGTAAACAAAVVH Reverse complement motif 0.241771 0.174273 0.394748 0.189208 0.268414 0.239541 0.272007 0.220038 0.224167 0.258886 0.339979 0.176968 0.270924 0.089910 0.066184 0.572982 0.089180 0.065481 0.057961 0.787378 0.007259 0.002688 0.003346 0.986707 0.002288 0.001427 0.814764 0.181521 0.006360 0.001685 0.004159 0.987796 0.025378 0.017745 0.000584 0.956294 0.001789 0.082928 0.001910 0.913373 0.967100 0.015691 0.003073 0.014136 0.303850 0.678034 0.013619 0.004497 0.197759 0.127275 0.325924 0.349042 0.190362 0.132646 0.170373 0.506619 0.174803 0.192852 0.156858 0.475488 0.221693 0.133379 0.306363 0.338566 0.260583 0.257473 0.208488 0.273456 Consensus sequence: DVVTTTGTTTACDTHDH Alignment: HDHADGTAAACAAAVVH --AAAATCAACAA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00227 Duxl Original Motif Reverse Complement Forward 3 11 0.007217 Species: Mus musculus Original motif 0.059324 0.549998 0.101788 0.288890 0.350238 0.047771 0.474127 0.127863 0.770996 0.015441 0.164902 0.048661 0.063151 0.673997 0.105494 0.157359 0.021548 0.664224 0.091845 0.222383 0.002154 0.741020 0.002050 0.254777 0.987687 0.008317 0.000992 0.003004 0.973679 0.023948 0.000878 0.001495 0.002325 0.007546 0.001364 0.988764 0.001171 0.979424 0.000772 0.018633 0.968044 0.001410 0.000963 0.029583 0.830222 0.031401 0.088899 0.049478 0.053145 0.528291 0.175613 0.242950 0.245422 0.250649 0.275044 0.228886 0.314555 0.186237 0.342207 0.157002 0.279193 0.196590 0.151908 0.372310 0.199093 0.291226 0.335413 0.174267 Consensus sequence: YRACCCAATCAACVVHV Reverse complement motif 0.199093 0.335413 0.291226 0.174267 0.372310 0.196590 0.151908 0.279193 0.314555 0.342207 0.186237 0.157002 0.245422 0.275044 0.250649 0.228886 0.053145 0.175613 0.528291 0.242950 0.049478 0.031401 0.088899 0.830222 0.029583 0.001410 0.000963 0.968044 0.001171 0.000772 0.979424 0.018633 0.988764 0.007546 0.001364 0.002325 0.001495 0.023948 0.000878 0.973679 0.003004 0.008317 0.000992 0.987687 0.002154 0.002050 0.741020 0.254777 0.021548 0.091845 0.664224 0.222383 0.063151 0.105494 0.673997 0.157359 0.048661 0.015441 0.164902 0.770996 0.350238 0.474127 0.047771 0.127863 0.059324 0.101788 0.549998 0.288890 Consensus sequence: VHVVGTTGATTGGGTMK Alignment: VHVVGTTGATTGGGTMK --TTGTTGATTTT---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00037 Zfp105_primary Original Motif Reverse Complement Backward 2 11 0.010195 Species: Mus musculus Original motif 0.363104 0.182807 0.145232 0.308856 0.419707 0.133742 0.222546 0.224005 0.164481 0.418263 0.052397 0.364858 0.715575 0.117639 0.064914 0.101872 0.883836 0.026985 0.032584 0.056596 0.558797 0.151280 0.033120 0.256803 0.267037 0.403488 0.026746 0.302729 0.939762 0.013627 0.034579 0.012032 0.897072 0.009878 0.035642 0.057408 0.305904 0.516040 0.055311 0.122746 0.880940 0.027958 0.048350 0.042752 0.710082 0.052464 0.040250 0.197204 0.246712 0.125155 0.318627 0.309506 0.429749 0.181755 0.176892 0.211603 0.339643 0.097216 0.355250 0.207891 Consensus sequence: HDYAAAHAAMAADHD Reverse complement motif 0.339643 0.355250 0.097216 0.207891 0.211603 0.181755 0.176892 0.429749 0.246712 0.318627 0.125155 0.309506 0.197204 0.052464 0.040250 0.710082 0.042752 0.027958 0.048350 0.880940 0.305904 0.055311 0.516040 0.122746 0.057408 0.009878 0.035642 0.897072 0.012032 0.013627 0.034579 0.939762 0.267037 0.026746 0.403488 0.302729 0.256803 0.151280 0.033120 0.558797 0.056596 0.026985 0.032584 0.883836 0.101872 0.117639 0.064914 0.715575 0.164481 0.052397 0.418263 0.364858 0.224005 0.133742 0.222546 0.419707 0.308856 0.182807 0.145232 0.363104 Consensus sequence: HHHTTRTTDTTTKDH Alignment: HHHTTRTTDTTTKDH ---TTGTTGATTTT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00073 Foxa2_primary Reverse Complement Original Motif Forward 3 11 0.013583 Species: Mus musculus Original motif 0.335487 0.205062 0.128957 0.330494 0.411635 0.179625 0.175701 0.233038 0.412976 0.128602 0.091890 0.366532 0.608396 0.079002 0.107142 0.205460 0.433474 0.035203 0.153143 0.378180 0.087552 0.005003 0.894586 0.012858 0.004459 0.038951 0.001109 0.955481 0.924470 0.068560 0.001165 0.005805 0.920483 0.070039 0.001674 0.007805 0.988335 0.001902 0.003155 0.006608 0.001527 0.656726 0.002699 0.339047 0.987505 0.001810 0.004336 0.006349 0.719584 0.065184 0.050384 0.164848 0.535389 0.099997 0.102849 0.261764 0.245215 0.272017 0.301499 0.181269 0.306107 0.209040 0.248687 0.236166 0.223744 0.278668 0.251931 0.245657 Consensus sequence: HHWAWGTAAAYAAAVDB Reverse complement motif 0.223744 0.251931 0.278668 0.245657 0.236166 0.209040 0.248687 0.306107 0.245215 0.301499 0.272017 0.181269 0.261764 0.099997 0.102849 0.535389 0.164848 0.065184 0.050384 0.719584 0.006349 0.001810 0.004336 0.987505 0.001527 0.002699 0.656726 0.339047 0.006608 0.001902 0.003155 0.988335 0.007805 0.070039 0.001674 0.920483 0.005805 0.068560 0.001165 0.924470 0.955481 0.038951 0.001109 0.004459 0.087552 0.894586 0.005003 0.012858 0.378180 0.035203 0.153143 0.433474 0.205460 0.079002 0.107142 0.608396 0.366532 0.128602 0.091890 0.412976 0.233038 0.179625 0.175701 0.411635 0.330494 0.205062 0.128957 0.335487 Consensus sequence: BDVTTTKTTTACWTWHH Alignment: HHWAWGTAAAYAAAVDB --AAAATCAACAA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00145 Barhl2 Reverse Complement Original Motif Forward 2 11 0.013942 Species: Mus musculus Original motif 0.461695 0.224449 0.118884 0.194972 0.573918 0.178052 0.084607 0.163423 0.509202 0.299283 0.046830 0.144686 0.781754 0.035879 0.132996 0.049371 0.909629 0.018003 0.066327 0.006042 0.185305 0.442819 0.168153 0.203723 0.004152 0.938941 0.000741 0.056166 0.952728 0.004094 0.036915 0.006262 0.962648 0.006522 0.001095 0.029735 0.002949 0.002007 0.002143 0.992902 0.002773 0.003794 0.001682 0.991751 0.985960 0.000635 0.003183 0.010222 0.728479 0.023198 0.141457 0.106866 0.100754 0.330009 0.347597 0.221641 0.392007 0.211701 0.147142 0.249150 0.323968 0.271247 0.123950 0.280834 Consensus sequence: HAMAAHCAATTAABHH Reverse complement motif 0.280834 0.271247 0.123950 0.323968 0.249150 0.211701 0.147142 0.392007 0.100754 0.347597 0.330009 0.221641 0.106866 0.023198 0.141457 0.728479 0.010222 0.000635 0.003183 0.985960 0.991751 0.003794 0.001682 0.002773 0.992902 0.002007 0.002143 0.002949 0.029735 0.006522 0.001095 0.962648 0.006262 0.004094 0.036915 0.952728 0.004152 0.000741 0.938941 0.056166 0.185305 0.168153 0.442819 0.203723 0.006042 0.018003 0.066327 0.909629 0.049371 0.035879 0.132996 0.781754 0.144686 0.299283 0.046830 0.509202 0.163423 0.178052 0.084607 0.573918 0.194972 0.224449 0.118884 0.461695 Consensus sequence: HHBTTAATTGDTTYTH Alignment: HAMAAHCAATTAABHH -AAAATCAACAA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00041 Foxj1_primary Reverse Complement Original Motif Backward 6 11 0.016482 Species: Mus musculus Original motif 0.446042 0.209997 0.124191 0.219770 0.271534 0.218131 0.245258 0.265077 0.368646 0.184693 0.168482 0.278180 0.348384 0.034204 0.583335 0.034077 0.040365 0.085618 0.013162 0.860855 0.824790 0.156631 0.004063 0.014515 0.835134 0.069381 0.003505 0.091980 0.967572 0.009280 0.006259 0.016890 0.009507 0.909577 0.004492 0.076424 0.947956 0.006994 0.008177 0.036873 0.599204 0.170666 0.065622 0.164508 0.708795 0.035865 0.070557 0.184782 0.303191 0.287145 0.184748 0.224917 0.285550 0.184167 0.248662 0.281621 0.235315 0.210836 0.254428 0.299421 0.220038 0.158539 0.286552 0.334871 Consensus sequence: HDHRTAAACAAAHDDD Reverse complement motif 0.334871 0.158539 0.286552 0.220038 0.299421 0.210836 0.254428 0.235315 0.281621 0.184167 0.248662 0.285550 0.224917 0.287145 0.184748 0.303191 0.184782 0.035865 0.070557 0.708795 0.164508 0.170666 0.065622 0.599204 0.036873 0.006994 0.008177 0.947956 0.009507 0.004492 0.909577 0.076424 0.016890 0.009280 0.006259 0.967572 0.091980 0.069381 0.003505 0.835134 0.014515 0.156631 0.004063 0.824790 0.860855 0.085618 0.013162 0.040365 0.348384 0.583335 0.034204 0.034077 0.278180 0.184693 0.168482 0.368646 0.265077 0.218131 0.245258 0.271534 0.219770 0.209997 0.124191 0.446042 Consensus sequence: DDDHTTTGTTTAMHDH Alignment: HDHRTAAACAAAHDDD AAAATCAACAA----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00025 Foxk1_secondary Original Motif Reverse Complement Backward 3 11 0.022020 Species: Mus musculus Original motif 0.240753 0.425595 0.141281 0.192371 0.367715 0.247224 0.117353 0.267708 0.489169 0.220343 0.113844 0.176644 0.742256 0.042809 0.146704 0.068231 0.078936 0.546144 0.032328 0.342592 0.588419 0.293580 0.082117 0.035885 0.913924 0.026256 0.050778 0.009042 0.009007 0.565680 0.010683 0.414630 0.947562 0.020878 0.018821 0.012739 0.901384 0.021519 0.030204 0.046893 0.077157 0.797900 0.026432 0.098511 0.824314 0.040128 0.051910 0.083648 0.254436 0.342235 0.143789 0.259539 0.319400 0.338163 0.129746 0.212691 0.231014 0.260719 0.169042 0.339225 Consensus sequence: HHHAYAAYAACAHHH Reverse complement motif 0.339225 0.260719 0.169042 0.231014 0.319400 0.129746 0.338163 0.212691 0.254436 0.143789 0.342235 0.259539 0.083648 0.040128 0.051910 0.824314 0.077157 0.026432 0.797900 0.098511 0.046893 0.021519 0.030204 0.901384 0.012739 0.020878 0.018821 0.947562 0.009007 0.010683 0.565680 0.414630 0.009042 0.026256 0.050778 0.913924 0.035885 0.293580 0.082117 0.588419 0.078936 0.032328 0.546144 0.342592 0.068231 0.042809 0.146704 0.742256 0.176644 0.220343 0.113844 0.489169 0.267708 0.247224 0.117353 0.367715 0.240753 0.141281 0.425595 0.192371 Consensus sequence: HDDTGTTKTTKTHHD Alignment: HDDTGTTKTTKTHHD --TTGTTGATTTT-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00067 Lef1_secondary Original Motif Reverse Complement Forward 5 11 0.024284 Species: Mus musculus Original motif 0.225775 0.266368 0.393085 0.114772 0.435548 0.077011 0.232595 0.254846 0.416750 0.144725 0.322119 0.116406 0.172866 0.341069 0.390257 0.095807 0.809227 0.021474 0.010361 0.158938 0.039268 0.014676 0.010455 0.935601 0.015615 0.901755 0.039475 0.043155 0.944804 0.006853 0.008451 0.039892 0.934861 0.010096 0.037766 0.017277 0.026944 0.020363 0.046918 0.905775 0.108303 0.713885 0.010564 0.167248 0.679723 0.017661 0.275577 0.027039 0.239565 0.345553 0.186641 0.228241 0.088115 0.243857 0.204018 0.464010 0.331032 0.182800 0.110215 0.375953 0.337037 0.160373 0.185584 0.317006 Consensus sequence: VDVVATCAATCAHBHD Reverse complement motif 0.317006 0.160373 0.185584 0.337037 0.375953 0.182800 0.110215 0.331032 0.464010 0.243857 0.204018 0.088115 0.239565 0.186641 0.345553 0.228241 0.027039 0.017661 0.275577 0.679723 0.108303 0.010564 0.713885 0.167248 0.905775 0.020363 0.046918 0.026944 0.017277 0.010096 0.037766 0.934861 0.039892 0.006853 0.008451 0.944804 0.015615 0.039475 0.901755 0.043155 0.935601 0.014676 0.010455 0.039268 0.158938 0.021474 0.010361 0.809227 0.172866 0.390257 0.341069 0.095807 0.116406 0.144725 0.322119 0.416750 0.254846 0.077011 0.232595 0.435548 0.225775 0.393085 0.266368 0.114772 Consensus sequence: DHVDTGATTGATVBDV Alignment: DHVDTGATTGATVBDV ----TTGTTGATTTT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 32 Motif name: Motif 32 Original motif 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.500000 0.000000 0.000000 0.500000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 Consensus sequence: TTACWGTTT Reserve complement motif 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.500000 0.000000 0.000000 0.500000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 Consensus sequence: AAACWGTAA ************************************************************************ Best Matches for Motif ID 32 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00052 Osr2_primary Reverse Complement Original Motif Forward 3 9 0.020262 Species: Mus musculus Original motif 0.295210 0.230759 0.178832 0.295199 0.286163 0.186772 0.186150 0.340915 0.287577 0.235045 0.329453 0.147924 0.263264 0.191325 0.081978 0.463433 0.839420 0.118123 0.018788 0.023669 0.005488 0.984397 0.000830 0.009284 0.660134 0.001532 0.336574 0.001760 0.003020 0.001773 0.993144 0.002063 0.039664 0.001060 0.005054 0.954222 0.980339 0.000636 0.016776 0.002249 0.003849 0.001418 0.992166 0.002568 0.000858 0.950172 0.007228 0.041743 0.342840 0.230712 0.133570 0.292878 0.342486 0.316980 0.167294 0.173240 0.362426 0.178913 0.146709 0.311952 0.266586 0.140406 0.435643 0.157365 Consensus sequence: HHVHACRGTAGCHHHD Reverse complement motif 0.266586 0.435643 0.140406 0.157365 0.311952 0.178913 0.146709 0.362426 0.173240 0.316980 0.167294 0.342486 0.292878 0.230712 0.133570 0.342840 0.000858 0.007228 0.950172 0.041743 0.003849 0.992166 0.001418 0.002568 0.002249 0.000636 0.016776 0.980339 0.954222 0.001060 0.005054 0.039664 0.003020 0.993144 0.001773 0.002063 0.001760 0.001532 0.336574 0.660134 0.005488 0.000830 0.984397 0.009284 0.023669 0.118123 0.018788 0.839420 0.463433 0.191325 0.081978 0.263264 0.287577 0.329453 0.235045 0.147924 0.340915 0.186772 0.186150 0.286163 0.295199 0.230759 0.178832 0.295210 Consensus sequence: HHHHGCTACKGTHVHH Alignment: HHVHACRGTAGCHHHD --AAACWGTAA----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00027 Osr1_primary Reverse Complement Original Motif Backward 6 9 0.020563 Species: Mus musculus Original motif 0.260366 0.252887 0.224273 0.262474 0.239931 0.233883 0.190643 0.335543 0.257637 0.188706 0.242480 0.311177 0.323833 0.165978 0.161144 0.349046 0.824983 0.119267 0.027014 0.028736 0.009055 0.974108 0.000889 0.015947 0.659219 0.001516 0.337361 0.001905 0.002965 0.001643 0.993070 0.002321 0.047380 0.001758 0.009593 0.941269 0.974073 0.000741 0.023187 0.001999 0.006256 0.001341 0.990114 0.002290 0.001372 0.921382 0.010719 0.066527 0.449788 0.160658 0.105504 0.284050 0.392727 0.304490 0.187448 0.115335 0.361758 0.209213 0.175805 0.253224 0.420972 0.108912 0.289406 0.180710 Consensus sequence: HHDHACRGTAGCHVHD Reverse complement motif 0.180710 0.108912 0.289406 0.420972 0.253224 0.209213 0.175805 0.361758 0.115335 0.304490 0.187448 0.392727 0.284050 0.160658 0.105504 0.449788 0.001372 0.010719 0.921382 0.066527 0.006256 0.990114 0.001341 0.002290 0.001999 0.000741 0.023187 0.974073 0.941269 0.001758 0.009593 0.047380 0.002965 0.993070 0.001643 0.002321 0.001905 0.001516 0.337361 0.659219 0.009055 0.000889 0.974108 0.015947 0.028736 0.119267 0.027014 0.824983 0.349046 0.165978 0.161144 0.323833 0.311177 0.188706 0.242480 0.257637 0.335543 0.233883 0.190643 0.239931 0.262474 0.252887 0.224273 0.260366 Consensus sequence: DHBHGCTACKGTHDHH Alignment: HHDHACRGTAGCHVHD --AAACWGTAA----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00073 Foxa2_primary Original Motif Reverse Complement Forward 9 9 0.021208 Species: Mus musculus Original motif 0.335487 0.205062 0.128957 0.330494 0.411635 0.179625 0.175701 0.233038 0.412976 0.128602 0.091890 0.366532 0.608396 0.079002 0.107142 0.205460 0.433474 0.035203 0.153143 0.378180 0.087552 0.005003 0.894586 0.012858 0.004459 0.038951 0.001109 0.955481 0.924470 0.068560 0.001165 0.005805 0.920483 0.070039 0.001674 0.007805 0.988335 0.001902 0.003155 0.006608 0.001527 0.656726 0.002699 0.339047 0.987505 0.001810 0.004336 0.006349 0.719584 0.065184 0.050384 0.164848 0.535389 0.099997 0.102849 0.261764 0.245215 0.272017 0.301499 0.181269 0.306107 0.209040 0.248687 0.236166 0.223744 0.278668 0.251931 0.245657 Consensus sequence: HHWAWGTAAAYAAAVDB Reverse complement motif 0.223744 0.251931 0.278668 0.245657 0.236166 0.209040 0.248687 0.306107 0.245215 0.301499 0.272017 0.181269 0.261764 0.099997 0.102849 0.535389 0.164848 0.065184 0.050384 0.719584 0.006349 0.001810 0.004336 0.987505 0.001527 0.002699 0.656726 0.339047 0.006608 0.001902 0.003155 0.988335 0.007805 0.070039 0.001674 0.920483 0.005805 0.068560 0.001165 0.924470 0.955481 0.038951 0.001109 0.004459 0.087552 0.894586 0.005003 0.012858 0.378180 0.035203 0.153143 0.433474 0.205460 0.079002 0.107142 0.608396 0.366532 0.128602 0.091890 0.412976 0.233038 0.179625 0.175701 0.411635 0.330494 0.205062 0.128957 0.335487 Consensus sequence: BDVTTTKTTTACWTWHH Alignment: BDVTTTKTTTACWTWHH --------TTACWGTTT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00061 Foxl1_primary Original Motif Reverse Complement Forward 9 9 0.021345 Species: Mus musculus Original motif 0.323208 0.152915 0.185111 0.338766 0.428132 0.056109 0.099487 0.416272 0.659386 0.039965 0.035805 0.264843 0.647143 0.049206 0.078984 0.224667 0.208834 0.076592 0.071631 0.642943 0.341077 0.003865 0.649511 0.005547 0.016627 0.001866 0.001715 0.979792 0.952319 0.045294 0.000870 0.001516 0.988834 0.004620 0.000720 0.005826 0.989346 0.001005 0.006467 0.003182 0.001093 0.784230 0.001235 0.213442 0.991209 0.002017 0.001737 0.005037 0.801581 0.037084 0.023060 0.138274 0.528554 0.089350 0.107501 0.274595 0.208802 0.268646 0.368022 0.154530 0.280218 0.221367 0.340497 0.157918 0.146611 0.250725 0.293524 0.309140 Consensus sequence: DWAATRTAAACAAWVVB Reverse complement motif 0.309140 0.250725 0.293524 0.146611 0.280218 0.340497 0.221367 0.157918 0.208802 0.368022 0.268646 0.154530 0.274595 0.089350 0.107501 0.528554 0.138274 0.037084 0.023060 0.801581 0.005037 0.002017 0.001737 0.991209 0.001093 0.001235 0.784230 0.213442 0.003182 0.001005 0.006467 0.989346 0.005826 0.004620 0.000720 0.988834 0.001516 0.045294 0.000870 0.952319 0.979792 0.001866 0.001715 0.016627 0.341077 0.649511 0.003865 0.005547 0.642943 0.076592 0.071631 0.208834 0.224667 0.049206 0.078984 0.647143 0.264843 0.039965 0.035805 0.659386 0.416272 0.056109 0.099487 0.428132 0.338766 0.152915 0.185111 0.323208 Consensus sequence: VVVWTTGTTTAMATTWD Alignment: VVVWTTGTTTAMATTWD --------TTACWGTTT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00081 Mybl1_primary Original Motif Reverse Complement Backward 5 9 0.023777 Species: Mus musculus Original motif 0.219490 0.243488 0.196239 0.340783 0.242096 0.094435 0.234242 0.429226 0.242319 0.155536 0.366023 0.236122 0.369837 0.185801 0.219486 0.224876 0.390568 0.211210 0.098244 0.299978 0.782192 0.011783 0.158354 0.047671 0.837985 0.006254 0.084522 0.071239 0.027255 0.965067 0.001360 0.006318 0.006706 0.831051 0.151462 0.010782 0.003491 0.002829 0.991758 0.001921 0.004195 0.009136 0.009776 0.976893 0.009860 0.166761 0.002159 0.821220 0.709623 0.006957 0.204415 0.079005 0.316262 0.239384 0.140024 0.304330 0.254660 0.237146 0.090326 0.417868 0.289939 0.309708 0.068038 0.332316 0.262670 0.214791 0.217375 0.305164 Consensus sequence: HDDDHAACCGTTAHHHD Reverse complement motif 0.305164 0.214791 0.217375 0.262670 0.332316 0.309708 0.068038 0.289939 0.417868 0.237146 0.090326 0.254660 0.304330 0.239384 0.140024 0.316262 0.079005 0.006957 0.204415 0.709623 0.821220 0.166761 0.002159 0.009860 0.976893 0.009136 0.009776 0.004195 0.003491 0.991758 0.002829 0.001921 0.006706 0.151462 0.831051 0.010782 0.027255 0.001360 0.965067 0.006318 0.071239 0.006254 0.084522 0.837985 0.047671 0.011783 0.158354 0.782192 0.299978 0.211210 0.098244 0.390568 0.224876 0.185801 0.219486 0.369837 0.242319 0.366023 0.155536 0.236122 0.429226 0.094435 0.234242 0.242096 0.340783 0.243488 0.196239 0.219490 Consensus sequence: DHHHTAACGGTTHDHDH Alignment: DHHHTAACGGTTHDHDH ----TTACWGTTT---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00025 Foxk1_primary Original Motif Reverse Complement Forward 9 9 0.024019 Species: Mus musculus Original motif 0.338172 0.192194 0.207817 0.261817 0.407924 0.117261 0.278236 0.196580 0.595570 0.070480 0.119221 0.214729 0.710845 0.038748 0.052600 0.197807 0.124647 0.116138 0.178053 0.581162 0.201602 0.005514 0.792110 0.000774 0.024590 0.004193 0.001331 0.969886 0.919465 0.077871 0.000760 0.001904 0.972342 0.010395 0.000580 0.016683 0.991045 0.001495 0.003585 0.003875 0.001358 0.885197 0.000980 0.112465 0.990318 0.001846 0.002968 0.004867 0.804563 0.063147 0.023496 0.108795 0.564824 0.087976 0.102865 0.244336 0.269947 0.300278 0.285008 0.144767 0.337905 0.220102 0.253694 0.188299 0.153781 0.274135 0.318343 0.253741 Consensus sequence: DDAATGTAAACAAAVVB Reverse complement motif 0.153781 0.318343 0.274135 0.253741 0.188299 0.220102 0.253694 0.337905 0.269947 0.285008 0.300278 0.144767 0.244336 0.087976 0.102865 0.564824 0.108795 0.063147 0.023496 0.804563 0.004867 0.001846 0.002968 0.990318 0.001358 0.000980 0.885197 0.112465 0.003875 0.001495 0.003585 0.991045 0.016683 0.010395 0.000580 0.972342 0.001904 0.077871 0.000760 0.919465 0.969886 0.004193 0.001331 0.024590 0.201602 0.792110 0.005514 0.000774 0.581162 0.116138 0.178053 0.124647 0.197807 0.038748 0.052600 0.710845 0.214729 0.070480 0.119221 0.595570 0.196580 0.117261 0.278236 0.407924 0.261817 0.192194 0.207817 0.338172 Consensus sequence: BBVTTTGTTTACATTDD Alignment: BBVTTTGTTTACATTDD --------TTACWGTTT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00186 Meis1 Original Motif Reverse Complement Backward 4 9 0.024551 Species: Mus musculus Original motif 0.432115 0.114994 0.130835 0.322056 0.508081 0.060822 0.214256 0.216841 0.225875 0.276028 0.280982 0.217115 0.092373 0.286687 0.360933 0.260007 0.947172 0.005937 0.028595 0.018297 0.027829 0.439935 0.505051 0.027185 0.023801 0.963424 0.008205 0.004571 0.001548 0.018215 0.000406 0.979831 0.008422 0.001124 0.989007 0.001446 0.025343 0.004094 0.000241 0.970323 0.001451 0.992789 0.002037 0.003724 0.991202 0.001638 0.003159 0.004002 0.695910 0.022145 0.013657 0.268288 0.357895 0.090931 0.093796 0.457378 0.453163 0.204395 0.181067 0.161376 0.200615 0.393437 0.171398 0.234551 Consensus sequence: WAVBASCTGTCAAWVH Reverse complement motif 0.200615 0.171398 0.393437 0.234551 0.161376 0.204395 0.181067 0.453163 0.457378 0.090931 0.093796 0.357895 0.268288 0.022145 0.013657 0.695910 0.004002 0.001638 0.003159 0.991202 0.001451 0.002037 0.992789 0.003724 0.970323 0.004094 0.000241 0.025343 0.008422 0.989007 0.001124 0.001446 0.979831 0.018215 0.000406 0.001548 0.023801 0.008205 0.963424 0.004571 0.027829 0.505051 0.439935 0.027185 0.018297 0.005937 0.028595 0.947172 0.092373 0.360933 0.286687 0.260007 0.225875 0.280982 0.276028 0.217115 0.216841 0.060822 0.214256 0.508081 0.322056 0.114994 0.130835 0.432115 Consensus sequence: DBWTTGACAGSTBVTW Alignment: DBWTTGACAGSTBVTW ----TTACWGTTT--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00092 Myb_primary Reverse Complement Original Motif Forward 5 9 0.025841 Species: Mus musculus Original motif 0.328645 0.216829 0.175041 0.279486 0.206917 0.095182 0.203533 0.494368 0.222004 0.148675 0.347360 0.281962 0.261099 0.154556 0.318840 0.265505 0.377807 0.263226 0.136863 0.222105 0.760794 0.008750 0.150250 0.080207 0.825640 0.005474 0.090464 0.078422 0.026327 0.960952 0.000707 0.012015 0.006831 0.825142 0.158264 0.009762 0.003618 0.003083 0.991947 0.001351 0.005535 0.009490 0.008936 0.976039 0.014230 0.225407 0.002645 0.757718 0.683148 0.019522 0.184293 0.113036 0.312491 0.189333 0.105503 0.392673 0.330394 0.234925 0.083817 0.350864 0.290215 0.302656 0.081892 0.325237 0.235445 0.214519 0.215223 0.334814 Consensus sequence: HDDDHAACCGTTAHHHD Reverse complement motif 0.334814 0.214519 0.215223 0.235445 0.325237 0.302656 0.081892 0.290215 0.350864 0.234925 0.083817 0.330394 0.392673 0.189333 0.105503 0.312491 0.113036 0.019522 0.184293 0.683148 0.757718 0.225407 0.002645 0.014230 0.976039 0.009490 0.008936 0.005535 0.003618 0.991947 0.003083 0.001351 0.006831 0.158264 0.825142 0.009762 0.026327 0.000707 0.960952 0.012015 0.078422 0.005474 0.090464 0.825640 0.080207 0.008750 0.150250 0.760794 0.222105 0.263226 0.136863 0.377807 0.261099 0.318840 0.154556 0.265505 0.222004 0.347360 0.148675 0.281962 0.494368 0.095182 0.203533 0.206917 0.279486 0.216829 0.175041 0.328645 Consensus sequence: DHHHTAACGGTTHHHDH Alignment: HDDDHAACCGTTAHHHD ----AAACWGTAA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00226 Mrg1 Original Motif Reverse Complement Forward 5 9 0.026773 Species: Mus musculus Original motif 0.378836 0.145096 0.102046 0.374022 0.507161 0.090730 0.177058 0.225051 0.277496 0.234581 0.275775 0.212149 0.065300 0.339403 0.360939 0.234358 0.918963 0.010948 0.043262 0.026826 0.017295 0.545133 0.416603 0.020969 0.023391 0.962223 0.007311 0.007075 0.001760 0.020258 0.000360 0.977622 0.013946 0.000586 0.983699 0.001769 0.035910 0.004825 0.000197 0.959068 0.001465 0.991446 0.001338 0.005750 0.986785 0.001158 0.005848 0.006209 0.715894 0.043046 0.018966 0.222093 0.332332 0.084841 0.098421 0.484405 0.473739 0.198580 0.152072 0.175610 0.211505 0.325971 0.212211 0.250313 Consensus sequence: WAVBASCTGTCAAWHB Reverse complement motif 0.211505 0.212211 0.325971 0.250313 0.175610 0.198580 0.152072 0.473739 0.484405 0.084841 0.098421 0.332332 0.222093 0.043046 0.018966 0.715894 0.006209 0.001158 0.005848 0.986785 0.001465 0.001338 0.991446 0.005750 0.959068 0.004825 0.000197 0.035910 0.013946 0.983699 0.000586 0.001769 0.977622 0.020258 0.000360 0.001760 0.023391 0.007311 0.962223 0.007075 0.017295 0.416603 0.545133 0.020969 0.026826 0.010948 0.043262 0.918963 0.065300 0.360939 0.339403 0.234358 0.212149 0.234581 0.275775 0.277496 0.225051 0.090730 0.177058 0.507161 0.374022 0.145096 0.102046 0.378836 Consensus sequence: BHWTTGACAGSTBBTW Alignment: BHWTTGACAGSTBBTW ----TTACWGTTT--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00203 Pknox1 Original Motif Reverse Complement Forward 5 9 0.027719 Species: Mus musculus Original motif 0.436259 0.086706 0.169714 0.307321 0.433826 0.063296 0.358082 0.144795 0.324190 0.284651 0.208786 0.182372 0.054648 0.285295 0.518967 0.141090 0.922874 0.012239 0.042656 0.022231 0.036668 0.581917 0.338993 0.042422 0.021599 0.968542 0.006920 0.002939 0.001846 0.026071 0.000271 0.971812 0.007232 0.000773 0.989645 0.002350 0.019103 0.005771 0.000209 0.974917 0.001535 0.989111 0.000852 0.008502 0.989698 0.000915 0.004907 0.004480 0.679114 0.077050 0.037931 0.205904 0.330007 0.110122 0.067993 0.491878 0.286458 0.421726 0.186579 0.105236 0.199258 0.473968 0.173008 0.153766 Consensus sequence: DRVSASCTGTCAAWVV Reverse complement motif 0.199258 0.173008 0.473968 0.153766 0.286458 0.186579 0.421726 0.105236 0.491878 0.110122 0.067993 0.330007 0.205904 0.077050 0.037931 0.679114 0.004480 0.000915 0.004907 0.989698 0.001535 0.000852 0.989111 0.008502 0.974917 0.005771 0.000209 0.019103 0.007232 0.989645 0.000773 0.002350 0.971812 0.026071 0.000271 0.001846 0.021599 0.006920 0.968542 0.002939 0.036668 0.338993 0.581917 0.042422 0.022231 0.012239 0.042656 0.922874 0.054648 0.518967 0.285295 0.141090 0.182372 0.284651 0.208786 0.324190 0.144795 0.063296 0.358082 0.433826 0.307321 0.086706 0.169714 0.436259 Consensus sequence: VVWTTGACAGSTSBKD Alignment: VVWTTGACAGSTSBKD ----TTACWGTTT--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 33 Motif name: Motif 33 Original motif 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.500000 0.000000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.500000 0.000000 0.000000 0.500000 1.000000 0.000000 0.000000 0.000000 Consensus sequence: TTTAATGTYTTTWA Reserve complement motif 0.000000 0.000000 0.000000 1.000000 0.500000 0.000000 0.000000 0.500000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.500000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 Consensus sequence: TWAAAKACATTAAA ************************************************************************ Best Matches for Motif ID 33 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00171 Msx3 Original Motif Reverse Complement Forward 3 14 0.014364 Species: Mus musculus Original motif 0.317812 0.352438 0.231628 0.098123 0.601471 0.133830 0.164947 0.099752 0.399508 0.293187 0.098524 0.208781 0.754569 0.054130 0.133622 0.057678 0.770469 0.088090 0.086904 0.054537 0.038689 0.673100 0.189096 0.099115 0.004935 0.522968 0.000482 0.471615 0.986316 0.001484 0.009222 0.002978 0.991636 0.005079 0.001457 0.001828 0.009156 0.001857 0.001081 0.987906 0.013688 0.006588 0.000191 0.979532 0.987635 0.000354 0.005166 0.006845 0.701095 0.027828 0.154852 0.116224 0.181731 0.184800 0.303458 0.330011 0.224816 0.221032 0.182405 0.371747 0.310539 0.208307 0.099081 0.382073 Consensus sequence: VAHAACYAATTAABHH Reverse complement motif 0.382073 0.208307 0.099081 0.310539 0.371747 0.221032 0.182405 0.224816 0.330011 0.184800 0.303458 0.181731 0.116224 0.027828 0.154852 0.701095 0.006845 0.000354 0.005166 0.987635 0.979532 0.006588 0.000191 0.013688 0.987906 0.001857 0.001081 0.009156 0.001828 0.005079 0.001457 0.991636 0.002978 0.001484 0.009222 0.986316 0.004935 0.000482 0.522968 0.471615 0.038689 0.189096 0.673100 0.099115 0.054537 0.088090 0.086904 0.770469 0.057678 0.054130 0.133622 0.754569 0.208781 0.293187 0.098524 0.399508 0.099752 0.133830 0.164947 0.601471 0.317812 0.231628 0.352438 0.098123 Consensus sequence: HHVTTAATTKGTTHTV Alignment: HHVTTAATTKGTTHTV --TTTAATGTYTTTWA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00145 Barhl2 Original Motif Reverse Complement Forward 3 14 0.014960 Species: Mus musculus Original motif 0.461695 0.224449 0.118884 0.194972 0.573918 0.178052 0.084607 0.163423 0.509202 0.299283 0.046830 0.144686 0.781754 0.035879 0.132996 0.049371 0.909629 0.018003 0.066327 0.006042 0.185305 0.442819 0.168153 0.203723 0.004152 0.938941 0.000741 0.056166 0.952728 0.004094 0.036915 0.006262 0.962648 0.006522 0.001095 0.029735 0.002949 0.002007 0.002143 0.992902 0.002773 0.003794 0.001682 0.991751 0.985960 0.000635 0.003183 0.010222 0.728479 0.023198 0.141457 0.106866 0.100754 0.330009 0.347597 0.221641 0.392007 0.211701 0.147142 0.249150 0.323968 0.271247 0.123950 0.280834 Consensus sequence: HAMAAHCAATTAABHH Reverse complement motif 0.280834 0.271247 0.123950 0.323968 0.249150 0.211701 0.147142 0.392007 0.100754 0.347597 0.330009 0.221641 0.106866 0.023198 0.141457 0.728479 0.010222 0.000635 0.003183 0.985960 0.991751 0.003794 0.001682 0.002773 0.992902 0.002007 0.002143 0.002949 0.029735 0.006522 0.001095 0.962648 0.006262 0.004094 0.036915 0.952728 0.004152 0.000741 0.938941 0.056166 0.185305 0.168153 0.442819 0.203723 0.006042 0.018003 0.066327 0.909629 0.049371 0.035879 0.132996 0.781754 0.144686 0.299283 0.046830 0.509202 0.163423 0.178052 0.084607 0.573918 0.194972 0.224449 0.118884 0.461695 Consensus sequence: HHBTTAATTGDTTYTH Alignment: HHBTTAATTGDTTYTH --TTTAATGTYTTTWA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00170 Isl2 Original Motif Reverse Complement Forward 3 14 0.022680 Species: Mus musculus Original motif 0.380653 0.464278 0.069710 0.085358 0.372741 0.252485 0.094893 0.279881 0.400406 0.346871 0.119279 0.133444 0.582825 0.148558 0.126868 0.141748 0.743019 0.117598 0.049691 0.089692 0.055277 0.296642 0.093515 0.554566 0.016892 0.507616 0.007671 0.467820 0.599279 0.361703 0.019061 0.019957 0.705284 0.282581 0.005323 0.006811 0.013750 0.013079 0.004736 0.968435 0.013264 0.013804 0.004612 0.968319 0.933004 0.004447 0.005179 0.057370 0.656051 0.041577 0.212432 0.089940 0.145543 0.109863 0.307597 0.436997 0.323514 0.098571 0.137254 0.440660 0.204784 0.284909 0.075638 0.434669 Consensus sequence: MHHAAYYMATTAADWH Reverse complement motif 0.434669 0.284909 0.075638 0.204784 0.440660 0.098571 0.137254 0.323514 0.436997 0.109863 0.307597 0.145543 0.089940 0.041577 0.212432 0.656051 0.057370 0.004447 0.005179 0.933004 0.968319 0.013804 0.004612 0.013264 0.968435 0.013079 0.004736 0.013750 0.006811 0.282581 0.005323 0.705284 0.019957 0.361703 0.019061 0.599279 0.016892 0.007671 0.507616 0.467820 0.554566 0.296642 0.093515 0.055277 0.089692 0.117598 0.049691 0.743019 0.141748 0.148558 0.126868 0.582825 0.133444 0.346871 0.119279 0.400406 0.279881 0.252485 0.094893 0.372741 0.380653 0.069710 0.464278 0.085358 Consensus sequence: HWDTTAATYKMTTHHR Alignment: HWDTTAATYKMTTHHR --TTTAATGTYTTTWA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00119 Nkx2-9 Reverse Complement Reverse Complement Backward 1 14 0.022923 Species: Mus musculus Original motif 0.246057 0.081231 0.164694 0.508019 0.148670 0.199380 0.121257 0.530694 0.228864 0.152179 0.074714 0.544243 0.315761 0.097229 0.242200 0.344810 0.669183 0.002936 0.306075 0.021805 0.870957 0.008933 0.091276 0.028835 0.009834 0.028141 0.956928 0.005097 0.001783 0.219475 0.004428 0.774314 0.774314 0.004428 0.219475 0.001783 0.005097 0.956928 0.028141 0.009834 0.028835 0.091276 0.008933 0.870957 0.021805 0.306075 0.002936 0.669183 0.411282 0.172328 0.253633 0.162758 0.794622 0.018789 0.052643 0.133945 0.590680 0.124233 0.103686 0.181401 0.241272 0.115001 0.214390 0.429337 0.145724 0.359816 0.128911 0.365550 Consensus sequence: TTTDAAGTACTTVAADH Reverse complement motif 0.365550 0.359816 0.128911 0.145724 0.429337 0.115001 0.214390 0.241272 0.181401 0.124233 0.103686 0.590680 0.133945 0.018789 0.052643 0.794622 0.162758 0.172328 0.253633 0.411282 0.669183 0.306075 0.002936 0.021805 0.870957 0.091276 0.008933 0.028835 0.005097 0.028141 0.956928 0.009834 0.001783 0.004428 0.219475 0.774314 0.774314 0.219475 0.004428 0.001783 0.009834 0.956928 0.028141 0.005097 0.028835 0.008933 0.091276 0.870957 0.021805 0.002936 0.306075 0.669183 0.344810 0.097229 0.242200 0.315761 0.544243 0.152179 0.074714 0.228864 0.530694 0.199380 0.121257 0.148670 0.508019 0.081231 0.164694 0.246057 Consensus sequence: HDTTBAAGTACTTDAAA Alignment: HDTTBAAGTACTTDAAA ---TWAAAKACATTAAA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00216 Obox1 Reverse Complement Original Motif Forward 1 14 0.025502 Species: Mus musculus Original motif 0.239477 0.131084 0.243507 0.385932 0.217543 0.106254 0.206114 0.470089 0.647326 0.113122 0.157767 0.081785 0.447787 0.111541 0.372093 0.068580 0.248541 0.017787 0.686924 0.046748 0.088770 0.008796 0.883034 0.019400 0.049663 0.003287 0.945325 0.001725 0.003569 0.000420 0.960584 0.035426 0.967192 0.029883 0.000248 0.002677 0.001721 0.005927 0.001063 0.991288 0.008389 0.011678 0.000280 0.979653 0.946957 0.000663 0.002329 0.050052 0.711018 0.017942 0.052601 0.218440 0.234125 0.619719 0.073871 0.072285 0.255026 0.148239 0.159856 0.436879 0.448611 0.200869 0.092123 0.258397 0.182337 0.333505 0.182092 0.302066 Consensus sequence: DDARGGGGATTAACDHH Reverse complement motif 0.182337 0.182092 0.333505 0.302066 0.258397 0.200869 0.092123 0.448611 0.436879 0.148239 0.159856 0.255026 0.234125 0.073871 0.619719 0.072285 0.218440 0.017942 0.052601 0.711018 0.050052 0.000663 0.002329 0.946957 0.979653 0.011678 0.000280 0.008389 0.991288 0.005927 0.001063 0.001721 0.002677 0.029883 0.000248 0.967192 0.003569 0.960584 0.000420 0.035426 0.049663 0.945325 0.003287 0.001725 0.088770 0.883034 0.008796 0.019400 0.248541 0.686924 0.017787 0.046748 0.068580 0.111541 0.372093 0.447787 0.081785 0.113122 0.157767 0.647326 0.470089 0.106254 0.206114 0.217543 0.385932 0.131084 0.243507 0.239477 Consensus sequence: DHDGTTAATCCCCKTDD Alignment: DDARGGGGATTAACDHH TWAAAKACATTAAA--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00051 Sox8_primary Original Motif Original Motif Forward 4 14 0.026664 Species: Mus musculus Original motif 0.244952 0.197659 0.278014 0.279374 0.244434 0.136006 0.278446 0.341114 0.512025 0.129954 0.139069 0.218951 0.190001 0.086232 0.125500 0.598267 0.154692 0.325860 0.193904 0.325544 0.384624 0.130540 0.035110 0.449726 0.945021 0.006713 0.011975 0.036291 0.008386 0.026630 0.004166 0.960817 0.020908 0.005554 0.009294 0.964244 0.149285 0.038995 0.806085 0.005635 0.110990 0.007155 0.007797 0.874058 0.087283 0.099671 0.059611 0.753435 0.250662 0.432576 0.082152 0.234610 0.251277 0.174578 0.147771 0.426374 0.205121 0.137656 0.296366 0.360857 0.316796 0.152457 0.164403 0.366344 0.475864 0.128717 0.153551 0.241867 Consensus sequence: DDATBWATTGTTHHDDD Reverse complement motif 0.241867 0.128717 0.153551 0.475864 0.366344 0.152457 0.164403 0.316796 0.360857 0.137656 0.296366 0.205121 0.426374 0.174578 0.147771 0.251277 0.250662 0.082152 0.432576 0.234610 0.753435 0.099671 0.059611 0.087283 0.874058 0.007155 0.007797 0.110990 0.149285 0.806085 0.038995 0.005635 0.964244 0.005554 0.009294 0.020908 0.960817 0.026630 0.004166 0.008386 0.036291 0.006713 0.011975 0.945021 0.449726 0.130540 0.035110 0.384624 0.154692 0.193904 0.325860 0.325544 0.598267 0.086232 0.125500 0.190001 0.218951 0.129954 0.139069 0.512025 0.341114 0.136006 0.278446 0.244434 0.279374 0.197659 0.278014 0.244952 Consensus sequence: DDDHDAACAATWBATDD Alignment: DDATBWATTGTTHHDDD ---TTTAATGTYTTTWA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00091 Sox5_primary Original Motif Reverse Complement Forward 3 14 0.028808 Species: Mus musculus Original motif 0.305368 0.133033 0.173233 0.388366 0.257879 0.197076 0.146872 0.398174 0.257635 0.122462 0.256979 0.362924 0.446808 0.093619 0.289963 0.169610 0.148292 0.091229 0.632311 0.128169 0.827592 0.026174 0.130622 0.015612 0.976345 0.003817 0.005452 0.014386 0.005230 0.937364 0.008904 0.048502 0.973417 0.003014 0.006136 0.017433 0.974095 0.004350 0.011425 0.010130 0.030624 0.011927 0.003795 0.953653 0.491667 0.015453 0.085481 0.407399 0.451773 0.100304 0.244084 0.203838 0.434242 0.114442 0.217049 0.234267 0.333464 0.254828 0.092729 0.318979 0.333644 0.114919 0.184420 0.367017 Consensus sequence: DHDDGAACAATWDDHD Reverse complement motif 0.367017 0.114919 0.184420 0.333644 0.318979 0.254828 0.092729 0.333464 0.234267 0.114442 0.217049 0.434242 0.203838 0.100304 0.244084 0.451773 0.407399 0.015453 0.085481 0.491667 0.953653 0.011927 0.003795 0.030624 0.010130 0.004350 0.011425 0.974095 0.017433 0.003014 0.006136 0.973417 0.005230 0.008904 0.937364 0.048502 0.014386 0.003817 0.005452 0.976345 0.015612 0.026174 0.130622 0.827592 0.148292 0.632311 0.091229 0.128169 0.169610 0.093619 0.289963 0.446808 0.362924 0.122462 0.256979 0.257635 0.398174 0.197076 0.146872 0.257879 0.388366 0.133033 0.173233 0.305368 Consensus sequence: DHDDWATTGTTCDDHD Alignment: DHDDWATTGTTCDDHD --TTTAATGTYTTTWA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00096 Sox13_primary Original Motif Reverse Complement Backward 1 14 0.030129 Species: Mus musculus Original motif 0.269275 0.121320 0.165706 0.443700 0.188801 0.239798 0.175798 0.395603 0.368195 0.140376 0.162749 0.328680 0.497992 0.105708 0.282795 0.113505 0.130964 0.090292 0.620010 0.158734 0.825318 0.023531 0.125342 0.025809 0.959293 0.007648 0.010682 0.022377 0.019733 0.898543 0.014756 0.066968 0.943830 0.005894 0.014484 0.035792 0.949658 0.010125 0.029732 0.010485 0.038214 0.025063 0.006015 0.930708 0.465769 0.016866 0.079467 0.437898 0.416082 0.086340 0.115778 0.381801 0.356556 0.103268 0.179331 0.360845 0.206830 0.204618 0.120034 0.468518 0.302958 0.164260 0.071574 0.461209 Consensus sequence: DHDRGAACAATWWDHW Reverse complement motif 0.461209 0.164260 0.071574 0.302958 0.468518 0.204618 0.120034 0.206830 0.360845 0.103268 0.179331 0.356556 0.381801 0.086340 0.115778 0.416082 0.437898 0.016866 0.079467 0.465769 0.930708 0.025063 0.006015 0.038214 0.010485 0.010125 0.029732 0.949658 0.035792 0.005894 0.014484 0.943830 0.019733 0.014756 0.898543 0.066968 0.022377 0.007648 0.010682 0.959293 0.025809 0.023531 0.125342 0.825318 0.130964 0.620010 0.090292 0.158734 0.113505 0.105708 0.282795 0.497992 0.328680 0.140376 0.162749 0.368195 0.395603 0.239798 0.175798 0.188801 0.443700 0.121320 0.165706 0.269275 Consensus sequence: WHDWWATTGTTCKDHD Alignment: DHDRGAACAATWWDHW --TTTAATGTYTTTWA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00166 Barhl1 Original Motif Reverse Complement Forward 3 14 0.030335 Species: Mus musculus Original motif 0.467514 0.210142 0.140580 0.181765 0.607254 0.124874 0.137587 0.130285 0.280889 0.423565 0.125411 0.170135 0.748944 0.067655 0.136796 0.046605 0.723747 0.023732 0.218759 0.033762 0.075749 0.608701 0.182230 0.133321 0.005053 0.764340 0.000825 0.229781 0.951342 0.006010 0.029473 0.013175 0.890431 0.010111 0.000910 0.098548 0.004275 0.001291 0.002113 0.992321 0.005850 0.006608 0.000432 0.987110 0.979314 0.000732 0.001996 0.017957 0.546971 0.034786 0.326876 0.091366 0.120451 0.194359 0.328320 0.356870 0.274765 0.177491 0.231888 0.315855 0.223913 0.420032 0.139775 0.216280 Consensus sequence: HAHAACCAATTARBDH Reverse complement motif 0.223913 0.139775 0.420032 0.216280 0.315855 0.177491 0.231888 0.274765 0.356870 0.194359 0.328320 0.120451 0.091366 0.034786 0.326876 0.546971 0.017957 0.000732 0.001996 0.979314 0.987110 0.006608 0.000432 0.005850 0.992321 0.001291 0.002113 0.004275 0.098548 0.010111 0.000910 0.890431 0.013175 0.006010 0.029473 0.951342 0.005053 0.000825 0.764340 0.229781 0.075749 0.182230 0.608701 0.133321 0.033762 0.023732 0.218759 0.723747 0.046605 0.067655 0.136796 0.748944 0.280889 0.125411 0.423565 0.170135 0.130285 0.124874 0.137587 0.607254 0.181765 0.210142 0.140580 0.467514 Consensus sequence: DDVKTAATTGGTTDTH Alignment: DDVKTAATTGGTTDTH --TTTAATGTYTTTWA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00032 Gata3_primary Reverse Complement Original Motif Backward 8 14 0.030484 Species: Mus musculus Original motif 0.151572 0.262753 0.258275 0.327401 0.221834 0.113385 0.275380 0.389400 0.297769 0.136928 0.134678 0.430625 0.270099 0.110415 0.271106 0.348380 0.265471 0.090253 0.223340 0.420936 0.616582 0.090091 0.171960 0.121367 0.197318 0.107541 0.406904 0.288237 0.798258 0.046950 0.001406 0.153385 0.003195 0.002516 0.989707 0.004582 0.991503 0.002748 0.002617 0.003132 0.005015 0.002764 0.003026 0.989195 0.948394 0.008932 0.001344 0.041330 0.973109 0.004100 0.004081 0.018710 0.040365 0.113905 0.828185 0.017545 0.736608 0.130524 0.113464 0.019404 0.415921 0.106101 0.316613 0.161365 0.376582 0.170927 0.155572 0.296919 0.137731 0.197151 0.211055 0.454064 0.324853 0.122747 0.246107 0.306293 0.462490 0.207311 0.159392 0.170807 0.380420 0.188972 0.311990 0.118618 0.222178 0.157873 0.380486 0.239463 Consensus sequence: BDHDDADAGATAAGADHBDHVD Reverse complement motif 0.222178 0.380486 0.157873 0.239463 0.118618 0.188972 0.311990 0.380420 0.170807 0.207311 0.159392 0.462490 0.306293 0.122747 0.246107 0.324853 0.454064 0.197151 0.211055 0.137731 0.296919 0.170927 0.155572 0.376582 0.161365 0.106101 0.316613 0.415921 0.019404 0.130524 0.113464 0.736608 0.040365 0.828185 0.113905 0.017545 0.018710 0.004100 0.004081 0.973109 0.041330 0.008932 0.001344 0.948394 0.989195 0.002764 0.003026 0.005015 0.003132 0.002748 0.002617 0.991503 0.003195 0.989707 0.002516 0.004582 0.153385 0.046950 0.001406 0.798258 0.197318 0.406904 0.107541 0.288237 0.121367 0.090091 0.171960 0.616582 0.420936 0.090253 0.223340 0.265471 0.348380 0.110415 0.271106 0.270099 0.430625 0.136928 0.134678 0.297769 0.389400 0.113385 0.275380 0.221834 0.327401 0.262753 0.258275 0.151572 Consensus sequence: HBHDVHDTCTTATCTHTDDHDV Alignment: BDHDDADAGATAAGADHBDHVD -TWAAAKACATTAAA------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 34 Motif name: Motif 34 Original motif 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 Consensus sequence: AAAGATGA Reserve complement motif 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 Consensus sequence: TCATCTTT ************************************************************************ Best Matches for Motif ID 34 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00032 Gata3_primary Reverse Complement Reverse Complement Backward 6 8 0.023590 Species: Mus musculus Original motif 0.151572 0.262753 0.258275 0.327401 0.221834 0.113385 0.275380 0.389400 0.297769 0.136928 0.134678 0.430625 0.270099 0.110415 0.271106 0.348380 0.265471 0.090253 0.223340 0.420936 0.616582 0.090091 0.171960 0.121367 0.197318 0.107541 0.406904 0.288237 0.798258 0.046950 0.001406 0.153385 0.003195 0.002516 0.989707 0.004582 0.991503 0.002748 0.002617 0.003132 0.005015 0.002764 0.003026 0.989195 0.948394 0.008932 0.001344 0.041330 0.973109 0.004100 0.004081 0.018710 0.040365 0.113905 0.828185 0.017545 0.736608 0.130524 0.113464 0.019404 0.415921 0.106101 0.316613 0.161365 0.376582 0.170927 0.155572 0.296919 0.137731 0.197151 0.211055 0.454064 0.324853 0.122747 0.246107 0.306293 0.462490 0.207311 0.159392 0.170807 0.380420 0.188972 0.311990 0.118618 0.222178 0.157873 0.380486 0.239463 Consensus sequence: BDHDDADAGATAAGADHBDHVD Reverse complement motif 0.222178 0.380486 0.157873 0.239463 0.118618 0.188972 0.311990 0.380420 0.170807 0.207311 0.159392 0.462490 0.306293 0.122747 0.246107 0.324853 0.454064 0.197151 0.211055 0.137731 0.296919 0.170927 0.155572 0.376582 0.161365 0.106101 0.316613 0.415921 0.019404 0.130524 0.113464 0.736608 0.040365 0.828185 0.113905 0.017545 0.018710 0.004100 0.004081 0.973109 0.041330 0.008932 0.001344 0.948394 0.989195 0.002764 0.003026 0.005015 0.003132 0.002748 0.002617 0.991503 0.003195 0.989707 0.002516 0.004582 0.153385 0.046950 0.001406 0.798258 0.197318 0.406904 0.107541 0.288237 0.121367 0.090091 0.171960 0.616582 0.420936 0.090253 0.223340 0.265471 0.348380 0.110415 0.271106 0.270099 0.430625 0.136928 0.134678 0.297769 0.389400 0.113385 0.275380 0.221834 0.327401 0.262753 0.258275 0.151572 Consensus sequence: HBHDVHDTCTTATCTHTDDHDV Alignment: HBHDVHDTCTTATCTHTDDHDV ---------TCATCTTT----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00048 Rara Reverse Complement Reverse Complement Backward 5 8 0.024858 Species: Mus musculus Original motif 0.222478 0.177331 0.266395 0.333797 0.276222 0.360097 0.118354 0.245327 0.106047 0.268455 0.234217 0.391281 0.244163 0.407141 0.146864 0.201832 0.852083 0.050643 0.039941 0.057332 0.814108 0.012894 0.165984 0.007015 0.905198 0.005648 0.088378 0.000776 0.002783 0.000555 0.988205 0.008457 0.001289 0.000626 0.898209 0.099877 0.002878 0.001631 0.008910 0.986582 0.000499 0.975550 0.005264 0.018687 0.963627 0.000883 0.034432 0.001058 0.181490 0.517766 0.077094 0.223650 0.183789 0.384790 0.308350 0.123071 0.229801 0.228801 0.224468 0.316930 0.218244 0.170273 0.366746 0.244736 Consensus sequence: DHBHAAAGGTCACVHD Reverse complement motif 0.218244 0.366746 0.170273 0.244736 0.316930 0.228801 0.224468 0.229801 0.183789 0.308350 0.384790 0.123071 0.181490 0.077094 0.517766 0.223650 0.001058 0.000883 0.034432 0.963627 0.000499 0.005264 0.975550 0.018687 0.986582 0.001631 0.008910 0.002878 0.001289 0.898209 0.000626 0.099877 0.002783 0.988205 0.000555 0.008457 0.000776 0.005648 0.088378 0.905198 0.007015 0.012894 0.165984 0.814108 0.057332 0.050643 0.039941 0.852083 0.244163 0.146864 0.407141 0.201832 0.391281 0.268455 0.234217 0.106047 0.276222 0.118354 0.360097 0.245327 0.333797 0.177331 0.266395 0.222478 Consensus sequence: HHVGTGACCTTTDVDD Alignment: HHVGTGACCTTTDVDD ----TCATCTTT---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00009 Nr2f2_primary Reverse Complement Reverse Complement Forward 5 8 0.032079 Species: Mus musculus Original motif 0.253408 0.181904 0.273186 0.291502 0.262827 0.381870 0.153734 0.201569 0.143383 0.243233 0.242562 0.370823 0.247498 0.336892 0.176114 0.239496 0.856654 0.037068 0.049492 0.056786 0.797369 0.012935 0.176463 0.013233 0.808222 0.001309 0.189796 0.000674 0.002583 0.000536 0.989167 0.007714 0.002421 0.000283 0.972777 0.024519 0.000270 0.003650 0.019038 0.977041 0.000184 0.956654 0.005329 0.037833 0.925587 0.000706 0.072434 0.001273 0.307028 0.327297 0.079126 0.286549 0.238576 0.245847 0.384025 0.131552 0.281599 0.234987 0.226211 0.257204 0.211511 0.212695 0.363980 0.211815 Consensus sequence: DHBHAAAGGTCAHVHB Reverse complement motif 0.211511 0.363980 0.212695 0.211815 0.257204 0.234987 0.226211 0.281599 0.238576 0.384025 0.245847 0.131552 0.307028 0.079126 0.327297 0.286549 0.001273 0.000706 0.072434 0.925587 0.000184 0.005329 0.956654 0.037833 0.977041 0.003650 0.019038 0.000270 0.002421 0.972777 0.000283 0.024519 0.002583 0.989167 0.000536 0.007714 0.000674 0.001309 0.189796 0.808222 0.013233 0.012935 0.176463 0.797369 0.056786 0.037068 0.049492 0.856654 0.247498 0.176114 0.336892 0.239496 0.370823 0.243233 0.242562 0.143383 0.262827 0.153734 0.381870 0.201569 0.291502 0.181904 0.273186 0.253408 Consensus sequence: BHVDTGACCTTTDVDD Alignment: BHVDTGACCTTTDVDD ----TCATCTTT---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00114 Homez Original Motif Reverse Complement Backward 4 8 0.035340 Species: Mus musculus Original motif 0.585235 0.056880 0.174898 0.182987 0.344783 0.171238 0.144379 0.339600 0.496888 0.112442 0.086669 0.304001 0.457408 0.134777 0.032789 0.375026 0.342717 0.420568 0.171418 0.065297 0.872988 0.030946 0.004203 0.091862 0.006581 0.013120 0.006495 0.973804 0.036193 0.946961 0.004377 0.012469 0.014767 0.005226 0.966106 0.013901 0.208700 0.008264 0.021875 0.761161 0.037957 0.018882 0.028895 0.914266 0.157997 0.026546 0.021365 0.794092 0.139814 0.136272 0.117987 0.605927 0.125467 0.233302 0.183071 0.458161 0.523941 0.191122 0.050126 0.234811 0.374984 0.049392 0.291831 0.283793 0.268235 0.165772 0.308515 0.257477 Consensus sequence: AHWWMATCGTTTTBADD Reverse complement motif 0.268235 0.308515 0.165772 0.257477 0.283793 0.049392 0.291831 0.374984 0.234811 0.191122 0.050126 0.523941 0.458161 0.233302 0.183071 0.125467 0.605927 0.136272 0.117987 0.139814 0.794092 0.026546 0.021365 0.157997 0.914266 0.018882 0.028895 0.037957 0.761161 0.008264 0.021875 0.208700 0.014767 0.966106 0.005226 0.013901 0.036193 0.004377 0.946961 0.012469 0.973804 0.013120 0.006495 0.006581 0.091862 0.030946 0.004203 0.872988 0.342717 0.171418 0.420568 0.065297 0.375026 0.134777 0.032789 0.457408 0.304001 0.112442 0.086669 0.496888 0.339600 0.171238 0.144379 0.344783 0.182987 0.056880 0.174898 0.585235 Consensus sequence: HDTVAAAACGATRWWHT Alignment: HDTVAAAACGATRWWHT ------AAAGATGA--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00046 Tcfe2a_secondary Reverse Complement Reverse Complement Backward 5 8 0.037515 Species: Mus musculus Original motif 0.296417 0.247522 0.206749 0.249312 0.410113 0.201959 0.303149 0.084779 0.267313 0.132645 0.452057 0.147985 0.187929 0.136827 0.427628 0.247616 0.198671 0.425254 0.234160 0.141915 0.029244 0.953929 0.004092 0.012734 0.954570 0.014314 0.018695 0.012421 0.010025 0.055055 0.845504 0.089415 0.874802 0.040849 0.069178 0.015172 0.015084 0.010551 0.008736 0.965628 0.012981 0.007192 0.965036 0.014791 0.037724 0.016891 0.495632 0.449753 0.021685 0.438927 0.056118 0.483270 0.209872 0.365671 0.139706 0.284751 0.151815 0.336912 0.289382 0.221891 0.152995 0.262354 0.416434 0.168217 0.227567 0.187603 0.447892 0.136938 Consensus sequence: HVDDVCAGATGKYHBBV Reverse complement motif 0.227567 0.447892 0.187603 0.136938 0.152995 0.416434 0.262354 0.168217 0.151815 0.289382 0.336912 0.221891 0.209872 0.139706 0.365671 0.284751 0.483270 0.438927 0.056118 0.021685 0.037724 0.495632 0.016891 0.449753 0.012981 0.965036 0.007192 0.014791 0.965628 0.010551 0.008736 0.015084 0.015172 0.040849 0.069178 0.874802 0.010025 0.845504 0.055055 0.089415 0.012421 0.014314 0.018695 0.954570 0.029244 0.004092 0.953929 0.012734 0.198671 0.234160 0.425254 0.141915 0.187929 0.427628 0.136827 0.247616 0.267313 0.452057 0.132645 0.147985 0.084779 0.201959 0.303149 0.410113 0.249312 0.247522 0.206749 0.296417 Consensus sequence: VBBDMYCATCTGVHHBH Alignment: VBBDMYCATCTGVHHBH -----TCATCTTT---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00100 Gata6_primary Reverse Complement Reverse Complement Backward 4 8 0.039168 Species: Mus musculus Original motif 0.349779 0.104807 0.163845 0.381569 0.379507 0.241361 0.162996 0.216137 0.301570 0.171595 0.216294 0.310541 0.383341 0.282970 0.194814 0.138875 0.222790 0.153121 0.314812 0.309278 0.547714 0.112442 0.004050 0.335794 0.003590 0.001126 0.990090 0.005194 0.990511 0.001699 0.001957 0.005833 0.002023 0.005588 0.002297 0.990092 0.890935 0.001908 0.001081 0.106076 0.944095 0.006031 0.009953 0.039921 0.034723 0.215453 0.721767 0.028058 0.515733 0.239041 0.204426 0.040800 0.386668 0.116787 0.252701 0.243844 0.210568 0.133136 0.175912 0.480385 0.219610 0.214405 0.172518 0.393466 0.267885 0.223946 0.338950 0.169218 Consensus sequence: DHDVDWGATAAGADDHV Reverse complement motif 0.267885 0.338950 0.223946 0.169218 0.393466 0.214405 0.172518 0.219610 0.480385 0.133136 0.175912 0.210568 0.243844 0.116787 0.252701 0.386668 0.040800 0.239041 0.204426 0.515733 0.034723 0.721767 0.215453 0.028058 0.039921 0.006031 0.009953 0.944095 0.106076 0.001908 0.001081 0.890935 0.990092 0.005588 0.002297 0.002023 0.005833 0.001699 0.001957 0.990511 0.003590 0.990090 0.001126 0.005194 0.335794 0.112442 0.004050 0.547714 0.222790 0.314812 0.153121 0.309278 0.138875 0.282970 0.194814 0.383341 0.310541 0.171595 0.216294 0.301570 0.216137 0.241361 0.162996 0.379507 0.381569 0.104807 0.163845 0.349779 Consensus sequence: VHDDTCTTATCWHBDHD Alignment: VHDDTCTTATCWHBDHD ------TCATCTTT--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00419 Spic Original Motif Original Motif Backward 6 8 0.043741 Species: Mus musculus Original motif 0.372554 0.181557 0.296001 0.149888 0.734552 0.057250 0.044752 0.163446 0.707604 0.045049 0.110341 0.137006 0.637848 0.057252 0.071934 0.232966 0.125449 0.108933 0.689441 0.076176 0.266215 0.517339 0.207018 0.009428 0.015016 0.002582 0.979670 0.002732 0.004303 0.002322 0.989973 0.003401 0.982327 0.003552 0.003393 0.010727 0.974155 0.001662 0.003294 0.020889 0.040023 0.128522 0.821560 0.009894 0.027635 0.045828 0.016297 0.910239 0.317500 0.045635 0.172234 0.464631 0.342838 0.107812 0.284775 0.264576 Consensus sequence: VAAAGMGGAAGTWD Reverse complement motif 0.264576 0.107812 0.284775 0.342838 0.464631 0.045635 0.172234 0.317500 0.910239 0.045828 0.016297 0.027635 0.040023 0.821560 0.128522 0.009894 0.020889 0.001662 0.003294 0.974155 0.010727 0.003552 0.003393 0.982327 0.004303 0.989973 0.002322 0.003401 0.015016 0.979670 0.002582 0.002732 0.266215 0.207018 0.517339 0.009428 0.125449 0.689441 0.108933 0.076176 0.232966 0.057252 0.071934 0.637848 0.137006 0.045049 0.110341 0.707604 0.163446 0.057250 0.044752 0.734552 0.149888 0.181557 0.296001 0.372554 Consensus sequence: DWACTTCCRCTTTB Alignment: VAAAGMGGAAGTWD -AAAGATGA----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00199 Six4 Reverse Complement Reverse Complement Backward 1 8 0.046722 Species: Mus musculus Original motif 0.523054 0.168817 0.140331 0.167798 0.187385 0.177009 0.246164 0.389442 0.414492 0.118547 0.308876 0.158085 0.345234 0.289795 0.130249 0.234723 0.611522 0.116948 0.098944 0.172586 0.016342 0.029436 0.015062 0.939161 0.014351 0.004796 0.962435 0.018418 0.987454 0.005228 0.002590 0.004727 0.007431 0.812214 0.005849 0.174506 0.969354 0.025386 0.002362 0.002898 0.005123 0.989068 0.003362 0.002447 0.001424 0.969981 0.012011 0.016585 0.209729 0.227411 0.210523 0.352337 0.341679 0.297940 0.104590 0.255792 0.126190 0.288862 0.245018 0.339930 0.173008 0.295896 0.252422 0.278674 0.409639 0.210750 0.296197 0.083415 Consensus sequence: ADDHATGACACCBHBBV Reverse complement motif 0.083415 0.210750 0.296197 0.409639 0.173008 0.252422 0.295896 0.278674 0.339930 0.288862 0.245018 0.126190 0.255792 0.297940 0.104590 0.341679 0.352337 0.227411 0.210523 0.209729 0.001424 0.012011 0.969981 0.016585 0.005123 0.003362 0.989068 0.002447 0.002898 0.025386 0.002362 0.969354 0.007431 0.005849 0.812214 0.174506 0.004727 0.005228 0.002590 0.987454 0.014351 0.962435 0.004796 0.018418 0.939161 0.029436 0.015062 0.016342 0.172586 0.116948 0.098944 0.611522 0.234723 0.289795 0.130249 0.345234 0.158085 0.118547 0.308876 0.414492 0.389442 0.177009 0.246164 0.187385 0.167798 0.168817 0.140331 0.523054 Consensus sequence: BBVHVGGTGTCATHDDT Alignment: BBVHVGGTGTCATHDDT ---------TCATCTTT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00219 Cutl1_3494.2 Reverse Complement Reverse Complement Backward 2 8 0.048317 Species: Mus musculus Original motif 0.233720 0.082903 0.208991 0.474386 0.507651 0.192839 0.165657 0.133852 0.416857 0.143747 0.322292 0.117104 0.029365 0.184697 0.093857 0.692081 0.144573 0.053738 0.658701 0.142989 0.867186 0.053221 0.032993 0.046600 0.042812 0.012598 0.006269 0.938320 0.338930 0.056180 0.507869 0.097021 0.938320 0.006269 0.012598 0.042812 0.046600 0.032993 0.053221 0.867186 0.142989 0.658701 0.053738 0.144573 0.692081 0.093857 0.184697 0.029365 0.260491 0.409202 0.153408 0.176899 0.151407 0.065515 0.123404 0.659674 0.492484 0.127826 0.190198 0.189491 Consensus sequence: DAVTGATRATCAHTD Reverse complement motif 0.189491 0.127826 0.190198 0.492484 0.659674 0.065515 0.123404 0.151407 0.260491 0.153408 0.409202 0.176899 0.029365 0.093857 0.184697 0.692081 0.142989 0.053738 0.658701 0.144573 0.867186 0.032993 0.053221 0.046600 0.042812 0.006269 0.012598 0.938320 0.338930 0.507869 0.056180 0.097021 0.938320 0.012598 0.006269 0.042812 0.046600 0.053221 0.032993 0.867186 0.144573 0.658701 0.053738 0.142989 0.692081 0.184697 0.093857 0.029365 0.117104 0.143747 0.322292 0.416857 0.133852 0.192839 0.165657 0.507651 0.474386 0.082903 0.208991 0.233720 Consensus sequence: DADTGATMATCABTD Alignment: DADTGATMATCABTD ------TCATCTTT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00208 Obox5_3963.2 Original Motif Original Motif Forward 4 8 0.048825 Species: Mus musculus Original motif 0.387261 0.198638 0.227497 0.186604 0.433519 0.034731 0.333894 0.197856 0.267661 0.212742 0.354328 0.165269 0.592496 0.107283 0.224595 0.075627 0.204749 0.093469 0.661179 0.040603 0.117847 0.005218 0.874222 0.002713 0.003947 0.001871 0.982671 0.011511 0.983643 0.007799 0.001236 0.007322 0.002525 0.002866 0.003899 0.990710 0.006852 0.004502 0.001227 0.987419 0.974671 0.000902 0.002297 0.022129 0.768669 0.009517 0.017357 0.204456 0.309857 0.185797 0.068291 0.436055 0.083091 0.099239 0.032683 0.784987 0.402339 0.181407 0.250088 0.166166 0.273450 0.139411 0.090102 0.497037 0.280230 0.335645 0.216046 0.168079 Consensus sequence: VRVAGGGATTAAHTVWV Reverse complement motif 0.280230 0.216046 0.335645 0.168079 0.497037 0.139411 0.090102 0.273450 0.166166 0.181407 0.250088 0.402339 0.784987 0.099239 0.032683 0.083091 0.436055 0.185797 0.068291 0.309857 0.204456 0.009517 0.017357 0.768669 0.022129 0.000902 0.002297 0.974671 0.987419 0.004502 0.001227 0.006852 0.990710 0.002866 0.003899 0.002525 0.007322 0.007799 0.001236 0.983643 0.003947 0.982671 0.001871 0.011511 0.117847 0.874222 0.005218 0.002713 0.204749 0.661179 0.093469 0.040603 0.075627 0.107283 0.224595 0.592496 0.267661 0.354328 0.212742 0.165269 0.197856 0.034731 0.333894 0.433519 0.186604 0.198638 0.227497 0.387261 Consensus sequence: VWBAHTTAATCCCTVKB Alignment: VRVAGGGATTAAHTVWV ---AAAGATGA------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 35 Motif name: Motif 35 Original motif 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.500000 0.000000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 Consensus sequence: AGATGYTCTTG Reserve complement motif 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 Consensus sequence: CAAGAKCATCT ************************************************************************ Best Matches for Motif ID 35 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00079 Esrra_primary Reverse Complement Original Motif Backward 3 11 0.014076 Species: Mus musculus Original motif 0.212524 0.177958 0.293723 0.315796 0.420838 0.283140 0.144938 0.151084 0.198119 0.196347 0.260353 0.345181 0.117752 0.282184 0.137207 0.462857 0.070125 0.781439 0.138093 0.010344 0.965989 0.000956 0.023828 0.009227 0.977263 0.003066 0.019255 0.000416 0.007404 0.000267 0.938934 0.053395 0.007147 0.000287 0.983377 0.009190 0.039608 0.000730 0.040682 0.918981 0.000685 0.905345 0.021930 0.072040 0.800961 0.001126 0.195791 0.002121 0.245039 0.241263 0.038084 0.475614 0.265397 0.238316 0.304963 0.191325 0.203742 0.286208 0.231002 0.279048 0.194132 0.188854 0.346693 0.270322 0.310711 0.263840 0.184317 0.241132 Consensus sequence: DHDBCAAGGTCAHVBDH Reverse complement motif 0.241132 0.263840 0.184317 0.310711 0.194132 0.346693 0.188854 0.270322 0.203742 0.231002 0.286208 0.279048 0.265397 0.304963 0.238316 0.191325 0.475614 0.241263 0.038084 0.245039 0.002121 0.001126 0.195791 0.800961 0.000685 0.021930 0.905345 0.072040 0.918981 0.000730 0.040682 0.039608 0.007147 0.983377 0.000287 0.009190 0.007404 0.938934 0.000267 0.053395 0.000416 0.003066 0.019255 0.977263 0.009227 0.000956 0.023828 0.965989 0.070125 0.138093 0.781439 0.010344 0.462857 0.282184 0.137207 0.117752 0.345181 0.196347 0.260353 0.198119 0.151084 0.283140 0.144938 0.420838 0.315796 0.177958 0.293723 0.212524 Consensus sequence: HHBVHTGACCTTGVDHD Alignment: DHDBCAAGGTCAHVBDH ----CAAGAKCATCT-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00046 Tcfe2a_secondary Original Motif Original Motif Forward 7 11 0.017522 Species: Mus musculus Original motif 0.296417 0.247522 0.206749 0.249312 0.410113 0.201959 0.303149 0.084779 0.267313 0.132645 0.452057 0.147985 0.187929 0.136827 0.427628 0.247616 0.198671 0.425254 0.234160 0.141915 0.029244 0.953929 0.004092 0.012734 0.954570 0.014314 0.018695 0.012421 0.010025 0.055055 0.845504 0.089415 0.874802 0.040849 0.069178 0.015172 0.015084 0.010551 0.008736 0.965628 0.012981 0.007192 0.965036 0.014791 0.037724 0.016891 0.495632 0.449753 0.021685 0.438927 0.056118 0.483270 0.209872 0.365671 0.139706 0.284751 0.151815 0.336912 0.289382 0.221891 0.152995 0.262354 0.416434 0.168217 0.227567 0.187603 0.447892 0.136938 Consensus sequence: HVDDVCAGATGKYHBBV Reverse complement motif 0.227567 0.447892 0.187603 0.136938 0.152995 0.416434 0.262354 0.168217 0.151815 0.289382 0.336912 0.221891 0.209872 0.139706 0.365671 0.284751 0.483270 0.438927 0.056118 0.021685 0.037724 0.495632 0.016891 0.449753 0.012981 0.965036 0.007192 0.014791 0.965628 0.010551 0.008736 0.015084 0.015172 0.040849 0.069178 0.874802 0.010025 0.845504 0.055055 0.089415 0.012421 0.014314 0.018695 0.954570 0.029244 0.004092 0.953929 0.012734 0.198671 0.234160 0.425254 0.141915 0.187929 0.427628 0.136827 0.247616 0.267313 0.452057 0.132645 0.147985 0.084779 0.201959 0.303149 0.410113 0.249312 0.247522 0.206749 0.296417 Consensus sequence: VBBDMYCATCTGVHHBH Alignment: HVDDVCAGATGKYHBBV ------AGATGYTCTTG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00019 Zbtb12_primary Original Motif Original Motif Backward 6 11 0.020965 Species: Mus musculus Original motif 0.163348 0.349811 0.273573 0.213268 0.212612 0.211975 0.220400 0.355012 0.325879 0.220972 0.186720 0.266430 0.510632 0.041115 0.419323 0.028930 0.067550 0.203499 0.411224 0.317727 0.023546 0.002038 0.972278 0.002138 0.017818 0.006841 0.006478 0.968864 0.019791 0.001443 0.009338 0.969428 0.003084 0.992130 0.002654 0.002131 0.001031 0.039768 0.003588 0.955613 0.980811 0.006260 0.008964 0.003965 0.013624 0.002796 0.979716 0.003863 0.841198 0.016422 0.129217 0.013163 0.169265 0.145424 0.085753 0.599558 0.068235 0.584950 0.065758 0.281057 0.378189 0.252218 0.209355 0.160238 0.167389 0.305726 0.229730 0.297156 Consensus sequence: BDHRBGTTCTAGATCVB Reverse complement motif 0.167389 0.229730 0.305726 0.297156 0.160238 0.252218 0.209355 0.378189 0.068235 0.065758 0.584950 0.281057 0.599558 0.145424 0.085753 0.169265 0.013163 0.016422 0.129217 0.841198 0.013624 0.979716 0.002796 0.003863 0.003965 0.006260 0.008964 0.980811 0.955613 0.039768 0.003588 0.001031 0.003084 0.002654 0.992130 0.002131 0.969428 0.001443 0.009338 0.019791 0.968864 0.006841 0.006478 0.017818 0.023546 0.972278 0.002038 0.002138 0.067550 0.411224 0.203499 0.317727 0.028930 0.041115 0.419323 0.510632 0.266430 0.220972 0.186720 0.325879 0.355012 0.211975 0.220400 0.212612 0.163348 0.273573 0.349811 0.213268 Consensus sequence: BBGATCTAGAACBKHDB Alignment: BDHRBGTTCTAGATCVB -AGATGYTCTTG----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00099 Ascl2_primary Original Motif Original Motif Forward 7 11 0.030270 Species: Mus musculus Original motif 0.168852 0.325948 0.188604 0.316596 0.150343 0.193286 0.241301 0.415069 0.091518 0.482905 0.122928 0.302648 0.472493 0.198776 0.225796 0.102935 0.294513 0.179919 0.447250 0.078318 0.014660 0.972080 0.005591 0.007668 0.954848 0.008107 0.008474 0.028571 0.006076 0.178912 0.760021 0.054991 0.052082 0.817415 0.124797 0.005707 0.019342 0.010406 0.008905 0.961347 0.005455 0.008073 0.977684 0.008788 0.042946 0.715551 0.087020 0.154483 0.116888 0.241739 0.170073 0.471300 0.315931 0.324343 0.291451 0.068274 0.199164 0.366921 0.163690 0.270226 0.218561 0.211076 0.187732 0.382631 0.145317 0.139808 0.389262 0.325614 Consensus sequence: BBYVVCAGCTGCBVHHD Reverse complement motif 0.145317 0.389262 0.139808 0.325614 0.382631 0.211076 0.187732 0.218561 0.199164 0.163690 0.366921 0.270226 0.315931 0.291451 0.324343 0.068274 0.471300 0.241739 0.170073 0.116888 0.042946 0.087020 0.715551 0.154483 0.005455 0.977684 0.008073 0.008788 0.961347 0.010406 0.008905 0.019342 0.052082 0.124797 0.817415 0.005707 0.006076 0.760021 0.178912 0.054991 0.028571 0.008107 0.008474 0.954848 0.014660 0.005591 0.972080 0.007668 0.294513 0.447250 0.179919 0.078318 0.102935 0.198776 0.225796 0.472493 0.091518 0.122928 0.482905 0.302648 0.415069 0.193286 0.241301 0.150343 0.168852 0.188604 0.325948 0.316596 Consensus sequence: HHDVVGCAGCTGVBKVB Alignment: BBYVVCAGCTGCBVHHD ------AGATGYTCTTG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00048 Rara Reverse Complement Original Motif Backward 2 11 0.031755 Species: Mus musculus Original motif 0.222478 0.177331 0.266395 0.333797 0.276222 0.360097 0.118354 0.245327 0.106047 0.268455 0.234217 0.391281 0.244163 0.407141 0.146864 0.201832 0.852083 0.050643 0.039941 0.057332 0.814108 0.012894 0.165984 0.007015 0.905198 0.005648 0.088378 0.000776 0.002783 0.000555 0.988205 0.008457 0.001289 0.000626 0.898209 0.099877 0.002878 0.001631 0.008910 0.986582 0.000499 0.975550 0.005264 0.018687 0.963627 0.000883 0.034432 0.001058 0.181490 0.517766 0.077094 0.223650 0.183789 0.384790 0.308350 0.123071 0.229801 0.228801 0.224468 0.316930 0.218244 0.170273 0.366746 0.244736 Consensus sequence: DHBHAAAGGTCACVHD Reverse complement motif 0.218244 0.366746 0.170273 0.244736 0.316930 0.228801 0.224468 0.229801 0.183789 0.308350 0.384790 0.123071 0.181490 0.077094 0.517766 0.223650 0.001058 0.000883 0.034432 0.963627 0.000499 0.005264 0.975550 0.018687 0.986582 0.001631 0.008910 0.002878 0.001289 0.898209 0.000626 0.099877 0.002783 0.988205 0.000555 0.008457 0.000776 0.005648 0.088378 0.905198 0.007015 0.012894 0.165984 0.814108 0.057332 0.050643 0.039941 0.852083 0.244163 0.146864 0.407141 0.201832 0.391281 0.268455 0.234217 0.106047 0.276222 0.118354 0.360097 0.245327 0.333797 0.177331 0.266395 0.222478 Consensus sequence: HHVGTGACCTTTDVDD Alignment: DHBHAAAGGTCACVHD ----CAAGAKCATCT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00025 Foxk1_secondary Original Motif Reverse Complement Backward 5 11 0.032905 Species: Mus musculus Original motif 0.240753 0.425595 0.141281 0.192371 0.367715 0.247224 0.117353 0.267708 0.489169 0.220343 0.113844 0.176644 0.742256 0.042809 0.146704 0.068231 0.078936 0.546144 0.032328 0.342592 0.588419 0.293580 0.082117 0.035885 0.913924 0.026256 0.050778 0.009042 0.009007 0.565680 0.010683 0.414630 0.947562 0.020878 0.018821 0.012739 0.901384 0.021519 0.030204 0.046893 0.077157 0.797900 0.026432 0.098511 0.824314 0.040128 0.051910 0.083648 0.254436 0.342235 0.143789 0.259539 0.319400 0.338163 0.129746 0.212691 0.231014 0.260719 0.169042 0.339225 Consensus sequence: HHHAYAAYAACAHHH Reverse complement motif 0.339225 0.260719 0.169042 0.231014 0.319400 0.129746 0.338163 0.212691 0.254436 0.143789 0.342235 0.259539 0.083648 0.040128 0.051910 0.824314 0.077157 0.026432 0.797900 0.098511 0.046893 0.021519 0.030204 0.901384 0.012739 0.020878 0.018821 0.947562 0.009007 0.010683 0.565680 0.414630 0.009042 0.026256 0.050778 0.913924 0.035885 0.293580 0.082117 0.588419 0.078936 0.032328 0.546144 0.342592 0.068231 0.042809 0.146704 0.742256 0.176644 0.220343 0.113844 0.489169 0.267708 0.247224 0.117353 0.367715 0.240753 0.141281 0.425595 0.192371 Consensus sequence: HDDTGTTKTTKTHHD Alignment: HDDTGTTKTTKTHHD AGATGYTCTTG---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v016060_primary Original Motif Original Motif Forward 9 11 0.035060 Species: Mus musculus Original motif 0.204923 0.208846 0.365383 0.220848 0.294304 0.300143 0.167287 0.238266 0.109711 0.619514 0.117379 0.153396 0.178979 0.378580 0.230177 0.212264 0.159594 0.542602 0.118178 0.179627 0.125206 0.430074 0.151826 0.292894 0.097692 0.709845 0.116956 0.075506 0.148292 0.565912 0.037632 0.248164 0.077951 0.034190 0.855503 0.032356 0.001657 0.001061 0.971877 0.025405 0.001926 0.001084 0.991712 0.005278 0.033031 0.012001 0.057796 0.897171 0.002723 0.002647 0.993348 0.001281 0.003261 0.000963 0.987199 0.008577 0.000611 0.090925 0.074857 0.833608 0.015299 0.978878 0.004949 0.000874 0.013368 0.600902 0.033485 0.352245 0.231949 0.149575 0.118804 0.499672 0.267580 0.186002 0.371242 0.175176 0.264884 0.223483 0.110082 0.401551 0.221365 0.170121 0.179559 0.428955 0.112997 0.692930 0.139981 0.054092 0.460305 0.207883 0.155111 0.176702 Consensus sequence: BHCBCBCCGGGTGGTCYHVHDCH Reverse complement motif 0.176702 0.207883 0.155111 0.460305 0.112997 0.139981 0.692930 0.054092 0.428955 0.170121 0.179559 0.221365 0.401551 0.223483 0.110082 0.264884 0.267580 0.371242 0.186002 0.175176 0.499672 0.149575 0.118804 0.231949 0.013368 0.033485 0.600902 0.352245 0.015299 0.004949 0.978878 0.000874 0.833608 0.090925 0.074857 0.000611 0.003261 0.987199 0.000963 0.008577 0.002723 0.993348 0.002647 0.001281 0.897171 0.012001 0.057796 0.033031 0.001926 0.991712 0.001084 0.005278 0.001657 0.971877 0.001061 0.025405 0.077951 0.855503 0.034190 0.032356 0.148292 0.037632 0.565912 0.248164 0.097692 0.116956 0.709845 0.075506 0.125206 0.151826 0.430074 0.292894 0.159594 0.118178 0.542602 0.179627 0.178979 0.230177 0.378580 0.212264 0.109711 0.117379 0.619514 0.153396 0.294304 0.167287 0.300143 0.238266 0.204923 0.365383 0.208846 0.220848 Consensus sequence: HGDHVHKGACCACCCGGBGBGDB Alignment: BHCBCBCCGGGTGGTCYHVHDCH --------AGATGYTCTTG---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00032 Gata3_secondary Original Motif Original Motif Backward 6 11 0.036670 Species: Mus musculus Original motif 0.177641 0.319872 0.115137 0.387350 0.136644 0.182137 0.205873 0.475347 0.254263 0.244280 0.165207 0.336250 0.240415 0.207557 0.237497 0.314530 0.271041 0.214702 0.364395 0.149863 0.095475 0.320104 0.191738 0.392682 0.500902 0.142722 0.026556 0.329820 0.051221 0.023698 0.897245 0.027836 0.922410 0.027509 0.024058 0.026023 0.030735 0.070903 0.024248 0.874114 0.242120 0.231992 0.225143 0.300745 0.106956 0.220471 0.283490 0.389083 0.152079 0.165830 0.135066 0.547025 0.839205 0.051581 0.060119 0.049095 0.041204 0.069147 0.070830 0.818819 0.051861 0.848177 0.027599 0.072363 0.383793 0.016807 0.397470 0.201931 0.381899 0.215846 0.255908 0.146347 0.094792 0.358651 0.280905 0.265652 0.296132 0.181545 0.178433 0.343890 0.301997 0.254722 0.108566 0.334714 0.349481 0.270693 0.137507 0.242319 Consensus sequence: HBHDVBWGATHBTATCRVBHHH Reverse complement motif 0.242319 0.270693 0.137507 0.349481 0.334714 0.254722 0.108566 0.301997 0.343890 0.181545 0.178433 0.296132 0.094792 0.280905 0.358651 0.265652 0.146347 0.215846 0.255908 0.381899 0.383793 0.397470 0.016807 0.201931 0.051861 0.027599 0.848177 0.072363 0.818819 0.069147 0.070830 0.041204 0.049095 0.051581 0.060119 0.839205 0.547025 0.165830 0.135066 0.152079 0.389083 0.220471 0.283490 0.106956 0.300745 0.231992 0.225143 0.242120 0.874114 0.070903 0.024248 0.030735 0.026023 0.027509 0.024058 0.922410 0.051221 0.897245 0.023698 0.027836 0.329820 0.142722 0.026556 0.500902 0.392682 0.320104 0.191738 0.095475 0.271041 0.364395 0.214702 0.149863 0.314530 0.207557 0.237497 0.240415 0.336250 0.244280 0.165207 0.254263 0.475347 0.182137 0.205873 0.136644 0.387350 0.319872 0.115137 0.177641 Consensus sequence: HHHBBMGATAVHATCWVVDHVH Alignment: HBHDVBWGATHBTATCRVBHHH ------AGATGYTCTTG----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00047 Zbtb7b_secondary Original Motif Reverse Complement Forward 5 11 0.036798 Species: Mus musculus Original motif 0.203365 0.307129 0.203712 0.285795 0.306328 0.182359 0.203143 0.308170 0.220878 0.174035 0.265341 0.339746 0.475421 0.085294 0.281054 0.158231 0.395971 0.330114 0.260810 0.013104 0.001970 0.006366 0.962058 0.029606 0.907785 0.081900 0.001279 0.009036 0.008745 0.981422 0.002970 0.006863 0.006791 0.966163 0.017605 0.009441 0.894233 0.081139 0.004949 0.019679 0.007553 0.970771 0.004892 0.016783 0.016719 0.797465 0.011842 0.173974 0.415678 0.189952 0.165207 0.229163 0.092707 0.182206 0.346121 0.378967 0.175722 0.130498 0.215118 0.478662 0.365762 0.163282 0.315788 0.155168 0.214734 0.272805 0.243194 0.269267 Consensus sequence: BDDRVGACCACCHBDVB Reverse complement motif 0.214734 0.243194 0.272805 0.269267 0.155168 0.163282 0.315788 0.365762 0.478662 0.130498 0.215118 0.175722 0.378967 0.182206 0.346121 0.092707 0.229163 0.189952 0.165207 0.415678 0.016719 0.011842 0.797465 0.173974 0.007553 0.004892 0.970771 0.016783 0.019679 0.081139 0.004949 0.894233 0.006791 0.017605 0.966163 0.009441 0.008745 0.002970 0.981422 0.006863 0.009036 0.081900 0.001279 0.907785 0.001970 0.962058 0.006366 0.029606 0.013104 0.330114 0.260810 0.395971 0.158231 0.085294 0.281054 0.475421 0.339746 0.174035 0.265341 0.220878 0.308170 0.182359 0.203143 0.306328 0.203365 0.203712 0.307129 0.285795 Consensus sequence: BBDVHGGTGGTCBKDDB Alignment: BBDVHGGTGGTCBKDDB ----AGATGYTCTTG-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v015681_primary Reverse Complement Original Motif Backward 7 11 0.038145 Species: Mus musculus Original motif 0.472795 0.179227 0.091251 0.256726 0.036521 0.159743 0.204840 0.598896 0.164582 0.312805 0.221324 0.301289 0.237069 0.249050 0.293048 0.220833 0.401949 0.225181 0.229401 0.143469 0.161422 0.494334 0.252207 0.092036 0.252940 0.177721 0.369400 0.199939 0.119630 0.024651 0.849920 0.005798 0.000962 0.002398 0.990616 0.006023 0.937852 0.027016 0.034535 0.000597 0.008963 0.987756 0.000629 0.002652 0.001584 0.992898 0.002349 0.003169 0.956822 0.027342 0.002484 0.013352 0.009873 0.987759 0.000988 0.001381 0.016397 0.980856 0.000369 0.002378 0.081761 0.758555 0.038572 0.121112 0.371713 0.091838 0.448027 0.088423 0.111617 0.121913 0.683885 0.082585 0.334562 0.102916 0.436488 0.126034 0.210362 0.101261 0.238339 0.450037 0.169041 0.271583 0.320799 0.238576 0.140316 0.049885 0.735236 0.074563 Consensus sequence: HTBVVVDGGACCACCCRGRDBG Reverse complement motif 0.140316 0.735236 0.049885 0.074563 0.169041 0.320799 0.271583 0.238576 0.450037 0.101261 0.238339 0.210362 0.334562 0.436488 0.102916 0.126034 0.111617 0.683885 0.121913 0.082585 0.371713 0.448027 0.091838 0.088423 0.081761 0.038572 0.758555 0.121112 0.016397 0.000369 0.980856 0.002378 0.009873 0.000988 0.987759 0.001381 0.013352 0.027342 0.002484 0.956822 0.001584 0.002349 0.992898 0.003169 0.008963 0.000629 0.987756 0.002652 0.000597 0.027016 0.034535 0.937852 0.000962 0.990616 0.002398 0.006023 0.119630 0.849920 0.024651 0.005798 0.252940 0.369400 0.177721 0.199939 0.161422 0.252207 0.494334 0.092036 0.143469 0.225181 0.229401 0.401949 0.237069 0.293048 0.249050 0.220833 0.164582 0.221324 0.312805 0.301289 0.598896 0.159743 0.204840 0.036521 0.256726 0.179227 0.091251 0.472795 Consensus sequence: CBDMCMGGGTGGTCCHVBVBAH Alignment: HTBVVVDGGACCACCCRGRDBG -----CAAGAKCATCT------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 36 Motif name: Motif 36 Original motif 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 Consensus sequence: TGGTGTCA Reserve complement motif 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 Consensus sequence: TGACACCA ************************************************************************ Best Matches for Motif ID 36 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00199 Six4 Reverse Complement Original Motif Forward 6 8 0.000000 Species: Mus musculus Original motif 0.523054 0.168817 0.140331 0.167798 0.187385 0.177009 0.246164 0.389442 0.414492 0.118547 0.308876 0.158085 0.345234 0.289795 0.130249 0.234723 0.611522 0.116948 0.098944 0.172586 0.016342 0.029436 0.015062 0.939161 0.014351 0.004796 0.962435 0.018418 0.987454 0.005228 0.002590 0.004727 0.007431 0.812214 0.005849 0.174506 0.969354 0.025386 0.002362 0.002898 0.005123 0.989068 0.003362 0.002447 0.001424 0.969981 0.012011 0.016585 0.209729 0.227411 0.210523 0.352337 0.341679 0.297940 0.104590 0.255792 0.126190 0.288862 0.245018 0.339930 0.173008 0.295896 0.252422 0.278674 0.409639 0.210750 0.296197 0.083415 Consensus sequence: ADDHATGACACCBHBBV Reverse complement motif 0.083415 0.210750 0.296197 0.409639 0.173008 0.252422 0.295896 0.278674 0.339930 0.288862 0.245018 0.126190 0.255792 0.297940 0.104590 0.341679 0.352337 0.227411 0.210523 0.209729 0.001424 0.012011 0.969981 0.016585 0.005123 0.003362 0.989068 0.002447 0.002898 0.025386 0.002362 0.969354 0.007431 0.005849 0.812214 0.174506 0.004727 0.005228 0.002590 0.987454 0.014351 0.962435 0.004796 0.018418 0.939161 0.029436 0.015062 0.016342 0.172586 0.116948 0.098944 0.611522 0.234723 0.289795 0.130249 0.345234 0.158085 0.118547 0.308876 0.414492 0.389442 0.177009 0.246164 0.187385 0.167798 0.168817 0.140331 0.523054 Consensus sequence: BBVHVGGTGTCATHDDT Alignment: ADDHATGACACCBHBBV -----TGACACCA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00388 Six6_2267.4 Reverse Complement Reverse Complement Forward 6 8 0.033561 Species: Mus musculus Original motif 0.330559 0.118371 0.278738 0.272331 0.605486 0.104492 0.066247 0.223775 0.180170 0.051522 0.131669 0.636639 0.431457 0.173748 0.323416 0.071378 0.131729 0.037944 0.812991 0.017337 0.022726 0.033975 0.914981 0.028317 0.138556 0.012597 0.847660 0.001188 0.001916 0.001156 0.046653 0.950276 0.965626 0.001518 0.031319 0.001536 0.003782 0.001412 0.002175 0.992631 0.006601 0.979412 0.002328 0.011660 0.947233 0.007670 0.017734 0.027363 0.374066 0.305253 0.063914 0.256767 0.267070 0.210201 0.216997 0.305732 0.294988 0.127424 0.094154 0.483434 0.354130 0.195592 0.176636 0.273642 0.094874 0.110275 0.192261 0.602591 Consensus sequence: DATRGGGTATCAHDWHT Reverse complement motif 0.602591 0.110275 0.192261 0.094874 0.273642 0.195592 0.176636 0.354130 0.483434 0.127424 0.094154 0.294988 0.305732 0.210201 0.216997 0.267070 0.256767 0.305253 0.063914 0.374066 0.027363 0.007670 0.017734 0.947233 0.006601 0.002328 0.979412 0.011660 0.992631 0.001412 0.002175 0.003782 0.001536 0.001518 0.031319 0.965626 0.950276 0.001156 0.046653 0.001916 0.138556 0.847660 0.012597 0.001188 0.022726 0.914981 0.033975 0.028317 0.131729 0.812991 0.037944 0.017337 0.071378 0.173748 0.323416 0.431457 0.636639 0.051522 0.131669 0.180170 0.223775 0.104492 0.066247 0.605486 0.272331 0.118371 0.278738 0.330559 Consensus sequence: AHWDHTGATACCCKATD Alignment: AHWDHTGATACCCKATD -----TGACACCA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00159 Six2 Reverse Complement Reverse Complement Backward 5 8 0.034289 Species: Mus musculus Original motif 0.452545 0.099192 0.290852 0.157411 0.587199 0.117373 0.086707 0.208721 0.191837 0.044362 0.256539 0.507262 0.299111 0.107464 0.518651 0.074774 0.118226 0.040974 0.797168 0.043631 0.010113 0.030311 0.923661 0.035916 0.126925 0.002828 0.869144 0.001103 0.001338 0.000719 0.046297 0.951646 0.958864 0.001525 0.038365 0.001246 0.003353 0.001741 0.001927 0.992979 0.007665 0.981087 0.001717 0.009531 0.903866 0.022768 0.054074 0.019292 0.165996 0.505327 0.077238 0.251439 0.252666 0.168847 0.288545 0.289942 0.336830 0.080857 0.058862 0.523451 0.234102 0.268721 0.215252 0.281925 0.172036 0.083695 0.223889 0.520379 Consensus sequence: DAKRGGGTATCACDWHT Reverse complement motif 0.520379 0.083695 0.223889 0.172036 0.281925 0.268721 0.215252 0.234102 0.523451 0.080857 0.058862 0.336830 0.289942 0.168847 0.288545 0.252666 0.165996 0.077238 0.505327 0.251439 0.019292 0.022768 0.054074 0.903866 0.007665 0.001717 0.981087 0.009531 0.992979 0.001741 0.001927 0.003353 0.001246 0.001525 0.038365 0.958864 0.951646 0.000719 0.046297 0.001338 0.126925 0.869144 0.002828 0.001103 0.010113 0.923661 0.030311 0.035916 0.118226 0.797168 0.040974 0.043631 0.299111 0.518651 0.107464 0.074774 0.507262 0.044362 0.256539 0.191837 0.208721 0.117373 0.086707 0.587199 0.157411 0.099192 0.290852 0.452545 Consensus sequence: AHWDGTGATACCCMRTD Alignment: AHWDGTGATACCCMRTD -----TGACACCA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00053 Rxra_primary Reverse Complement Original Motif Forward 6 8 0.034602 Species: Mus musculus Original motif 0.235299 0.222264 0.237416 0.305021 0.144778 0.278902 0.341673 0.234648 0.261127 0.261904 0.191591 0.285378 0.119943 0.410774 0.218940 0.250343 0.222672 0.075554 0.365253 0.336521 0.001838 0.046904 0.002828 0.948430 0.030410 0.006359 0.960821 0.002410 0.987391 0.007562 0.002810 0.002237 0.105188 0.888650 0.001163 0.004998 0.006475 0.987074 0.001793 0.004659 0.001816 0.765138 0.003092 0.229953 0.010354 0.846496 0.029899 0.113251 0.328732 0.039382 0.265510 0.366377 0.209638 0.262628 0.145613 0.382121 0.385390 0.177695 0.299828 0.137087 0.403452 0.268924 0.096028 0.231595 0.203082 0.231812 0.213520 0.351585 Consensus sequence: DBHBDTGACCCCDHVHB Reverse complement motif 0.351585 0.231812 0.213520 0.203082 0.231595 0.268924 0.096028 0.403452 0.137087 0.177695 0.299828 0.385390 0.382121 0.262628 0.145613 0.209638 0.366377 0.039382 0.265510 0.328732 0.010354 0.029899 0.846496 0.113251 0.001816 0.003092 0.765138 0.229953 0.006475 0.001793 0.987074 0.004659 0.105188 0.001163 0.888650 0.004998 0.002237 0.007562 0.002810 0.987391 0.030410 0.960821 0.006359 0.002410 0.948430 0.046904 0.002828 0.001838 0.222672 0.365253 0.075554 0.336521 0.119943 0.218940 0.410774 0.250343 0.285378 0.261904 0.191591 0.261127 0.144778 0.341673 0.278902 0.234648 0.305021 0.222264 0.237416 0.235299 Consensus sequence: VHBHDGGGGTCAHBHBD Alignment: DBHBDTGACCCCDHVHB -----TGACACCA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00079 Esrra_secondary Original Motif Original Motif Backward 6 8 0.034918 Species: Mus musculus Original motif 0.252126 0.268706 0.351590 0.127578 0.158171 0.083434 0.389646 0.368749 0.180010 0.290882 0.279192 0.249916 0.206905 0.249360 0.275438 0.268296 0.756588 0.046202 0.023921 0.173289 0.018262 0.022596 0.949143 0.010000 0.206468 0.046491 0.745475 0.001566 0.005511 0.001141 0.983152 0.010196 0.004791 0.001893 0.985951 0.007365 0.027643 0.001133 0.008565 0.962659 0.002459 0.970934 0.007826 0.018780 0.924387 0.003164 0.071225 0.001224 0.419387 0.230189 0.111588 0.238836 0.290954 0.163823 0.341233 0.203991 0.196768 0.281307 0.313868 0.208056 0.128428 0.260428 0.378607 0.232537 0.269305 0.378895 0.123480 0.228320 Consensus sequence: VKBBAGGGGTCAHDBBH Reverse complement motif 0.269305 0.123480 0.378895 0.228320 0.128428 0.378607 0.260428 0.232537 0.196768 0.313868 0.281307 0.208056 0.290954 0.341233 0.163823 0.203991 0.238836 0.230189 0.111588 0.419387 0.001224 0.003164 0.071225 0.924387 0.002459 0.007826 0.970934 0.018780 0.962659 0.001133 0.008565 0.027643 0.004791 0.985951 0.001893 0.007365 0.005511 0.983152 0.001141 0.010196 0.206468 0.745475 0.046491 0.001566 0.018262 0.949143 0.022596 0.010000 0.173289 0.046202 0.023921 0.756588 0.206905 0.275438 0.249360 0.268296 0.180010 0.279192 0.290882 0.249916 0.158171 0.389646 0.083434 0.368749 0.252126 0.351590 0.268706 0.127578 Consensus sequence: DBBHHTGACCCCTBBYV Alignment: VKBBAGGGGTCAHDBBH ----TGGTGTCA----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00122 Tgif1 Original Motif Reverse Complement Backward 6 8 0.035471 Species: Mus musculus Original motif 0.272977 0.158875 0.284742 0.283406 0.550609 0.124110 0.169608 0.155673 0.114568 0.207160 0.282464 0.395807 0.560868 0.052907 0.053508 0.332716 0.336500 0.068048 0.114050 0.481403 0.007736 0.003722 0.000495 0.988048 0.004489 0.000729 0.992211 0.002571 0.956618 0.000414 0.000890 0.042078 0.004381 0.990925 0.000538 0.004156 0.982797 0.000366 0.015539 0.001298 0.016760 0.002980 0.969991 0.010269 0.036013 0.725983 0.200022 0.037982 0.064755 0.104386 0.133891 0.696968 0.199404 0.263520 0.410228 0.126848 0.222648 0.351390 0.272575 0.153387 0.087778 0.206043 0.395671 0.310507 0.319643 0.144216 0.196041 0.340100 Consensus sequence: DABWWTGACAGCTVVBD Reverse complement motif 0.340100 0.144216 0.196041 0.319643 0.087778 0.395671 0.206043 0.310507 0.222648 0.272575 0.351390 0.153387 0.199404 0.410228 0.263520 0.126848 0.696968 0.104386 0.133891 0.064755 0.036013 0.200022 0.725983 0.037982 0.016760 0.969991 0.002980 0.010269 0.001298 0.000366 0.015539 0.982797 0.004381 0.000538 0.990925 0.004156 0.042078 0.000414 0.000890 0.956618 0.004489 0.992211 0.000729 0.002571 0.988048 0.003722 0.000495 0.007736 0.481403 0.068048 0.114050 0.336500 0.332716 0.052907 0.053508 0.560868 0.395807 0.207160 0.282464 0.114568 0.155673 0.124110 0.169608 0.550609 0.272977 0.284742 0.158875 0.283406 Consensus sequence: DBVVAGCTGTCAWWVTH Alignment: DBVVAGCTGTCAWWVTH ----TGGTGTCA----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00192 Six1 Reverse Complement Reverse Complement Forward 6 8 0.035555 Species: Mus musculus Original motif 0.319306 0.130147 0.399309 0.151238 0.482636 0.211172 0.085871 0.220321 0.214292 0.085504 0.207353 0.492851 0.392819 0.136859 0.403883 0.066438 0.215886 0.049341 0.685932 0.048842 0.039793 0.053756 0.870240 0.036211 0.202525 0.005026 0.791396 0.001053 0.001092 0.001021 0.052968 0.944919 0.963185 0.001738 0.033596 0.001480 0.002017 0.001886 0.002847 0.993250 0.009914 0.974962 0.001987 0.013137 0.909252 0.021586 0.037899 0.031263 0.177851 0.274190 0.117998 0.429961 0.228906 0.159459 0.303955 0.307681 0.330938 0.158106 0.118706 0.392251 0.160453 0.267920 0.280244 0.291383 0.176707 0.068175 0.229538 0.525580 Consensus sequence: DHDRGGGTATCAHDHBT Reverse complement motif 0.525580 0.068175 0.229538 0.176707 0.291383 0.267920 0.280244 0.160453 0.392251 0.158106 0.118706 0.330938 0.307681 0.159459 0.303955 0.228906 0.429961 0.274190 0.117998 0.177851 0.031263 0.021586 0.037899 0.909252 0.009914 0.001987 0.974962 0.013137 0.993250 0.001886 0.002847 0.002017 0.001480 0.001738 0.033596 0.963185 0.944919 0.001021 0.052968 0.001092 0.202525 0.791396 0.005026 0.001053 0.039793 0.870240 0.053756 0.036211 0.215886 0.685932 0.049341 0.048842 0.392819 0.403883 0.136859 0.066438 0.492851 0.085504 0.207353 0.214292 0.220321 0.211172 0.085871 0.482636 0.319306 0.399309 0.130147 0.151238 Consensus sequence: AVHDHTGATACCCMDHH Alignment: AVHDHTGATACCCMDHH -----TGACACCA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00388 Six6_2267.5 Reverse Complement Reverse Complement Backward 5 8 0.035579 Species: Mus musculus Original motif 0.357565 0.095438 0.345110 0.201887 0.415206 0.108701 0.160030 0.316063 0.276710 0.105226 0.183597 0.434468 0.461481 0.135300 0.303126 0.100093 0.190186 0.035578 0.728290 0.045946 0.040893 0.024794 0.889495 0.044817 0.197092 0.018297 0.781124 0.003487 0.005212 0.002190 0.027421 0.965178 0.970183 0.002451 0.021340 0.006025 0.004645 0.002381 0.003788 0.989186 0.017413 0.955357 0.007268 0.019962 0.927889 0.018513 0.013421 0.040177 0.411060 0.139133 0.096462 0.353345 0.215585 0.237932 0.205422 0.341060 0.409189 0.134754 0.084179 0.371879 0.210772 0.273586 0.108006 0.407635 0.091781 0.159161 0.216288 0.532770 Consensus sequence: DDDRGGGTATCAWHWHT Reverse complement motif 0.532770 0.159161 0.216288 0.091781 0.407635 0.273586 0.108006 0.210772 0.371879 0.134754 0.084179 0.409189 0.341060 0.237932 0.205422 0.215585 0.353345 0.139133 0.096462 0.411060 0.040177 0.018513 0.013421 0.927889 0.017413 0.007268 0.955357 0.019962 0.989186 0.002381 0.003788 0.004645 0.006025 0.002451 0.021340 0.970183 0.965178 0.002190 0.027421 0.005212 0.197092 0.781124 0.018297 0.003487 0.040893 0.889495 0.024794 0.044817 0.190186 0.728290 0.035578 0.045946 0.100093 0.135300 0.303126 0.461481 0.434468 0.105226 0.183597 0.276710 0.316063 0.108701 0.160030 0.415206 0.201887 0.095438 0.345110 0.357565 Consensus sequence: AHWHWTGATACCCKDDD Alignment: AHWHWTGATACCCKDDD -----TGACACCA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00068 Eomes_primary Reverse Complement Reverse Complement Forward 6 8 0.036216 Species: Mus musculus Original motif 0.186316 0.215541 0.297644 0.300499 0.300381 0.234276 0.266283 0.199061 0.317841 0.211418 0.183235 0.287507 0.482598 0.095323 0.245062 0.177017 0.654197 0.008988 0.261951 0.074864 0.095656 0.022883 0.843364 0.038097 0.002655 0.008355 0.976390 0.012600 0.003287 0.080755 0.001057 0.914900 0.006753 0.001517 0.989917 0.001813 0.039940 0.098800 0.003305 0.857955 0.009015 0.039036 0.844029 0.107921 0.984070 0.002369 0.008852 0.004709 0.789505 0.101528 0.029294 0.079672 0.649685 0.139882 0.090466 0.119966 0.421759 0.205595 0.073074 0.299573 0.214779 0.290522 0.134050 0.360649 0.202141 0.270323 0.176798 0.350738 Consensus sequence: BVHDAGGTGTGAAAHHH Reverse complement motif 0.350738 0.270323 0.176798 0.202141 0.360649 0.290522 0.134050 0.214779 0.299573 0.205595 0.073074 0.421759 0.119966 0.139882 0.090466 0.649685 0.079672 0.101528 0.029294 0.789505 0.004709 0.002369 0.008852 0.984070 0.009015 0.844029 0.039036 0.107921 0.857955 0.098800 0.003305 0.039940 0.006753 0.989917 0.001517 0.001813 0.914900 0.080755 0.001057 0.003287 0.002655 0.976390 0.008355 0.012600 0.095656 0.843364 0.022883 0.038097 0.074864 0.008988 0.261951 0.654197 0.177017 0.095323 0.245062 0.482598 0.287507 0.211418 0.183235 0.317841 0.199061 0.234276 0.266283 0.300381 0.300499 0.215541 0.297644 0.186316 Consensus sequence: HHHTTTCACACCTDHBV Alignment: HHHTTTCACACCTDHBV -----TGACACCA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00258 Tgif2 Reverse Complement Reverse Complement Forward 5 8 0.037383 Species: Mus musculus Original motif 0.519684 0.141807 0.112153 0.226356 0.614097 0.079211 0.138045 0.168647 0.186975 0.327654 0.245051 0.240320 0.108289 0.303530 0.219106 0.369076 0.914812 0.012014 0.046628 0.026546 0.070482 0.163253 0.689315 0.076951 0.016354 0.972639 0.003648 0.007359 0.002043 0.018718 0.000384 0.978855 0.006109 0.001408 0.990736 0.001747 0.024783 0.002060 0.000402 0.972755 0.001485 0.991963 0.001756 0.004796 0.989335 0.001052 0.002320 0.007293 0.778804 0.056366 0.037632 0.127198 0.377980 0.094597 0.086888 0.440535 0.458125 0.289431 0.152762 0.099682 0.223103 0.435348 0.216962 0.124587 Consensus sequence: AABBAGCTGTCAAWVV Reverse complement motif 0.223103 0.216962 0.435348 0.124587 0.099682 0.289431 0.152762 0.458125 0.440535 0.094597 0.086888 0.377980 0.127198 0.056366 0.037632 0.778804 0.007293 0.001052 0.002320 0.989335 0.001485 0.001756 0.991963 0.004796 0.972755 0.002060 0.000402 0.024783 0.006109 0.990736 0.001408 0.001747 0.978855 0.018718 0.000384 0.002043 0.016354 0.003648 0.972639 0.007359 0.070482 0.689315 0.163253 0.076951 0.026546 0.012014 0.046628 0.914812 0.369076 0.303530 0.219106 0.108289 0.186975 0.245051 0.327654 0.240320 0.168647 0.079211 0.138045 0.614097 0.226356 0.141807 0.112153 0.519684 Consensus sequence: VBWTTGACAGCTVBTT Alignment: VBWTTGACAGCTVBTT ----TGACACCA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 37 Motif name: Motif 37 Original motif 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 Consensus sequence: ACTTTGG Reserve complement motif 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 Consensus sequence: CCAAAGT ************************************************************************ Best Matches for Motif ID 37 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00066 Hnf4a_secondary Reverse Complement Original Motif Backward 8 7 0.000000 Species: Mus musculus Original motif 0.131680 0.169949 0.346277 0.352094 0.109910 0.144258 0.373681 0.372151 0.196671 0.411335 0.159689 0.232305 0.311086 0.307077 0.122332 0.259505 0.895155 0.013238 0.038874 0.052733 0.779629 0.018399 0.171269 0.030703 0.950546 0.002649 0.041825 0.004980 0.004769 0.002646 0.985847 0.006739 0.004458 0.002117 0.012011 0.981414 0.016789 0.969626 0.003890 0.009695 0.002468 0.982852 0.004754 0.009926 0.891448 0.003193 0.097548 0.007811 0.513330 0.308971 0.070467 0.107232 0.179371 0.115514 0.130898 0.574217 0.285826 0.277536 0.166982 0.269655 0.319407 0.227783 0.129020 0.323790 Consensus sequence: BBHHAAAGTCCAMTHH Reverse complement motif 0.323790 0.227783 0.129020 0.319407 0.269655 0.277536 0.166982 0.285826 0.574217 0.115514 0.130898 0.179371 0.107232 0.308971 0.070467 0.513330 0.007811 0.003193 0.097548 0.891448 0.002468 0.004754 0.982852 0.009926 0.016789 0.003890 0.969626 0.009695 0.981414 0.002117 0.012011 0.004458 0.004769 0.985847 0.002646 0.006739 0.004980 0.002649 0.041825 0.950546 0.030703 0.018399 0.171269 0.779629 0.052733 0.013238 0.038874 0.895155 0.259505 0.307077 0.122332 0.311086 0.196671 0.159689 0.411335 0.232305 0.109910 0.373681 0.144258 0.372151 0.352094 0.169949 0.346277 0.131680 Consensus sequence: HHAYTGGACTTTHDBV Alignment: BBHHAAAGTCCAMTHH --CCAAAGT------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00067 Lef1_primary Reverse Complement Reverse Complement Forward 7 7 0.012838 Species: Mus musculus Original motif 0.281920 0.214207 0.278077 0.225796 0.325566 0.151435 0.298797 0.224202 0.290253 0.145824 0.243443 0.320480 0.069286 0.404645 0.141614 0.384454 0.070044 0.621448 0.142647 0.165862 0.007295 0.907657 0.038110 0.046938 0.015587 0.018273 0.000658 0.965482 0.005527 0.005886 0.001905 0.986682 0.024512 0.001189 0.001344 0.972955 0.007384 0.025221 0.952270 0.015125 0.966438 0.000630 0.002693 0.030239 0.082252 0.001173 0.001495 0.915080 0.030255 0.677155 0.275323 0.017267 0.199467 0.118815 0.056814 0.624905 0.345445 0.169597 0.216831 0.268127 0.278106 0.150864 0.173693 0.397336 0.251834 0.339733 0.219703 0.188730 Consensus sequence: DDDYCCTTTGATCTDDV Reverse complement motif 0.251834 0.219703 0.339733 0.188730 0.397336 0.150864 0.173693 0.278106 0.268127 0.169597 0.216831 0.345445 0.624905 0.118815 0.056814 0.199467 0.030255 0.275323 0.677155 0.017267 0.915080 0.001173 0.001495 0.082252 0.030239 0.000630 0.002693 0.966438 0.007384 0.952270 0.025221 0.015125 0.972955 0.001189 0.001344 0.024512 0.986682 0.005886 0.001905 0.005527 0.965482 0.018273 0.000658 0.015587 0.007295 0.038110 0.907657 0.046938 0.070044 0.142647 0.621448 0.165862 0.069286 0.141614 0.404645 0.384454 0.320480 0.145824 0.243443 0.290253 0.224202 0.151435 0.298797 0.325566 0.225796 0.214207 0.278077 0.281920 Consensus sequence: VDDAGATCAAAGGKDDD Alignment: VDDAGATCAAAGGKDDD ------CCAAAGT---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00079 Esrra_primary Reverse Complement Original Motif Backward 8 7 0.014085 Species: Mus musculus Original motif 0.212524 0.177958 0.293723 0.315796 0.420838 0.283140 0.144938 0.151084 0.198119 0.196347 0.260353 0.345181 0.117752 0.282184 0.137207 0.462857 0.070125 0.781439 0.138093 0.010344 0.965989 0.000956 0.023828 0.009227 0.977263 0.003066 0.019255 0.000416 0.007404 0.000267 0.938934 0.053395 0.007147 0.000287 0.983377 0.009190 0.039608 0.000730 0.040682 0.918981 0.000685 0.905345 0.021930 0.072040 0.800961 0.001126 0.195791 0.002121 0.245039 0.241263 0.038084 0.475614 0.265397 0.238316 0.304963 0.191325 0.203742 0.286208 0.231002 0.279048 0.194132 0.188854 0.346693 0.270322 0.310711 0.263840 0.184317 0.241132 Consensus sequence: DHDBCAAGGTCAHVBDH Reverse complement motif 0.241132 0.263840 0.184317 0.310711 0.194132 0.346693 0.188854 0.270322 0.203742 0.231002 0.286208 0.279048 0.265397 0.304963 0.238316 0.191325 0.475614 0.241263 0.038084 0.245039 0.002121 0.001126 0.195791 0.800961 0.000685 0.021930 0.905345 0.072040 0.918981 0.000730 0.040682 0.039608 0.007147 0.983377 0.000287 0.009190 0.007404 0.938934 0.000267 0.053395 0.000416 0.003066 0.019255 0.977263 0.009227 0.000956 0.023828 0.965989 0.070125 0.138093 0.781439 0.010344 0.462857 0.282184 0.137207 0.117752 0.345181 0.196347 0.260353 0.198119 0.151084 0.283140 0.144938 0.420838 0.315796 0.177958 0.293723 0.212524 Consensus sequence: HHBVHTGACCTTGVDHD Alignment: DHDBCAAGGTCAHVBDH ---CCAAAGT------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00083 Tcf7l2_primary Reverse Complement Reverse Complement Backward 5 7 0.014116 Species: Mus musculus Original motif 0.285725 0.187143 0.254855 0.272277 0.276264 0.157893 0.258178 0.307665 0.238788 0.161120 0.254018 0.346074 0.076041 0.333901 0.150903 0.439156 0.093376 0.526578 0.180529 0.199517 0.010827 0.880320 0.034150 0.074703 0.016546 0.023834 0.000940 0.958680 0.007166 0.008215 0.001941 0.982678 0.029634 0.001363 0.001379 0.967625 0.010872 0.031751 0.926186 0.031190 0.949407 0.000760 0.002581 0.047253 0.109203 0.001362 0.002094 0.887341 0.044198 0.567994 0.353059 0.034749 0.222623 0.142360 0.041281 0.593736 0.358872 0.167597 0.220534 0.252997 0.233072 0.141480 0.230985 0.394463 0.350703 0.243129 0.233961 0.172207 Consensus sequence: DDDYCCTTTGATSTDDV Reverse complement motif 0.172207 0.243129 0.233961 0.350703 0.394463 0.141480 0.230985 0.233072 0.252997 0.167597 0.220534 0.358872 0.593736 0.142360 0.041281 0.222623 0.044198 0.353059 0.567994 0.034749 0.887341 0.001362 0.002094 0.109203 0.047253 0.000760 0.002581 0.949407 0.010872 0.926186 0.031751 0.031190 0.967625 0.001363 0.001379 0.029634 0.982678 0.008215 0.001941 0.007166 0.958680 0.023834 0.000940 0.016546 0.010827 0.034150 0.880320 0.074703 0.093376 0.180529 0.526578 0.199517 0.439156 0.333901 0.150903 0.076041 0.346074 0.161120 0.254018 0.238788 0.307665 0.157893 0.258178 0.276264 0.272277 0.187143 0.254855 0.285725 Consensus sequence: BDDASATCAAAGGMDDD Alignment: BDDASATCAAAGGMDDD ------CCAAAGT---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00062 Sox4_primary Original Motif Reverse Complement Forward 5 7 0.015980 Species: Mus musculus Original motif 0.427843 0.231210 0.119424 0.221523 0.196506 0.239531 0.304906 0.259057 0.302488 0.156922 0.290190 0.250401 0.433872 0.149126 0.196496 0.220506 0.258426 0.076511 0.475100 0.189963 0.841714 0.046453 0.099915 0.011918 0.983853 0.001612 0.001362 0.013174 0.003460 0.982032 0.005728 0.008780 0.989743 0.002253 0.002020 0.005984 0.990761 0.003397 0.002843 0.003000 0.770864 0.003540 0.001549 0.224048 0.235342 0.002598 0.757383 0.004677 0.371426 0.089574 0.529959 0.009040 0.480804 0.196949 0.240413 0.081833 0.187158 0.355102 0.216599 0.241142 0.248006 0.232182 0.157452 0.362360 0.403367 0.177684 0.164649 0.254300 Consensus sequence: HBDDDAACAAAGRVBHH Reverse complement motif 0.254300 0.177684 0.164649 0.403367 0.362360 0.232182 0.157452 0.248006 0.187158 0.216599 0.355102 0.241142 0.081833 0.196949 0.240413 0.480804 0.371426 0.529959 0.089574 0.009040 0.235342 0.757383 0.002598 0.004677 0.224048 0.003540 0.001549 0.770864 0.003000 0.003397 0.002843 0.990761 0.005984 0.002253 0.002020 0.989743 0.003460 0.005728 0.982032 0.008780 0.013174 0.001612 0.001362 0.983853 0.011918 0.046453 0.099915 0.841714 0.258426 0.475100 0.076511 0.189963 0.220506 0.149126 0.196496 0.433872 0.250401 0.156922 0.290190 0.302488 0.196506 0.304906 0.239531 0.259057 0.221523 0.231210 0.119424 0.427843 Consensus sequence: HHBBMCTTTGTTHDDBH Alignment: HHBBMCTTTGTTHDDBH ----ACTTTGG------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00030 Sox11_primary Original Motif Reverse Complement Forward 5 7 0.018161 Species: Mus musculus Original motif 0.351812 0.238467 0.143954 0.265768 0.195246 0.235838 0.281473 0.287443 0.349478 0.172616 0.210739 0.267167 0.484061 0.110438 0.173131 0.232370 0.276692 0.070713 0.479604 0.172991 0.859124 0.044167 0.083951 0.012758 0.975608 0.002029 0.002285 0.020079 0.006422 0.978485 0.007124 0.007969 0.987489 0.003025 0.002868 0.006617 0.987739 0.005463 0.002730 0.004067 0.693013 0.004067 0.002445 0.300475 0.189100 0.003677 0.801408 0.005814 0.352090 0.072517 0.567737 0.007656 0.542316 0.176545 0.192768 0.088371 0.196382 0.304176 0.205985 0.293457 0.289415 0.201358 0.182937 0.326290 0.385801 0.216362 0.152363 0.245475 Consensus sequence: HBDDRAACAAAGRABHH Reverse complement motif 0.245475 0.216362 0.152363 0.385801 0.326290 0.201358 0.182937 0.289415 0.196382 0.205985 0.304176 0.293457 0.088371 0.176545 0.192768 0.542316 0.352090 0.567737 0.072517 0.007656 0.189100 0.801408 0.003677 0.005814 0.300475 0.004067 0.002445 0.693013 0.004067 0.005463 0.002730 0.987739 0.006617 0.003025 0.002868 0.987489 0.006422 0.007124 0.978485 0.007969 0.020079 0.002029 0.002285 0.975608 0.012758 0.044167 0.083951 0.859124 0.276692 0.479604 0.070713 0.172991 0.232370 0.110438 0.173131 0.484061 0.267167 0.172616 0.210739 0.349478 0.287443 0.235838 0.281473 0.195246 0.265768 0.238467 0.143954 0.351812 Consensus sequence: HHBTMCTTTGTTMDDVH Alignment: HHBTMCTTTGTTMDDVH ----ACTTTGG------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00058 Tcf3_primary Original Motif Reverse Complement Forward 5 7 0.020076 Species: Mus musculus Original motif 0.185864 0.201179 0.183663 0.429294 0.371100 0.233868 0.122934 0.272098 0.249563 0.171285 0.128851 0.450301 0.582940 0.043382 0.129099 0.244578 0.041400 0.395349 0.497087 0.066163 0.759123 0.009670 0.005936 0.225270 0.056579 0.008662 0.003986 0.930772 0.043968 0.865783 0.056001 0.034249 0.962748 0.003731 0.003265 0.030256 0.971318 0.003542 0.012299 0.012841 0.937558 0.003991 0.020195 0.038256 0.125931 0.057976 0.798081 0.018012 0.209401 0.172342 0.483980 0.134277 0.485703 0.129227 0.309936 0.075134 0.397027 0.195902 0.152395 0.254676 0.311636 0.231510 0.157732 0.299122 0.320965 0.206031 0.164299 0.308705 Consensus sequence: HHHASATCAAAGVRHHH Reverse complement motif 0.308705 0.206031 0.164299 0.320965 0.299122 0.231510 0.157732 0.311636 0.254676 0.195902 0.152395 0.397027 0.075134 0.129227 0.309936 0.485703 0.209401 0.483980 0.172342 0.134277 0.125931 0.798081 0.057976 0.018012 0.038256 0.003991 0.020195 0.937558 0.012841 0.003542 0.012299 0.971318 0.030256 0.003731 0.003265 0.962748 0.043968 0.056001 0.865783 0.034249 0.930772 0.008662 0.003986 0.056579 0.225270 0.009670 0.005936 0.759123 0.041400 0.497087 0.395349 0.066163 0.244578 0.043382 0.129099 0.582940 0.450301 0.171285 0.128851 0.249563 0.272098 0.233868 0.122934 0.371100 0.429294 0.201179 0.183663 0.185864 Consensus sequence: HHHKVCTTTGATSTHHH Alignment: HHHKVCTTTGATSTHHH ----ACTTTGG------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00054 Tcf7_primary Original Motif Reverse Complement Forward 5 7 0.023024 Species: Mus musculus Original motif 0.170811 0.196976 0.220503 0.411710 0.337231 0.228482 0.140137 0.294150 0.299312 0.173780 0.143426 0.383481 0.603957 0.053557 0.128214 0.214271 0.036338 0.377925 0.534647 0.051091 0.725865 0.010314 0.008501 0.255320 0.067855 0.007849 0.004559 0.919737 0.049387 0.815496 0.098330 0.036787 0.960514 0.005036 0.005137 0.029313 0.960631 0.004550 0.018815 0.016004 0.935245 0.005169 0.023866 0.035720 0.159760 0.060340 0.761341 0.018559 0.228534 0.153897 0.523052 0.094517 0.557984 0.123512 0.254154 0.064350 0.490252 0.211976 0.124557 0.173215 0.310463 0.250279 0.132612 0.306646 0.332720 0.248937 0.120633 0.297711 Consensus sequence: BHHASATCAAAGGAHHH Reverse complement motif 0.297711 0.248937 0.120633 0.332720 0.306646 0.250279 0.132612 0.310463 0.173215 0.211976 0.124557 0.490252 0.064350 0.123512 0.254154 0.557984 0.228534 0.523052 0.153897 0.094517 0.159760 0.761341 0.060340 0.018559 0.035720 0.005169 0.023866 0.935245 0.016004 0.004550 0.018815 0.960631 0.029313 0.005036 0.005137 0.960514 0.049387 0.098330 0.815496 0.036787 0.919737 0.007849 0.004559 0.067855 0.255320 0.010314 0.008501 0.725865 0.036338 0.534647 0.377925 0.051091 0.214271 0.053557 0.128214 0.603957 0.383481 0.173780 0.143426 0.299312 0.294150 0.228482 0.140137 0.337231 0.411710 0.196976 0.220503 0.170811 Consensus sequence: HHHTCCTTTGATSTHHV Alignment: HHHTCCTTTGATSTHHV ----ACTTTGG------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00413 Elf4 Reverse Complement Reverse Complement Backward 5 7 0.028333 Species: Mus musculus Original motif 0.349744 0.139466 0.209326 0.301464 0.080478 0.359482 0.307083 0.252956 0.145756 0.213763 0.350557 0.289924 0.317307 0.199359 0.096089 0.387245 0.868576 0.009724 0.088821 0.032878 0.001975 0.827004 0.014159 0.156862 0.045494 0.000985 0.001907 0.951615 0.011012 0.001203 0.002186 0.985599 0.002743 0.992908 0.002226 0.002123 0.001498 0.990840 0.001556 0.006106 0.000951 0.005138 0.880591 0.113319 0.003127 0.107962 0.867980 0.020930 0.156602 0.055355 0.396563 0.391480 0.421246 0.049379 0.084495 0.444880 0.223879 0.068063 0.203809 0.504249 0.144100 0.323579 0.131544 0.400777 Consensus sequence: DBBHACTTCCGGKWTH Reverse complement motif 0.400777 0.323579 0.131544 0.144100 0.504249 0.068063 0.203809 0.223879 0.444880 0.049379 0.084495 0.421246 0.156602 0.396563 0.055355 0.391480 0.003127 0.867980 0.107962 0.020930 0.000951 0.880591 0.005138 0.113319 0.001498 0.001556 0.990840 0.006106 0.002743 0.002226 0.992908 0.002123 0.985599 0.001203 0.002186 0.011012 0.951615 0.000985 0.001907 0.045494 0.001975 0.014159 0.827004 0.156862 0.032878 0.009724 0.088821 0.868576 0.387245 0.199359 0.096089 0.317307 0.145756 0.350557 0.213763 0.289924 0.080478 0.307083 0.359482 0.252956 0.301464 0.139466 0.209326 0.349744 Consensus sequence: HAWYCCGGAAGTHBBD Alignment: HAWYCCGGAAGTHBBD -----CCAAAGT---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00418 Etv6 Reverse Complement Reverse Complement Forward 6 7 0.028729 Species: Mus musculus Original motif 0.354972 0.069107 0.299350 0.276571 0.209701 0.408003 0.227382 0.154914 0.284336 0.375266 0.162604 0.177794 0.176569 0.181438 0.342172 0.299820 0.106551 0.204378 0.060299 0.628772 0.884088 0.003252 0.103113 0.009546 0.001110 0.704391 0.006294 0.288205 0.014992 0.000892 0.001401 0.982714 0.004842 0.001887 0.002470 0.990801 0.002724 0.992864 0.002206 0.002206 0.001792 0.991200 0.001615 0.005393 0.005151 0.010157 0.940259 0.044433 0.017780 0.199839 0.761921 0.020459 0.230834 0.269936 0.119652 0.379577 0.233019 0.093692 0.034743 0.638546 0.194739 0.181763 0.175340 0.448159 0.145452 0.293709 0.335917 0.224922 Consensus sequence: DVHBTACTTCCGGHTHB Reverse complement motif 0.145452 0.335917 0.293709 0.224922 0.448159 0.181763 0.175340 0.194739 0.638546 0.093692 0.034743 0.233019 0.379577 0.269936 0.119652 0.230834 0.017780 0.761921 0.199839 0.020459 0.005151 0.940259 0.010157 0.044433 0.001792 0.001615 0.991200 0.005393 0.002724 0.002206 0.992864 0.002206 0.990801 0.001887 0.002470 0.004842 0.982714 0.000892 0.001401 0.014992 0.001110 0.006294 0.704391 0.288205 0.009546 0.003252 0.103113 0.884088 0.628772 0.204378 0.060299 0.106551 0.176569 0.342172 0.181438 0.299820 0.284336 0.162604 0.375266 0.177794 0.209701 0.227382 0.408003 0.154914 0.276571 0.069107 0.299350 0.354972 Consensus sequence: BHAHCCGGAAGTABDVD Alignment: BHAHCCGGAAGTABDVD -----CCAAAGT----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 38 Motif name: Motif 38 Original motif 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.500000 0.500000 1.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.000000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 Consensus sequence: ATKAYTTTG Reserve complement motif 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.500000 0.000000 0.500000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 Consensus sequence: CAAAKTYAT ************************************************************************ Best Matches for Motif ID 38 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00079 Esrra_primary Original Motif Reverse Complement Forward 5 9 0.015920 Species: Mus musculus Original motif 0.212524 0.177958 0.293723 0.315796 0.420838 0.283140 0.144938 0.151084 0.198119 0.196347 0.260353 0.345181 0.117752 0.282184 0.137207 0.462857 0.070125 0.781439 0.138093 0.010344 0.965989 0.000956 0.023828 0.009227 0.977263 0.003066 0.019255 0.000416 0.007404 0.000267 0.938934 0.053395 0.007147 0.000287 0.983377 0.009190 0.039608 0.000730 0.040682 0.918981 0.000685 0.905345 0.021930 0.072040 0.800961 0.001126 0.195791 0.002121 0.245039 0.241263 0.038084 0.475614 0.265397 0.238316 0.304963 0.191325 0.203742 0.286208 0.231002 0.279048 0.194132 0.188854 0.346693 0.270322 0.310711 0.263840 0.184317 0.241132 Consensus sequence: DHDBCAAGGTCAHVBDH Reverse complement motif 0.241132 0.263840 0.184317 0.310711 0.194132 0.346693 0.188854 0.270322 0.203742 0.231002 0.286208 0.279048 0.265397 0.304963 0.238316 0.191325 0.475614 0.241263 0.038084 0.245039 0.002121 0.001126 0.195791 0.800961 0.000685 0.021930 0.905345 0.072040 0.918981 0.000730 0.040682 0.039608 0.007147 0.983377 0.000287 0.009190 0.007404 0.938934 0.000267 0.053395 0.000416 0.003066 0.019255 0.977263 0.009227 0.000956 0.023828 0.965989 0.070125 0.138093 0.781439 0.010344 0.462857 0.282184 0.137207 0.117752 0.345181 0.196347 0.260353 0.198119 0.151084 0.283140 0.144938 0.420838 0.315796 0.177958 0.293723 0.212524 Consensus sequence: HHBVHTGACCTTGVDHD Alignment: HHBVHTGACCTTGVDHD ----ATKAYTTTG---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00054 Tcf7_primary Original Motif Reverse Complement Backward 8 9 0.018277 Species: Mus musculus Original motif 0.170811 0.196976 0.220503 0.411710 0.337231 0.228482 0.140137 0.294150 0.299312 0.173780 0.143426 0.383481 0.603957 0.053557 0.128214 0.214271 0.036338 0.377925 0.534647 0.051091 0.725865 0.010314 0.008501 0.255320 0.067855 0.007849 0.004559 0.919737 0.049387 0.815496 0.098330 0.036787 0.960514 0.005036 0.005137 0.029313 0.960631 0.004550 0.018815 0.016004 0.935245 0.005169 0.023866 0.035720 0.159760 0.060340 0.761341 0.018559 0.228534 0.153897 0.523052 0.094517 0.557984 0.123512 0.254154 0.064350 0.490252 0.211976 0.124557 0.173215 0.310463 0.250279 0.132612 0.306646 0.332720 0.248937 0.120633 0.297711 Consensus sequence: BHHASATCAAAGGAHHH Reverse complement motif 0.297711 0.248937 0.120633 0.332720 0.306646 0.250279 0.132612 0.310463 0.173215 0.211976 0.124557 0.490252 0.064350 0.123512 0.254154 0.557984 0.228534 0.523052 0.153897 0.094517 0.159760 0.761341 0.060340 0.018559 0.035720 0.005169 0.023866 0.935245 0.016004 0.004550 0.018815 0.960631 0.029313 0.005036 0.005137 0.960514 0.049387 0.098330 0.815496 0.036787 0.919737 0.007849 0.004559 0.067855 0.255320 0.010314 0.008501 0.725865 0.036338 0.534647 0.377925 0.051091 0.214271 0.053557 0.128214 0.603957 0.383481 0.173780 0.143426 0.299312 0.294150 0.228482 0.140137 0.337231 0.411710 0.196976 0.220503 0.170811 Consensus sequence: HHHTCCTTTGATSTHHV Alignment: HHHTCCTTTGATSTHHV -ATKAYTTTG------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00058 Tcf3_primary Original Motif Reverse Complement Forward 2 9 0.018650 Species: Mus musculus Original motif 0.185864 0.201179 0.183663 0.429294 0.371100 0.233868 0.122934 0.272098 0.249563 0.171285 0.128851 0.450301 0.582940 0.043382 0.129099 0.244578 0.041400 0.395349 0.497087 0.066163 0.759123 0.009670 0.005936 0.225270 0.056579 0.008662 0.003986 0.930772 0.043968 0.865783 0.056001 0.034249 0.962748 0.003731 0.003265 0.030256 0.971318 0.003542 0.012299 0.012841 0.937558 0.003991 0.020195 0.038256 0.125931 0.057976 0.798081 0.018012 0.209401 0.172342 0.483980 0.134277 0.485703 0.129227 0.309936 0.075134 0.397027 0.195902 0.152395 0.254676 0.311636 0.231510 0.157732 0.299122 0.320965 0.206031 0.164299 0.308705 Consensus sequence: HHHASATCAAAGVRHHH Reverse complement motif 0.308705 0.206031 0.164299 0.320965 0.299122 0.231510 0.157732 0.311636 0.254676 0.195902 0.152395 0.397027 0.075134 0.129227 0.309936 0.485703 0.209401 0.483980 0.172342 0.134277 0.125931 0.798081 0.057976 0.018012 0.038256 0.003991 0.020195 0.937558 0.012841 0.003542 0.012299 0.971318 0.030256 0.003731 0.003265 0.962748 0.043968 0.056001 0.865783 0.034249 0.930772 0.008662 0.003986 0.056579 0.225270 0.009670 0.005936 0.759123 0.041400 0.497087 0.395349 0.066163 0.244578 0.043382 0.129099 0.582940 0.450301 0.171285 0.128851 0.249563 0.272098 0.233868 0.122934 0.371100 0.429294 0.201179 0.183663 0.185864 Consensus sequence: HHHKVCTTTGATSTHHH Alignment: HHHKVCTTTGATSTHHH -ATKAYTTTG------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00062 Sox4_primary Original Motif Reverse Complement Backward 8 9 0.019272 Species: Mus musculus Original motif 0.427843 0.231210 0.119424 0.221523 0.196506 0.239531 0.304906 0.259057 0.302488 0.156922 0.290190 0.250401 0.433872 0.149126 0.196496 0.220506 0.258426 0.076511 0.475100 0.189963 0.841714 0.046453 0.099915 0.011918 0.983853 0.001612 0.001362 0.013174 0.003460 0.982032 0.005728 0.008780 0.989743 0.002253 0.002020 0.005984 0.990761 0.003397 0.002843 0.003000 0.770864 0.003540 0.001549 0.224048 0.235342 0.002598 0.757383 0.004677 0.371426 0.089574 0.529959 0.009040 0.480804 0.196949 0.240413 0.081833 0.187158 0.355102 0.216599 0.241142 0.248006 0.232182 0.157452 0.362360 0.403367 0.177684 0.164649 0.254300 Consensus sequence: HBDDDAACAAAGRVBHH Reverse complement motif 0.254300 0.177684 0.164649 0.403367 0.362360 0.232182 0.157452 0.248006 0.187158 0.216599 0.355102 0.241142 0.081833 0.196949 0.240413 0.480804 0.371426 0.529959 0.089574 0.009040 0.235342 0.757383 0.002598 0.004677 0.224048 0.003540 0.001549 0.770864 0.003000 0.003397 0.002843 0.990761 0.005984 0.002253 0.002020 0.989743 0.003460 0.005728 0.982032 0.008780 0.013174 0.001612 0.001362 0.983853 0.011918 0.046453 0.099915 0.841714 0.258426 0.475100 0.076511 0.189963 0.220506 0.149126 0.196496 0.433872 0.250401 0.156922 0.290190 0.302488 0.196506 0.304906 0.239531 0.259057 0.221523 0.231210 0.119424 0.427843 Consensus sequence: HHBBMCTTTGTTHDDBH Alignment: HHBBMCTTTGTTHDDBH -ATKAYTTTG------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00030 Sox11_primary Original Motif Reverse Complement Forward 2 9 0.022524 Species: Mus musculus Original motif 0.351812 0.238467 0.143954 0.265768 0.195246 0.235838 0.281473 0.287443 0.349478 0.172616 0.210739 0.267167 0.484061 0.110438 0.173131 0.232370 0.276692 0.070713 0.479604 0.172991 0.859124 0.044167 0.083951 0.012758 0.975608 0.002029 0.002285 0.020079 0.006422 0.978485 0.007124 0.007969 0.987489 0.003025 0.002868 0.006617 0.987739 0.005463 0.002730 0.004067 0.693013 0.004067 0.002445 0.300475 0.189100 0.003677 0.801408 0.005814 0.352090 0.072517 0.567737 0.007656 0.542316 0.176545 0.192768 0.088371 0.196382 0.304176 0.205985 0.293457 0.289415 0.201358 0.182937 0.326290 0.385801 0.216362 0.152363 0.245475 Consensus sequence: HBDDRAACAAAGRABHH Reverse complement motif 0.245475 0.216362 0.152363 0.385801 0.326290 0.201358 0.182937 0.289415 0.196382 0.205985 0.304176 0.293457 0.088371 0.176545 0.192768 0.542316 0.352090 0.567737 0.072517 0.007656 0.189100 0.801408 0.003677 0.005814 0.300475 0.004067 0.002445 0.693013 0.004067 0.005463 0.002730 0.987739 0.006617 0.003025 0.002868 0.987489 0.006422 0.007124 0.978485 0.007969 0.020079 0.002029 0.002285 0.975608 0.012758 0.044167 0.083951 0.859124 0.276692 0.479604 0.070713 0.172991 0.232370 0.110438 0.173131 0.484061 0.267167 0.172616 0.210739 0.349478 0.287443 0.235838 0.281473 0.195246 0.265768 0.238467 0.143954 0.351812 Consensus sequence: HHBTMCTTTGTTMDDVH Alignment: HHBTMCTTTGTTMDDVH -ATKAYTTTG------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00200 Nkx6-1_2825.1 Original Motif Original Motif Backward 1 9 0.023974 Species: Mus musculus Original motif 0.227745 0.143729 0.473157 0.155369 0.339118 0.308916 0.205493 0.146474 0.345779 0.158724 0.153018 0.342479 0.557584 0.079553 0.110321 0.252542 0.771651 0.018170 0.024962 0.185218 0.184990 0.007357 0.023611 0.784042 0.004607 0.044635 0.000601 0.950157 0.986717 0.002383 0.004487 0.006413 0.983766 0.001866 0.002672 0.011697 0.017243 0.002934 0.001772 0.978051 0.012392 0.014879 0.166863 0.805867 0.883539 0.002678 0.087438 0.026345 0.315534 0.452703 0.102959 0.128804 0.115226 0.301679 0.112527 0.470568 0.136048 0.255000 0.214893 0.394059 0.142643 0.308403 0.250214 0.298740 0.061431 0.237193 0.507859 0.193517 Consensus sequence: DVHAATTAATTAMYBBG Reverse complement motif 0.061431 0.507859 0.237193 0.193517 0.142643 0.250214 0.308403 0.298740 0.394059 0.255000 0.214893 0.136048 0.470568 0.301679 0.112527 0.115226 0.315534 0.102959 0.452703 0.128804 0.026345 0.002678 0.087438 0.883539 0.805867 0.014879 0.166863 0.012392 0.978051 0.002934 0.001772 0.017243 0.011697 0.001866 0.002672 0.983766 0.006413 0.002383 0.004487 0.986717 0.950157 0.044635 0.000601 0.004607 0.784042 0.007357 0.023611 0.184990 0.185218 0.018170 0.024962 0.771651 0.252542 0.079553 0.110321 0.557584 0.342479 0.158724 0.153018 0.345779 0.146474 0.308916 0.205493 0.339118 0.227745 0.473157 0.143729 0.155369 Consensus sequence: CBVMRTAATTAATTHBH Alignment: DVHAATTAATTAMYBBG --------ATKAYTTTG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00067 Lef1_primary Reverse Complement Reverse Complement Forward 8 9 0.024047 Species: Mus musculus Original motif 0.281920 0.214207 0.278077 0.225796 0.325566 0.151435 0.298797 0.224202 0.290253 0.145824 0.243443 0.320480 0.069286 0.404645 0.141614 0.384454 0.070044 0.621448 0.142647 0.165862 0.007295 0.907657 0.038110 0.046938 0.015587 0.018273 0.000658 0.965482 0.005527 0.005886 0.001905 0.986682 0.024512 0.001189 0.001344 0.972955 0.007384 0.025221 0.952270 0.015125 0.966438 0.000630 0.002693 0.030239 0.082252 0.001173 0.001495 0.915080 0.030255 0.677155 0.275323 0.017267 0.199467 0.118815 0.056814 0.624905 0.345445 0.169597 0.216831 0.268127 0.278106 0.150864 0.173693 0.397336 0.251834 0.339733 0.219703 0.188730 Consensus sequence: DDDYCCTTTGATCTDDV Reverse complement motif 0.251834 0.219703 0.339733 0.188730 0.397336 0.150864 0.173693 0.278106 0.268127 0.169597 0.216831 0.345445 0.624905 0.118815 0.056814 0.199467 0.030255 0.275323 0.677155 0.017267 0.915080 0.001173 0.001495 0.082252 0.030239 0.000630 0.002693 0.966438 0.007384 0.952270 0.025221 0.015125 0.972955 0.001189 0.001344 0.024512 0.986682 0.005886 0.001905 0.005527 0.965482 0.018273 0.000658 0.015587 0.007295 0.038110 0.907657 0.046938 0.070044 0.142647 0.621448 0.165862 0.069286 0.141614 0.404645 0.384454 0.320480 0.145824 0.243443 0.290253 0.224202 0.151435 0.298797 0.325566 0.225796 0.214207 0.278077 0.281920 Consensus sequence: VDDAGATCAAAGGKDDD Alignment: VDDAGATCAAAGGKDDD -------CAAAKTYAT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00083 Tcf7l2_primary Original Motif Original Motif Forward 2 9 0.025343 Species: Mus musculus Original motif 0.285725 0.187143 0.254855 0.272277 0.276264 0.157893 0.258178 0.307665 0.238788 0.161120 0.254018 0.346074 0.076041 0.333901 0.150903 0.439156 0.093376 0.526578 0.180529 0.199517 0.010827 0.880320 0.034150 0.074703 0.016546 0.023834 0.000940 0.958680 0.007166 0.008215 0.001941 0.982678 0.029634 0.001363 0.001379 0.967625 0.010872 0.031751 0.926186 0.031190 0.949407 0.000760 0.002581 0.047253 0.109203 0.001362 0.002094 0.887341 0.044198 0.567994 0.353059 0.034749 0.222623 0.142360 0.041281 0.593736 0.358872 0.167597 0.220534 0.252997 0.233072 0.141480 0.230985 0.394463 0.350703 0.243129 0.233961 0.172207 Consensus sequence: DDDYCCTTTGATSTDDV Reverse complement motif 0.172207 0.243129 0.233961 0.350703 0.394463 0.141480 0.230985 0.233072 0.252997 0.167597 0.220534 0.358872 0.593736 0.142360 0.041281 0.222623 0.044198 0.353059 0.567994 0.034749 0.887341 0.001362 0.002094 0.109203 0.047253 0.000760 0.002581 0.949407 0.010872 0.926186 0.031751 0.031190 0.967625 0.001363 0.001379 0.029634 0.982678 0.008215 0.001941 0.007166 0.958680 0.023834 0.000940 0.016546 0.010827 0.034150 0.880320 0.074703 0.093376 0.180529 0.526578 0.199517 0.439156 0.333901 0.150903 0.076041 0.346074 0.161120 0.254018 0.238788 0.307665 0.157893 0.258178 0.276264 0.272277 0.187143 0.254855 0.285725 Consensus sequence: BDDASATCAAAGGMDDD Alignment: DDDYCCTTTGATSTDDV -ATKAYTTTG------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00167 En1 Original Motif Reverse Complement Backward 2 9 0.025990 Species: Mus musculus Original motif 0.225324 0.200755 0.409800 0.164122 0.229000 0.311958 0.294484 0.164558 0.279127 0.279600 0.289348 0.151924 0.731839 0.146527 0.080429 0.041204 0.815756 0.078552 0.067059 0.038633 0.113802 0.539919 0.107461 0.238817 0.004782 0.154753 0.001038 0.839427 0.972174 0.003850 0.019756 0.004220 0.988578 0.002699 0.005007 0.003715 0.007014 0.002380 0.003761 0.986845 0.007181 0.008818 0.009221 0.974780 0.966805 0.003637 0.016918 0.012641 0.482834 0.077180 0.332986 0.107001 0.055785 0.135179 0.371295 0.437741 0.232569 0.181896 0.369752 0.215783 0.203976 0.486402 0.200623 0.108999 Consensus sequence: VVVAACTAATTARKDV Reverse complement motif 0.203976 0.200623 0.486402 0.108999 0.232569 0.369752 0.181896 0.215783 0.437741 0.135179 0.371295 0.055785 0.107001 0.077180 0.332986 0.482834 0.012641 0.003637 0.016918 0.966805 0.974780 0.008818 0.009221 0.007181 0.986845 0.002380 0.003761 0.007014 0.003715 0.002699 0.005007 0.988578 0.004220 0.003850 0.019756 0.972174 0.839427 0.154753 0.001038 0.004782 0.113802 0.107461 0.539919 0.238817 0.038633 0.078552 0.067059 0.815756 0.041204 0.146527 0.080429 0.731839 0.279127 0.289348 0.279600 0.151924 0.229000 0.294484 0.311958 0.164558 0.225324 0.409800 0.200755 0.164122 Consensus sequence: VHRKTAATTAGTTVVV Alignment: VHRKTAATTAGTTVVV ------ATKAYTTTG- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00238 Nkx6-3 Original Motif Original Motif Backward 1 9 0.026204 Species: Mus musculus Original motif 0.211080 0.172311 0.431247 0.185362 0.384982 0.234092 0.223039 0.157886 0.310057 0.205880 0.172143 0.311920 0.457713 0.100792 0.100760 0.340735 0.675530 0.025764 0.022872 0.275835 0.177571 0.016003 0.029571 0.776854 0.005091 0.070291 0.000805 0.923813 0.985078 0.003252 0.005333 0.006337 0.983499 0.002121 0.005028 0.009353 0.019439 0.004503 0.002273 0.973785 0.008771 0.016780 0.249674 0.724776 0.843445 0.003550 0.123087 0.029918 0.296529 0.352616 0.228921 0.121934 0.089109 0.193310 0.157449 0.560132 0.136822 0.217266 0.312594 0.333318 0.192396 0.261720 0.233534 0.312350 0.080253 0.215905 0.453925 0.249917 Consensus sequence: DVHWATTAATTAVTBBB Reverse complement motif 0.080253 0.453925 0.215905 0.249917 0.312350 0.261720 0.233534 0.192396 0.333318 0.217266 0.312594 0.136822 0.560132 0.193310 0.157449 0.089109 0.296529 0.228921 0.352616 0.121934 0.029918 0.003550 0.123087 0.843445 0.724776 0.016780 0.249674 0.008771 0.973785 0.004503 0.002273 0.019439 0.009353 0.002121 0.005028 0.983499 0.006337 0.003252 0.005333 0.985078 0.923813 0.070291 0.000805 0.005091 0.776854 0.016003 0.029571 0.177571 0.275835 0.025764 0.022872 0.675530 0.340735 0.100792 0.100760 0.457713 0.311920 0.205880 0.172143 0.310057 0.157886 0.234092 0.223039 0.384982 0.211080 0.431247 0.172311 0.185362 Consensus sequence: BVVAVTAATTAATWHBH Alignment: DVHWATTAATTAVTBBB --------ATKAYTTTG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 39 Motif name: Motif 39 Original motif 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 Consensus sequence: GCTGTGAC Reserve complement motif 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 Consensus sequence: GTCACAGC ************************************************************************ Best Matches for Motif ID 39 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00122 Tgif1 Reverse Complement Original Motif Forward 5 8 0.000000 Species: Mus musculus Original motif 0.272977 0.158875 0.284742 0.283406 0.550609 0.124110 0.169608 0.155673 0.114568 0.207160 0.282464 0.395807 0.560868 0.052907 0.053508 0.332716 0.336500 0.068048 0.114050 0.481403 0.007736 0.003722 0.000495 0.988048 0.004489 0.000729 0.992211 0.002571 0.956618 0.000414 0.000890 0.042078 0.004381 0.990925 0.000538 0.004156 0.982797 0.000366 0.015539 0.001298 0.016760 0.002980 0.969991 0.010269 0.036013 0.725983 0.200022 0.037982 0.064755 0.104386 0.133891 0.696968 0.199404 0.263520 0.410228 0.126848 0.222648 0.351390 0.272575 0.153387 0.087778 0.206043 0.395671 0.310507 0.319643 0.144216 0.196041 0.340100 Consensus sequence: DABWWTGACAGCTVVBD Reverse complement motif 0.340100 0.144216 0.196041 0.319643 0.087778 0.395671 0.206043 0.310507 0.222648 0.272575 0.351390 0.153387 0.199404 0.410228 0.263520 0.126848 0.696968 0.104386 0.133891 0.064755 0.036013 0.200022 0.725983 0.037982 0.016760 0.969991 0.002980 0.010269 0.001298 0.000366 0.015539 0.982797 0.004381 0.000538 0.990925 0.004156 0.042078 0.000414 0.000890 0.956618 0.004489 0.992211 0.000729 0.002571 0.988048 0.003722 0.000495 0.007736 0.481403 0.068048 0.114050 0.336500 0.332716 0.052907 0.053508 0.560868 0.395807 0.207160 0.282464 0.114568 0.155673 0.124110 0.169608 0.550609 0.272977 0.284742 0.158875 0.283406 Consensus sequence: DBVVAGCTGTCAWWVTH Alignment: DABWWTGACAGCTVVBD ----GTCACAGC----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00258 Tgif2 Original Motif Original Motif Backward 4 8 0.002418 Species: Mus musculus Original motif 0.519684 0.141807 0.112153 0.226356 0.614097 0.079211 0.138045 0.168647 0.186975 0.327654 0.245051 0.240320 0.108289 0.303530 0.219106 0.369076 0.914812 0.012014 0.046628 0.026546 0.070482 0.163253 0.689315 0.076951 0.016354 0.972639 0.003648 0.007359 0.002043 0.018718 0.000384 0.978855 0.006109 0.001408 0.990736 0.001747 0.024783 0.002060 0.000402 0.972755 0.001485 0.991963 0.001756 0.004796 0.989335 0.001052 0.002320 0.007293 0.778804 0.056366 0.037632 0.127198 0.377980 0.094597 0.086888 0.440535 0.458125 0.289431 0.152762 0.099682 0.223103 0.435348 0.216962 0.124587 Consensus sequence: AABBAGCTGTCAAWVV Reverse complement motif 0.223103 0.216962 0.435348 0.124587 0.099682 0.289431 0.152762 0.458125 0.440535 0.094597 0.086888 0.377980 0.127198 0.056366 0.037632 0.778804 0.007293 0.001052 0.002320 0.989335 0.001485 0.001756 0.991963 0.004796 0.972755 0.002060 0.000402 0.024783 0.006109 0.990736 0.001408 0.001747 0.978855 0.018718 0.000384 0.002043 0.016354 0.003648 0.972639 0.007359 0.070482 0.689315 0.163253 0.076951 0.026546 0.012014 0.046628 0.914812 0.369076 0.303530 0.219106 0.108289 0.186975 0.245051 0.327654 0.240320 0.168647 0.079211 0.138045 0.614097 0.226356 0.141807 0.112153 0.519684 Consensus sequence: VBWTTGACAGCTVBTT Alignment: AABBAGCTGTCAAWVV -----GCTGTGAC--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00006 Zic3_secondary Reverse Complement Original Motif Backward 7 8 0.005539 Species: Mus musculus Original motif 0.225537 0.223459 0.280507 0.270498 0.332396 0.181810 0.207290 0.278505 0.309873 0.017922 0.386135 0.286070 0.101947 0.871607 0.020267 0.006179 0.541366 0.089100 0.242170 0.127364 0.003307 0.969997 0.002414 0.024283 0.903286 0.021590 0.015872 0.059253 0.039887 0.009732 0.945083 0.005298 0.001704 0.827209 0.006276 0.164810 0.723052 0.003102 0.221051 0.052795 0.011758 0.024398 0.560633 0.403211 0.003656 0.012952 0.939586 0.043807 0.477846 0.270399 0.113113 0.138642 0.225706 0.298505 0.258523 0.217266 0.365251 0.191780 0.197411 0.245557 Consensus sequence: DDDCACAGCAKGHVD Reverse complement motif 0.245557 0.191780 0.197411 0.365251 0.225706 0.258523 0.298505 0.217266 0.138642 0.270399 0.113113 0.477846 0.003656 0.939586 0.012952 0.043807 0.011758 0.560633 0.024398 0.403211 0.052795 0.003102 0.221051 0.723052 0.001704 0.006276 0.827209 0.164810 0.039887 0.945083 0.009732 0.005298 0.059253 0.021590 0.015872 0.903286 0.003307 0.002414 0.969997 0.024283 0.127364 0.089100 0.242170 0.541366 0.101947 0.020267 0.871607 0.006179 0.309873 0.386135 0.017922 0.286070 0.278505 0.181810 0.207290 0.332396 0.225537 0.280507 0.223459 0.270498 Consensus sequence: DVHCYTGCTGTGHDH Alignment: DDDCACAGCAKGHVD -GTCACAGC------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00068 Eomes_primary Original Motif Original Motif Backward 5 8 0.005782 Species: Mus musculus Original motif 0.186316 0.215541 0.297644 0.300499 0.300381 0.234276 0.266283 0.199061 0.317841 0.211418 0.183235 0.287507 0.482598 0.095323 0.245062 0.177017 0.654197 0.008988 0.261951 0.074864 0.095656 0.022883 0.843364 0.038097 0.002655 0.008355 0.976390 0.012600 0.003287 0.080755 0.001057 0.914900 0.006753 0.001517 0.989917 0.001813 0.039940 0.098800 0.003305 0.857955 0.009015 0.039036 0.844029 0.107921 0.984070 0.002369 0.008852 0.004709 0.789505 0.101528 0.029294 0.079672 0.649685 0.139882 0.090466 0.119966 0.421759 0.205595 0.073074 0.299573 0.214779 0.290522 0.134050 0.360649 0.202141 0.270323 0.176798 0.350738 Consensus sequence: BVHDAGGTGTGAAAHHH Reverse complement motif 0.350738 0.270323 0.176798 0.202141 0.360649 0.290522 0.134050 0.214779 0.299573 0.205595 0.073074 0.421759 0.119966 0.139882 0.090466 0.649685 0.079672 0.101528 0.029294 0.789505 0.004709 0.002369 0.008852 0.984070 0.009015 0.844029 0.039036 0.107921 0.857955 0.098800 0.003305 0.039940 0.006753 0.989917 0.001517 0.001813 0.914900 0.080755 0.001057 0.003287 0.002655 0.976390 0.008355 0.012600 0.095656 0.843364 0.022883 0.038097 0.074864 0.008988 0.261951 0.654197 0.177017 0.095323 0.245062 0.482598 0.287507 0.211418 0.183235 0.317841 0.199061 0.234276 0.266283 0.300381 0.300499 0.215541 0.297644 0.186316 Consensus sequence: HHHTTTCACACCTDHBV Alignment: BVHDAGGTGTGAAAHHH -----GCTGTGAC---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00193 Rhox11_2205.1 Original Motif Original Motif Backward 5 8 0.006295 Species: Mus musculus Original motif 0.504898 0.140204 0.135418 0.219480 0.282348 0.244881 0.300572 0.172199 0.183939 0.100670 0.384783 0.330608 0.326709 0.269523 0.194043 0.209724 0.142989 0.557393 0.066826 0.232792 0.038356 0.014052 0.932450 0.015142 0.092102 0.778844 0.125082 0.003972 0.010254 0.001252 0.005231 0.983263 0.033486 0.000891 0.947486 0.018137 0.005360 0.007407 0.003729 0.983504 0.603485 0.007179 0.003482 0.385853 0.798026 0.029788 0.032370 0.139816 0.529622 0.100632 0.016507 0.353238 0.243581 0.126094 0.401402 0.228923 0.207484 0.285456 0.353715 0.153346 0.282413 0.188410 0.441463 0.087715 0.422774 0.152965 0.094106 0.330155 Consensus sequence: AVDHCGCTGTWAWDVVW Reverse complement motif 0.330155 0.152965 0.094106 0.422774 0.282413 0.441463 0.188410 0.087715 0.207484 0.353715 0.285456 0.153346 0.243581 0.401402 0.126094 0.228923 0.353238 0.100632 0.016507 0.529622 0.139816 0.029788 0.032370 0.798026 0.385853 0.007179 0.003482 0.603485 0.983504 0.007407 0.003729 0.005360 0.033486 0.947486 0.000891 0.018137 0.983263 0.001252 0.005231 0.010254 0.092102 0.125082 0.778844 0.003972 0.038356 0.932450 0.014052 0.015142 0.142989 0.066826 0.557393 0.232792 0.209724 0.269523 0.194043 0.326709 0.183939 0.384783 0.100670 0.330608 0.282348 0.300572 0.244881 0.172199 0.219480 0.140204 0.135418 0.504898 Consensus sequence: WVVHWTWACAGCGHHVT Alignment: AVDHCGCTGTWAWDVVW -----GCTGTGAC---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00193 Rhox11_1765.2 Original Motif Original Motif Forward 6 8 0.006663 Species: Mus musculus Original motif 0.538735 0.129821 0.147336 0.184107 0.331267 0.275123 0.227609 0.166001 0.174654 0.113319 0.383610 0.328417 0.296734 0.281670 0.230068 0.191527 0.128222 0.561296 0.062928 0.247554 0.027028 0.014676 0.949335 0.008962 0.087209 0.761581 0.147964 0.003246 0.006796 0.000741 0.006037 0.986427 0.039496 0.000533 0.943453 0.016517 0.005541 0.005164 0.002805 0.986489 0.561957 0.002761 0.004207 0.431075 0.780197 0.037155 0.031222 0.151425 0.518642 0.104220 0.012670 0.364468 0.314451 0.111366 0.333508 0.240676 0.236936 0.357992 0.280813 0.124259 0.314846 0.163774 0.426195 0.095185 0.408340 0.134111 0.102987 0.354562 Consensus sequence: AVDVCGCTGTWAWDVVW Reverse complement motif 0.354562 0.134111 0.102987 0.408340 0.314846 0.426195 0.163774 0.095185 0.236936 0.280813 0.357992 0.124259 0.314451 0.333508 0.111366 0.240676 0.364468 0.104220 0.012670 0.518642 0.151425 0.037155 0.031222 0.780197 0.431075 0.002761 0.004207 0.561957 0.986489 0.005164 0.002805 0.005541 0.039496 0.943453 0.000533 0.016517 0.986427 0.000741 0.006037 0.006796 0.087209 0.147964 0.761581 0.003246 0.027028 0.949335 0.014676 0.008962 0.128222 0.062928 0.561296 0.247554 0.191527 0.281670 0.230068 0.296734 0.174654 0.383610 0.113319 0.328417 0.166001 0.275123 0.227609 0.331267 0.184107 0.129821 0.147336 0.538735 Consensus sequence: WVVHWTWACAGCGBHBT Alignment: AVDVCGCTGTWAWDVVW -----GCTGTGAC---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00205 Pknox2 Original Motif Original Motif Forward 6 8 0.007477 Species: Mus musculus Original motif 0.428425 0.195557 0.163102 0.212916 0.596487 0.103248 0.171370 0.128895 0.255216 0.203813 0.424426 0.116546 0.034183 0.441823 0.347767 0.176227 0.613880 0.025627 0.347719 0.012774 0.028636 0.551817 0.409264 0.010283 0.020873 0.969731 0.003025 0.006371 0.001171 0.039795 0.000323 0.958710 0.004303 0.001241 0.992873 0.001583 0.014490 0.007334 0.000309 0.977866 0.000873 0.991756 0.001920 0.005451 0.979609 0.000960 0.015793 0.003638 0.586289 0.199905 0.051181 0.162625 0.207586 0.157832 0.051564 0.583018 0.295651 0.262238 0.182998 0.259112 0.158213 0.267067 0.215259 0.359461 Consensus sequence: HAVSRSCTGTCAATHB Reverse complement motif 0.359461 0.267067 0.215259 0.158213 0.259112 0.262238 0.182998 0.295651 0.583018 0.157832 0.051564 0.207586 0.162625 0.199905 0.051181 0.586289 0.003638 0.000960 0.015793 0.979609 0.000873 0.001920 0.991756 0.005451 0.977866 0.007334 0.000309 0.014490 0.004303 0.992873 0.001241 0.001583 0.958710 0.039795 0.000323 0.001171 0.020873 0.003025 0.969731 0.006371 0.028636 0.409264 0.551817 0.010283 0.012774 0.025627 0.347719 0.613880 0.034183 0.347767 0.441823 0.176227 0.255216 0.424426 0.203813 0.116546 0.128895 0.103248 0.171370 0.596487 0.212916 0.195557 0.163102 0.428425 Consensus sequence: VHATTGACAGSKSVTH Alignment: HAVSRSCTGTCAATHB -----GCTGTGAC--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00102 Zic1_secondary Reverse Complement Original Motif Forward 2 8 0.008775 Species: Mus musculus Original motif 0.161683 0.405114 0.171743 0.261460 0.259478 0.357988 0.146793 0.235741 0.371334 0.026439 0.283598 0.318630 0.092229 0.883389 0.018758 0.005623 0.419591 0.169874 0.253266 0.157270 0.002985 0.976375 0.002722 0.017918 0.909381 0.021357 0.013299 0.055963 0.039418 0.007014 0.948302 0.005266 0.001711 0.845894 0.005756 0.146640 0.803792 0.003049 0.148687 0.044472 0.015314 0.017153 0.680239 0.287294 0.003793 0.011414 0.937403 0.047390 0.431916 0.266291 0.144154 0.157638 0.269331 0.239338 0.366817 0.124513 0.395873 0.103980 0.214796 0.285351 Consensus sequence: BHDCVCAGCAGGHVD Reverse complement motif 0.285351 0.103980 0.214796 0.395873 0.269331 0.366817 0.239338 0.124513 0.157638 0.266291 0.144154 0.431916 0.003793 0.937403 0.011414 0.047390 0.015314 0.680239 0.017153 0.287294 0.044472 0.003049 0.148687 0.803792 0.001711 0.005756 0.845894 0.146640 0.039418 0.948302 0.007014 0.005266 0.055963 0.021357 0.013299 0.909381 0.002985 0.002722 0.976375 0.017918 0.157270 0.169874 0.253266 0.419591 0.092229 0.018758 0.883389 0.005623 0.318630 0.026439 0.283598 0.371334 0.259478 0.146793 0.357988 0.235741 0.161683 0.171743 0.405114 0.261460 Consensus sequence: DVHCCTGCTGBGDDB Alignment: BHDCVCAGCAGGHVD -GTCACAGC------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00186 Meis1 Original Motif Original Motif Backward 4 8 0.009566 Species: Mus musculus Original motif 0.432115 0.114994 0.130835 0.322056 0.508081 0.060822 0.214256 0.216841 0.225875 0.276028 0.280982 0.217115 0.092373 0.286687 0.360933 0.260007 0.947172 0.005937 0.028595 0.018297 0.027829 0.439935 0.505051 0.027185 0.023801 0.963424 0.008205 0.004571 0.001548 0.018215 0.000406 0.979831 0.008422 0.001124 0.989007 0.001446 0.025343 0.004094 0.000241 0.970323 0.001451 0.992789 0.002037 0.003724 0.991202 0.001638 0.003159 0.004002 0.695910 0.022145 0.013657 0.268288 0.357895 0.090931 0.093796 0.457378 0.453163 0.204395 0.181067 0.161376 0.200615 0.393437 0.171398 0.234551 Consensus sequence: WAVBASCTGTCAAWVH Reverse complement motif 0.200615 0.171398 0.393437 0.234551 0.161376 0.204395 0.181067 0.453163 0.457378 0.090931 0.093796 0.357895 0.268288 0.022145 0.013657 0.695910 0.004002 0.001638 0.003159 0.991202 0.001451 0.002037 0.992789 0.003724 0.970323 0.004094 0.000241 0.025343 0.008422 0.989007 0.001124 0.001446 0.979831 0.018215 0.000406 0.001548 0.023801 0.008205 0.963424 0.004571 0.027829 0.505051 0.439935 0.027185 0.018297 0.005937 0.028595 0.947172 0.092373 0.360933 0.286687 0.260007 0.225875 0.280982 0.276028 0.217115 0.216841 0.060822 0.214256 0.508081 0.322056 0.114994 0.130835 0.432115 Consensus sequence: DBWTTGACAGSTBVTW Alignment: WAVBASCTGTCAAWVH -----GCTGTGAC--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00226 Mrg1 Original Motif Original Motif Forward 6 8 0.012461 Species: Mus musculus Original motif 0.378836 0.145096 0.102046 0.374022 0.507161 0.090730 0.177058 0.225051 0.277496 0.234581 0.275775 0.212149 0.065300 0.339403 0.360939 0.234358 0.918963 0.010948 0.043262 0.026826 0.017295 0.545133 0.416603 0.020969 0.023391 0.962223 0.007311 0.007075 0.001760 0.020258 0.000360 0.977622 0.013946 0.000586 0.983699 0.001769 0.035910 0.004825 0.000197 0.959068 0.001465 0.991446 0.001338 0.005750 0.986785 0.001158 0.005848 0.006209 0.715894 0.043046 0.018966 0.222093 0.332332 0.084841 0.098421 0.484405 0.473739 0.198580 0.152072 0.175610 0.211505 0.325971 0.212211 0.250313 Consensus sequence: WAVBASCTGTCAAWHB Reverse complement motif 0.211505 0.212211 0.325971 0.250313 0.175610 0.198580 0.152072 0.473739 0.484405 0.084841 0.098421 0.332332 0.222093 0.043046 0.018966 0.715894 0.006209 0.001158 0.005848 0.986785 0.001465 0.001338 0.991446 0.005750 0.959068 0.004825 0.000197 0.035910 0.013946 0.983699 0.000586 0.001769 0.977622 0.020258 0.000360 0.001760 0.023391 0.007311 0.962223 0.007075 0.017295 0.416603 0.545133 0.020969 0.026826 0.010948 0.043262 0.918963 0.065300 0.360939 0.339403 0.234358 0.212149 0.234581 0.275775 0.277496 0.225051 0.090730 0.177058 0.507161 0.374022 0.145096 0.102046 0.378836 Consensus sequence: BHWTTGACAGSTBBTW Alignment: WAVBASCTGTCAAWHB -----GCTGTGAC--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 40 Motif name: Motif 40 Original motif 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 Consensus sequence: AAGTTCA Reserve complement motif 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 Consensus sequence: TGAACTT ************************************************************************ Best Matches for Motif ID 40 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00048 Rara Original Motif Original Motif Backward 5 7 0.000000 Species: Mus musculus Original motif 0.222478 0.177331 0.266395 0.333797 0.276222 0.360097 0.118354 0.245327 0.106047 0.268455 0.234217 0.391281 0.244163 0.407141 0.146864 0.201832 0.852083 0.050643 0.039941 0.057332 0.814108 0.012894 0.165984 0.007015 0.905198 0.005648 0.088378 0.000776 0.002783 0.000555 0.988205 0.008457 0.001289 0.000626 0.898209 0.099877 0.002878 0.001631 0.008910 0.986582 0.000499 0.975550 0.005264 0.018687 0.963627 0.000883 0.034432 0.001058 0.181490 0.517766 0.077094 0.223650 0.183789 0.384790 0.308350 0.123071 0.229801 0.228801 0.224468 0.316930 0.218244 0.170273 0.366746 0.244736 Consensus sequence: DHBHAAAGGTCACVHD Reverse complement motif 0.218244 0.366746 0.170273 0.244736 0.316930 0.228801 0.224468 0.229801 0.183789 0.308350 0.384790 0.123071 0.181490 0.077094 0.517766 0.223650 0.001058 0.000883 0.034432 0.963627 0.000499 0.005264 0.975550 0.018687 0.986582 0.001631 0.008910 0.002878 0.001289 0.898209 0.000626 0.099877 0.002783 0.988205 0.000555 0.008457 0.000776 0.005648 0.088378 0.905198 0.007015 0.012894 0.165984 0.814108 0.057332 0.050643 0.039941 0.852083 0.244163 0.146864 0.407141 0.201832 0.391281 0.268455 0.234217 0.106047 0.276222 0.118354 0.360097 0.245327 0.333797 0.177331 0.266395 0.222478 Consensus sequence: HHVGTGACCTTTDVDD Alignment: DHBHAAAGGTCACVHD -----AAGTTCA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00066 Hnf4a_secondary Reverse Complement Reverse Complement Backward 6 7 0.005165 Species: Mus musculus Original motif 0.131680 0.169949 0.346277 0.352094 0.109910 0.144258 0.373681 0.372151 0.196671 0.411335 0.159689 0.232305 0.311086 0.307077 0.122332 0.259505 0.895155 0.013238 0.038874 0.052733 0.779629 0.018399 0.171269 0.030703 0.950546 0.002649 0.041825 0.004980 0.004769 0.002646 0.985847 0.006739 0.004458 0.002117 0.012011 0.981414 0.016789 0.969626 0.003890 0.009695 0.002468 0.982852 0.004754 0.009926 0.891448 0.003193 0.097548 0.007811 0.513330 0.308971 0.070467 0.107232 0.179371 0.115514 0.130898 0.574217 0.285826 0.277536 0.166982 0.269655 0.319407 0.227783 0.129020 0.323790 Consensus sequence: BBHHAAAGTCCAMTHH Reverse complement motif 0.323790 0.227783 0.129020 0.319407 0.269655 0.277536 0.166982 0.285826 0.574217 0.115514 0.130898 0.179371 0.107232 0.308971 0.070467 0.513330 0.007811 0.003193 0.097548 0.891448 0.002468 0.004754 0.982852 0.009926 0.016789 0.003890 0.969626 0.009695 0.981414 0.002117 0.012011 0.004458 0.004769 0.985847 0.002646 0.006739 0.004980 0.002649 0.041825 0.950546 0.030703 0.018399 0.171269 0.779629 0.052733 0.013238 0.038874 0.895155 0.259505 0.307077 0.122332 0.311086 0.196671 0.159689 0.411335 0.232305 0.109910 0.373681 0.144258 0.372151 0.352094 0.169949 0.346277 0.131680 Consensus sequence: HHAYTGGACTTTHDBV Alignment: HHAYTGGACTTTHDBV ----TGAACTT----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00079 Esrra_primary Original Motif Original Motif Backward 6 7 0.007732 Species: Mus musculus Original motif 0.212524 0.177958 0.293723 0.315796 0.420838 0.283140 0.144938 0.151084 0.198119 0.196347 0.260353 0.345181 0.117752 0.282184 0.137207 0.462857 0.070125 0.781439 0.138093 0.010344 0.965989 0.000956 0.023828 0.009227 0.977263 0.003066 0.019255 0.000416 0.007404 0.000267 0.938934 0.053395 0.007147 0.000287 0.983377 0.009190 0.039608 0.000730 0.040682 0.918981 0.000685 0.905345 0.021930 0.072040 0.800961 0.001126 0.195791 0.002121 0.245039 0.241263 0.038084 0.475614 0.265397 0.238316 0.304963 0.191325 0.203742 0.286208 0.231002 0.279048 0.194132 0.188854 0.346693 0.270322 0.310711 0.263840 0.184317 0.241132 Consensus sequence: DHDBCAAGGTCAHVBDH Reverse complement motif 0.241132 0.263840 0.184317 0.310711 0.194132 0.346693 0.188854 0.270322 0.203742 0.231002 0.286208 0.279048 0.265397 0.304963 0.238316 0.191325 0.475614 0.241263 0.038084 0.245039 0.002121 0.001126 0.195791 0.800961 0.000685 0.021930 0.905345 0.072040 0.918981 0.000730 0.040682 0.039608 0.007147 0.983377 0.000287 0.009190 0.007404 0.938934 0.000267 0.053395 0.000416 0.003066 0.019255 0.977263 0.009227 0.000956 0.023828 0.965989 0.070125 0.138093 0.781439 0.010344 0.462857 0.282184 0.137207 0.117752 0.345181 0.196347 0.260353 0.198119 0.151084 0.283140 0.144938 0.420838 0.315796 0.177958 0.293723 0.212524 Consensus sequence: HHBVHTGACCTTGVDHD Alignment: DHDBCAAGGTCAHVBDH -----AAGTTCA----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00009 Nr2f2_primary Original Motif Original Motif Backward 5 7 0.009092 Species: Mus musculus Original motif 0.253408 0.181904 0.273186 0.291502 0.262827 0.381870 0.153734 0.201569 0.143383 0.243233 0.242562 0.370823 0.247498 0.336892 0.176114 0.239496 0.856654 0.037068 0.049492 0.056786 0.797369 0.012935 0.176463 0.013233 0.808222 0.001309 0.189796 0.000674 0.002583 0.000536 0.989167 0.007714 0.002421 0.000283 0.972777 0.024519 0.000270 0.003650 0.019038 0.977041 0.000184 0.956654 0.005329 0.037833 0.925587 0.000706 0.072434 0.001273 0.307028 0.327297 0.079126 0.286549 0.238576 0.245847 0.384025 0.131552 0.281599 0.234987 0.226211 0.257204 0.211511 0.212695 0.363980 0.211815 Consensus sequence: DHBHAAAGGTCAHVHB Reverse complement motif 0.211511 0.363980 0.212695 0.211815 0.257204 0.234987 0.226211 0.281599 0.238576 0.384025 0.245847 0.131552 0.307028 0.079126 0.327297 0.286549 0.001273 0.000706 0.072434 0.925587 0.000184 0.005329 0.956654 0.037833 0.977041 0.003650 0.019038 0.000270 0.002421 0.972777 0.000283 0.024519 0.002583 0.989167 0.000536 0.007714 0.000674 0.001309 0.189796 0.808222 0.013233 0.012935 0.176463 0.797369 0.056786 0.037068 0.049492 0.856654 0.247498 0.176114 0.336892 0.239496 0.370823 0.243233 0.242562 0.143383 0.262827 0.153734 0.381870 0.201569 0.291502 0.181904 0.273186 0.253408 Consensus sequence: BHVDTGACCTTTDVDD Alignment: DHBHAAAGGTCAHVHB -----AAGTTCA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00019 Zbtb12_primary Reverse Complement Reverse Complement Forward 8 7 0.035752 Species: Mus musculus Original motif 0.163348 0.349811 0.273573 0.213268 0.212612 0.211975 0.220400 0.355012 0.325879 0.220972 0.186720 0.266430 0.510632 0.041115 0.419323 0.028930 0.067550 0.203499 0.411224 0.317727 0.023546 0.002038 0.972278 0.002138 0.017818 0.006841 0.006478 0.968864 0.019791 0.001443 0.009338 0.969428 0.003084 0.992130 0.002654 0.002131 0.001031 0.039768 0.003588 0.955613 0.980811 0.006260 0.008964 0.003965 0.013624 0.002796 0.979716 0.003863 0.841198 0.016422 0.129217 0.013163 0.169265 0.145424 0.085753 0.599558 0.068235 0.584950 0.065758 0.281057 0.378189 0.252218 0.209355 0.160238 0.167389 0.305726 0.229730 0.297156 Consensus sequence: BDHRBGTTCTAGATCVB Reverse complement motif 0.167389 0.229730 0.305726 0.297156 0.160238 0.252218 0.209355 0.378189 0.068235 0.065758 0.584950 0.281057 0.599558 0.145424 0.085753 0.169265 0.013163 0.016422 0.129217 0.841198 0.013624 0.979716 0.002796 0.003863 0.003965 0.006260 0.008964 0.980811 0.955613 0.039768 0.003588 0.001031 0.003084 0.002654 0.992130 0.002131 0.969428 0.001443 0.009338 0.019791 0.968864 0.006841 0.006478 0.017818 0.023546 0.972278 0.002038 0.002138 0.067550 0.411224 0.203499 0.317727 0.028930 0.041115 0.419323 0.510632 0.266430 0.220972 0.186720 0.325879 0.355012 0.211975 0.220400 0.212612 0.163348 0.273573 0.349811 0.213268 Consensus sequence: BBGATCTAGAACBKHDB Alignment: BBGATCTAGAACBKHDB -------TGAACTT--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00222 Tcf2 Original Motif Reverse Complement Forward 6 7 0.037980 Species: Mus musculus Original motif 0.314412 0.143512 0.264912 0.277164 0.157997 0.184389 0.369205 0.288409 0.135761 0.400456 0.144198 0.319585 0.174918 0.189077 0.293539 0.342466 0.059548 0.050376 0.839169 0.050907 0.062155 0.032353 0.015343 0.890149 0.011322 0.005522 0.003327 0.979830 0.960176 0.002513 0.002465 0.034847 0.981010 0.008328 0.004727 0.005935 0.006622 0.951830 0.013146 0.028402 0.010202 0.154748 0.016885 0.818164 0.895112 0.013182 0.028839 0.062866 0.278112 0.134938 0.556639 0.030311 0.164392 0.362982 0.210651 0.261976 0.224410 0.335183 0.122095 0.318312 0.045608 0.320960 0.380649 0.252783 0.151847 0.162111 0.151885 0.534157 Consensus sequence: DBBBGTTAACTAGBHBT Reverse complement motif 0.534157 0.162111 0.151885 0.151847 0.045608 0.380649 0.320960 0.252783 0.224410 0.122095 0.335183 0.318312 0.164392 0.210651 0.362982 0.261976 0.278112 0.556639 0.134938 0.030311 0.062866 0.013182 0.028839 0.895112 0.818164 0.154748 0.016885 0.010202 0.006622 0.013146 0.951830 0.028402 0.005935 0.008328 0.004727 0.981010 0.034847 0.002513 0.002465 0.960176 0.979830 0.005522 0.003327 0.011322 0.890149 0.032353 0.015343 0.062155 0.059548 0.839169 0.050376 0.050907 0.342466 0.189077 0.293539 0.174918 0.135761 0.144198 0.400456 0.319585 0.157997 0.369205 0.184389 0.288409 0.277164 0.143512 0.264912 0.314412 Consensus sequence: ABDBCTAGTTAACVBBD Alignment: ABDBCTAGTTAACVBBD -----AAGTTCA----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00042 Gm397_primary Original Motif Reverse Complement Backward 7 7 0.038862 Species: Mus musculus Original motif 0.248614 0.321010 0.201723 0.228654 0.332381 0.190810 0.184854 0.291955 0.253802 0.119338 0.331394 0.295466 0.577827 0.100884 0.130066 0.191223 0.180374 0.011174 0.042942 0.765510 0.009131 0.024996 0.962422 0.003450 0.003308 0.034731 0.002930 0.959032 0.063907 0.001099 0.933714 0.001280 0.001280 0.933714 0.001099 0.063907 0.959032 0.002930 0.034731 0.003308 0.003450 0.962422 0.024996 0.009131 0.765510 0.042942 0.011174 0.180374 0.026456 0.256356 0.130672 0.586516 0.589555 0.285548 0.036864 0.088034 0.265828 0.529813 0.031915 0.172445 0.209015 0.104817 0.374275 0.311892 0.224283 0.292805 0.144270 0.338642 Consensus sequence: HHDATGTGCACATAMDH Reverse complement motif 0.338642 0.292805 0.144270 0.224283 0.209015 0.374275 0.104817 0.311892 0.265828 0.031915 0.529813 0.172445 0.088034 0.285548 0.036864 0.589555 0.586516 0.256356 0.130672 0.026456 0.180374 0.042942 0.011174 0.765510 0.003450 0.024996 0.962422 0.009131 0.003308 0.002930 0.034731 0.959032 0.001280 0.001099 0.933714 0.063907 0.063907 0.933714 0.001099 0.001280 0.959032 0.034731 0.002930 0.003308 0.009131 0.962422 0.024996 0.003450 0.765510 0.011174 0.042942 0.180374 0.191223 0.100884 0.130066 0.577827 0.253802 0.331394 0.119338 0.295466 0.291955 0.190810 0.184854 0.332381 0.248614 0.201723 0.321010 0.228654 Consensus sequence: HHRTATGTGCACATHHD Alignment: HHRTATGTGCACATHHD ----AAGTTCA------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00413 Elf4 Reverse Complement Original Motif Forward 2 7 0.042126 Species: Mus musculus Original motif 0.349744 0.139466 0.209326 0.301464 0.080478 0.359482 0.307083 0.252956 0.145756 0.213763 0.350557 0.289924 0.317307 0.199359 0.096089 0.387245 0.868576 0.009724 0.088821 0.032878 0.001975 0.827004 0.014159 0.156862 0.045494 0.000985 0.001907 0.951615 0.011012 0.001203 0.002186 0.985599 0.002743 0.992908 0.002226 0.002123 0.001498 0.990840 0.001556 0.006106 0.000951 0.005138 0.880591 0.113319 0.003127 0.107962 0.867980 0.020930 0.156602 0.055355 0.396563 0.391480 0.421246 0.049379 0.084495 0.444880 0.223879 0.068063 0.203809 0.504249 0.144100 0.323579 0.131544 0.400777 Consensus sequence: DBBHACTTCCGGKWTH Reverse complement motif 0.400777 0.323579 0.131544 0.144100 0.504249 0.068063 0.203809 0.223879 0.444880 0.049379 0.084495 0.421246 0.156602 0.396563 0.055355 0.391480 0.003127 0.867980 0.107962 0.020930 0.000951 0.880591 0.005138 0.113319 0.001498 0.001556 0.990840 0.006106 0.002743 0.002226 0.992908 0.002123 0.985599 0.001203 0.002186 0.011012 0.951615 0.000985 0.001907 0.045494 0.001975 0.014159 0.827004 0.156862 0.032878 0.009724 0.088821 0.868576 0.387245 0.199359 0.096089 0.317307 0.145756 0.350557 0.213763 0.289924 0.080478 0.307083 0.359482 0.252956 0.301464 0.139466 0.209326 0.349744 Consensus sequence: HAWYCCGGAAGTHBBD Alignment: DBBHACTTCCGGKWTH -TGAACTT-------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00067 Lef1_primary Original Motif Reverse Complement Backward 9 7 0.042466 Species: Mus musculus Original motif 0.281920 0.214207 0.278077 0.225796 0.325566 0.151435 0.298797 0.224202 0.290253 0.145824 0.243443 0.320480 0.069286 0.404645 0.141614 0.384454 0.070044 0.621448 0.142647 0.165862 0.007295 0.907657 0.038110 0.046938 0.015587 0.018273 0.000658 0.965482 0.005527 0.005886 0.001905 0.986682 0.024512 0.001189 0.001344 0.972955 0.007384 0.025221 0.952270 0.015125 0.966438 0.000630 0.002693 0.030239 0.082252 0.001173 0.001495 0.915080 0.030255 0.677155 0.275323 0.017267 0.199467 0.118815 0.056814 0.624905 0.345445 0.169597 0.216831 0.268127 0.278106 0.150864 0.173693 0.397336 0.251834 0.339733 0.219703 0.188730 Consensus sequence: DDDYCCTTTGATCTDDV Reverse complement motif 0.251834 0.219703 0.339733 0.188730 0.397336 0.150864 0.173693 0.278106 0.268127 0.169597 0.216831 0.345445 0.624905 0.118815 0.056814 0.199467 0.030255 0.275323 0.677155 0.017267 0.915080 0.001173 0.001495 0.082252 0.030239 0.000630 0.002693 0.966438 0.007384 0.952270 0.025221 0.015125 0.972955 0.001189 0.001344 0.024512 0.986682 0.005886 0.001905 0.005527 0.965482 0.018273 0.000658 0.015587 0.007295 0.038110 0.907657 0.046938 0.070044 0.142647 0.621448 0.165862 0.069286 0.141614 0.404645 0.384454 0.320480 0.145824 0.243443 0.290253 0.224202 0.151435 0.298797 0.325566 0.225796 0.214207 0.278077 0.281920 Consensus sequence: VDDAGATCAAAGGKDDD Alignment: VDDAGATCAAAGGKDDD --AAGTTCA-------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00026 Zscan4_primary Original Motif Reverse Complement Forward 5 7 0.042767 Species: Mus musculus Original motif 0.203927 0.157260 0.307071 0.331743 0.360341 0.265216 0.147327 0.227115 0.251195 0.298806 0.241051 0.208949 0.487186 0.122472 0.214362 0.175980 0.122838 0.051062 0.055773 0.770327 0.020467 0.009992 0.965816 0.003725 0.005887 0.026663 0.006808 0.960643 0.030656 0.002167 0.965099 0.002078 0.002078 0.965099 0.002167 0.030656 0.960643 0.006808 0.026663 0.005887 0.003725 0.965816 0.009992 0.020467 0.770327 0.055773 0.051062 0.122838 0.044808 0.382307 0.042920 0.529965 0.751320 0.047417 0.044482 0.156781 0.362742 0.228898 0.085373 0.322987 0.436635 0.111479 0.217284 0.234601 0.303930 0.285374 0.195872 0.214824 Consensus sequence: DHVDTGTGCACAYAHDH Reverse complement motif 0.214824 0.285374 0.195872 0.303930 0.234601 0.111479 0.217284 0.436635 0.322987 0.228898 0.085373 0.362742 0.156781 0.047417 0.044482 0.751320 0.529965 0.382307 0.042920 0.044808 0.122838 0.055773 0.051062 0.770327 0.003725 0.009992 0.965816 0.020467 0.005887 0.006808 0.026663 0.960643 0.002078 0.002167 0.965099 0.030656 0.030656 0.965099 0.002167 0.002078 0.960643 0.026663 0.006808 0.005887 0.020467 0.965816 0.009992 0.003725 0.770327 0.051062 0.055773 0.122838 0.175980 0.122472 0.214362 0.487186 0.251195 0.241051 0.298806 0.208949 0.227115 0.265216 0.147327 0.360341 0.331743 0.157260 0.307071 0.203927 Consensus sequence: HDHTMTGTGCACADVHD Alignment: HDHTMTGTGCACADVHD ----AAGTTCA------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 41 Motif name: Motif 41 Original motif 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 Consensus sequence: TGGAGGAAA Reserve complement motif 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 Consensus sequence: TTTCCTCCA ************************************************************************ Best Matches for Motif ID 41 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00043 Bcl6b_primary Reverse Complement Reverse Complement Backward 5 9 0.000000 Species: Mus musculus Original motif 0.346550 0.082299 0.202982 0.368169 0.169328 0.599178 0.046508 0.184986 0.085619 0.105820 0.059390 0.749172 0.128756 0.084682 0.076780 0.709782 0.032381 0.009923 0.016477 0.941220 0.013184 0.868651 0.009399 0.108766 0.018397 0.104497 0.450474 0.426632 0.800902 0.010911 0.015982 0.172205 0.141166 0.055397 0.762379 0.041059 0.073467 0.021239 0.811630 0.093665 0.878497 0.015031 0.044964 0.061509 0.875924 0.027013 0.013780 0.083283 0.205684 0.213313 0.040936 0.540067 0.244336 0.228277 0.168227 0.359160 0.208971 0.304437 0.148473 0.338119 0.201607 0.294079 0.334889 0.169425 Consensus sequence: DCTTTCKAGGAATHHV Reverse complement motif 0.201607 0.334889 0.294079 0.169425 0.338119 0.304437 0.148473 0.208971 0.359160 0.228277 0.168227 0.244336 0.540067 0.213313 0.040936 0.205684 0.083283 0.027013 0.013780 0.875924 0.061509 0.015031 0.044964 0.878497 0.073467 0.811630 0.021239 0.093665 0.141166 0.762379 0.055397 0.041059 0.172205 0.010911 0.015982 0.800902 0.018397 0.450474 0.104497 0.426632 0.013184 0.009399 0.868651 0.108766 0.941220 0.009923 0.016477 0.032381 0.709782 0.084682 0.076780 0.128756 0.749172 0.105820 0.059390 0.085619 0.169328 0.046508 0.599178 0.184986 0.368169 0.082299 0.202982 0.346550 Consensus sequence: VHHATTCCTYGAAAGD Alignment: VHHATTCCTYGAAAGD ---TTTCCTCCA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00409 Elf5 Original Motif Original Motif Backward 4 9 0.010360 Species: Mus musculus Original motif 0.179167 0.229135 0.279326 0.312372 0.421239 0.102900 0.145609 0.330252 0.791978 0.009721 0.028951 0.169350 0.237609 0.375543 0.161526 0.225321 0.145845 0.325411 0.516045 0.012699 0.431007 0.516333 0.051679 0.000982 0.005750 0.001408 0.990928 0.001915 0.002025 0.001886 0.992021 0.004068 0.986405 0.001705 0.001039 0.010851 0.950652 0.003619 0.000482 0.045248 0.165221 0.013897 0.819076 0.001805 0.032042 0.049374 0.014632 0.903953 0.285325 0.108010 0.127373 0.479292 0.366131 0.141246 0.290661 0.201963 Consensus sequence: BWAHSMGGAAGTWD Reverse complement motif 0.201963 0.141246 0.290661 0.366131 0.479292 0.108010 0.127373 0.285325 0.903953 0.049374 0.014632 0.032042 0.165221 0.819076 0.013897 0.001805 0.045248 0.003619 0.000482 0.950652 0.010851 0.001705 0.001039 0.986405 0.002025 0.992021 0.001886 0.004068 0.005750 0.990928 0.001408 0.001915 0.431007 0.051679 0.516333 0.000982 0.145845 0.516045 0.325411 0.012699 0.237609 0.161526 0.375543 0.225321 0.169350 0.009721 0.028951 0.791978 0.330252 0.102900 0.145609 0.421239 0.312372 0.229135 0.279326 0.179167 Consensus sequence: DWACTTCCRSDTWV Alignment: BWAHSMGGAAGTWD --TGGAGGAAA--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00090 Elf3_primary Original Motif Original Motif Backward 4 9 0.012663 Species: Mus musculus Original motif 0.338918 0.138284 0.180304 0.342493 0.614328 0.046536 0.066645 0.272492 0.248636 0.405469 0.125813 0.220081 0.389942 0.368832 0.198252 0.042975 0.473107 0.443315 0.064884 0.018693 0.032285 0.005365 0.952727 0.009624 0.021365 0.006895 0.955827 0.015913 0.976258 0.006536 0.010998 0.006209 0.892027 0.007456 0.003678 0.096839 0.433755 0.037682 0.520487 0.008076 0.098931 0.159997 0.023691 0.717381 0.423164 0.077419 0.201004 0.298413 0.572262 0.158763 0.164963 0.104012 Consensus sequence: DAHMMGGAARTDA Reverse complement motif 0.104012 0.158763 0.164963 0.572262 0.298413 0.077419 0.201004 0.423164 0.717381 0.159997 0.023691 0.098931 0.433755 0.520487 0.037682 0.008076 0.096839 0.007456 0.003678 0.892027 0.006209 0.006536 0.010998 0.976258 0.021365 0.955827 0.006895 0.015913 0.032285 0.952727 0.005365 0.009624 0.018693 0.443315 0.064884 0.473107 0.042975 0.368832 0.198252 0.389942 0.248636 0.125813 0.405469 0.220081 0.272492 0.046536 0.066645 0.614328 0.342493 0.138284 0.180304 0.338918 Consensus sequence: TDAMTTCCYYDTD Alignment: DAHMMGGAARTDA -TGGAGGAAA--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00085 Sfpi1_primary Original Motif Original Motif Forward 3 9 0.013109 Species: Mus musculus Original motif 0.211586 0.273653 0.234763 0.279998 0.298032 0.104818 0.290385 0.306764 0.593467 0.048056 0.154602 0.203875 0.459746 0.052697 0.169949 0.317608 0.188623 0.155357 0.591543 0.064477 0.402746 0.286227 0.290285 0.020742 0.048569 0.001240 0.946397 0.003793 0.004354 0.001387 0.990819 0.003441 0.974272 0.001416 0.001466 0.022847 0.938748 0.003090 0.000833 0.057329 0.045831 0.270321 0.674644 0.009204 0.055664 0.092552 0.026061 0.825722 0.301235 0.122653 0.267039 0.309073 0.278680 0.276099 0.219159 0.226061 Consensus sequence: BDAWGVGGAAGTDH Reverse complement motif 0.226061 0.276099 0.219159 0.278680 0.309073 0.122653 0.267039 0.301235 0.825722 0.092552 0.026061 0.055664 0.045831 0.674644 0.270321 0.009204 0.057329 0.003090 0.000833 0.938748 0.022847 0.001416 0.001466 0.974272 0.004354 0.990819 0.001387 0.003441 0.048569 0.946397 0.001240 0.003793 0.020742 0.286227 0.290285 0.402746 0.188623 0.591543 0.155357 0.064477 0.317608 0.052697 0.169949 0.459746 0.203875 0.048056 0.154602 0.593467 0.306764 0.104818 0.290385 0.298032 0.279998 0.273653 0.234763 0.211586 Consensus sequence: HDACTTCCBCWTDV Alignment: BDAWGVGGAAGTDH --TGGAGGAAA--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00055 Hbp1_primary Original Motif Original Motif Backward 4 9 0.014016 Species: Mus musculus Original motif 0.348694 0.177225 0.158977 0.315104 0.241477 0.301470 0.225252 0.231801 0.299530 0.177310 0.188699 0.334462 0.413829 0.141414 0.102784 0.341973 0.032644 0.017968 0.004577 0.944811 0.021091 0.330699 0.642563 0.005647 0.969224 0.001914 0.005956 0.022906 0.969063 0.003485 0.003398 0.024054 0.013104 0.003523 0.002842 0.980532 0.005485 0.020244 0.932599 0.041672 0.757494 0.002617 0.231695 0.008193 0.865658 0.039206 0.073039 0.022097 0.110535 0.114879 0.043620 0.730965 0.186322 0.154540 0.442471 0.216667 0.366490 0.152622 0.256688 0.224200 0.216146 0.261309 0.238703 0.283842 Consensus sequence: HHDWTSAATGAATDDB Reverse complement motif 0.283842 0.261309 0.238703 0.216146 0.224200 0.152622 0.256688 0.366490 0.186322 0.442471 0.154540 0.216667 0.730965 0.114879 0.043620 0.110535 0.022097 0.039206 0.073039 0.865658 0.008193 0.002617 0.231695 0.757494 0.005485 0.932599 0.020244 0.041672 0.980532 0.003523 0.002842 0.013104 0.024054 0.003485 0.003398 0.969063 0.022906 0.001914 0.005956 0.969224 0.021091 0.642563 0.330699 0.005647 0.944811 0.017968 0.004577 0.032644 0.341973 0.141414 0.102784 0.413829 0.334462 0.177310 0.188699 0.299530 0.241477 0.225252 0.301470 0.231801 0.315104 0.177225 0.158977 0.348694 Consensus sequence: VDHATTCATTSAWDDH Alignment: HHDWTSAATGAATDDB ----TGGAGGAAA--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00021 Zfp281_secondary Reverse Complement Original Motif Forward 4 9 0.014260 Species: Mus musculus Original motif 0.463582 0.061604 0.232850 0.241964 0.128956 0.062321 0.481130 0.327593 0.217730 0.020690 0.453776 0.307803 0.535427 0.042857 0.149994 0.271722 0.222391 0.125415 0.375419 0.276775 0.640877 0.065373 0.223489 0.070261 0.021896 0.962922 0.010999 0.004183 0.033993 0.953699 0.002967 0.009341 0.009096 0.979346 0.006614 0.004944 0.010148 0.971252 0.010228 0.008373 0.019605 0.958973 0.012496 0.008926 0.752208 0.080178 0.046020 0.121594 0.466313 0.149124 0.107403 0.277160 0.177748 0.055516 0.159170 0.607566 0.314879 0.170636 0.187525 0.326960 0.322202 0.105206 0.230803 0.341789 0.284925 0.228846 0.320951 0.165278 Consensus sequence: DKKWDACCCCCAHTDDV Reverse complement motif 0.284925 0.320951 0.228846 0.165278 0.341789 0.105206 0.230803 0.322202 0.326960 0.170636 0.187525 0.314879 0.607566 0.055516 0.159170 0.177748 0.277160 0.149124 0.107403 0.466313 0.121594 0.080178 0.046020 0.752208 0.019605 0.012496 0.958973 0.008926 0.010148 0.010228 0.971252 0.008373 0.009096 0.006614 0.979346 0.004944 0.033993 0.002967 0.953699 0.009341 0.021896 0.010999 0.962922 0.004183 0.070261 0.065373 0.223489 0.640877 0.222391 0.375419 0.125415 0.276775 0.271722 0.042857 0.149994 0.535427 0.217730 0.453776 0.020690 0.307803 0.128956 0.481130 0.062321 0.327593 0.241964 0.061604 0.232850 0.463582 Consensus sequence: VDDAHTGGGGGTHWYYD Alignment: DKKWDACCCCCAHTDDV ---TTTCCTCCA----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00208 Obox5_2284.1 Reverse Complement Reverse Complement Forward 5 9 0.016190 Species: Mus musculus Original motif 0.281264 0.188968 0.136609 0.393160 0.344028 0.038266 0.328422 0.289284 0.266627 0.234290 0.328022 0.171062 0.393172 0.142839 0.379282 0.084706 0.110940 0.063210 0.811347 0.014502 0.089051 0.002920 0.905749 0.002280 0.008411 0.000554 0.984833 0.006202 0.987567 0.004995 0.000896 0.006542 0.003972 0.001261 0.003058 0.991709 0.007568 0.004773 0.000491 0.987168 0.974587 0.000828 0.001598 0.022987 0.799844 0.004926 0.020978 0.174252 0.383707 0.178162 0.082155 0.355976 0.074343 0.081369 0.030820 0.813467 0.182973 0.309007 0.180900 0.327119 0.274045 0.191530 0.121366 0.413060 0.286677 0.377630 0.141803 0.193890 Consensus sequence: HDVRGGGATTAAHTHHH Reverse complement motif 0.286677 0.141803 0.377630 0.193890 0.413060 0.191530 0.121366 0.274045 0.327119 0.309007 0.180900 0.182973 0.813467 0.081369 0.030820 0.074343 0.355976 0.178162 0.082155 0.383707 0.174252 0.004926 0.020978 0.799844 0.022987 0.000828 0.001598 0.974587 0.987168 0.004773 0.000491 0.007568 0.991709 0.001261 0.003058 0.003972 0.006542 0.004995 0.000896 0.987567 0.008411 0.984833 0.000554 0.006202 0.089051 0.905749 0.002920 0.002280 0.110940 0.811347 0.063210 0.014502 0.084706 0.142839 0.379282 0.393172 0.266627 0.328022 0.234290 0.171062 0.289284 0.038266 0.328422 0.344028 0.393160 0.188968 0.136609 0.281264 Consensus sequence: DHHAHTTAATCCCKVDH Alignment: DHHAHTTAATCCCKVDH ----TTTCCTCCA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00419 Spic Original Motif Original Motif Backward 4 9 0.016816 Species: Mus musculus Original motif 0.372554 0.181557 0.296001 0.149888 0.734552 0.057250 0.044752 0.163446 0.707604 0.045049 0.110341 0.137006 0.637848 0.057252 0.071934 0.232966 0.125449 0.108933 0.689441 0.076176 0.266215 0.517339 0.207018 0.009428 0.015016 0.002582 0.979670 0.002732 0.004303 0.002322 0.989973 0.003401 0.982327 0.003552 0.003393 0.010727 0.974155 0.001662 0.003294 0.020889 0.040023 0.128522 0.821560 0.009894 0.027635 0.045828 0.016297 0.910239 0.317500 0.045635 0.172234 0.464631 0.342838 0.107812 0.284775 0.264576 Consensus sequence: VAAAGMGGAAGTWD Reverse complement motif 0.264576 0.107812 0.284775 0.342838 0.464631 0.045635 0.172234 0.317500 0.910239 0.045828 0.016297 0.027635 0.040023 0.821560 0.128522 0.009894 0.020889 0.001662 0.003294 0.974155 0.010727 0.003552 0.003393 0.982327 0.004303 0.989973 0.002322 0.003401 0.015016 0.979670 0.002582 0.002732 0.266215 0.207018 0.517339 0.009428 0.125449 0.689441 0.108933 0.076176 0.232966 0.057252 0.071934 0.637848 0.137006 0.045049 0.110341 0.707604 0.163446 0.057250 0.044752 0.734552 0.149888 0.181557 0.296001 0.372554 Consensus sequence: DWACTTCCRCTTTB Alignment: VAAAGMGGAAGTWD --TGGAGGAAA--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00208 Obox5_3963.2 Reverse Complement Reverse Complement Forward 5 9 0.017507 Species: Mus musculus Original motif 0.387261 0.198638 0.227497 0.186604 0.433519 0.034731 0.333894 0.197856 0.267661 0.212742 0.354328 0.165269 0.592496 0.107283 0.224595 0.075627 0.204749 0.093469 0.661179 0.040603 0.117847 0.005218 0.874222 0.002713 0.003947 0.001871 0.982671 0.011511 0.983643 0.007799 0.001236 0.007322 0.002525 0.002866 0.003899 0.990710 0.006852 0.004502 0.001227 0.987419 0.974671 0.000902 0.002297 0.022129 0.768669 0.009517 0.017357 0.204456 0.309857 0.185797 0.068291 0.436055 0.083091 0.099239 0.032683 0.784987 0.402339 0.181407 0.250088 0.166166 0.273450 0.139411 0.090102 0.497037 0.280230 0.335645 0.216046 0.168079 Consensus sequence: VRVAGGGATTAAHTVWV Reverse complement motif 0.280230 0.216046 0.335645 0.168079 0.497037 0.139411 0.090102 0.273450 0.166166 0.181407 0.250088 0.402339 0.784987 0.099239 0.032683 0.083091 0.436055 0.185797 0.068291 0.309857 0.204456 0.009517 0.017357 0.768669 0.022129 0.000902 0.002297 0.974671 0.987419 0.004502 0.001227 0.006852 0.990710 0.002866 0.003899 0.002525 0.007322 0.007799 0.001236 0.983643 0.003947 0.982671 0.001871 0.011511 0.117847 0.874222 0.005218 0.002713 0.204749 0.661179 0.093469 0.040603 0.075627 0.107283 0.224595 0.592496 0.267661 0.354328 0.212742 0.165269 0.197856 0.034731 0.333894 0.433519 0.186604 0.198638 0.227497 0.387261 Consensus sequence: VWBAHTTAATCCCTVKB Alignment: VWBAHTTAATCCCTVKB ----TTTCCTCCA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00082 Zfp187_primary Reverse Complement Reverse Complement Forward 3 9 0.017867 Species: Mus musculus Original motif 0.190539 0.277187 0.240231 0.292043 0.132707 0.187246 0.111293 0.568754 0.936112 0.021141 0.033932 0.008815 0.012721 0.023350 0.004164 0.959765 0.007185 0.002386 0.987110 0.003318 0.059134 0.009005 0.034016 0.897845 0.900906 0.002575 0.086677 0.009842 0.003163 0.941371 0.002196 0.053270 0.034631 0.265318 0.037179 0.662873 0.967171 0.007014 0.003028 0.022787 0.980796 0.002228 0.010049 0.006927 0.020630 0.005755 0.005408 0.968208 0.427020 0.122682 0.118347 0.331951 0.447075 0.284990 0.061633 0.206303 Consensus sequence: BTATGTACTAATWH Reverse complement motif 0.206303 0.284990 0.061633 0.447075 0.331951 0.122682 0.118347 0.427020 0.968208 0.005755 0.005408 0.020630 0.006927 0.002228 0.010049 0.980796 0.022787 0.007014 0.003028 0.967171 0.662873 0.265318 0.037179 0.034631 0.003163 0.002196 0.941371 0.053270 0.009842 0.002575 0.086677 0.900906 0.897845 0.009005 0.034016 0.059134 0.007185 0.987110 0.002386 0.003318 0.959765 0.023350 0.004164 0.012721 0.008815 0.021141 0.033932 0.936112 0.568754 0.187246 0.111293 0.132707 0.292043 0.277187 0.240231 0.190539 Consensus sequence: HWATTAGTACATAV Alignment: HWATTAGTACATAV --TTTCCTCCA--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 42 Motif name: Motif 42 Original motif 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 Consensus sequence: TGAATGAA Reserve complement motif 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 Consensus sequence: TTCATTCA ************************************************************************ Best Matches for Motif ID 42 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00055 Hbp1_primary Original Motif Original Motif Forward 5 8 0.000000 Species: Mus musculus Original motif 0.348694 0.177225 0.158977 0.315104 0.241477 0.301470 0.225252 0.231801 0.299530 0.177310 0.188699 0.334462 0.413829 0.141414 0.102784 0.341973 0.032644 0.017968 0.004577 0.944811 0.021091 0.330699 0.642563 0.005647 0.969224 0.001914 0.005956 0.022906 0.969063 0.003485 0.003398 0.024054 0.013104 0.003523 0.002842 0.980532 0.005485 0.020244 0.932599 0.041672 0.757494 0.002617 0.231695 0.008193 0.865658 0.039206 0.073039 0.022097 0.110535 0.114879 0.043620 0.730965 0.186322 0.154540 0.442471 0.216667 0.366490 0.152622 0.256688 0.224200 0.216146 0.261309 0.238703 0.283842 Consensus sequence: HHDWTSAATGAATDDB Reverse complement motif 0.283842 0.261309 0.238703 0.216146 0.224200 0.152622 0.256688 0.366490 0.186322 0.442471 0.154540 0.216667 0.730965 0.114879 0.043620 0.110535 0.022097 0.039206 0.073039 0.865658 0.008193 0.002617 0.231695 0.757494 0.005485 0.932599 0.020244 0.041672 0.980532 0.003523 0.002842 0.013104 0.024054 0.003485 0.003398 0.969063 0.022906 0.001914 0.005956 0.969224 0.021091 0.642563 0.330699 0.005647 0.944811 0.017968 0.004577 0.032644 0.341973 0.141414 0.102784 0.413829 0.334462 0.177310 0.188699 0.299530 0.241477 0.225252 0.301470 0.231801 0.315104 0.177225 0.158977 0.348694 Consensus sequence: VDHATTCATTSAWDDH Alignment: HHDWTSAATGAATDDB ----TGAATGAA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00118 Pou4f3 Original Motif Original Motif Forward 6 8 0.042090 Species: Mus musculus Original motif 0.383079 0.200564 0.157774 0.258582 0.286661 0.232328 0.346094 0.134917 0.183287 0.074980 0.188685 0.553047 0.245056 0.223547 0.014679 0.516718 0.928782 0.007660 0.014149 0.049409 0.008881 0.020425 0.001142 0.969552 0.020532 0.000614 0.002803 0.976051 0.968278 0.003691 0.001780 0.026252 0.986910 0.001908 0.004534 0.006648 0.006532 0.009241 0.001632 0.982594 0.062388 0.006200 0.562032 0.369379 0.937585 0.034112 0.009775 0.018527 0.305324 0.123407 0.348899 0.222371 0.075111 0.110371 0.496285 0.318233 0.221869 0.271240 0.060549 0.446342 0.190858 0.546784 0.055998 0.206361 Consensus sequence: HVTTATTAATKADKHC Reverse complement motif 0.190858 0.055998 0.546784 0.206361 0.446342 0.271240 0.060549 0.221869 0.075111 0.496285 0.110371 0.318233 0.305324 0.348899 0.123407 0.222371 0.018527 0.034112 0.009775 0.937585 0.062388 0.562032 0.006200 0.369379 0.982594 0.009241 0.001632 0.006532 0.006648 0.001908 0.004534 0.986910 0.026252 0.003691 0.001780 0.968278 0.976051 0.000614 0.002803 0.020532 0.969552 0.020425 0.001142 0.008881 0.049409 0.007660 0.014149 0.928782 0.516718 0.223547 0.014679 0.245056 0.553047 0.074980 0.188685 0.183287 0.286661 0.346094 0.232328 0.134917 0.258582 0.200564 0.157774 0.383079 Consensus sequence: GHYHTYATTAATAAVH Alignment: HVTTATTAATKADKHC -----TGAATGAA--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00237 Otp Reverse Complement Reverse Complement Backward 6 8 0.042625 Species: Mus musculus Original motif 0.230993 0.375169 0.212909 0.180928 0.308053 0.197960 0.335842 0.158144 0.146999 0.355311 0.118315 0.379375 0.411189 0.175886 0.183790 0.229135 0.473168 0.101553 0.388483 0.036796 0.007589 0.115608 0.001555 0.875248 0.008817 0.035417 0.000301 0.955465 0.983825 0.008430 0.006604 0.001141 0.983066 0.001256 0.010977 0.004701 0.004701 0.010977 0.001256 0.983066 0.001141 0.006604 0.008430 0.983825 0.955465 0.000301 0.035417 0.008817 0.875248 0.001555 0.115608 0.007589 0.059530 0.422614 0.086819 0.431037 0.234910 0.104731 0.282998 0.377362 0.222053 0.180868 0.345763 0.251316 0.124269 0.122352 0.604547 0.148832 Consensus sequence: VVHDRTTAATTAAYDDG Reverse complement motif 0.124269 0.604547 0.122352 0.148832 0.222053 0.345763 0.180868 0.251316 0.377362 0.104731 0.282998 0.234910 0.431037 0.422614 0.086819 0.059530 0.007589 0.001555 0.115608 0.875248 0.008817 0.000301 0.035417 0.955465 0.983825 0.006604 0.008430 0.001141 0.983066 0.010977 0.001256 0.004701 0.004701 0.001256 0.010977 0.983066 0.001141 0.008430 0.006604 0.983825 0.955465 0.035417 0.000301 0.008817 0.875248 0.115608 0.001555 0.007589 0.036796 0.101553 0.388483 0.473168 0.229135 0.175886 0.183790 0.411189 0.379375 0.355311 0.118315 0.146999 0.308053 0.335842 0.197960 0.158144 0.230993 0.212909 0.375169 0.180928 Consensus sequence: CHDMTTAATTAAKDHVV Alignment: CHDMTTAATTAAKDHVV ----TTCATTCA----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00130 Lhx3 Original Motif Reverse Complement Backward 5 8 0.042789 Species: Mus musculus Original motif 0.226746 0.289244 0.371785 0.112225 0.256971 0.229670 0.248726 0.264633 0.556784 0.228344 0.038490 0.176382 0.631659 0.088282 0.196624 0.083434 0.021306 0.098213 0.006109 0.874373 0.016974 0.029949 0.000343 0.952734 0.971885 0.004194 0.023228 0.000693 0.983076 0.001653 0.004793 0.010478 0.010478 0.004793 0.001653 0.983076 0.000693 0.023228 0.004194 0.971885 0.952734 0.000343 0.029949 0.016974 0.874373 0.006109 0.098213 0.021306 0.425814 0.086548 0.127397 0.360241 0.343977 0.034349 0.079320 0.542354 0.412597 0.281154 0.077380 0.228869 0.338396 0.315969 0.106509 0.239127 0.112285 0.233324 0.310745 0.343646 Consensus sequence: VDAATTAATTAAWWHHB Reverse complement motif 0.343646 0.233324 0.310745 0.112285 0.239127 0.315969 0.106509 0.338396 0.228869 0.281154 0.077380 0.412597 0.542354 0.034349 0.079320 0.343977 0.360241 0.086548 0.127397 0.425814 0.021306 0.006109 0.098213 0.874373 0.016974 0.000343 0.029949 0.952734 0.971885 0.023228 0.004194 0.000693 0.983076 0.004793 0.001653 0.010478 0.010478 0.001653 0.004793 0.983076 0.000693 0.004194 0.023228 0.971885 0.952734 0.029949 0.000343 0.016974 0.874373 0.098213 0.006109 0.021306 0.083434 0.088282 0.196624 0.631659 0.176382 0.228344 0.038490 0.556784 0.264633 0.229670 0.248726 0.256971 0.226746 0.371785 0.289244 0.112225 Consensus sequence: VHHWWTTAATTAATTDV Alignment: VHHWWTTAATTAATTDV -----TGAATGAA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00212 Lhx5 Reverse Complement Reverse Complement Forward 6 8 0.044202 Species: Mus musculus Original motif 0.192127 0.348816 0.300474 0.158583 0.251871 0.201197 0.314740 0.232192 0.469240 0.195840 0.137749 0.197171 0.620351 0.063061 0.196615 0.119973 0.026357 0.096838 0.024928 0.851877 0.010301 0.066114 0.000301 0.923283 0.980649 0.007663 0.010886 0.000802 0.981397 0.001294 0.004654 0.012655 0.012655 0.004654 0.001294 0.981397 0.000802 0.010886 0.007663 0.980649 0.923283 0.000301 0.066114 0.010301 0.851877 0.024928 0.096838 0.026357 0.528438 0.142302 0.071537 0.257724 0.296647 0.115284 0.062688 0.525382 0.401193 0.235971 0.157675 0.205160 0.309966 0.315367 0.145959 0.228708 0.089761 0.287439 0.205359 0.417441 Consensus sequence: VDHATTAATTAAAWHHB Reverse complement motif 0.417441 0.287439 0.205359 0.089761 0.309966 0.145959 0.315367 0.228708 0.205160 0.235971 0.157675 0.401193 0.525382 0.115284 0.062688 0.296647 0.257724 0.142302 0.071537 0.528438 0.026357 0.024928 0.096838 0.851877 0.010301 0.000301 0.066114 0.923283 0.980649 0.010886 0.007663 0.000802 0.981397 0.004654 0.001294 0.012655 0.012655 0.001294 0.004654 0.981397 0.000802 0.007663 0.010886 0.980649 0.923283 0.066114 0.000301 0.010301 0.851877 0.096838 0.024928 0.026357 0.119973 0.063061 0.196615 0.620351 0.197171 0.195840 0.137749 0.469240 0.251871 0.314740 0.201197 0.232192 0.192127 0.300474 0.348816 0.158583 Consensus sequence: VDHWTTTAATTAATHHV Alignment: VDHWTTTAATTAATHHV -----TTCATTCA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00012 Bbx_primary Reverse Complement Reverse Complement Forward 4 8 0.045144 Species: Mus musculus Original motif 0.243561 0.194936 0.123150 0.438353 0.606538 0.159878 0.056476 0.177109 0.460256 0.141315 0.215237 0.183192 0.134434 0.033508 0.053304 0.778753 0.091333 0.019966 0.020704 0.867997 0.136284 0.753571 0.062560 0.047585 0.917109 0.031475 0.015472 0.035944 0.452244 0.084890 0.121698 0.341168 0.035944 0.015472 0.031475 0.917109 0.047585 0.062560 0.753571 0.136284 0.867997 0.020704 0.019966 0.091333 0.778753 0.053304 0.033508 0.134434 0.123705 0.284125 0.353361 0.238808 0.291282 0.126574 0.120737 0.461406 0.330626 0.062565 0.348868 0.257941 Consensus sequence: HADTTCAWTGAABWD Reverse complement motif 0.330626 0.348868 0.062565 0.257941 0.461406 0.126574 0.120737 0.291282 0.123705 0.353361 0.284125 0.238808 0.134434 0.053304 0.033508 0.778753 0.091333 0.020704 0.019966 0.867997 0.047585 0.753571 0.062560 0.136284 0.917109 0.015472 0.031475 0.035944 0.341168 0.084890 0.121698 0.452244 0.035944 0.031475 0.015472 0.917109 0.136284 0.062560 0.753571 0.047585 0.867997 0.019966 0.020704 0.091333 0.778753 0.033508 0.053304 0.134434 0.183192 0.141315 0.215237 0.460256 0.177109 0.159878 0.056476 0.606538 0.438353 0.194936 0.123150 0.243561 Consensus sequence: HWBTTCAWTGAADTH Alignment: HWBTTCAWTGAADTH ---TTCATTCA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00142 Uncx4.1 Original Motif Reverse Complement Forward 5 8 0.045595 Species: Mus musculus Original motif 0.304380 0.311795 0.268876 0.114949 0.351118 0.211470 0.225202 0.212210 0.231585 0.174454 0.127484 0.466477 0.479229 0.157540 0.203780 0.159451 0.625673 0.170623 0.111368 0.092336 0.010242 0.148179 0.010210 0.831370 0.009608 0.062829 0.000911 0.926652 0.980815 0.008055 0.009383 0.001746 0.980244 0.001172 0.005903 0.012681 0.012681 0.005903 0.001172 0.980244 0.001746 0.009383 0.008055 0.980815 0.926652 0.000911 0.062829 0.009608 0.831370 0.010210 0.148179 0.010242 0.148058 0.361669 0.223929 0.266344 0.178551 0.183863 0.465801 0.171785 0.170980 0.366501 0.305559 0.156960 0.125744 0.153063 0.556137 0.165056 Consensus sequence: VDHDATTAATTAABVVG Reverse complement motif 0.125744 0.556137 0.153063 0.165056 0.170980 0.305559 0.366501 0.156960 0.178551 0.465801 0.183863 0.171785 0.148058 0.223929 0.361669 0.266344 0.010242 0.010210 0.148179 0.831370 0.009608 0.000911 0.062829 0.926652 0.980815 0.009383 0.008055 0.001746 0.980244 0.005903 0.001172 0.012681 0.012681 0.001172 0.005903 0.980244 0.001746 0.008055 0.009383 0.980815 0.926652 0.062829 0.000911 0.009608 0.831370 0.148179 0.010210 0.010242 0.092336 0.170623 0.111368 0.625673 0.159451 0.157540 0.203780 0.479229 0.466477 0.174454 0.127484 0.231585 0.212210 0.211470 0.225202 0.351118 0.304380 0.268876 0.311795 0.114949 Consensus sequence: CVVBTTAATTAATDHDV Alignment: CVVBTTAATTAATDHDV ----TGAATGAA----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00172 Prop1 Original Motif Reverse Complement Forward 6 8 0.046095 Species: Mus musculus Original motif 0.239694 0.382964 0.212782 0.164560 0.211105 0.192638 0.471186 0.125071 0.361402 0.251084 0.217415 0.170099 0.474402 0.180412 0.249562 0.095624 0.015257 0.155181 0.007371 0.822191 0.011633 0.033757 0.000947 0.953662 0.984150 0.005351 0.005253 0.005247 0.982857 0.001638 0.005309 0.010196 0.010196 0.005309 0.001638 0.982857 0.005247 0.005253 0.005351 0.984150 0.953662 0.000947 0.033757 0.011633 0.822191 0.007371 0.155181 0.015257 0.159439 0.160044 0.349613 0.330903 0.454571 0.111567 0.175216 0.258646 0.305750 0.183822 0.246269 0.264159 0.351726 0.178703 0.236408 0.233163 0.142463 0.525857 0.103778 0.227902 Consensus sequence: VVVVTTAATTAABDDDC Reverse complement motif 0.142463 0.103778 0.525857 0.227902 0.233163 0.178703 0.236408 0.351726 0.264159 0.183822 0.246269 0.305750 0.258646 0.111567 0.175216 0.454571 0.159439 0.349613 0.160044 0.330903 0.015257 0.007371 0.155181 0.822191 0.011633 0.000947 0.033757 0.953662 0.984150 0.005253 0.005351 0.005247 0.982857 0.005309 0.001638 0.010196 0.010196 0.001638 0.005309 0.982857 0.005247 0.005351 0.005253 0.984150 0.953662 0.033757 0.000947 0.011633 0.822191 0.155181 0.007371 0.015257 0.095624 0.180412 0.249562 0.474402 0.170099 0.251084 0.217415 0.361402 0.211105 0.471186 0.192638 0.125071 0.239694 0.212782 0.382964 0.164560 Consensus sequence: GDDDBTTAATTAABBVV Alignment: GDDDBTTAATTAABBVV -----TGAATGAA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00169 Lmx1b Original Motif Reverse Complement Forward 5 8 0.048175 Species: Mus musculus Original motif 0.336931 0.220707 0.306671 0.135692 0.251068 0.126246 0.394767 0.227919 0.318914 0.086872 0.150663 0.443551 0.368649 0.051170 0.092361 0.487819 0.359682 0.088506 0.064771 0.487041 0.019535 0.162692 0.015925 0.801848 0.015902 0.024224 0.000652 0.959222 0.974698 0.006086 0.002334 0.016882 0.978085 0.001281 0.005421 0.015214 0.015214 0.005421 0.001281 0.978085 0.016882 0.002334 0.006086 0.974698 0.959222 0.000652 0.024224 0.015902 0.801848 0.015925 0.162692 0.019535 0.242323 0.115688 0.116364 0.525625 0.283782 0.097563 0.188384 0.430271 0.252386 0.255982 0.135946 0.355686 0.141430 0.249462 0.350759 0.258349 Consensus sequence: VDWWWTTAATTAATDHB Reverse complement motif 0.141430 0.350759 0.249462 0.258349 0.355686 0.255982 0.135946 0.252386 0.430271 0.097563 0.188384 0.283782 0.525625 0.115688 0.116364 0.242323 0.019535 0.015925 0.162692 0.801848 0.015902 0.000652 0.024224 0.959222 0.974698 0.002334 0.006086 0.016882 0.978085 0.005421 0.001281 0.015214 0.015214 0.001281 0.005421 0.978085 0.016882 0.006086 0.002334 0.974698 0.959222 0.024224 0.000652 0.015902 0.801848 0.162692 0.015925 0.019535 0.487041 0.088506 0.064771 0.359682 0.487819 0.051170 0.092361 0.368649 0.443551 0.086872 0.150663 0.318914 0.251068 0.394767 0.126246 0.227919 0.135692 0.220707 0.306671 0.336931 Consensus sequence: BHDATTAATTAAWWWHB Alignment: BHDATTAATTAAWWWHB ----TGAATGAA----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00149 Phox2b Reverse Complement Reverse Complement Backward 6 8 0.049128 Species: Mus musculus Original motif 0.270312 0.380127 0.282721 0.066841 0.311438 0.198757 0.357591 0.132214 0.166453 0.217463 0.312350 0.303735 0.604298 0.151111 0.094727 0.149864 0.577367 0.199873 0.198382 0.024378 0.053117 0.151891 0.010359 0.784633 0.018560 0.037001 0.003208 0.941231 0.974725 0.006070 0.016797 0.002408 0.975412 0.000845 0.011275 0.012468 0.012468 0.011275 0.000845 0.975412 0.002408 0.016797 0.006070 0.974725 0.941231 0.003208 0.037001 0.018560 0.784633 0.010359 0.151891 0.053117 0.064719 0.315444 0.226411 0.393427 0.379871 0.088168 0.289727 0.242234 0.205449 0.280466 0.296675 0.217411 0.161998 0.172365 0.502390 0.163246 Consensus sequence: VVBAATTAATTAABDBG Reverse complement motif 0.161998 0.502390 0.172365 0.163246 0.205449 0.296675 0.280466 0.217411 0.242234 0.088168 0.289727 0.379871 0.393427 0.315444 0.226411 0.064719 0.053117 0.010359 0.151891 0.784633 0.018560 0.003208 0.037001 0.941231 0.974725 0.016797 0.006070 0.002408 0.975412 0.011275 0.000845 0.012468 0.012468 0.000845 0.011275 0.975412 0.002408 0.006070 0.016797 0.974725 0.941231 0.037001 0.003208 0.018560 0.784633 0.151891 0.010359 0.053117 0.024378 0.199873 0.198382 0.577367 0.149864 0.151111 0.094727 0.604298 0.166453 0.312350 0.217463 0.303735 0.311438 0.357591 0.198757 0.132214 0.270312 0.282721 0.380127 0.066841 Consensus sequence: CBDVTTAATTAATTBVV Alignment: CBDVTTAATTAATTBVV ----TTCATTCA----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 43 Motif name: Motif 43 Original motif 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 Consensus sequence: AAKGAAAGGCA Reserve complement motif 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.000000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 Consensus sequence: TGCCTTTCYTT ************************************************************************ Best Matches for Motif ID 43 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00074 Isgf3g_primary Reverse Complement Reverse Complement Forward 1 11 0.012358 Species: Mus musculus Original motif 0.276786 0.305435 0.213026 0.204753 0.396362 0.114731 0.248667 0.240240 0.461284 0.092047 0.334734 0.111936 0.775091 0.019703 0.057075 0.148131 0.860742 0.032827 0.020878 0.085553 0.318035 0.134940 0.114054 0.432971 0.031989 0.819436 0.031529 0.117045 0.038741 0.005309 0.945956 0.009995 0.961581 0.018494 0.013401 0.006524 0.943392 0.004223 0.007869 0.044516 0.964748 0.010789 0.003727 0.020735 0.029401 0.875794 0.079869 0.014937 0.034572 0.294928 0.012201 0.658299 0.370121 0.165750 0.227886 0.236243 0.803710 0.072510 0.054519 0.069261 Consensus sequence: VDRAAWCGAAACTDA Reverse complement motif 0.069261 0.072510 0.054519 0.803710 0.236243 0.165750 0.227886 0.370121 0.658299 0.294928 0.012201 0.034572 0.029401 0.079869 0.875794 0.014937 0.020735 0.010789 0.003727 0.964748 0.044516 0.004223 0.007869 0.943392 0.006524 0.018494 0.013401 0.961581 0.038741 0.945956 0.005309 0.009995 0.031989 0.031529 0.819436 0.117045 0.432971 0.134940 0.114054 0.318035 0.085553 0.032827 0.020878 0.860742 0.148131 0.019703 0.057075 0.775091 0.111936 0.092047 0.334734 0.461284 0.240240 0.114731 0.248667 0.396362 0.276786 0.213026 0.305435 0.204753 Consensus sequence: TDAGTTTCGWTTKDV Alignment: TDAGTTTCGWTTKDV TGCCTTTCYTT---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00083 Tcf7l2_primary Original Motif Reverse Complement Backward 3 11 0.014351 Species: Mus musculus Original motif 0.285725 0.187143 0.254855 0.272277 0.276264 0.157893 0.258178 0.307665 0.238788 0.161120 0.254018 0.346074 0.076041 0.333901 0.150903 0.439156 0.093376 0.526578 0.180529 0.199517 0.010827 0.880320 0.034150 0.074703 0.016546 0.023834 0.000940 0.958680 0.007166 0.008215 0.001941 0.982678 0.029634 0.001363 0.001379 0.967625 0.010872 0.031751 0.926186 0.031190 0.949407 0.000760 0.002581 0.047253 0.109203 0.001362 0.002094 0.887341 0.044198 0.567994 0.353059 0.034749 0.222623 0.142360 0.041281 0.593736 0.358872 0.167597 0.220534 0.252997 0.233072 0.141480 0.230985 0.394463 0.350703 0.243129 0.233961 0.172207 Consensus sequence: DDDYCCTTTGATSTDDV Reverse complement motif 0.172207 0.243129 0.233961 0.350703 0.394463 0.141480 0.230985 0.233072 0.252997 0.167597 0.220534 0.358872 0.593736 0.142360 0.041281 0.222623 0.044198 0.353059 0.567994 0.034749 0.887341 0.001362 0.002094 0.109203 0.047253 0.000760 0.002581 0.949407 0.010872 0.926186 0.031751 0.031190 0.967625 0.001363 0.001379 0.029634 0.982678 0.008215 0.001941 0.007166 0.958680 0.023834 0.000940 0.016546 0.010827 0.034150 0.880320 0.074703 0.093376 0.180529 0.526578 0.199517 0.439156 0.333901 0.150903 0.076041 0.346074 0.161120 0.254018 0.238788 0.307665 0.157893 0.258178 0.276264 0.272277 0.187143 0.254855 0.285725 Consensus sequence: BDDASATCAAAGGMDDD Alignment: BDDASATCAAAGGMDDD ----AAKGAAAGGCA-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00067 Lef1_primary Original Motif Reverse Complement Forward 5 11 0.015991 Species: Mus musculus Original motif 0.281920 0.214207 0.278077 0.225796 0.325566 0.151435 0.298797 0.224202 0.290253 0.145824 0.243443 0.320480 0.069286 0.404645 0.141614 0.384454 0.070044 0.621448 0.142647 0.165862 0.007295 0.907657 0.038110 0.046938 0.015587 0.018273 0.000658 0.965482 0.005527 0.005886 0.001905 0.986682 0.024512 0.001189 0.001344 0.972955 0.007384 0.025221 0.952270 0.015125 0.966438 0.000630 0.002693 0.030239 0.082252 0.001173 0.001495 0.915080 0.030255 0.677155 0.275323 0.017267 0.199467 0.118815 0.056814 0.624905 0.345445 0.169597 0.216831 0.268127 0.278106 0.150864 0.173693 0.397336 0.251834 0.339733 0.219703 0.188730 Consensus sequence: DDDYCCTTTGATCTDDV Reverse complement motif 0.251834 0.219703 0.339733 0.188730 0.397336 0.150864 0.173693 0.278106 0.268127 0.169597 0.216831 0.345445 0.624905 0.118815 0.056814 0.199467 0.030255 0.275323 0.677155 0.017267 0.915080 0.001173 0.001495 0.082252 0.030239 0.000630 0.002693 0.966438 0.007384 0.952270 0.025221 0.015125 0.972955 0.001189 0.001344 0.024512 0.986682 0.005886 0.001905 0.005527 0.965482 0.018273 0.000658 0.015587 0.007295 0.038110 0.907657 0.046938 0.070044 0.142647 0.621448 0.165862 0.069286 0.141614 0.404645 0.384454 0.320480 0.145824 0.243443 0.290253 0.224202 0.151435 0.298797 0.325566 0.225796 0.214207 0.278077 0.281920 Consensus sequence: VDDAGATCAAAGGKDDD Alignment: VDDAGATCAAAGGKDDD ----AAKGAAAGGCA-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00054 Tcf7_primary Original Motif Original Motif Backward 3 11 0.022126 Species: Mus musculus Original motif 0.170811 0.196976 0.220503 0.411710 0.337231 0.228482 0.140137 0.294150 0.299312 0.173780 0.143426 0.383481 0.603957 0.053557 0.128214 0.214271 0.036338 0.377925 0.534647 0.051091 0.725865 0.010314 0.008501 0.255320 0.067855 0.007849 0.004559 0.919737 0.049387 0.815496 0.098330 0.036787 0.960514 0.005036 0.005137 0.029313 0.960631 0.004550 0.018815 0.016004 0.935245 0.005169 0.023866 0.035720 0.159760 0.060340 0.761341 0.018559 0.228534 0.153897 0.523052 0.094517 0.557984 0.123512 0.254154 0.064350 0.490252 0.211976 0.124557 0.173215 0.310463 0.250279 0.132612 0.306646 0.332720 0.248937 0.120633 0.297711 Consensus sequence: BHHASATCAAAGGAHHH Reverse complement motif 0.297711 0.248937 0.120633 0.332720 0.306646 0.250279 0.132612 0.310463 0.173215 0.211976 0.124557 0.490252 0.064350 0.123512 0.254154 0.557984 0.228534 0.523052 0.153897 0.094517 0.159760 0.761341 0.060340 0.018559 0.035720 0.005169 0.023866 0.935245 0.016004 0.004550 0.018815 0.960631 0.029313 0.005036 0.005137 0.960514 0.049387 0.098330 0.815496 0.036787 0.919737 0.007849 0.004559 0.067855 0.255320 0.010314 0.008501 0.725865 0.036338 0.534647 0.377925 0.051091 0.214271 0.053557 0.128214 0.603957 0.383481 0.173780 0.143426 0.299312 0.294150 0.228482 0.140137 0.337231 0.411710 0.196976 0.220503 0.170811 Consensus sequence: HHHTCCTTTGATSTHHV Alignment: BHHASATCAAAGGAHHH ----AAKGAAAGGCA-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00030 Sox11_primary Reverse Complement Reverse Complement Backward 5 11 0.023370 Species: Mus musculus Original motif 0.351812 0.238467 0.143954 0.265768 0.195246 0.235838 0.281473 0.287443 0.349478 0.172616 0.210739 0.267167 0.484061 0.110438 0.173131 0.232370 0.276692 0.070713 0.479604 0.172991 0.859124 0.044167 0.083951 0.012758 0.975608 0.002029 0.002285 0.020079 0.006422 0.978485 0.007124 0.007969 0.987489 0.003025 0.002868 0.006617 0.987739 0.005463 0.002730 0.004067 0.693013 0.004067 0.002445 0.300475 0.189100 0.003677 0.801408 0.005814 0.352090 0.072517 0.567737 0.007656 0.542316 0.176545 0.192768 0.088371 0.196382 0.304176 0.205985 0.293457 0.289415 0.201358 0.182937 0.326290 0.385801 0.216362 0.152363 0.245475 Consensus sequence: HBDDRAACAAAGRABHH Reverse complement motif 0.245475 0.216362 0.152363 0.385801 0.326290 0.201358 0.182937 0.289415 0.196382 0.205985 0.304176 0.293457 0.088371 0.176545 0.192768 0.542316 0.352090 0.567737 0.072517 0.007656 0.189100 0.801408 0.003677 0.005814 0.300475 0.004067 0.002445 0.693013 0.004067 0.005463 0.002730 0.987739 0.006617 0.003025 0.002868 0.987489 0.006422 0.007124 0.978485 0.007969 0.020079 0.002029 0.002285 0.975608 0.012758 0.044167 0.083951 0.859124 0.276692 0.479604 0.070713 0.172991 0.232370 0.110438 0.173131 0.484061 0.267167 0.172616 0.210739 0.349478 0.287443 0.235838 0.281473 0.195246 0.265768 0.238467 0.143954 0.351812 Consensus sequence: HHBTMCTTTGTTMDDVH Alignment: HHBTMCTTTGTTMDDVH --TGCCTTTCYTT---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00062 Sox4_primary Reverse Complement Reverse Complement Forward 3 11 0.023497 Species: Mus musculus Original motif 0.427843 0.231210 0.119424 0.221523 0.196506 0.239531 0.304906 0.259057 0.302488 0.156922 0.290190 0.250401 0.433872 0.149126 0.196496 0.220506 0.258426 0.076511 0.475100 0.189963 0.841714 0.046453 0.099915 0.011918 0.983853 0.001612 0.001362 0.013174 0.003460 0.982032 0.005728 0.008780 0.989743 0.002253 0.002020 0.005984 0.990761 0.003397 0.002843 0.003000 0.770864 0.003540 0.001549 0.224048 0.235342 0.002598 0.757383 0.004677 0.371426 0.089574 0.529959 0.009040 0.480804 0.196949 0.240413 0.081833 0.187158 0.355102 0.216599 0.241142 0.248006 0.232182 0.157452 0.362360 0.403367 0.177684 0.164649 0.254300 Consensus sequence: HBDDDAACAAAGRVBHH Reverse complement motif 0.254300 0.177684 0.164649 0.403367 0.362360 0.232182 0.157452 0.248006 0.187158 0.216599 0.355102 0.241142 0.081833 0.196949 0.240413 0.480804 0.371426 0.529959 0.089574 0.009040 0.235342 0.757383 0.002598 0.004677 0.224048 0.003540 0.001549 0.770864 0.003000 0.003397 0.002843 0.990761 0.005984 0.002253 0.002020 0.989743 0.003460 0.005728 0.982032 0.008780 0.013174 0.001612 0.001362 0.983853 0.011918 0.046453 0.099915 0.841714 0.258426 0.475100 0.076511 0.189963 0.220506 0.149126 0.196496 0.433872 0.250401 0.156922 0.290190 0.302488 0.196506 0.304906 0.239531 0.259057 0.221523 0.231210 0.119424 0.427843 Consensus sequence: HHBBMCTTTGTTHDDBH Alignment: HHBBMCTTTGTTHDDBH --TGCCTTTCYTT---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00058 Tcf3_primary Original Motif Original Motif Backward 3 11 0.023926 Species: Mus musculus Original motif 0.185864 0.201179 0.183663 0.429294 0.371100 0.233868 0.122934 0.272098 0.249563 0.171285 0.128851 0.450301 0.582940 0.043382 0.129099 0.244578 0.041400 0.395349 0.497087 0.066163 0.759123 0.009670 0.005936 0.225270 0.056579 0.008662 0.003986 0.930772 0.043968 0.865783 0.056001 0.034249 0.962748 0.003731 0.003265 0.030256 0.971318 0.003542 0.012299 0.012841 0.937558 0.003991 0.020195 0.038256 0.125931 0.057976 0.798081 0.018012 0.209401 0.172342 0.483980 0.134277 0.485703 0.129227 0.309936 0.075134 0.397027 0.195902 0.152395 0.254676 0.311636 0.231510 0.157732 0.299122 0.320965 0.206031 0.164299 0.308705 Consensus sequence: HHHASATCAAAGVRHHH Reverse complement motif 0.308705 0.206031 0.164299 0.320965 0.299122 0.231510 0.157732 0.311636 0.254676 0.195902 0.152395 0.397027 0.075134 0.129227 0.309936 0.485703 0.209401 0.483980 0.172342 0.134277 0.125931 0.798081 0.057976 0.018012 0.038256 0.003991 0.020195 0.937558 0.012841 0.003542 0.012299 0.971318 0.030256 0.003731 0.003265 0.962748 0.043968 0.056001 0.865783 0.034249 0.930772 0.008662 0.003986 0.056579 0.225270 0.009670 0.005936 0.759123 0.041400 0.497087 0.395349 0.066163 0.244578 0.043382 0.129099 0.582940 0.450301 0.171285 0.128851 0.249563 0.272098 0.233868 0.122934 0.371100 0.429294 0.201179 0.183663 0.185864 Consensus sequence: HHHKVCTTTGATSTHHH Alignment: HHHASATCAAAGVRHHH ----AAKGAAAGGCA-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00079 Esrra_primary Original Motif Original Motif Backward 6 11 0.023978 Species: Mus musculus Original motif 0.212524 0.177958 0.293723 0.315796 0.420838 0.283140 0.144938 0.151084 0.198119 0.196347 0.260353 0.345181 0.117752 0.282184 0.137207 0.462857 0.070125 0.781439 0.138093 0.010344 0.965989 0.000956 0.023828 0.009227 0.977263 0.003066 0.019255 0.000416 0.007404 0.000267 0.938934 0.053395 0.007147 0.000287 0.983377 0.009190 0.039608 0.000730 0.040682 0.918981 0.000685 0.905345 0.021930 0.072040 0.800961 0.001126 0.195791 0.002121 0.245039 0.241263 0.038084 0.475614 0.265397 0.238316 0.304963 0.191325 0.203742 0.286208 0.231002 0.279048 0.194132 0.188854 0.346693 0.270322 0.310711 0.263840 0.184317 0.241132 Consensus sequence: DHDBCAAGGTCAHVBDH Reverse complement motif 0.241132 0.263840 0.184317 0.310711 0.194132 0.346693 0.188854 0.270322 0.203742 0.231002 0.286208 0.279048 0.265397 0.304963 0.238316 0.191325 0.475614 0.241263 0.038084 0.245039 0.002121 0.001126 0.195791 0.800961 0.000685 0.021930 0.905345 0.072040 0.918981 0.000730 0.040682 0.039608 0.007147 0.983377 0.000287 0.009190 0.007404 0.938934 0.000267 0.053395 0.000416 0.003066 0.019255 0.977263 0.009227 0.000956 0.023828 0.965989 0.070125 0.138093 0.781439 0.010344 0.462857 0.282184 0.137207 0.117752 0.345181 0.196347 0.260353 0.198119 0.151084 0.283140 0.144938 0.420838 0.315796 0.177958 0.293723 0.212524 Consensus sequence: HHBVHTGACCTTGVDHD Alignment: DHDBCAAGGTCAHVBDH -AAKGAAAGGCA----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00044 Mafk_secondary Reverse Complement Reverse Complement Backward 2 11 0.026408 Species: Mus musculus Original motif 0.289934 0.244974 0.342021 0.123071 0.317105 0.250774 0.206169 0.225952 0.589909 0.146264 0.176464 0.087364 0.805648 0.031025 0.116712 0.046614 0.859239 0.012630 0.068740 0.059391 0.877855 0.017270 0.013520 0.091354 0.822443 0.051458 0.029433 0.096666 0.175032 0.076822 0.256419 0.491726 0.028231 0.131221 0.031440 0.809107 0.050608 0.039418 0.847824 0.062150 0.041983 0.868232 0.042708 0.047077 0.757931 0.111841 0.090214 0.040013 0.451956 0.283644 0.033652 0.230747 0.058765 0.285975 0.414514 0.240747 0.391919 0.133805 0.407813 0.066464 Consensus sequence: VHAAAAADTGCAHBR Reverse complement motif 0.391919 0.407813 0.133805 0.066464 0.058765 0.414514 0.285975 0.240747 0.230747 0.283644 0.033652 0.451956 0.040013 0.111841 0.090214 0.757931 0.041983 0.042708 0.868232 0.047077 0.050608 0.847824 0.039418 0.062150 0.809107 0.131221 0.031440 0.028231 0.491726 0.076822 0.256419 0.175032 0.096666 0.051458 0.029433 0.822443 0.091354 0.017270 0.013520 0.877855 0.059391 0.012630 0.068740 0.859239 0.046614 0.031025 0.116712 0.805648 0.087364 0.146264 0.176464 0.589909 0.225952 0.250774 0.206169 0.317105 0.289934 0.342021 0.244974 0.123071 Consensus sequence: MBHTGCADTTTTTHV Alignment: MBHTGCADTTTTTHV ---TGCCTTTCYTT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00217 Hoxa10 Original Motif Original Motif Backward 1 11 0.027394 Species: Mus musculus Original motif 0.253548 0.084175 0.291022 0.371255 0.417014 0.294330 0.125631 0.163025 0.123351 0.208324 0.445405 0.222921 0.172372 0.079941 0.703466 0.044221 0.067738 0.316338 0.008581 0.607343 0.714812 0.267364 0.004791 0.013032 0.889412 0.007924 0.076273 0.026392 0.025273 0.005506 0.003887 0.965335 0.702649 0.009737 0.005991 0.281622 0.912510 0.003037 0.007419 0.077034 0.883516 0.023732 0.005164 0.087588 0.694916 0.058227 0.048693 0.198164 0.235705 0.164601 0.066361 0.533333 0.182632 0.079837 0.301116 0.436414 0.280662 0.390486 0.085440 0.243412 0.524839 0.080903 0.096006 0.298252 Consensus sequence: DHBGYAATAAAATDHW Reverse complement motif 0.298252 0.080903 0.096006 0.524839 0.280662 0.085440 0.390486 0.243412 0.436414 0.079837 0.301116 0.182632 0.533333 0.164601 0.066361 0.235705 0.198164 0.058227 0.048693 0.694916 0.087588 0.023732 0.005164 0.883516 0.077034 0.003037 0.007419 0.912510 0.281622 0.009737 0.005991 0.702649 0.965335 0.005506 0.003887 0.025273 0.026392 0.007924 0.076273 0.889412 0.013032 0.267364 0.004791 0.714812 0.607343 0.316338 0.008581 0.067738 0.172372 0.703466 0.079941 0.044221 0.123351 0.445405 0.208324 0.222921 0.163025 0.294330 0.125631 0.417014 0.371255 0.084175 0.291022 0.253548 Consensus sequence: WDDATTTTATTMCBHD Alignment: DHBGYAATAAAATDHW -----AAKGAAAGGCA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 44 Motif name: Motif 44 Original motif 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.500000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 Consensus sequence: AATGKAAGAA Reserve complement motif 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.500000 0.000000 0.500000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 Consensus sequence: TTCTTYCATT ************************************************************************ Best Matches for Motif ID 44 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00082 Zfp187_primary Original Motif Original Motif Forward 2 10 0.029321 Species: Mus musculus Original motif 0.190539 0.277187 0.240231 0.292043 0.132707 0.187246 0.111293 0.568754 0.936112 0.021141 0.033932 0.008815 0.012721 0.023350 0.004164 0.959765 0.007185 0.002386 0.987110 0.003318 0.059134 0.009005 0.034016 0.897845 0.900906 0.002575 0.086677 0.009842 0.003163 0.941371 0.002196 0.053270 0.034631 0.265318 0.037179 0.662873 0.967171 0.007014 0.003028 0.022787 0.980796 0.002228 0.010049 0.006927 0.020630 0.005755 0.005408 0.968208 0.427020 0.122682 0.118347 0.331951 0.447075 0.284990 0.061633 0.206303 Consensus sequence: BTATGTACTAATWH Reverse complement motif 0.206303 0.284990 0.061633 0.447075 0.331951 0.122682 0.118347 0.427020 0.968208 0.005755 0.005408 0.020630 0.006927 0.002228 0.010049 0.980796 0.022787 0.007014 0.003028 0.967171 0.662873 0.265318 0.037179 0.034631 0.003163 0.002196 0.941371 0.053270 0.009842 0.002575 0.086677 0.900906 0.897845 0.009005 0.034016 0.059134 0.007185 0.987110 0.002386 0.003318 0.959765 0.023350 0.004164 0.012721 0.008815 0.021141 0.033932 0.936112 0.568754 0.187246 0.111293 0.132707 0.292043 0.277187 0.240231 0.190539 Consensus sequence: HWATTAGTACATAV Alignment: BTATGTACTAATWH -AATGKAAGAA--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00055 Hbp1_primary Reverse Complement Reverse Complement Backward 7 10 0.031411 Species: Mus musculus Original motif 0.348694 0.177225 0.158977 0.315104 0.241477 0.301470 0.225252 0.231801 0.299530 0.177310 0.188699 0.334462 0.413829 0.141414 0.102784 0.341973 0.032644 0.017968 0.004577 0.944811 0.021091 0.330699 0.642563 0.005647 0.969224 0.001914 0.005956 0.022906 0.969063 0.003485 0.003398 0.024054 0.013104 0.003523 0.002842 0.980532 0.005485 0.020244 0.932599 0.041672 0.757494 0.002617 0.231695 0.008193 0.865658 0.039206 0.073039 0.022097 0.110535 0.114879 0.043620 0.730965 0.186322 0.154540 0.442471 0.216667 0.366490 0.152622 0.256688 0.224200 0.216146 0.261309 0.238703 0.283842 Consensus sequence: HHDWTSAATGAATDDB Reverse complement motif 0.283842 0.261309 0.238703 0.216146 0.224200 0.152622 0.256688 0.366490 0.186322 0.442471 0.154540 0.216667 0.730965 0.114879 0.043620 0.110535 0.022097 0.039206 0.073039 0.865658 0.008193 0.002617 0.231695 0.757494 0.005485 0.932599 0.020244 0.041672 0.980532 0.003523 0.002842 0.013104 0.024054 0.003485 0.003398 0.969063 0.022906 0.001914 0.005956 0.969224 0.021091 0.642563 0.330699 0.005647 0.944811 0.017968 0.004577 0.032644 0.341973 0.141414 0.102784 0.413829 0.334462 0.177310 0.188699 0.299530 0.241477 0.225252 0.301470 0.231801 0.315104 0.177225 0.158977 0.348694 Consensus sequence: VDHATTCATTSAWDDH Alignment: VDHATTCATTSAWDDH TTCTTYCATT------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00025 Foxk1_primary Original Motif Original Motif Backward 6 10 0.038592 Species: Mus musculus Original motif 0.338172 0.192194 0.207817 0.261817 0.407924 0.117261 0.278236 0.196580 0.595570 0.070480 0.119221 0.214729 0.710845 0.038748 0.052600 0.197807 0.124647 0.116138 0.178053 0.581162 0.201602 0.005514 0.792110 0.000774 0.024590 0.004193 0.001331 0.969886 0.919465 0.077871 0.000760 0.001904 0.972342 0.010395 0.000580 0.016683 0.991045 0.001495 0.003585 0.003875 0.001358 0.885197 0.000980 0.112465 0.990318 0.001846 0.002968 0.004867 0.804563 0.063147 0.023496 0.108795 0.564824 0.087976 0.102865 0.244336 0.269947 0.300278 0.285008 0.144767 0.337905 0.220102 0.253694 0.188299 0.153781 0.274135 0.318343 0.253741 Consensus sequence: DDAATGTAAACAAAVVB Reverse complement motif 0.153781 0.318343 0.274135 0.253741 0.188299 0.220102 0.253694 0.337905 0.269947 0.285008 0.300278 0.144767 0.244336 0.087976 0.102865 0.564824 0.108795 0.063147 0.023496 0.804563 0.004867 0.001846 0.002968 0.990318 0.001358 0.000980 0.885197 0.112465 0.003875 0.001495 0.003585 0.991045 0.016683 0.010395 0.000580 0.972342 0.001904 0.077871 0.000760 0.919465 0.969886 0.004193 0.001331 0.024590 0.201602 0.792110 0.005514 0.000774 0.581162 0.116138 0.178053 0.124647 0.197807 0.038748 0.052600 0.710845 0.214729 0.070480 0.119221 0.595570 0.196580 0.117261 0.278236 0.407924 0.261817 0.192194 0.207817 0.338172 Consensus sequence: BBVTTTGTTTACATTDD Alignment: DDAATGTAAACAAAVVB --AATGKAAGAA----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00061 Foxl1_primary Original Motif Original Motif Backward 6 10 0.039278 Species: Mus musculus Original motif 0.323208 0.152915 0.185111 0.338766 0.428132 0.056109 0.099487 0.416272 0.659386 0.039965 0.035805 0.264843 0.647143 0.049206 0.078984 0.224667 0.208834 0.076592 0.071631 0.642943 0.341077 0.003865 0.649511 0.005547 0.016627 0.001866 0.001715 0.979792 0.952319 0.045294 0.000870 0.001516 0.988834 0.004620 0.000720 0.005826 0.989346 0.001005 0.006467 0.003182 0.001093 0.784230 0.001235 0.213442 0.991209 0.002017 0.001737 0.005037 0.801581 0.037084 0.023060 0.138274 0.528554 0.089350 0.107501 0.274595 0.208802 0.268646 0.368022 0.154530 0.280218 0.221367 0.340497 0.157918 0.146611 0.250725 0.293524 0.309140 Consensus sequence: DWAATRTAAACAAWVVB Reverse complement motif 0.309140 0.250725 0.293524 0.146611 0.280218 0.340497 0.221367 0.157918 0.208802 0.368022 0.268646 0.154530 0.274595 0.089350 0.107501 0.528554 0.138274 0.037084 0.023060 0.801581 0.005037 0.002017 0.001737 0.991209 0.001093 0.001235 0.784230 0.213442 0.003182 0.001005 0.006467 0.989346 0.005826 0.004620 0.000720 0.988834 0.001516 0.045294 0.000870 0.952319 0.979792 0.001866 0.001715 0.016627 0.341077 0.649511 0.003865 0.005547 0.642943 0.076592 0.071631 0.208834 0.224667 0.049206 0.078984 0.647143 0.264843 0.039965 0.035805 0.659386 0.416272 0.056109 0.099487 0.428132 0.338766 0.152915 0.185111 0.323208 Consensus sequence: VVVWTTGTTTAMATTWD Alignment: DWAATRTAAACAAWVVB --AATGKAAGAA----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00157 Hmx3 Reverse Complement Reverse Complement Backward 7 10 0.043381 Species: Mus musculus Original motif 0.493883 0.207908 0.206555 0.091654 0.124338 0.490519 0.252638 0.132506 0.482613 0.229280 0.188509 0.099597 0.758821 0.067165 0.111206 0.062809 0.154132 0.098232 0.594074 0.153562 0.015565 0.938529 0.001667 0.044239 0.835485 0.001163 0.156926 0.006426 0.869937 0.118961 0.001666 0.009435 0.005815 0.004470 0.001031 0.988683 0.014066 0.042296 0.000378 0.943259 0.924765 0.001168 0.024126 0.049941 0.873425 0.020468 0.034636 0.071470 0.387156 0.148327 0.115500 0.349017 0.256863 0.183824 0.381900 0.177413 0.472131 0.208576 0.255773 0.063519 0.524326 0.109150 0.180486 0.186038 0.125721 0.103316 0.133298 0.637666 Consensus sequence: VBVAGCAATTAAHVVAT Reverse complement motif 0.637666 0.103316 0.133298 0.125721 0.186038 0.109150 0.180486 0.524326 0.063519 0.208576 0.255773 0.472131 0.256863 0.381900 0.183824 0.177413 0.349017 0.148327 0.115500 0.387156 0.071470 0.020468 0.034636 0.873425 0.049941 0.001168 0.024126 0.924765 0.943259 0.042296 0.000378 0.014066 0.988683 0.004470 0.001031 0.005815 0.009435 0.118961 0.001666 0.869937 0.006426 0.001163 0.156926 0.835485 0.015565 0.001667 0.938529 0.044239 0.154132 0.594074 0.098232 0.153562 0.062809 0.067165 0.111206 0.758821 0.099597 0.229280 0.188509 0.482613 0.124338 0.252638 0.490519 0.132506 0.091654 0.207908 0.206555 0.493883 Consensus sequence: ATBVHTTAATTGCTBBB Alignment: ATBVHTTAATTGCTBBB -TTCTTYCATT------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00083 Tcf7l2_primary Reverse Complement Original Motif Backward 5 10 0.043670 Species: Mus musculus Original motif 0.285725 0.187143 0.254855 0.272277 0.276264 0.157893 0.258178 0.307665 0.238788 0.161120 0.254018 0.346074 0.076041 0.333901 0.150903 0.439156 0.093376 0.526578 0.180529 0.199517 0.010827 0.880320 0.034150 0.074703 0.016546 0.023834 0.000940 0.958680 0.007166 0.008215 0.001941 0.982678 0.029634 0.001363 0.001379 0.967625 0.010872 0.031751 0.926186 0.031190 0.949407 0.000760 0.002581 0.047253 0.109203 0.001362 0.002094 0.887341 0.044198 0.567994 0.353059 0.034749 0.222623 0.142360 0.041281 0.593736 0.358872 0.167597 0.220534 0.252997 0.233072 0.141480 0.230985 0.394463 0.350703 0.243129 0.233961 0.172207 Consensus sequence: DDDYCCTTTGATSTDDV Reverse complement motif 0.172207 0.243129 0.233961 0.350703 0.394463 0.141480 0.230985 0.233072 0.252997 0.167597 0.220534 0.358872 0.593736 0.142360 0.041281 0.222623 0.044198 0.353059 0.567994 0.034749 0.887341 0.001362 0.002094 0.109203 0.047253 0.000760 0.002581 0.949407 0.010872 0.926186 0.031751 0.031190 0.967625 0.001363 0.001379 0.029634 0.982678 0.008215 0.001941 0.007166 0.958680 0.023834 0.000940 0.016546 0.010827 0.034150 0.880320 0.074703 0.093376 0.180529 0.526578 0.199517 0.439156 0.333901 0.150903 0.076041 0.346074 0.161120 0.254018 0.238788 0.307665 0.157893 0.258178 0.276264 0.272277 0.187143 0.254855 0.285725 Consensus sequence: BDDASATCAAAGGMDDD Alignment: DDDYCCTTTGATSTDDV ---TTCTTYCATT---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00067 Lef1_primary Reverse Complement Original Motif Backward 5 10 0.044411 Species: Mus musculus Original motif 0.281920 0.214207 0.278077 0.225796 0.325566 0.151435 0.298797 0.224202 0.290253 0.145824 0.243443 0.320480 0.069286 0.404645 0.141614 0.384454 0.070044 0.621448 0.142647 0.165862 0.007295 0.907657 0.038110 0.046938 0.015587 0.018273 0.000658 0.965482 0.005527 0.005886 0.001905 0.986682 0.024512 0.001189 0.001344 0.972955 0.007384 0.025221 0.952270 0.015125 0.966438 0.000630 0.002693 0.030239 0.082252 0.001173 0.001495 0.915080 0.030255 0.677155 0.275323 0.017267 0.199467 0.118815 0.056814 0.624905 0.345445 0.169597 0.216831 0.268127 0.278106 0.150864 0.173693 0.397336 0.251834 0.339733 0.219703 0.188730 Consensus sequence: DDDYCCTTTGATCTDDV Reverse complement motif 0.251834 0.219703 0.339733 0.188730 0.397336 0.150864 0.173693 0.278106 0.268127 0.169597 0.216831 0.345445 0.624905 0.118815 0.056814 0.199467 0.030255 0.275323 0.677155 0.017267 0.915080 0.001173 0.001495 0.082252 0.030239 0.000630 0.002693 0.966438 0.007384 0.952270 0.025221 0.015125 0.972955 0.001189 0.001344 0.024512 0.986682 0.005886 0.001905 0.005527 0.965482 0.018273 0.000658 0.015587 0.007295 0.038110 0.907657 0.046938 0.070044 0.142647 0.621448 0.165862 0.069286 0.141614 0.404645 0.384454 0.320480 0.145824 0.243443 0.290253 0.224202 0.151435 0.298797 0.325566 0.225796 0.214207 0.278077 0.281920 Consensus sequence: VDDAGATCAAAGGKDDD Alignment: DDDYCCTTTGATCTDDV ---TTCTTYCATT---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00155 Hmx2 Reverse Complement Reverse Complement Backward 7 10 0.045489 Species: Mus musculus Original motif 0.496013 0.201439 0.234082 0.068466 0.187731 0.442491 0.232786 0.136992 0.546269 0.190140 0.171225 0.092365 0.766900 0.055660 0.121480 0.055959 0.166703 0.152146 0.573689 0.107463 0.008586 0.974989 0.003194 0.013231 0.847648 0.001099 0.146478 0.004775 0.851907 0.131324 0.006893 0.009877 0.005053 0.003719 0.001092 0.990135 0.015092 0.055361 0.000333 0.929213 0.934792 0.001369 0.011244 0.052595 0.890982 0.010911 0.022703 0.075405 0.360898 0.185917 0.109871 0.343315 0.248362 0.207536 0.407845 0.136257 0.413889 0.266826 0.266667 0.052618 0.472173 0.104750 0.246154 0.176923 0.094095 0.071488 0.092888 0.741528 Consensus sequence: VVAAGCAATTAAHVVDT Reverse complement motif 0.741528 0.071488 0.092888 0.094095 0.176923 0.104750 0.246154 0.472173 0.052618 0.266826 0.266667 0.413889 0.248362 0.407845 0.207536 0.136257 0.343315 0.185917 0.109871 0.360898 0.075405 0.010911 0.022703 0.890982 0.052595 0.001369 0.011244 0.934792 0.929213 0.055361 0.000333 0.015092 0.990135 0.003719 0.001092 0.005053 0.009877 0.131324 0.006893 0.851907 0.004775 0.001099 0.146478 0.847648 0.008586 0.003194 0.974989 0.013231 0.166703 0.573689 0.152146 0.107463 0.055959 0.055660 0.121480 0.766900 0.092365 0.190140 0.171225 0.546269 0.187731 0.232786 0.442491 0.136992 0.068466 0.201439 0.234082 0.496013 Consensus sequence: ADBVHTTAATTGCTTVB Alignment: ADBVHTTAATTGCTTVB -TTCTTYCATT------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00134 Hoxb13 Reverse Complement Reverse Complement Forward 2 10 0.047905 Species: Mus musculus Original motif 0.376100 0.272625 0.202253 0.149021 0.479072 0.116315 0.274952 0.129661 0.297412 0.328646 0.182054 0.191889 0.052067 0.771717 0.088083 0.088133 0.018222 0.666056 0.006952 0.308770 0.755568 0.122362 0.001339 0.120731 0.915413 0.001023 0.052340 0.031225 0.002612 0.028396 0.000695 0.968297 0.831092 0.001851 0.005615 0.161442 0.927869 0.001839 0.001169 0.069123 0.967747 0.009603 0.002871 0.019778 0.843186 0.073812 0.055868 0.027134 0.371084 0.143031 0.086222 0.399662 0.264976 0.212885 0.118960 0.403179 0.215633 0.345186 0.105518 0.333663 0.221910 0.297212 0.329310 0.151568 Consensus sequence: VRHCCAATAAAAWHHV Reverse complement motif 0.221910 0.329310 0.297212 0.151568 0.215633 0.105518 0.345186 0.333663 0.403179 0.212885 0.118960 0.264976 0.399662 0.143031 0.086222 0.371084 0.027134 0.073812 0.055868 0.843186 0.019778 0.009603 0.002871 0.967747 0.069123 0.001839 0.001169 0.927869 0.161442 0.001851 0.005615 0.831092 0.968297 0.028396 0.000695 0.002612 0.031225 0.001023 0.052340 0.915413 0.120731 0.122362 0.001339 0.755568 0.018222 0.006952 0.666056 0.308770 0.052067 0.088083 0.771717 0.088133 0.297412 0.182054 0.328646 0.191889 0.129661 0.116315 0.274952 0.479072 0.149021 0.272625 0.202253 0.376100 Consensus sequence: VDHWTTTTATTGGDKB Alignment: VDHWTTTTATTGGDKB -TTCTTYCATT----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00180 Hoxd13 Reverse Complement Reverse Complement Forward 2 10 0.048189 Species: Mus musculus Original motif 0.279189 0.316791 0.190404 0.213616 0.297705 0.175638 0.191020 0.335637 0.333485 0.203858 0.174034 0.288623 0.046444 0.540349 0.083237 0.329969 0.016780 0.648667 0.003870 0.330682 0.679959 0.116873 0.002745 0.200422 0.936496 0.002013 0.026876 0.034615 0.004741 0.008734 0.003861 0.982665 0.904624 0.000869 0.005345 0.089162 0.967883 0.002295 0.001003 0.028819 0.980087 0.004768 0.002887 0.012258 0.898523 0.041633 0.022776 0.037069 0.246903 0.292446 0.069240 0.391411 0.192528 0.300908 0.105655 0.400908 0.247610 0.343317 0.190760 0.218313 0.246702 0.253595 0.176298 0.323404 Consensus sequence: HDHYYAATAAAAHHHH Reverse complement motif 0.323404 0.253595 0.176298 0.246702 0.247610 0.190760 0.343317 0.218313 0.400908 0.300908 0.105655 0.192528 0.391411 0.292446 0.069240 0.246903 0.037069 0.041633 0.022776 0.898523 0.012258 0.004768 0.002887 0.980087 0.028819 0.002295 0.001003 0.967883 0.089162 0.000869 0.005345 0.904624 0.982665 0.008734 0.003861 0.004741 0.034615 0.002013 0.026876 0.936496 0.200422 0.116873 0.002745 0.679959 0.016780 0.003870 0.648667 0.330682 0.046444 0.083237 0.540349 0.329969 0.288623 0.203858 0.174034 0.333485 0.335637 0.175638 0.191020 0.297705 0.279189 0.190404 0.316791 0.213616 Consensus sequence: HDHHTTTTATTKKHDD Alignment: HDHHTTTTATTKKHDD -TTCTTYCATT----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 45 Motif name: Motif 45 Original motif 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.500000 0.000000 0.000000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 Consensus sequence: TAASTCTWTTTTAA Reserve complement motif 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.000000 0.000000 0.500000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 Consensus sequence: TTAAAAWAGASTTA ************************************************************************ Best Matches for Motif ID 45 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00114 Homez Original Motif Original Motif Forward 3 14 0.042602 Species: Mus musculus Original motif 0.585235 0.056880 0.174898 0.182987 0.344783 0.171238 0.144379 0.339600 0.496888 0.112442 0.086669 0.304001 0.457408 0.134777 0.032789 0.375026 0.342717 0.420568 0.171418 0.065297 0.872988 0.030946 0.004203 0.091862 0.006581 0.013120 0.006495 0.973804 0.036193 0.946961 0.004377 0.012469 0.014767 0.005226 0.966106 0.013901 0.208700 0.008264 0.021875 0.761161 0.037957 0.018882 0.028895 0.914266 0.157997 0.026546 0.021365 0.794092 0.139814 0.136272 0.117987 0.605927 0.125467 0.233302 0.183071 0.458161 0.523941 0.191122 0.050126 0.234811 0.374984 0.049392 0.291831 0.283793 0.268235 0.165772 0.308515 0.257477 Consensus sequence: AHWWMATCGTTTTBADD Reverse complement motif 0.268235 0.308515 0.165772 0.257477 0.283793 0.049392 0.291831 0.374984 0.234811 0.191122 0.050126 0.523941 0.458161 0.233302 0.183071 0.125467 0.605927 0.136272 0.117987 0.139814 0.794092 0.026546 0.021365 0.157997 0.914266 0.018882 0.028895 0.037957 0.761161 0.008264 0.021875 0.208700 0.014767 0.966106 0.005226 0.013901 0.036193 0.004377 0.946961 0.012469 0.973804 0.013120 0.006495 0.006581 0.091862 0.030946 0.004203 0.872988 0.342717 0.171418 0.420568 0.065297 0.375026 0.134777 0.032789 0.457408 0.304001 0.112442 0.086669 0.496888 0.339600 0.171238 0.144379 0.344783 0.182987 0.056880 0.174898 0.585235 Consensus sequence: HDTVAAAACGATRWWHT Alignment: AHWWMATCGTTTTBADD --TAASTCTWTTTTAA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00062 Sox4_primary Reverse Complement Original Motif Forward 4 14 0.049350 Species: Mus musculus Original motif 0.427843 0.231210 0.119424 0.221523 0.196506 0.239531 0.304906 0.259057 0.302488 0.156922 0.290190 0.250401 0.433872 0.149126 0.196496 0.220506 0.258426 0.076511 0.475100 0.189963 0.841714 0.046453 0.099915 0.011918 0.983853 0.001612 0.001362 0.013174 0.003460 0.982032 0.005728 0.008780 0.989743 0.002253 0.002020 0.005984 0.990761 0.003397 0.002843 0.003000 0.770864 0.003540 0.001549 0.224048 0.235342 0.002598 0.757383 0.004677 0.371426 0.089574 0.529959 0.009040 0.480804 0.196949 0.240413 0.081833 0.187158 0.355102 0.216599 0.241142 0.248006 0.232182 0.157452 0.362360 0.403367 0.177684 0.164649 0.254300 Consensus sequence: HBDDDAACAAAGRVBHH Reverse complement motif 0.254300 0.177684 0.164649 0.403367 0.362360 0.232182 0.157452 0.248006 0.187158 0.216599 0.355102 0.241142 0.081833 0.196949 0.240413 0.480804 0.371426 0.529959 0.089574 0.009040 0.235342 0.757383 0.002598 0.004677 0.224048 0.003540 0.001549 0.770864 0.003000 0.003397 0.002843 0.990761 0.005984 0.002253 0.002020 0.989743 0.003460 0.005728 0.982032 0.008780 0.013174 0.001612 0.001362 0.983853 0.011918 0.046453 0.099915 0.841714 0.258426 0.475100 0.076511 0.189963 0.220506 0.149126 0.196496 0.433872 0.250401 0.156922 0.290190 0.302488 0.196506 0.304906 0.239531 0.259057 0.221523 0.231210 0.119424 0.427843 Consensus sequence: HHBBMCTTTGTTHDDBH Alignment: HBDDDAACAAAGRVBHH ---TTAAAAWAGASTTA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00061 Foxl1_primary Original Motif Reverse Complement Backward 5 13 0.542468 Species: Mus musculus Original motif 0.323208 0.152915 0.185111 0.338766 0.428132 0.056109 0.099487 0.416272 0.659386 0.039965 0.035805 0.264843 0.647143 0.049206 0.078984 0.224667 0.208834 0.076592 0.071631 0.642943 0.341077 0.003865 0.649511 0.005547 0.016627 0.001866 0.001715 0.979792 0.952319 0.045294 0.000870 0.001516 0.988834 0.004620 0.000720 0.005826 0.989346 0.001005 0.006467 0.003182 0.001093 0.784230 0.001235 0.213442 0.991209 0.002017 0.001737 0.005037 0.801581 0.037084 0.023060 0.138274 0.528554 0.089350 0.107501 0.274595 0.208802 0.268646 0.368022 0.154530 0.280218 0.221367 0.340497 0.157918 0.146611 0.250725 0.293524 0.309140 Consensus sequence: DWAATRTAAACAAWVVB Reverse complement motif 0.309140 0.250725 0.293524 0.146611 0.280218 0.340497 0.221367 0.157918 0.208802 0.368022 0.268646 0.154530 0.274595 0.089350 0.107501 0.528554 0.138274 0.037084 0.023060 0.801581 0.005037 0.002017 0.001737 0.991209 0.001093 0.001235 0.784230 0.213442 0.003182 0.001005 0.006467 0.989346 0.005826 0.004620 0.000720 0.988834 0.001516 0.045294 0.000870 0.952319 0.979792 0.001866 0.001715 0.016627 0.341077 0.649511 0.003865 0.005547 0.642943 0.076592 0.071631 0.208834 0.224667 0.049206 0.078984 0.647143 0.264843 0.039965 0.035805 0.659386 0.416272 0.056109 0.099487 0.428132 0.338766 0.152915 0.185111 0.323208 Consensus sequence: VVVWTTGTTTAMATTWD Alignment: -VVVWTTGTTTAMATTWD TAASTCTWTTTTAA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00172 Prop1 Reverse Complement Original Motif Forward 5 13 0.545182 Species: Mus musculus Original motif 0.239694 0.382964 0.212782 0.164560 0.211105 0.192638 0.471186 0.125071 0.361402 0.251084 0.217415 0.170099 0.474402 0.180412 0.249562 0.095624 0.015257 0.155181 0.007371 0.822191 0.011633 0.033757 0.000947 0.953662 0.984150 0.005351 0.005253 0.005247 0.982857 0.001638 0.005309 0.010196 0.010196 0.005309 0.001638 0.982857 0.005247 0.005253 0.005351 0.984150 0.953662 0.000947 0.033757 0.011633 0.822191 0.007371 0.155181 0.015257 0.159439 0.160044 0.349613 0.330903 0.454571 0.111567 0.175216 0.258646 0.305750 0.183822 0.246269 0.264159 0.351726 0.178703 0.236408 0.233163 0.142463 0.525857 0.103778 0.227902 Consensus sequence: VVVVTTAATTAABDDDC Reverse complement motif 0.142463 0.103778 0.525857 0.227902 0.233163 0.178703 0.236408 0.351726 0.264159 0.183822 0.246269 0.305750 0.258646 0.111567 0.175216 0.454571 0.159439 0.349613 0.160044 0.330903 0.015257 0.007371 0.155181 0.822191 0.011633 0.000947 0.033757 0.953662 0.984150 0.005253 0.005351 0.005247 0.982857 0.005309 0.001638 0.010196 0.010196 0.001638 0.005309 0.982857 0.005247 0.005351 0.005253 0.984150 0.953662 0.033757 0.000947 0.011633 0.822191 0.155181 0.007371 0.015257 0.095624 0.180412 0.249562 0.474402 0.170099 0.251084 0.217415 0.361402 0.211105 0.471186 0.192638 0.125071 0.239694 0.212782 0.382964 0.164560 Consensus sequence: GDDDBTTAATTAABBVV Alignment: VVVVTTAATTAABDDDC- ----TTAAAAWAGASTTA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00212 Lhx5 Original Motif Reverse Complement Backward 5 13 0.547386 Species: Mus musculus Original motif 0.192127 0.348816 0.300474 0.158583 0.251871 0.201197 0.314740 0.232192 0.469240 0.195840 0.137749 0.197171 0.620351 0.063061 0.196615 0.119973 0.026357 0.096838 0.024928 0.851877 0.010301 0.066114 0.000301 0.923283 0.980649 0.007663 0.010886 0.000802 0.981397 0.001294 0.004654 0.012655 0.012655 0.004654 0.001294 0.981397 0.000802 0.010886 0.007663 0.980649 0.923283 0.000301 0.066114 0.010301 0.851877 0.024928 0.096838 0.026357 0.528438 0.142302 0.071537 0.257724 0.296647 0.115284 0.062688 0.525382 0.401193 0.235971 0.157675 0.205160 0.309966 0.315367 0.145959 0.228708 0.089761 0.287439 0.205359 0.417441 Consensus sequence: VDHATTAATTAAAWHHB Reverse complement motif 0.417441 0.287439 0.205359 0.089761 0.309966 0.145959 0.315367 0.228708 0.205160 0.235971 0.157675 0.401193 0.525382 0.115284 0.062688 0.296647 0.257724 0.142302 0.071537 0.528438 0.026357 0.024928 0.096838 0.851877 0.010301 0.000301 0.066114 0.923283 0.980649 0.010886 0.007663 0.000802 0.981397 0.004654 0.001294 0.012655 0.012655 0.001294 0.004654 0.981397 0.000802 0.007663 0.010886 0.980649 0.923283 0.066114 0.000301 0.010301 0.851877 0.096838 0.024928 0.026357 0.119973 0.063061 0.196615 0.620351 0.197171 0.195840 0.137749 0.469240 0.251871 0.314740 0.201197 0.232192 0.192127 0.300474 0.348816 0.158583 Consensus sequence: VDHWTTTAATTAATHHV Alignment: -VDHWTTTAATTAATHHV TAASTCTWTTTTAA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00237 Otp Reverse Complement Reverse Complement Backward 2 13 0.548444 Species: Mus musculus Original motif 0.230993 0.375169 0.212909 0.180928 0.308053 0.197960 0.335842 0.158144 0.146999 0.355311 0.118315 0.379375 0.411189 0.175886 0.183790 0.229135 0.473168 0.101553 0.388483 0.036796 0.007589 0.115608 0.001555 0.875248 0.008817 0.035417 0.000301 0.955465 0.983825 0.008430 0.006604 0.001141 0.983066 0.001256 0.010977 0.004701 0.004701 0.010977 0.001256 0.983066 0.001141 0.006604 0.008430 0.983825 0.955465 0.000301 0.035417 0.008817 0.875248 0.001555 0.115608 0.007589 0.059530 0.422614 0.086819 0.431037 0.234910 0.104731 0.282998 0.377362 0.222053 0.180868 0.345763 0.251316 0.124269 0.122352 0.604547 0.148832 Consensus sequence: VVHDRTTAATTAAYDDG Reverse complement motif 0.124269 0.604547 0.122352 0.148832 0.222053 0.345763 0.180868 0.251316 0.377362 0.104731 0.282998 0.234910 0.431037 0.422614 0.086819 0.059530 0.007589 0.001555 0.115608 0.875248 0.008817 0.000301 0.035417 0.955465 0.983825 0.006604 0.008430 0.001141 0.983066 0.010977 0.001256 0.004701 0.004701 0.001256 0.010977 0.983066 0.001141 0.008430 0.006604 0.983825 0.955465 0.035417 0.000301 0.008817 0.875248 0.115608 0.001555 0.007589 0.036796 0.101553 0.388483 0.473168 0.229135 0.175886 0.183790 0.411189 0.379375 0.355311 0.118315 0.146999 0.308053 0.335842 0.197960 0.158144 0.230993 0.212909 0.375169 0.180928 Consensus sequence: CHDMTTAATTAAKDHVV Alignment: -CHDMTTAATTAAKDHVV ---TTAAAAWAGASTTA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00130 Lhx3 Reverse Complement Original Motif Backward 2 13 0.548839 Species: Mus musculus Original motif 0.226746 0.289244 0.371785 0.112225 0.256971 0.229670 0.248726 0.264633 0.556784 0.228344 0.038490 0.176382 0.631659 0.088282 0.196624 0.083434 0.021306 0.098213 0.006109 0.874373 0.016974 0.029949 0.000343 0.952734 0.971885 0.004194 0.023228 0.000693 0.983076 0.001653 0.004793 0.010478 0.010478 0.004793 0.001653 0.983076 0.000693 0.023228 0.004194 0.971885 0.952734 0.000343 0.029949 0.016974 0.874373 0.006109 0.098213 0.021306 0.425814 0.086548 0.127397 0.360241 0.343977 0.034349 0.079320 0.542354 0.412597 0.281154 0.077380 0.228869 0.338396 0.315969 0.106509 0.239127 0.112285 0.233324 0.310745 0.343646 Consensus sequence: VDAATTAATTAAWWHHB Reverse complement motif 0.343646 0.233324 0.310745 0.112285 0.239127 0.315969 0.106509 0.338396 0.228869 0.281154 0.077380 0.412597 0.542354 0.034349 0.079320 0.343977 0.360241 0.086548 0.127397 0.425814 0.021306 0.006109 0.098213 0.874373 0.016974 0.000343 0.029949 0.952734 0.971885 0.023228 0.004194 0.000693 0.983076 0.004793 0.001653 0.010478 0.010478 0.001653 0.004793 0.983076 0.000693 0.004194 0.023228 0.971885 0.952734 0.029949 0.000343 0.016974 0.874373 0.098213 0.006109 0.021306 0.083434 0.088282 0.196624 0.631659 0.176382 0.228344 0.038490 0.556784 0.264633 0.229670 0.248726 0.256971 0.226746 0.371785 0.289244 0.112225 Consensus sequence: VHHWWTTAATTAATTDV Alignment: -VHHWWTTAATTAATTDV ---TTAAAAWAGASTTA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00145 Barhl2 Original Motif Reverse Complement Backward 3 12 1.030542 Species: Mus musculus Original motif 0.461695 0.224449 0.118884 0.194972 0.573918 0.178052 0.084607 0.163423 0.509202 0.299283 0.046830 0.144686 0.781754 0.035879 0.132996 0.049371 0.909629 0.018003 0.066327 0.006042 0.185305 0.442819 0.168153 0.203723 0.004152 0.938941 0.000741 0.056166 0.952728 0.004094 0.036915 0.006262 0.962648 0.006522 0.001095 0.029735 0.002949 0.002007 0.002143 0.992902 0.002773 0.003794 0.001682 0.991751 0.985960 0.000635 0.003183 0.010222 0.728479 0.023198 0.141457 0.106866 0.100754 0.330009 0.347597 0.221641 0.392007 0.211701 0.147142 0.249150 0.323968 0.271247 0.123950 0.280834 Consensus sequence: HAMAAHCAATTAABHH Reverse complement motif 0.280834 0.271247 0.123950 0.323968 0.249150 0.211701 0.147142 0.392007 0.100754 0.347597 0.330009 0.221641 0.106866 0.023198 0.141457 0.728479 0.010222 0.000635 0.003183 0.985960 0.991751 0.003794 0.001682 0.002773 0.992902 0.002007 0.002143 0.002949 0.029735 0.006522 0.001095 0.962648 0.006262 0.004094 0.036915 0.952728 0.004152 0.000741 0.938941 0.056166 0.185305 0.168153 0.442819 0.203723 0.006042 0.018003 0.066327 0.909629 0.049371 0.035879 0.132996 0.781754 0.144686 0.299283 0.046830 0.509202 0.163423 0.178052 0.084607 0.573918 0.194972 0.224449 0.118884 0.461695 Consensus sequence: HHBTTAATTGDTTYTH Alignment: --HAMAAHCAATTAABHH --TAASTCTWTTTTAA-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00109 Obox6 Reverse Complement Original Motif Forward 3 12 1.034396 Species: Mus musculus Original motif 0.505449 0.243908 0.109355 0.141288 0.297413 0.206507 0.201510 0.294571 0.691300 0.037294 0.141216 0.130190 0.680730 0.092257 0.036853 0.190160 0.348071 0.118125 0.345388 0.188416 0.140809 0.605582 0.189427 0.064182 0.039008 0.001848 0.956724 0.002420 0.003771 0.000570 0.983421 0.012238 0.969153 0.028918 0.000574 0.001355 0.003106 0.002396 0.001479 0.993019 0.009026 0.012438 0.000393 0.978144 0.969731 0.000460 0.002034 0.027774 0.444629 0.020696 0.076200 0.458475 0.254738 0.341763 0.053351 0.350148 0.119131 0.226982 0.464626 0.189261 Consensus sequence: AHAADCGGATTAWHB Reverse complement motif 0.119131 0.464626 0.226982 0.189261 0.350148 0.341763 0.053351 0.254738 0.458475 0.020696 0.076200 0.444629 0.027774 0.000460 0.002034 0.969731 0.978144 0.012438 0.000393 0.009026 0.993019 0.002396 0.001479 0.003106 0.001355 0.028918 0.000574 0.969153 0.003771 0.983421 0.000570 0.012238 0.039008 0.956724 0.001848 0.002420 0.140809 0.189427 0.605582 0.064182 0.188416 0.118125 0.345388 0.348071 0.190160 0.092257 0.036853 0.680730 0.130190 0.037294 0.141216 0.691300 0.294571 0.206507 0.201510 0.297413 0.141288 0.243908 0.109355 0.505449 Consensus sequence: BHWTAATCCGDTTHT Alignment: BHWTAATCCGDTTHT-- --TTAAAAWAGASTTA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00166 Barhl1 Reverse Complement Original Motif Forward 3 12 1.037459 Species: Mus musculus Original motif 0.467514 0.210142 0.140580 0.181765 0.607254 0.124874 0.137587 0.130285 0.280889 0.423565 0.125411 0.170135 0.748944 0.067655 0.136796 0.046605 0.723747 0.023732 0.218759 0.033762 0.075749 0.608701 0.182230 0.133321 0.005053 0.764340 0.000825 0.229781 0.951342 0.006010 0.029473 0.013175 0.890431 0.010111 0.000910 0.098548 0.004275 0.001291 0.002113 0.992321 0.005850 0.006608 0.000432 0.987110 0.979314 0.000732 0.001996 0.017957 0.546971 0.034786 0.326876 0.091366 0.120451 0.194359 0.328320 0.356870 0.274765 0.177491 0.231888 0.315855 0.223913 0.420032 0.139775 0.216280 Consensus sequence: HAHAACCAATTARBDH Reverse complement motif 0.223913 0.139775 0.420032 0.216280 0.315855 0.177491 0.231888 0.274765 0.356870 0.194359 0.328320 0.120451 0.091366 0.034786 0.326876 0.546971 0.017957 0.000732 0.001996 0.979314 0.987110 0.006608 0.000432 0.005850 0.992321 0.001291 0.002113 0.004275 0.098548 0.010111 0.000910 0.890431 0.013175 0.006010 0.029473 0.951342 0.005053 0.000825 0.764340 0.229781 0.075749 0.182230 0.608701 0.133321 0.033762 0.023732 0.218759 0.723747 0.046605 0.067655 0.136796 0.748944 0.280889 0.125411 0.423565 0.170135 0.130285 0.124874 0.137587 0.607254 0.181765 0.210142 0.140580 0.467514 Consensus sequence: DDVKTAATTGGTTDTH Alignment: DDVKTAATTGGTTDTH-- --TTAAAAWAGASTTA-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 46 Motif name: Motif 46 Original motif 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.500000 0.000000 0.500000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 Consensus sequence: ATAGGTTTAGYATA Reserve complement motif 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.500000 0.500000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 Consensus sequence: TATKCTAAACCTAT ************************************************************************ Best Matches for Motif ID 46 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00111 Dmbx1 Original Motif Original Motif Forward 4 14 0.036499 Species: Mus musculus Original motif 0.341712 0.131887 0.116437 0.409963 0.283906 0.076249 0.365173 0.274672 0.492212 0.077397 0.310871 0.119520 0.493786 0.075296 0.130460 0.300459 0.250600 0.362069 0.176185 0.211146 0.276779 0.499358 0.197580 0.026283 0.055301 0.013502 0.929631 0.001566 0.003194 0.006606 0.987514 0.002686 0.939596 0.057879 0.001197 0.001328 0.003076 0.002848 0.001228 0.992848 0.012045 0.007004 0.000799 0.980152 0.971675 0.001072 0.001680 0.025573 0.398313 0.051075 0.351335 0.199277 0.092401 0.114350 0.374362 0.418888 0.152628 0.280503 0.301836 0.265032 0.303927 0.200947 0.192110 0.303017 0.367352 0.124551 0.150288 0.357809 Consensus sequence: WDRWHMGGATTADKBHD Reverse complement motif 0.357809 0.124551 0.150288 0.367352 0.303017 0.200947 0.192110 0.303927 0.152628 0.301836 0.280503 0.265032 0.418888 0.114350 0.374362 0.092401 0.199277 0.051075 0.351335 0.398313 0.025573 0.001072 0.001680 0.971675 0.980152 0.007004 0.000799 0.012045 0.992848 0.002848 0.001228 0.003076 0.001328 0.057879 0.001197 0.939596 0.003194 0.987514 0.006606 0.002686 0.055301 0.929631 0.013502 0.001566 0.276779 0.197580 0.499358 0.026283 0.250600 0.176185 0.362069 0.211146 0.300459 0.075296 0.130460 0.493786 0.119520 0.077397 0.310871 0.492212 0.283906 0.365173 0.076249 0.274672 0.409963 0.131887 0.116437 0.341712 Consensus sequence: DHBRDTAATCCRDWKHW Alignment: WDRWHMGGATTADKBHD ---ATAGGTTTAGYATA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00061 Foxl1_primary Reverse Complement Original Motif Backward 3 14 0.039333 Species: Mus musculus Original motif 0.323208 0.152915 0.185111 0.338766 0.428132 0.056109 0.099487 0.416272 0.659386 0.039965 0.035805 0.264843 0.647143 0.049206 0.078984 0.224667 0.208834 0.076592 0.071631 0.642943 0.341077 0.003865 0.649511 0.005547 0.016627 0.001866 0.001715 0.979792 0.952319 0.045294 0.000870 0.001516 0.988834 0.004620 0.000720 0.005826 0.989346 0.001005 0.006467 0.003182 0.001093 0.784230 0.001235 0.213442 0.991209 0.002017 0.001737 0.005037 0.801581 0.037084 0.023060 0.138274 0.528554 0.089350 0.107501 0.274595 0.208802 0.268646 0.368022 0.154530 0.280218 0.221367 0.340497 0.157918 0.146611 0.250725 0.293524 0.309140 Consensus sequence: DWAATRTAAACAAWVVB Reverse complement motif 0.309140 0.250725 0.293524 0.146611 0.280218 0.340497 0.221367 0.157918 0.208802 0.368022 0.268646 0.154530 0.274595 0.089350 0.107501 0.528554 0.138274 0.037084 0.023060 0.801581 0.005037 0.002017 0.001737 0.991209 0.001093 0.001235 0.784230 0.213442 0.003182 0.001005 0.006467 0.989346 0.005826 0.004620 0.000720 0.988834 0.001516 0.045294 0.000870 0.952319 0.979792 0.001866 0.001715 0.016627 0.341077 0.649511 0.003865 0.005547 0.642943 0.076592 0.071631 0.208834 0.224667 0.049206 0.078984 0.647143 0.264843 0.039965 0.035805 0.659386 0.416272 0.056109 0.099487 0.428132 0.338766 0.152915 0.185111 0.323208 Consensus sequence: VVVWTTGTTTAMATTWD Alignment: DWAATRTAAACAAWVVB -TATKCTAAACCTAT-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00068 Eomes_secondary Reverse Complement Reverse Complement Forward 1 14 0.039476 Species: Mus musculus Original motif 0.253642 0.252604 0.298295 0.195458 0.112892 0.341342 0.341061 0.204704 0.297430 0.215095 0.343350 0.144125 0.241098 0.129378 0.421448 0.208076 0.894201 0.007299 0.061032 0.037468 0.052259 0.054303 0.856609 0.036829 0.005074 0.015048 0.966734 0.013144 0.003258 0.061529 0.002368 0.932845 0.017531 0.005025 0.973155 0.004289 0.116022 0.030172 0.047139 0.806667 0.027749 0.602513 0.009946 0.359792 0.018763 0.048982 0.794648 0.137608 0.177116 0.459591 0.284833 0.078460 0.121483 0.491485 0.148745 0.238287 0.152590 0.245835 0.214717 0.386857 0.221040 0.320773 0.249918 0.208270 Consensus sequence: VBVDAGGTGTYGVBBV Reverse complement motif 0.221040 0.249918 0.320773 0.208270 0.386857 0.245835 0.214717 0.152590 0.121483 0.148745 0.491485 0.238287 0.177116 0.284833 0.459591 0.078460 0.018763 0.794648 0.048982 0.137608 0.027749 0.009946 0.602513 0.359792 0.806667 0.030172 0.047139 0.116022 0.017531 0.973155 0.005025 0.004289 0.932845 0.061529 0.002368 0.003258 0.005074 0.966734 0.015048 0.013144 0.052259 0.856609 0.054303 0.036829 0.037468 0.007299 0.061032 0.894201 0.241098 0.421448 0.129378 0.208076 0.297430 0.343350 0.215095 0.144125 0.112892 0.341061 0.341342 0.204704 0.253642 0.298295 0.252604 0.195458 Consensus sequence: VVBVCKACACCTHVBV Alignment: VVBVCKACACCTHVBV TATKCTAAACCTAT-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00112 Gsc Reverse Complement Original Motif Backward 3 14 0.041185 Species: Mus musculus Original motif 0.471765 0.155805 0.130216 0.242214 0.336226 0.217033 0.236748 0.209992 0.397939 0.127567 0.045155 0.429339 0.262638 0.456883 0.100119 0.180360 0.277939 0.114100 0.520395 0.087567 0.069718 0.401925 0.012565 0.515792 0.026036 0.001115 0.000374 0.972475 0.985609 0.000281 0.009340 0.004771 0.992498 0.001751 0.001641 0.004110 0.003048 0.000589 0.009260 0.987104 0.005338 0.968427 0.001002 0.025233 0.001736 0.954156 0.002782 0.041326 0.030103 0.441404 0.400145 0.128348 0.083495 0.360697 0.075527 0.480281 0.219244 0.119908 0.236702 0.424146 0.256872 0.229901 0.124714 0.388513 0.313903 0.308509 0.263518 0.114070 Consensus sequence: HVWHRYTAATCCSYDHV Reverse complement motif 0.114070 0.308509 0.263518 0.313903 0.388513 0.229901 0.124714 0.256872 0.424146 0.119908 0.236702 0.219244 0.480281 0.360697 0.075527 0.083495 0.030103 0.400145 0.441404 0.128348 0.001736 0.002782 0.954156 0.041326 0.005338 0.001002 0.968427 0.025233 0.987104 0.000589 0.009260 0.003048 0.004110 0.001751 0.001641 0.992498 0.004771 0.000281 0.009340 0.985609 0.972475 0.001115 0.000374 0.026036 0.515792 0.401925 0.012565 0.069718 0.277939 0.520395 0.114100 0.087567 0.262638 0.100119 0.456883 0.180360 0.429339 0.127567 0.045155 0.397939 0.209992 0.217033 0.236748 0.336226 0.242214 0.155805 0.130216 0.471765 Consensus sequence: BHDMSGGATTAMMDWBH Alignment: HVWHRYTAATCCSYDHV -TATKCTAAACCTAT-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00018 Irf4_primary Original Motif Reverse Complement Forward 1 14 0.041683 Species: Mus musculus Original motif 0.302723 0.390309 0.162248 0.144720 0.263298 0.109753 0.466266 0.160683 0.314007 0.079943 0.170722 0.435328 0.657943 0.042407 0.054822 0.244828 0.175125 0.281452 0.069422 0.474000 0.014866 0.891988 0.005489 0.087657 0.012252 0.001771 0.982933 0.003044 0.985642 0.006248 0.005379 0.002731 0.933526 0.002109 0.003143 0.061222 0.988146 0.003436 0.001669 0.006749 0.021771 0.945675 0.026522 0.006032 0.029305 0.568908 0.017908 0.383879 0.396869 0.133807 0.324146 0.145178 0.326865 0.278882 0.198196 0.196056 0.506287 0.142988 0.165503 0.185222 Consensus sequence: VDDAYCGAAACYDVA Reverse complement motif 0.185222 0.142988 0.165503 0.506287 0.196056 0.278882 0.198196 0.326865 0.145178 0.133807 0.324146 0.396869 0.029305 0.017908 0.568908 0.383879 0.021771 0.026522 0.945675 0.006032 0.006749 0.003436 0.001669 0.988146 0.061222 0.002109 0.003143 0.933526 0.002731 0.006248 0.005379 0.985642 0.012252 0.982933 0.001771 0.003044 0.014866 0.005489 0.891988 0.087657 0.474000 0.281452 0.069422 0.175125 0.244828 0.042407 0.054822 0.657943 0.435328 0.079943 0.170722 0.314007 0.263298 0.466266 0.109753 0.160683 0.302723 0.162248 0.390309 0.144720 Consensus sequence: TBDKGTTTCGMTDHV Alignment: VDDAYCGAAACYDVA ATAGGTTTAGYATA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00025 Foxk1_primary Reverse Complement Original Motif Forward 2 14 0.042226 Species: Mus musculus Original motif 0.338172 0.192194 0.207817 0.261817 0.407924 0.117261 0.278236 0.196580 0.595570 0.070480 0.119221 0.214729 0.710845 0.038748 0.052600 0.197807 0.124647 0.116138 0.178053 0.581162 0.201602 0.005514 0.792110 0.000774 0.024590 0.004193 0.001331 0.969886 0.919465 0.077871 0.000760 0.001904 0.972342 0.010395 0.000580 0.016683 0.991045 0.001495 0.003585 0.003875 0.001358 0.885197 0.000980 0.112465 0.990318 0.001846 0.002968 0.004867 0.804563 0.063147 0.023496 0.108795 0.564824 0.087976 0.102865 0.244336 0.269947 0.300278 0.285008 0.144767 0.337905 0.220102 0.253694 0.188299 0.153781 0.274135 0.318343 0.253741 Consensus sequence: DDAATGTAAACAAAVVB Reverse complement motif 0.153781 0.318343 0.274135 0.253741 0.188299 0.220102 0.253694 0.337905 0.269947 0.285008 0.300278 0.144767 0.244336 0.087976 0.102865 0.564824 0.108795 0.063147 0.023496 0.804563 0.004867 0.001846 0.002968 0.990318 0.001358 0.000980 0.885197 0.112465 0.003875 0.001495 0.003585 0.991045 0.016683 0.010395 0.000580 0.972342 0.001904 0.077871 0.000760 0.919465 0.969886 0.004193 0.001331 0.024590 0.201602 0.792110 0.005514 0.000774 0.581162 0.116138 0.178053 0.124647 0.197807 0.038748 0.052600 0.710845 0.214729 0.070480 0.119221 0.595570 0.196580 0.117261 0.278236 0.407924 0.261817 0.192194 0.207817 0.338172 Consensus sequence: BBVTTTGTTTACATTDD Alignment: DDAATGTAAACAAAVVB -TATKCTAAACCTAT-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00011 Irf6_primary Original Motif Reverse Complement Forward 3 14 0.042495 Species: Mus musculus Original motif 0.256714 0.363080 0.149403 0.230804 0.312941 0.135162 0.190389 0.361507 0.255033 0.128823 0.354898 0.261246 0.667588 0.053933 0.205778 0.072701 0.199950 0.339707 0.114445 0.345899 0.029853 0.908514 0.006383 0.055250 0.019621 0.002231 0.976266 0.001882 0.983875 0.005320 0.008639 0.002166 0.698671 0.002741 0.006725 0.291864 0.990097 0.003609 0.003047 0.003247 0.008905 0.975208 0.011495 0.004392 0.022092 0.611448 0.018828 0.347632 0.538109 0.125313 0.241515 0.095063 0.456841 0.205124 0.177213 0.160822 0.372926 0.189134 0.195747 0.242193 0.217155 0.198027 0.300393 0.284425 0.277630 0.187849 0.237049 0.297472 Consensus sequence: HDDAHCGAAACYAVDDD Reverse complement motif 0.297472 0.187849 0.237049 0.277630 0.217155 0.300393 0.198027 0.284425 0.242193 0.189134 0.195747 0.372926 0.160822 0.205124 0.177213 0.456841 0.095063 0.125313 0.241515 0.538109 0.022092 0.018828 0.611448 0.347632 0.008905 0.011495 0.975208 0.004392 0.003247 0.003609 0.003047 0.990097 0.291864 0.002741 0.006725 0.698671 0.002166 0.005320 0.008639 0.983875 0.019621 0.976266 0.002231 0.001882 0.029853 0.006383 0.908514 0.055250 0.345899 0.339707 0.114445 0.199950 0.072701 0.053933 0.205778 0.667588 0.255033 0.354898 0.128823 0.261246 0.361507 0.135162 0.190389 0.312941 0.256714 0.149403 0.363080 0.230804 Consensus sequence: DHDBTKGTTTCGHTHDD Alignment: DHDBTKGTTTCGHTHDD --ATAGGTTTAGYATA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00125 Pitx2 Original Motif Original Motif Forward 3 14 0.043683 Species: Mus musculus Original motif 0.242677 0.229501 0.259308 0.268514 0.239574 0.084187 0.407773 0.268465 0.389673 0.131082 0.221817 0.257427 0.458845 0.170821 0.273585 0.096749 0.287524 0.102892 0.557422 0.052162 0.106202 0.003368 0.887079 0.003351 0.006667 0.001481 0.981787 0.010064 0.949041 0.045868 0.000548 0.004542 0.003032 0.006646 0.000697 0.989625 0.008515 0.011174 0.000301 0.980009 0.895900 0.000770 0.001149 0.102180 0.700956 0.039195 0.190695 0.069155 0.092379 0.164035 0.093911 0.649675 0.257833 0.316866 0.114741 0.310560 0.380147 0.125922 0.251193 0.242738 0.281898 0.165542 0.207846 0.344713 0.186833 0.429334 0.101793 0.282040 Consensus sequence: DDDVRGGATTAATHDDH Reverse complement motif 0.186833 0.101793 0.429334 0.282040 0.344713 0.165542 0.207846 0.281898 0.242738 0.125922 0.251193 0.380147 0.257833 0.114741 0.316866 0.310560 0.649675 0.164035 0.093911 0.092379 0.069155 0.039195 0.190695 0.700956 0.102180 0.000770 0.001149 0.895900 0.980009 0.011174 0.000301 0.008515 0.989625 0.006646 0.000697 0.003032 0.004542 0.045868 0.000548 0.949041 0.006667 0.981787 0.001481 0.010064 0.106202 0.887079 0.003368 0.003351 0.287524 0.557422 0.102892 0.052162 0.096749 0.170821 0.273585 0.458845 0.257427 0.131082 0.221817 0.389673 0.239574 0.407773 0.084187 0.268465 0.268514 0.229501 0.259308 0.242677 Consensus sequence: DDDDATTAATCCMBDHD Alignment: DDDVRGGATTAATHDDH --ATAGGTTTAGYATA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00229 Otx1 Original Motif Original Motif Forward 3 14 0.044340 Species: Mus musculus Original motif 0.300610 0.149999 0.303810 0.245581 0.194444 0.095366 0.487289 0.222901 0.366838 0.110418 0.162922 0.359822 0.426793 0.049280 0.474292 0.049636 0.176031 0.195172 0.608443 0.020354 0.077179 0.003862 0.916244 0.002715 0.006954 0.001526 0.985903 0.005616 0.953016 0.043074 0.000504 0.003406 0.001743 0.004547 0.001783 0.991927 0.012882 0.003454 0.000402 0.983262 0.939084 0.000404 0.001874 0.058638 0.687439 0.025328 0.143515 0.143718 0.117461 0.128987 0.097084 0.656468 0.291905 0.125407 0.094129 0.488559 0.241296 0.237850 0.201291 0.319563 0.317041 0.222787 0.160309 0.299862 0.187481 0.261819 0.240698 0.310001 Consensus sequence: DDDRGGGATTAATWHHB Reverse complement motif 0.310001 0.261819 0.240698 0.187481 0.299862 0.222787 0.160309 0.317041 0.319563 0.237850 0.201291 0.241296 0.488559 0.125407 0.094129 0.291905 0.656468 0.128987 0.097084 0.117461 0.143718 0.025328 0.143515 0.687439 0.058638 0.000404 0.001874 0.939084 0.983262 0.003454 0.000402 0.012882 0.991927 0.004547 0.001783 0.001743 0.003406 0.043074 0.000504 0.953016 0.006954 0.985903 0.001526 0.005616 0.077179 0.916244 0.003862 0.002715 0.176031 0.608443 0.195172 0.020354 0.426793 0.474292 0.049280 0.049636 0.359822 0.110418 0.162922 0.366838 0.194444 0.487289 0.095366 0.222901 0.300610 0.303810 0.149999 0.245581 Consensus sequence: VHHWATTAATCCCMDHH Alignment: DDDRGGGATTAATWHHB --ATAGGTTTAGYATA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00153 Pitx1 Original Motif Original Motif Backward 1 14 0.044637 Species: Mus musculus Original motif 0.207371 0.246323 0.166934 0.379372 0.115831 0.171040 0.352289 0.360841 0.435857 0.190325 0.290547 0.083272 0.281154 0.147141 0.422767 0.148938 0.453996 0.050465 0.389240 0.106298 0.187631 0.043211 0.734974 0.034185 0.042788 0.001867 0.954016 0.001329 0.006032 0.001055 0.986493 0.006420 0.955163 0.042114 0.000355 0.002368 0.003755 0.004760 0.000754 0.990731 0.005515 0.009073 0.000267 0.985144 0.913280 0.000712 0.001035 0.084973 0.721584 0.024188 0.198396 0.055833 0.334868 0.490003 0.058252 0.116877 0.457303 0.071620 0.241947 0.229130 0.478355 0.207860 0.143752 0.170032 0.256961 0.248882 0.203598 0.290559 Consensus sequence: HBVDRGGGATTAAMDHH Reverse complement motif 0.290559 0.248882 0.203598 0.256961 0.170032 0.207860 0.143752 0.478355 0.229130 0.071620 0.241947 0.457303 0.334868 0.058252 0.490003 0.116877 0.055833 0.024188 0.198396 0.721584 0.084973 0.000712 0.001035 0.913280 0.985144 0.009073 0.000267 0.005515 0.990731 0.004760 0.000754 0.003755 0.002368 0.042114 0.000355 0.955163 0.006032 0.986493 0.001055 0.006420 0.042788 0.954016 0.001867 0.001329 0.187631 0.734974 0.043211 0.034185 0.106298 0.050465 0.389240 0.453996 0.281154 0.422767 0.147141 0.148938 0.083272 0.190325 0.290547 0.435857 0.360841 0.171040 0.352289 0.115831 0.379372 0.246323 0.166934 0.207371 Consensus sequence: HHDRTTAATCCCKHBVH Alignment: HBVDRGGGATTAAMDHH ---ATAGGTTTAGYATA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 2 Motif ID: 47 Motif name: Motif 47 Original motif 0.000000 0.500000 0.000000 0.500000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.714286 0.285714 0.000000 0.000000 0.000000 0.857143 0.000000 0.142857 0.000000 1.000000 0.000000 0.000000 0.000000 0.142857 0.142857 0.714286 0.357143 0.000000 0.357143 0.285714 0.000000 0.428571 0.571429 0.000000 0.142857 0.071429 0.000000 0.785714 0.000000 0.000000 1.000000 0.000000 0.071429 0.000000 0.785714 0.142857 0.142857 0.428571 0.000000 0.428571 Consensus sequence: YGCCACCTDSTGGY Reserve complement motif 0.142857 0.000000 0.428571 0.428571 0.071429 0.785714 0.000000 0.142857 0.000000 1.000000 0.000000 0.000000 0.785714 0.071429 0.000000 0.142857 0.000000 0.571429 0.428571 0.000000 0.285714 0.000000 0.357143 0.357143 0.714286 0.142857 0.142857 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.857143 0.142857 0.000000 0.285714 0.000000 0.714286 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.500000 Consensus sequence: KCCASDAGGTGGCK ************************************************************************ Best Matches for Motif ID 47 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v016060_secondary Reverse Complement Original Motif Backward 7 14 0.014596 Species: Mus musculus Original motif 0.319838 0.171199 0.138099 0.370865 0.269358 0.196600 0.346909 0.187133 0.176807 0.338888 0.193903 0.290402 0.230268 0.119645 0.310500 0.339587 0.517372 0.257658 0.111673 0.113296 0.159477 0.126524 0.561119 0.152879 0.117072 0.553013 0.130919 0.198996 0.073372 0.163548 0.525014 0.238066 0.143608 0.186896 0.170528 0.498967 0.054943 0.079034 0.722992 0.143031 0.048852 0.015134 0.852458 0.083556 0.029001 0.023938 0.918900 0.028160 0.036727 0.092645 0.090591 0.780037 0.017757 0.057598 0.895222 0.029423 0.026113 0.048113 0.879744 0.046030 0.023041 0.787043 0.123490 0.066426 0.579766 0.004868 0.296873 0.118493 0.303862 0.042931 0.290151 0.363055 0.099672 0.237431 0.262301 0.400597 0.217788 0.163908 0.367628 0.250676 0.450783 0.141108 0.226137 0.181972 0.485086 0.102553 0.242662 0.169700 0.109057 0.454222 0.145665 0.291056 Consensus sequence: HVBDAGCGBGGGTGGCRDBDDDB Reverse complement motif 0.109057 0.145665 0.454222 0.291056 0.169700 0.102553 0.242662 0.485086 0.181972 0.141108 0.226137 0.450783 0.217788 0.367628 0.163908 0.250676 0.400597 0.237431 0.262301 0.099672 0.363055 0.042931 0.290151 0.303862 0.118493 0.004868 0.296873 0.579766 0.023041 0.123490 0.787043 0.066426 0.026113 0.879744 0.048113 0.046030 0.017757 0.895222 0.057598 0.029423 0.780037 0.092645 0.090591 0.036727 0.029001 0.918900 0.023938 0.028160 0.048852 0.852458 0.015134 0.083556 0.054943 0.722992 0.079034 0.143031 0.498967 0.186896 0.170528 0.143608 0.073372 0.525014 0.163548 0.238066 0.117072 0.130919 0.553013 0.198996 0.159477 0.561119 0.126524 0.152879 0.113296 0.257658 0.111673 0.517372 0.339587 0.119645 0.310500 0.230268 0.176807 0.193903 0.338888 0.290402 0.269358 0.346909 0.196600 0.187133 0.370865 0.171199 0.138099 0.319838 Consensus sequence: BDDHVDKGCCACCCVCGCTDBVH Alignment: HVBDAGCGBGGGTGGCRDBDDDB ---KCCASDAGGTGGCK------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v016060_secondary Original Motif Original Motif Backward 3 14 0.018818 Species: Mus musculus Original motif 0.533199 0.080715 0.330435 0.055650 0.152031 0.212841 0.110234 0.524893 0.223934 0.264217 0.087037 0.424811 0.115097 0.339994 0.343861 0.201048 0.124993 0.418259 0.365642 0.091106 0.158365 0.292428 0.088361 0.460847 0.165479 0.561778 0.022254 0.250489 0.136873 0.259822 0.579763 0.023543 0.109570 0.747495 0.055128 0.087807 0.061912 0.792986 0.109031 0.036071 0.508703 0.267806 0.169766 0.053725 0.040912 0.838888 0.057470 0.062730 0.330554 0.606077 0.016192 0.047177 0.068079 0.563969 0.029742 0.338209 0.388799 0.291667 0.191284 0.128249 0.183283 0.578079 0.171100 0.067538 0.165163 0.097206 0.631377 0.106253 0.128564 0.435496 0.253275 0.182665 0.103395 0.088222 0.234758 0.573625 0.432879 0.276641 0.155895 0.134585 0.339199 0.148928 0.311036 0.200836 0.211958 0.298526 0.158443 0.331072 Consensus sequence: RTHBSYCGCCMCMYVCGBTVDH Reverse complement motif 0.331072 0.298526 0.158443 0.211958 0.200836 0.148928 0.311036 0.339199 0.134585 0.276641 0.155895 0.432879 0.573625 0.088222 0.234758 0.103395 0.128564 0.253275 0.435496 0.182665 0.165163 0.631377 0.097206 0.106253 0.183283 0.171100 0.578079 0.067538 0.128249 0.291667 0.191284 0.388799 0.068079 0.029742 0.563969 0.338209 0.330554 0.016192 0.606077 0.047177 0.040912 0.057470 0.838888 0.062730 0.053725 0.267806 0.169766 0.508703 0.061912 0.109031 0.792986 0.036071 0.109570 0.055128 0.747495 0.087807 0.136873 0.579763 0.259822 0.023543 0.165479 0.022254 0.561778 0.250489 0.460847 0.292428 0.088361 0.158365 0.124993 0.365642 0.418259 0.091106 0.115097 0.343861 0.339994 0.201048 0.424811 0.264217 0.087037 0.223934 0.524893 0.212841 0.110234 0.152031 0.055650 0.080715 0.330435 0.533199 Consensus sequence: HDBABCGBKRGYGGCGMSBHAK Alignment: RTHBSYCGCCMCMYVCGBTVDH ------YGCCACCTDSTGGY-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v016060_primary Original Motif Reverse Complement Forward 8 14 0.023110 Species: Mus musculus Original motif 0.204923 0.208846 0.365383 0.220848 0.294304 0.300143 0.167287 0.238266 0.109711 0.619514 0.117379 0.153396 0.178979 0.378580 0.230177 0.212264 0.159594 0.542602 0.118178 0.179627 0.125206 0.430074 0.151826 0.292894 0.097692 0.709845 0.116956 0.075506 0.148292 0.565912 0.037632 0.248164 0.077951 0.034190 0.855503 0.032356 0.001657 0.001061 0.971877 0.025405 0.001926 0.001084 0.991712 0.005278 0.033031 0.012001 0.057796 0.897171 0.002723 0.002647 0.993348 0.001281 0.003261 0.000963 0.987199 0.008577 0.000611 0.090925 0.074857 0.833608 0.015299 0.978878 0.004949 0.000874 0.013368 0.600902 0.033485 0.352245 0.231949 0.149575 0.118804 0.499672 0.267580 0.186002 0.371242 0.175176 0.264884 0.223483 0.110082 0.401551 0.221365 0.170121 0.179559 0.428955 0.112997 0.692930 0.139981 0.054092 0.460305 0.207883 0.155111 0.176702 Consensus sequence: BHCBCBCCGGGTGGTCYHVHDCH Reverse complement motif 0.176702 0.207883 0.155111 0.460305 0.112997 0.139981 0.692930 0.054092 0.428955 0.170121 0.179559 0.221365 0.401551 0.223483 0.110082 0.264884 0.267580 0.371242 0.186002 0.175176 0.499672 0.149575 0.118804 0.231949 0.013368 0.033485 0.600902 0.352245 0.015299 0.004949 0.978878 0.000874 0.833608 0.090925 0.074857 0.000611 0.003261 0.987199 0.000963 0.008577 0.002723 0.993348 0.002647 0.001281 0.897171 0.012001 0.057796 0.033031 0.001926 0.991712 0.001084 0.005278 0.001657 0.971877 0.001061 0.025405 0.077951 0.855503 0.034190 0.032356 0.148292 0.037632 0.565912 0.248164 0.097692 0.116956 0.709845 0.075506 0.125206 0.151826 0.430074 0.292894 0.159594 0.118178 0.542602 0.179627 0.178979 0.230177 0.378580 0.212264 0.109711 0.117379 0.619514 0.153396 0.294304 0.167287 0.300143 0.238266 0.204923 0.365383 0.208846 0.220848 Consensus sequence: HGDHVHKGACCACCCGGBGBGDB Alignment: HGDHVHKGACCACCCGGBGBGDB -------YGCCACCTDSTGGY-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00022 Zfp740_secondary Original Motif Original Motif Forward 4 14 0.025419 Species: Mus musculus Original motif 0.398967 0.071604 0.323957 0.205472 0.457709 0.058192 0.267218 0.216881 0.393346 0.032365 0.329533 0.244756 0.119528 0.091191 0.190078 0.599202 0.273933 0.123548 0.073075 0.529444 0.068935 0.812883 0.015245 0.102937 0.029664 0.907790 0.024804 0.037742 0.020725 0.933422 0.016796 0.029057 0.015086 0.948448 0.018030 0.018436 0.015628 0.884941 0.061172 0.038259 0.067508 0.744063 0.107305 0.081125 0.108097 0.140614 0.650174 0.101115 0.065696 0.247239 0.506149 0.180916 0.395005 0.077185 0.345914 0.181895 0.527081 0.093650 0.281853 0.097416 0.289378 0.245159 0.348803 0.116660 0.147136 0.260117 0.145993 0.446754 Consensus sequence: DDDTWCCCCCCGGDRVH Reverse complement motif 0.446754 0.260117 0.145993 0.147136 0.289378 0.348803 0.245159 0.116660 0.097416 0.093650 0.281853 0.527081 0.181895 0.077185 0.345914 0.395005 0.065696 0.506149 0.247239 0.180916 0.108097 0.650174 0.140614 0.101115 0.067508 0.107305 0.744063 0.081125 0.015628 0.061172 0.884941 0.038259 0.015086 0.018030 0.948448 0.018436 0.020725 0.016796 0.933422 0.029057 0.029664 0.024804 0.907790 0.037742 0.068935 0.015245 0.812883 0.102937 0.529444 0.123548 0.073075 0.273933 0.599202 0.091191 0.190078 0.119528 0.244756 0.032365 0.329533 0.393346 0.216881 0.058192 0.267218 0.457709 0.205472 0.071604 0.323957 0.398967 Consensus sequence: HVKDCCGGGGGGWADDD Alignment: DDDTWCCCCCCGGDRVH ---YGCCACCTDSTGGY ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v016060_primary Original Motif Original Motif Backward 1 14 0.027879 Species: Mus musculus Original motif 0.180868 0.321661 0.134642 0.362829 0.232215 0.134289 0.315356 0.318141 0.065068 0.093681 0.569842 0.271408 0.370822 0.229680 0.154738 0.244759 0.323039 0.182873 0.173588 0.320500 0.175039 0.266898 0.276080 0.281984 0.412669 0.147730 0.146326 0.293275 0.325953 0.028805 0.629596 0.015646 0.003017 0.001766 0.979711 0.015507 0.888973 0.040666 0.069420 0.000941 0.017309 0.979155 0.000899 0.002637 0.001732 0.988816 0.004856 0.004596 0.889763 0.078125 0.010384 0.021729 0.007566 0.987081 0.001421 0.003932 0.027797 0.966593 0.000878 0.004731 0.025816 0.867003 0.065749 0.041433 0.220658 0.075256 0.582904 0.121182 0.088946 0.283695 0.565345 0.062015 0.328012 0.241332 0.305901 0.124755 0.307302 0.137589 0.375928 0.179181 0.298752 0.231470 0.315255 0.154524 0.094565 0.142901 0.705696 0.056838 Consensus sequence: HDGHHBHRGACCACCCGSVDVG Reverse complement motif 0.094565 0.705696 0.142901 0.056838 0.298752 0.315255 0.231470 0.154524 0.307302 0.375928 0.137589 0.179181 0.124755 0.241332 0.305901 0.328012 0.088946 0.565345 0.283695 0.062015 0.220658 0.582904 0.075256 0.121182 0.025816 0.065749 0.867003 0.041433 0.027797 0.000878 0.966593 0.004731 0.007566 0.001421 0.987081 0.003932 0.021729 0.078125 0.010384 0.889763 0.001732 0.004856 0.988816 0.004596 0.017309 0.000899 0.979155 0.002637 0.000941 0.040666 0.069420 0.888973 0.003017 0.979711 0.001766 0.015507 0.325953 0.629596 0.028805 0.015646 0.293275 0.147730 0.146326 0.412669 0.281984 0.266898 0.276080 0.175039 0.320500 0.182873 0.173588 0.323039 0.244759 0.229680 0.154738 0.370822 0.065068 0.569842 0.093681 0.271408 0.318141 0.134289 0.315356 0.232215 0.362829 0.321661 0.134642 0.180868 Consensus sequence: CVHBSCGGGTGGTCMHVHHCDH Alignment: HDGHHBHRGACCACCCGSVDVG --------YGCCACCTDSTGGY ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00006 Zic3_primary Original Motif Original Motif Forward 1 14 0.028396 Species: Mus musculus Original motif 0.133123 0.374622 0.252864 0.239392 0.305344 0.451195 0.093638 0.149822 0.125347 0.723516 0.027695 0.123442 0.129457 0.754873 0.045215 0.070455 0.117681 0.809987 0.036742 0.035590 0.046565 0.817263 0.077300 0.058872 0.047132 0.790594 0.143506 0.018768 0.059681 0.087688 0.665195 0.187436 0.058872 0.077300 0.817263 0.046565 0.035590 0.036742 0.809987 0.117681 0.070455 0.045215 0.754873 0.129457 0.123442 0.027695 0.723516 0.125347 0.104029 0.069439 0.636026 0.190506 0.070968 0.197801 0.581172 0.150060 0.147077 0.235294 0.230097 0.387531 Consensus sequence: BMCCCCCGGGGGGGB Reverse complement motif 0.387531 0.235294 0.230097 0.147077 0.070968 0.581172 0.197801 0.150060 0.104029 0.636026 0.069439 0.190506 0.123442 0.723516 0.027695 0.125347 0.070455 0.754873 0.045215 0.129457 0.035590 0.809987 0.036742 0.117681 0.058872 0.817263 0.077300 0.046565 0.059681 0.665195 0.087688 0.187436 0.047132 0.143506 0.790594 0.018768 0.046565 0.077300 0.817263 0.058872 0.117681 0.036742 0.809987 0.035590 0.129457 0.045215 0.754873 0.070455 0.125347 0.027695 0.723516 0.123442 0.305344 0.093638 0.451195 0.149822 0.133123 0.252864 0.374622 0.239392 Consensus sequence: VCCCCCCCGGGGGRB Alignment: BMCCCCCGGGGGGGB YGCCACCTDSTGGY- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00102 Zic1_primary Original Motif Original Motif Forward 1 14 0.028786 Species: Mus musculus Original motif 0.174040 0.367918 0.270176 0.187866 0.359560 0.309872 0.111047 0.219520 0.094468 0.790352 0.026034 0.089145 0.114860 0.779490 0.050895 0.054755 0.105195 0.837712 0.031857 0.025237 0.045234 0.825039 0.073990 0.055737 0.145555 0.592986 0.228415 0.033044 0.045273 0.175001 0.607615 0.172111 0.055737 0.073990 0.825039 0.045234 0.025237 0.031857 0.837712 0.105195 0.054755 0.050895 0.779490 0.114860 0.089145 0.026034 0.790352 0.094468 0.060833 0.067787 0.717352 0.154028 0.097742 0.194545 0.591608 0.116104 Consensus sequence: BHCCCCCGGGGGGG Reverse complement motif 0.097742 0.591608 0.194545 0.116104 0.060833 0.717352 0.067787 0.154028 0.089145 0.790352 0.026034 0.094468 0.054755 0.779490 0.050895 0.114860 0.025237 0.837712 0.031857 0.105195 0.055737 0.825039 0.073990 0.045234 0.045273 0.607615 0.175001 0.172111 0.145555 0.228415 0.592986 0.033044 0.045234 0.073990 0.825039 0.055737 0.105195 0.031857 0.837712 0.025237 0.114860 0.050895 0.779490 0.054755 0.094468 0.026034 0.790352 0.089145 0.219520 0.309872 0.111047 0.359560 0.174040 0.270176 0.367918 0.187866 Consensus sequence: CCCCCCCGGGGGHB Alignment: BHCCCCCGGGGGGG YGCCACCTDSTGGY ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v015681_secondary Original Motif Original Motif Forward 8 14 0.028999 Species: Mus musculus Original motif 0.404007 0.395873 0.173319 0.026801 0.305977 0.215534 0.215359 0.263130 0.370148 0.250957 0.113088 0.265808 0.324336 0.229498 0.174679 0.271487 0.263563 0.137896 0.079217 0.519324 0.265762 0.222582 0.082555 0.429102 0.206721 0.288405 0.017851 0.487023 0.164361 0.236500 0.061051 0.538088 0.593344 0.348446 0.050304 0.007906 0.031328 0.947050 0.007032 0.014590 0.010428 0.956605 0.029142 0.003825 0.459636 0.207616 0.155368 0.177380 0.014573 0.964608 0.012209 0.008610 0.066291 0.918196 0.008729 0.006784 0.019488 0.866774 0.018897 0.094841 0.767405 0.104198 0.029234 0.099164 0.052494 0.772531 0.039832 0.135142 0.296085 0.243498 0.350935 0.109482 0.518843 0.226659 0.124784 0.129714 0.647901 0.019721 0.159901 0.172477 0.113912 0.231511 0.214864 0.439713 0.223117 0.310596 0.293328 0.172959 0.185557 0.487662 0.136321 0.190459 Consensus sequence: MHHHWHYTMCCHCCCACVAABVH Reverse complement motif 0.185557 0.136321 0.487662 0.190459 0.223117 0.293328 0.310596 0.172959 0.439713 0.231511 0.214864 0.113912 0.172477 0.019721 0.159901 0.647901 0.129714 0.226659 0.124784 0.518843 0.296085 0.350935 0.243498 0.109482 0.052494 0.039832 0.772531 0.135142 0.099164 0.104198 0.029234 0.767405 0.019488 0.018897 0.866774 0.094841 0.066291 0.008729 0.918196 0.006784 0.014573 0.012209 0.964608 0.008610 0.177380 0.207616 0.155368 0.459636 0.010428 0.029142 0.956605 0.003825 0.031328 0.007032 0.947050 0.014590 0.007906 0.348446 0.050304 0.593344 0.538088 0.236500 0.061051 0.164361 0.487023 0.288405 0.017851 0.206721 0.429102 0.222582 0.082555 0.265762 0.519324 0.137896 0.079217 0.263563 0.271487 0.229498 0.174679 0.324336 0.265808 0.250957 0.113088 0.370148 0.263130 0.215534 0.215359 0.305977 0.026801 0.395873 0.173319 0.404007 Consensus sequence: DVVTTVGTGGGHGGYAMHWHHHY Alignment: MHHHWHYTMCCHCCCACVAABVH -------YGCCACCTDSTGGY-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v016060_secondary Reverse Complement Reverse Complement Backward 7 14 0.029786 Species: Mus musculus Original motif 0.168550 0.345968 0.396524 0.088958 0.038113 0.360882 0.114042 0.486963 0.349356 0.180599 0.051416 0.418629 0.258773 0.332518 0.244932 0.163778 0.371663 0.208591 0.263136 0.156609 0.225440 0.321741 0.175932 0.276887 0.100827 0.656850 0.018644 0.223679 0.494140 0.155427 0.327424 0.023009 0.105642 0.805846 0.027712 0.060800 0.065110 0.845072 0.058046 0.031772 0.649343 0.110180 0.180680 0.059797 0.064269 0.853604 0.066860 0.015268 0.437421 0.533797 0.016833 0.011948 0.121694 0.787708 0.016177 0.074421 0.625382 0.066925 0.266070 0.041623 0.117819 0.608153 0.165139 0.108889 0.145639 0.102001 0.604926 0.147434 0.521188 0.184986 0.064607 0.229219 0.180371 0.274237 0.096591 0.448801 0.071055 0.455813 0.332817 0.140315 0.084503 0.199982 0.448293 0.267222 0.389451 0.169545 0.155507 0.285497 0.424314 0.227621 0.101210 0.246855 Consensus sequence: VYWVVHCRCCACMCACGAHSBHH Reverse complement motif 0.246855 0.227621 0.101210 0.424314 0.285497 0.169545 0.155507 0.389451 0.084503 0.448293 0.199982 0.267222 0.071055 0.332817 0.455813 0.140315 0.448801 0.274237 0.096591 0.180371 0.229219 0.184986 0.064607 0.521188 0.145639 0.604926 0.102001 0.147434 0.117819 0.165139 0.608153 0.108889 0.041623 0.066925 0.266070 0.625382 0.121694 0.016177 0.787708 0.074421 0.437421 0.016833 0.533797 0.011948 0.064269 0.066860 0.853604 0.015268 0.059797 0.110180 0.180680 0.649343 0.065110 0.058046 0.845072 0.031772 0.105642 0.027712 0.805846 0.060800 0.023009 0.155427 0.327424 0.494140 0.100827 0.018644 0.656850 0.223679 0.225440 0.175932 0.321741 0.276887 0.156609 0.208591 0.263136 0.371663 0.258773 0.244932 0.332518 0.163778 0.418629 0.180599 0.051416 0.349356 0.486963 0.360882 0.114042 0.038113 0.168550 0.396524 0.345968 0.088958 Consensus sequence: HHBSHTCGTGRGTGGKGDBVWMV Alignment: HHBSHTCGTGRGTGGKGDBVWMV ---KCCASDAGGTGGCK------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00057 Zic2_primary Original Motif Original Motif Forward 1 14 0.030218 Species: Mus musculus Original motif 0.171475 0.300729 0.275648 0.252148 0.274948 0.494479 0.090926 0.139646 0.136266 0.716563 0.033328 0.113843 0.116272 0.772964 0.046083 0.064680 0.103529 0.835329 0.032215 0.028927 0.057023 0.813129 0.071277 0.058571 0.057483 0.766273 0.157290 0.018955 0.071535 0.110226 0.631760 0.186479 0.058571 0.071277 0.813129 0.057023 0.028927 0.032215 0.835329 0.103529 0.064680 0.046083 0.772964 0.116272 0.113843 0.033328 0.716563 0.136266 0.119744 0.068294 0.609218 0.202743 0.065793 0.215443 0.562951 0.155813 0.178819 0.196535 0.205955 0.418691 Consensus sequence: BMCCCCCGGGGGGGB Reverse complement motif 0.418691 0.196535 0.205955 0.178819 0.065793 0.562951 0.215443 0.155813 0.119744 0.609218 0.068294 0.202743 0.113843 0.716563 0.033328 0.136266 0.064680 0.772964 0.046083 0.116272 0.028927 0.835329 0.032215 0.103529 0.058571 0.813129 0.071277 0.057023 0.071535 0.631760 0.110226 0.186479 0.057483 0.157290 0.766273 0.018955 0.057023 0.071277 0.813129 0.058571 0.103529 0.032215 0.835329 0.028927 0.116272 0.046083 0.772964 0.064680 0.136266 0.033328 0.716563 0.113843 0.274948 0.090926 0.494479 0.139646 0.171475 0.275648 0.300729 0.252148 Consensus sequence: VCCCCCCCGGGGGRB Alignment: BMCCCCCGGGGGGGB YGCCACCTDSTGGY- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 2 Motif ID: 48 Motif name: Motif 48 Original motif 0.023810 0.000000 0.976190 0.000000 0.238095 0.714286 0.000000 0.047619 0.952380 0.023810 0.000000 0.023810 0.380952 0.142857 0.452381 0.023810 0.523810 0.190476 0.285714 0.000000 0.095238 0.047619 0.619048 0.238095 0.000000 0.023810 0.904761 0.071429 0.000000 0.571429 0.428571 0.000000 0.976190 0.023810 0.000000 0.000000 0.333333 0.000000 0.666667 0.000000 0.000000 0.428571 0.571429 0.000000 Consensus sequence: GCARRGGSAGS Reserve complement motif 0.000000 0.571429 0.428571 0.000000 0.333333 0.666667 0.000000 0.000000 0.000000 0.023810 0.000000 0.976190 0.000000 0.428571 0.571429 0.000000 0.000000 0.904761 0.023810 0.071429 0.095238 0.619048 0.047619 0.238095 0.000000 0.190476 0.285714 0.523810 0.380952 0.452381 0.142857 0.023810 0.023810 0.023810 0.000000 0.952380 0.238095 0.000000 0.714286 0.047619 0.023810 0.976190 0.000000 0.000000 Consensus sequence: SCTSCCKMTGC ************************************************************************ Best Matches for Motif ID 48 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00153 Pitx1 Reverse Complement Reverse Complement Forward 7 11 0.045469 Species: Mus musculus Original motif 0.207371 0.246323 0.166934 0.379372 0.115831 0.171040 0.352289 0.360841 0.435857 0.190325 0.290547 0.083272 0.281154 0.147141 0.422767 0.148938 0.453996 0.050465 0.389240 0.106298 0.187631 0.043211 0.734974 0.034185 0.042788 0.001867 0.954016 0.001329 0.006032 0.001055 0.986493 0.006420 0.955163 0.042114 0.000355 0.002368 0.003755 0.004760 0.000754 0.990731 0.005515 0.009073 0.000267 0.985144 0.913280 0.000712 0.001035 0.084973 0.721584 0.024188 0.198396 0.055833 0.334868 0.490003 0.058252 0.116877 0.457303 0.071620 0.241947 0.229130 0.478355 0.207860 0.143752 0.170032 0.256961 0.248882 0.203598 0.290559 Consensus sequence: HBVDRGGGATTAAMDHH Reverse complement motif 0.290559 0.248882 0.203598 0.256961 0.170032 0.207860 0.143752 0.478355 0.229130 0.071620 0.241947 0.457303 0.334868 0.058252 0.490003 0.116877 0.055833 0.024188 0.198396 0.721584 0.084973 0.000712 0.001035 0.913280 0.985144 0.009073 0.000267 0.005515 0.990731 0.004760 0.000754 0.003755 0.002368 0.042114 0.000355 0.955163 0.006032 0.986493 0.001055 0.006420 0.042788 0.954016 0.001867 0.001329 0.187631 0.734974 0.043211 0.034185 0.106298 0.050465 0.389240 0.453996 0.281154 0.422767 0.147141 0.148938 0.083272 0.190325 0.290547 0.435857 0.360841 0.171040 0.352289 0.115831 0.379372 0.246323 0.166934 0.207371 Consensus sequence: HHDRTTAATCCCKHBVH Alignment: HHDRTTAATCCCKHBVH ------SCTSCCKMTGC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00085 Sfpi1_primary Original Motif Original Motif Backward 4 11 0.045822 Species: Mus musculus Original motif 0.211586 0.273653 0.234763 0.279998 0.298032 0.104818 0.290385 0.306764 0.593467 0.048056 0.154602 0.203875 0.459746 0.052697 0.169949 0.317608 0.188623 0.155357 0.591543 0.064477 0.402746 0.286227 0.290285 0.020742 0.048569 0.001240 0.946397 0.003793 0.004354 0.001387 0.990819 0.003441 0.974272 0.001416 0.001466 0.022847 0.938748 0.003090 0.000833 0.057329 0.045831 0.270321 0.674644 0.009204 0.055664 0.092552 0.026061 0.825722 0.301235 0.122653 0.267039 0.309073 0.278680 0.276099 0.219159 0.226061 Consensus sequence: BDAWGVGGAAGTDH Reverse complement motif 0.226061 0.276099 0.219159 0.278680 0.309073 0.122653 0.267039 0.301235 0.825722 0.092552 0.026061 0.055664 0.045831 0.674644 0.270321 0.009204 0.057329 0.003090 0.000833 0.938748 0.022847 0.001416 0.001466 0.974272 0.004354 0.990819 0.001387 0.003441 0.048569 0.946397 0.001240 0.003793 0.020742 0.286227 0.290285 0.402746 0.188623 0.591543 0.155357 0.064477 0.317608 0.052697 0.169949 0.459746 0.203875 0.048056 0.154602 0.593467 0.306764 0.104818 0.290385 0.298032 0.279998 0.273653 0.234763 0.211586 Consensus sequence: HDACTTCCBCWTDV Alignment: BDAWGVGGAAGTDH GCARRGGSAGS--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v016060_secondary Reverse Complement Original Motif Forward 8 11 0.046367 Species: Mus musculus Original motif 0.533199 0.080715 0.330435 0.055650 0.152031 0.212841 0.110234 0.524893 0.223934 0.264217 0.087037 0.424811 0.115097 0.339994 0.343861 0.201048 0.124993 0.418259 0.365642 0.091106 0.158365 0.292428 0.088361 0.460847 0.165479 0.561778 0.022254 0.250489 0.136873 0.259822 0.579763 0.023543 0.109570 0.747495 0.055128 0.087807 0.061912 0.792986 0.109031 0.036071 0.508703 0.267806 0.169766 0.053725 0.040912 0.838888 0.057470 0.062730 0.330554 0.606077 0.016192 0.047177 0.068079 0.563969 0.029742 0.338209 0.388799 0.291667 0.191284 0.128249 0.183283 0.578079 0.171100 0.067538 0.165163 0.097206 0.631377 0.106253 0.128564 0.435496 0.253275 0.182665 0.103395 0.088222 0.234758 0.573625 0.432879 0.276641 0.155895 0.134585 0.339199 0.148928 0.311036 0.200836 0.211958 0.298526 0.158443 0.331072 Consensus sequence: RTHBSYCGCCMCMYVCGBTVDH Reverse complement motif 0.331072 0.298526 0.158443 0.211958 0.200836 0.148928 0.311036 0.339199 0.134585 0.276641 0.155895 0.432879 0.573625 0.088222 0.234758 0.103395 0.128564 0.253275 0.435496 0.182665 0.165163 0.631377 0.097206 0.106253 0.183283 0.171100 0.578079 0.067538 0.128249 0.291667 0.191284 0.388799 0.068079 0.029742 0.563969 0.338209 0.330554 0.016192 0.606077 0.047177 0.040912 0.057470 0.838888 0.062730 0.053725 0.267806 0.169766 0.508703 0.061912 0.109031 0.792986 0.036071 0.109570 0.055128 0.747495 0.087807 0.136873 0.579763 0.259822 0.023543 0.165479 0.022254 0.561778 0.250489 0.460847 0.292428 0.088361 0.158365 0.124993 0.365642 0.418259 0.091106 0.115097 0.343861 0.339994 0.201048 0.424811 0.264217 0.087037 0.223934 0.524893 0.212841 0.110234 0.152031 0.055650 0.080715 0.330435 0.533199 Consensus sequence: HDBABCGBKRGYGGCGMSBHAK Alignment: RTHBSYCGCCMCMYVCGBTVDH -------SCTSCCKMTGC---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00400 Zif268 Reverse Complement Original Motif Forward 6 11 0.046586 Species: Mus musculus Original motif 0.104824 0.412716 0.254506 0.227955 0.644922 0.065476 0.140479 0.149122 0.201205 0.166164 0.347131 0.285501 0.360606 0.256316 0.150766 0.232313 0.199831 0.240681 0.279350 0.280137 0.234308 0.204076 0.321306 0.240310 0.274112 0.462435 0.111425 0.152028 0.067070 0.717501 0.073934 0.141496 0.106745 0.084442 0.658566 0.150247 0.025128 0.967053 0.003585 0.004234 0.006412 0.982989 0.003227 0.007371 0.009588 0.877620 0.002571 0.110221 0.621521 0.355443 0.015669 0.007366 0.002600 0.980275 0.004191 0.012934 0.118773 0.026658 0.783843 0.070725 0.022358 0.822101 0.024684 0.130857 0.713212 0.080912 0.128793 0.077084 0.166568 0.250955 0.107934 0.474544 0.225040 0.222494 0.163301 0.389166 0.268976 0.223206 0.265314 0.242504 0.137052 0.229058 0.148439 0.485451 0.135819 0.304550 0.141994 0.417637 0.272440 0.319501 0.230580 0.177478 Consensus sequence: BADHBDHCGCCCMCGCAHHDBBV Reverse complement motif 0.272440 0.230580 0.319501 0.177478 0.417637 0.304550 0.141994 0.135819 0.485451 0.229058 0.148439 0.137052 0.242504 0.223206 0.265314 0.268976 0.389166 0.222494 0.163301 0.225040 0.474544 0.250955 0.107934 0.166568 0.077084 0.080912 0.128793 0.713212 0.022358 0.024684 0.822101 0.130857 0.118773 0.783843 0.026658 0.070725 0.002600 0.004191 0.980275 0.012934 0.007366 0.355443 0.015669 0.621521 0.009588 0.002571 0.877620 0.110221 0.006412 0.003227 0.982989 0.007371 0.025128 0.003585 0.967053 0.004234 0.106745 0.658566 0.084442 0.150247 0.067070 0.073934 0.717501 0.141496 0.274112 0.111425 0.462435 0.152028 0.234308 0.321306 0.204076 0.240310 0.280137 0.240681 0.279350 0.199831 0.232313 0.256316 0.150766 0.360606 0.201205 0.347131 0.166164 0.285501 0.149122 0.065476 0.140479 0.644922 0.104824 0.254506 0.412716 0.227955 Consensus sequence: VVVDHHTGCGYGGGCGDHVHHTB Alignment: BADHBDHCGCCCMCGCAHHDBBV -----SCTSCCKMTGC------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00099 Ascl2_primary Reverse Complement Original Motif Backward 6 11 0.047335 Species: Mus musculus Original motif 0.168852 0.325948 0.188604 0.316596 0.150343 0.193286 0.241301 0.415069 0.091518 0.482905 0.122928 0.302648 0.472493 0.198776 0.225796 0.102935 0.294513 0.179919 0.447250 0.078318 0.014660 0.972080 0.005591 0.007668 0.954848 0.008107 0.008474 0.028571 0.006076 0.178912 0.760021 0.054991 0.052082 0.817415 0.124797 0.005707 0.019342 0.010406 0.008905 0.961347 0.005455 0.008073 0.977684 0.008788 0.042946 0.715551 0.087020 0.154483 0.116888 0.241739 0.170073 0.471300 0.315931 0.324343 0.291451 0.068274 0.199164 0.366921 0.163690 0.270226 0.218561 0.211076 0.187732 0.382631 0.145317 0.139808 0.389262 0.325614 Consensus sequence: BBYVVCAGCTGCBVHHD Reverse complement motif 0.145317 0.389262 0.139808 0.325614 0.382631 0.211076 0.187732 0.218561 0.199164 0.163690 0.366921 0.270226 0.315931 0.291451 0.324343 0.068274 0.471300 0.241739 0.170073 0.116888 0.042946 0.087020 0.715551 0.154483 0.005455 0.977684 0.008073 0.008788 0.961347 0.010406 0.008905 0.019342 0.052082 0.124797 0.817415 0.005707 0.006076 0.760021 0.178912 0.054991 0.028571 0.008107 0.008474 0.954848 0.014660 0.005591 0.972080 0.007668 0.294513 0.447250 0.179919 0.078318 0.102935 0.198776 0.225796 0.472493 0.091518 0.122928 0.482905 0.302648 0.415069 0.193286 0.241301 0.150343 0.168852 0.188604 0.325948 0.316596 Consensus sequence: HHDVVGCAGCTGVBKVB Alignment: BBYVVCAGCTGCBVHHD -SCTSCCKMTGC----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00527 Foxn4_secondary Reverse Complement Reverse Complement Backward 11 11 0.048713 Species: Mus musculus Original motif 0.298336 0.418632 0.208054 0.074978 0.289907 0.015608 0.457100 0.237385 0.273583 0.077889 0.107860 0.540668 0.184954 0.161611 0.384390 0.269045 0.521826 0.156340 0.089019 0.232815 0.356716 0.131104 0.394857 0.117323 0.266669 0.108765 0.505273 0.119293 0.020778 0.047199 0.919524 0.012500 0.948536 0.018775 0.008113 0.024576 0.010822 0.964042 0.014701 0.010434 0.007428 0.019505 0.966351 0.006717 0.010025 0.975678 0.008648 0.005649 0.043796 0.120935 0.742979 0.092289 0.008252 0.250704 0.541132 0.199913 0.474428 0.044681 0.134430 0.346461 0.146597 0.421317 0.143166 0.288920 0.020540 0.181479 0.553811 0.244170 0.129612 0.173360 0.535219 0.161808 0.506084 0.158156 0.130983 0.204776 0.054872 0.103043 0.545792 0.296293 0.389882 0.171037 0.164162 0.274918 0.225861 0.314031 0.288872 0.171237 Consensus sequence: VDWDARRGACGCGGWHGGAKHV Reverse complement motif 0.225861 0.288872 0.314031 0.171237 0.274918 0.171037 0.164162 0.389882 0.054872 0.545792 0.103043 0.296293 0.204776 0.158156 0.130983 0.506084 0.129612 0.535219 0.173360 0.161808 0.020540 0.553811 0.181479 0.244170 0.146597 0.143166 0.421317 0.288920 0.346461 0.044681 0.134430 0.474428 0.008252 0.541132 0.250704 0.199913 0.043796 0.742979 0.120935 0.092289 0.010025 0.008648 0.975678 0.005649 0.007428 0.966351 0.019505 0.006717 0.010822 0.014701 0.964042 0.010434 0.024576 0.018775 0.008113 0.948536 0.020778 0.919524 0.047199 0.012500 0.266669 0.505273 0.108765 0.119293 0.356716 0.394857 0.131104 0.117323 0.232815 0.156340 0.089019 0.521826 0.184954 0.384390 0.161611 0.269045 0.540668 0.077889 0.107860 0.273583 0.289907 0.457100 0.015608 0.237385 0.298336 0.208054 0.418632 0.074978 Consensus sequence: VHYTCCDWCCGCGTCMMTHWHV Alignment: VHYTCCDWCCGCGTCMMTHWHV -SCTSCCKMTGC---------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00010 Tcfap2b_secondary Original Motif Reverse Complement Backward 1 11 0.049762 Species: Mus musculus Original motif 0.325895 0.099601 0.286848 0.287657 0.177095 0.035123 0.260876 0.526906 0.344850 0.211117 0.015725 0.428308 0.128363 0.059965 0.777560 0.034112 0.048072 0.881624 0.024842 0.045462 0.072628 0.872650 0.011271 0.043451 0.057165 0.162157 0.347719 0.432959 0.015437 0.448405 0.428425 0.107733 0.446877 0.336374 0.099940 0.116809 0.090955 0.023004 0.848240 0.037801 0.040151 0.015072 0.901303 0.043473 0.087378 0.817019 0.027876 0.067727 0.532482 0.021469 0.266773 0.179276 0.325017 0.271661 0.138860 0.264463 0.203625 0.179490 0.143885 0.473001 Consensus sequence: DTWGCCKSMGGCRHH Reverse complement motif 0.473001 0.179490 0.143885 0.203625 0.264463 0.271661 0.138860 0.325017 0.179276 0.021469 0.266773 0.532482 0.087378 0.027876 0.817019 0.067727 0.040151 0.901303 0.015072 0.043473 0.090955 0.848240 0.023004 0.037801 0.116809 0.336374 0.099940 0.446877 0.015437 0.428425 0.448405 0.107733 0.432959 0.162157 0.347719 0.057165 0.072628 0.011271 0.872650 0.043451 0.048072 0.024842 0.881624 0.045462 0.128363 0.777560 0.059965 0.034112 0.428308 0.211117 0.015725 0.344850 0.526906 0.035123 0.260876 0.177095 0.287657 0.099601 0.286848 0.325895 Consensus sequence: HHKGCCYSRGGCWAD Alignment: HHKGCCYSRGGCWAD ----GCARRGGSAGS ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v015681_secondary Reverse Complement Reverse Complement Backward 1 11 0.050755 Species: Mus musculus Original motif 0.331499 0.188505 0.182841 0.297156 0.328961 0.213025 0.273530 0.184484 0.197213 0.129292 0.524914 0.148581 0.274491 0.226406 0.312118 0.186986 0.103231 0.393726 0.364988 0.138055 0.552594 0.166422 0.186262 0.094722 0.157618 0.064773 0.616497 0.161112 0.139166 0.176098 0.621185 0.063551 0.748420 0.062398 0.012447 0.176735 0.116584 0.009438 0.860326 0.013653 0.005030 0.003646 0.974877 0.016447 0.055257 0.007181 0.921760 0.015802 0.032748 0.058249 0.052709 0.856293 0.105606 0.872231 0.014370 0.007793 0.019480 0.497379 0.125899 0.357242 0.478582 0.269713 0.061464 0.190242 0.253985 0.287006 0.201320 0.257689 0.319384 0.210231 0.175842 0.294543 0.222123 0.287802 0.201294 0.288782 0.139951 0.376041 0.081133 0.402875 0.213450 0.343835 0.383676 0.059039 0.322294 0.355918 0.148062 0.173725 Consensus sequence: HVGVSAGGAGGGTCYHHHHYVH Reverse complement motif 0.322294 0.148062 0.355918 0.173725 0.213450 0.383676 0.343835 0.059039 0.402875 0.376041 0.081133 0.139951 0.288782 0.287802 0.201294 0.222123 0.294543 0.210231 0.175842 0.319384 0.253985 0.201320 0.287006 0.257689 0.190242 0.269713 0.061464 0.478582 0.019480 0.125899 0.497379 0.357242 0.105606 0.014370 0.872231 0.007793 0.856293 0.058249 0.052709 0.032748 0.055257 0.921760 0.007181 0.015802 0.005030 0.974877 0.003646 0.016447 0.116584 0.860326 0.009438 0.013653 0.176735 0.062398 0.012447 0.748420 0.139166 0.621185 0.176098 0.063551 0.157618 0.616497 0.064773 0.161112 0.094722 0.166422 0.186262 0.552594 0.103231 0.364988 0.393726 0.138055 0.274491 0.312118 0.226406 0.186986 0.197213 0.524914 0.129292 0.148581 0.184484 0.213025 0.273530 0.328961 0.297156 0.188505 0.182841 0.331499 Consensus sequence: DVMHHDHKGACCCTCCTSVCBH Alignment: DVMHHDHKGACCCTCCTSVCBH -----------SCTSCCKMTGC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00055 Hbp1_secondary Original Motif Reverse Complement Backward 2 11 0.050865 Species: Mus musculus Original motif 0.313621 0.149049 0.200899 0.336432 0.262644 0.147616 0.334882 0.254859 0.175848 0.137857 0.292272 0.394023 0.045910 0.364107 0.180535 0.409448 0.093235 0.718630 0.093516 0.094619 0.095552 0.724866 0.044589 0.134993 0.058227 0.785149 0.029814 0.126810 0.897368 0.023735 0.019064 0.059832 0.043826 0.041750 0.020731 0.893692 0.044268 0.013557 0.014689 0.927487 0.102208 0.026005 0.709573 0.162214 0.058404 0.046118 0.135257 0.760221 0.303689 0.280676 0.320259 0.095375 0.258633 0.262177 0.197029 0.282161 0.564761 0.122466 0.194691 0.118082 0.104738 0.358061 0.310533 0.226668 0.267450 0.230099 0.197859 0.304593 Consensus sequence: DDDYCCCATTGTVHABH Reverse complement motif 0.304593 0.230099 0.197859 0.267450 0.104738 0.310533 0.358061 0.226668 0.118082 0.122466 0.194691 0.564761 0.282161 0.262177 0.197029 0.258633 0.303689 0.320259 0.280676 0.095375 0.760221 0.046118 0.135257 0.058404 0.102208 0.709573 0.026005 0.162214 0.927487 0.013557 0.014689 0.044268 0.893692 0.041750 0.020731 0.043826 0.059832 0.023735 0.019064 0.897368 0.058227 0.029814 0.785149 0.126810 0.095552 0.044589 0.724866 0.134993 0.093235 0.093516 0.718630 0.094619 0.409448 0.364107 0.180535 0.045910 0.394023 0.137857 0.292272 0.175848 0.262644 0.334882 0.147616 0.254859 0.336432 0.149049 0.200899 0.313621 Consensus sequence: HBTHVACAATGGGMDHD Alignment: HBTHVACAATGGGMDHD -----GCARRGGSAGS- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00005 Tcfap2a_primary Original Motif Original Motif Backward 1 11 0.051294 Species: Mus musculus Original motif 0.422613 0.103833 0.119614 0.353939 0.249412 0.169205 0.202313 0.379071 0.229443 0.231233 0.068690 0.470634 0.013814 0.501744 0.463635 0.020806 0.006744 0.985507 0.003252 0.004497 0.001758 0.859562 0.001396 0.137285 0.005460 0.315890 0.186790 0.491861 0.040326 0.375312 0.497433 0.086929 0.491861 0.186790 0.315890 0.005460 0.137285 0.001396 0.859562 0.001758 0.004497 0.003252 0.985507 0.006744 0.020806 0.463635 0.501744 0.013814 0.348377 0.094358 0.419593 0.137673 0.559411 0.134625 0.133295 0.172668 0.331903 0.197670 0.240404 0.230023 Consensus sequence: WDHSCCYSRGGSRAD Reverse complement motif 0.230023 0.197670 0.240404 0.331903 0.172668 0.134625 0.133295 0.559411 0.348377 0.419593 0.094358 0.137673 0.020806 0.501744 0.463635 0.013814 0.004497 0.985507 0.003252 0.006744 0.137285 0.859562 0.001396 0.001758 0.005460 0.186790 0.315890 0.491861 0.040326 0.497433 0.375312 0.086929 0.491861 0.315890 0.186790 0.005460 0.001758 0.001396 0.859562 0.137285 0.006744 0.003252 0.985507 0.004497 0.013814 0.463635 0.501744 0.020806 0.470634 0.231233 0.068690 0.229443 0.379071 0.169205 0.202313 0.249412 0.353939 0.103833 0.119614 0.422613 Consensus sequence: DTMSCCKSMGGSHDW Alignment: WDHSCCYSRGGSRAD ----GCARRGGSAGS ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 2 Motif ID: 49 Motif name: Motif 49 Original motif 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 Consensus sequence: AAAAAAAAAAAAAT Reserve complement motif 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 Consensus sequence: ATTTTTTTTTTTTT ************************************************************************ Best Matches for Motif ID 49 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00037 Zfp105_primary Reverse Complement Reverse Complement Backward 2 14 0.036174 Species: Mus musculus Original motif 0.363104 0.182807 0.145232 0.308856 0.419707 0.133742 0.222546 0.224005 0.164481 0.418263 0.052397 0.364858 0.715575 0.117639 0.064914 0.101872 0.883836 0.026985 0.032584 0.056596 0.558797 0.151280 0.033120 0.256803 0.267037 0.403488 0.026746 0.302729 0.939762 0.013627 0.034579 0.012032 0.897072 0.009878 0.035642 0.057408 0.305904 0.516040 0.055311 0.122746 0.880940 0.027958 0.048350 0.042752 0.710082 0.052464 0.040250 0.197204 0.246712 0.125155 0.318627 0.309506 0.429749 0.181755 0.176892 0.211603 0.339643 0.097216 0.355250 0.207891 Consensus sequence: HDYAAAHAAMAADHD Reverse complement motif 0.339643 0.355250 0.097216 0.207891 0.211603 0.181755 0.176892 0.429749 0.246712 0.318627 0.125155 0.309506 0.197204 0.052464 0.040250 0.710082 0.042752 0.027958 0.048350 0.880940 0.305904 0.055311 0.516040 0.122746 0.057408 0.009878 0.035642 0.897072 0.012032 0.013627 0.034579 0.939762 0.267037 0.026746 0.403488 0.302729 0.256803 0.151280 0.033120 0.558797 0.056596 0.026985 0.032584 0.883836 0.101872 0.117639 0.064914 0.715575 0.164481 0.052397 0.418263 0.364858 0.224005 0.133742 0.222546 0.419707 0.308856 0.182807 0.145232 0.363104 Consensus sequence: HHHTTRTTDTTTKDH Alignment: HHHTTRTTDTTTKDH ATTTTTTTTTTTTT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00061 Foxl1_primary Original Motif Original Motif Forward 2 14 0.039144 Species: Mus musculus Original motif 0.323208 0.152915 0.185111 0.338766 0.428132 0.056109 0.099487 0.416272 0.659386 0.039965 0.035805 0.264843 0.647143 0.049206 0.078984 0.224667 0.208834 0.076592 0.071631 0.642943 0.341077 0.003865 0.649511 0.005547 0.016627 0.001866 0.001715 0.979792 0.952319 0.045294 0.000870 0.001516 0.988834 0.004620 0.000720 0.005826 0.989346 0.001005 0.006467 0.003182 0.001093 0.784230 0.001235 0.213442 0.991209 0.002017 0.001737 0.005037 0.801581 0.037084 0.023060 0.138274 0.528554 0.089350 0.107501 0.274595 0.208802 0.268646 0.368022 0.154530 0.280218 0.221367 0.340497 0.157918 0.146611 0.250725 0.293524 0.309140 Consensus sequence: DWAATRTAAACAAWVVB Reverse complement motif 0.309140 0.250725 0.293524 0.146611 0.280218 0.340497 0.221367 0.157918 0.208802 0.368022 0.268646 0.154530 0.274595 0.089350 0.107501 0.528554 0.138274 0.037084 0.023060 0.801581 0.005037 0.002017 0.001737 0.991209 0.001093 0.001235 0.784230 0.213442 0.003182 0.001005 0.006467 0.989346 0.005826 0.004620 0.000720 0.988834 0.001516 0.045294 0.000870 0.952319 0.979792 0.001866 0.001715 0.016627 0.341077 0.649511 0.003865 0.005547 0.642943 0.076592 0.071631 0.208834 0.224667 0.049206 0.078984 0.647143 0.264843 0.039965 0.035805 0.659386 0.416272 0.056109 0.099487 0.428132 0.338766 0.152915 0.185111 0.323208 Consensus sequence: VVVWTTGTTTAMATTWD Alignment: DWAATRTAAACAAWVVB -AAAAAAAAAAAAAT-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00077 Srf_secondary Original Motif Original Motif Forward 3 14 0.041604 Species: Mus musculus Original motif 0.162968 0.284828 0.440984 0.111220 0.151392 0.200635 0.205316 0.442657 0.267215 0.083669 0.192498 0.456618 0.332771 0.180711 0.200027 0.286491 0.509370 0.102954 0.242569 0.145107 0.666262 0.077309 0.154466 0.101962 0.737968 0.113335 0.100401 0.048296 0.658878 0.141580 0.134033 0.065510 0.766115 0.094051 0.069763 0.070072 0.755621 0.088491 0.044802 0.111086 0.749083 0.135917 0.047510 0.067490 0.663231 0.176795 0.028134 0.131839 0.553358 0.277659 0.038655 0.130328 0.392578 0.314083 0.209844 0.083495 0.198462 0.237132 0.239466 0.324940 0.275121 0.210087 0.194779 0.320013 0.287748 0.277395 0.142704 0.292154 Consensus sequence: VBDDAAAAAAAAMVBHH Reverse complement motif 0.292154 0.277395 0.142704 0.287748 0.320013 0.210087 0.194779 0.275121 0.324940 0.237132 0.239466 0.198462 0.083495 0.314083 0.209844 0.392578 0.130328 0.277659 0.038655 0.553358 0.131839 0.176795 0.028134 0.663231 0.067490 0.135917 0.047510 0.749083 0.111086 0.088491 0.044802 0.755621 0.070072 0.094051 0.069763 0.766115 0.065510 0.141580 0.134033 0.658878 0.048296 0.113335 0.100401 0.737968 0.101962 0.077309 0.154466 0.666262 0.145107 0.102954 0.242569 0.509370 0.286491 0.180711 0.200027 0.332771 0.456618 0.083669 0.192498 0.267215 0.442657 0.200635 0.205316 0.151392 0.162968 0.440984 0.284828 0.111220 Consensus sequence: HHVBYTTTTTTTTDDVV Alignment: VBDDAAAAAAAAMVBHH --AAAAAAAAAAAAAT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00073 Foxa2_primary Reverse Complement Reverse Complement Forward 3 14 0.042087 Species: Mus musculus Original motif 0.335487 0.205062 0.128957 0.330494 0.411635 0.179625 0.175701 0.233038 0.412976 0.128602 0.091890 0.366532 0.608396 0.079002 0.107142 0.205460 0.433474 0.035203 0.153143 0.378180 0.087552 0.005003 0.894586 0.012858 0.004459 0.038951 0.001109 0.955481 0.924470 0.068560 0.001165 0.005805 0.920483 0.070039 0.001674 0.007805 0.988335 0.001902 0.003155 0.006608 0.001527 0.656726 0.002699 0.339047 0.987505 0.001810 0.004336 0.006349 0.719584 0.065184 0.050384 0.164848 0.535389 0.099997 0.102849 0.261764 0.245215 0.272017 0.301499 0.181269 0.306107 0.209040 0.248687 0.236166 0.223744 0.278668 0.251931 0.245657 Consensus sequence: HHWAWGTAAAYAAAVDB Reverse complement motif 0.223744 0.251931 0.278668 0.245657 0.236166 0.209040 0.248687 0.306107 0.245215 0.301499 0.272017 0.181269 0.261764 0.099997 0.102849 0.535389 0.164848 0.065184 0.050384 0.719584 0.006349 0.001810 0.004336 0.987505 0.001527 0.002699 0.656726 0.339047 0.006608 0.001902 0.003155 0.988335 0.007805 0.070039 0.001674 0.920483 0.005805 0.068560 0.001165 0.924470 0.955481 0.038951 0.001109 0.004459 0.087552 0.894586 0.005003 0.012858 0.378180 0.035203 0.153143 0.433474 0.205460 0.079002 0.107142 0.608396 0.366532 0.128602 0.091890 0.412976 0.233038 0.179625 0.175701 0.411635 0.330494 0.205062 0.128957 0.335487 Consensus sequence: BDVTTTKTTTACWTWHH Alignment: BDVTTTKTTTACWTWHH --ATTTTTTTTTTTTT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00180 Hoxd13 Reverse Complement Reverse Complement Forward 3 14 0.042413 Species: Mus musculus Original motif 0.279189 0.316791 0.190404 0.213616 0.297705 0.175638 0.191020 0.335637 0.333485 0.203858 0.174034 0.288623 0.046444 0.540349 0.083237 0.329969 0.016780 0.648667 0.003870 0.330682 0.679959 0.116873 0.002745 0.200422 0.936496 0.002013 0.026876 0.034615 0.004741 0.008734 0.003861 0.982665 0.904624 0.000869 0.005345 0.089162 0.967883 0.002295 0.001003 0.028819 0.980087 0.004768 0.002887 0.012258 0.898523 0.041633 0.022776 0.037069 0.246903 0.292446 0.069240 0.391411 0.192528 0.300908 0.105655 0.400908 0.247610 0.343317 0.190760 0.218313 0.246702 0.253595 0.176298 0.323404 Consensus sequence: HDHYYAATAAAAHHHH Reverse complement motif 0.323404 0.253595 0.176298 0.246702 0.247610 0.190760 0.343317 0.218313 0.400908 0.300908 0.105655 0.192528 0.391411 0.292446 0.069240 0.246903 0.037069 0.041633 0.022776 0.898523 0.012258 0.004768 0.002887 0.980087 0.028819 0.002295 0.001003 0.967883 0.089162 0.000869 0.005345 0.904624 0.982665 0.008734 0.003861 0.004741 0.034615 0.002013 0.026876 0.936496 0.200422 0.116873 0.002745 0.679959 0.016780 0.003870 0.648667 0.330682 0.046444 0.083237 0.540349 0.329969 0.288623 0.203858 0.174034 0.333485 0.335637 0.175638 0.191020 0.297705 0.279189 0.190404 0.316791 0.213616 Consensus sequence: HDHHTTTTATTKKHDD Alignment: HDHHTTTTATTKKHDD --ATTTTTTTTTTTTT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00061 Foxl1_secondary Reverse Complement Reverse Complement Backward 2 14 0.042467 Species: Mus musculus Original motif 0.560226 0.121586 0.083231 0.234957 0.318077 0.149137 0.179955 0.352831 0.482497 0.118420 0.173594 0.225488 0.200166 0.160901 0.191493 0.447440 0.033691 0.569719 0.018901 0.377690 0.638020 0.166545 0.021254 0.174181 0.573953 0.105729 0.009308 0.311010 0.890518 0.053364 0.013424 0.042694 0.910758 0.028166 0.032648 0.028428 0.013358 0.738707 0.023981 0.223953 0.911783 0.018754 0.031898 0.037564 0.702891 0.068940 0.076823 0.151346 0.445507 0.320769 0.057216 0.176507 0.587798 0.129586 0.140592 0.142024 0.258981 0.330939 0.167334 0.242747 0.362022 0.333796 0.145861 0.158320 Consensus sequence: ADDDYAWAACAAMAHH Reverse complement motif 0.158320 0.333796 0.145861 0.362022 0.258981 0.167334 0.330939 0.242747 0.142024 0.129586 0.140592 0.587798 0.176507 0.320769 0.057216 0.445507 0.151346 0.068940 0.076823 0.702891 0.037564 0.018754 0.031898 0.911783 0.013358 0.023981 0.738707 0.223953 0.028428 0.028166 0.032648 0.910758 0.042694 0.053364 0.013424 0.890518 0.311010 0.105729 0.009308 0.573953 0.174181 0.166545 0.021254 0.638020 0.033691 0.018901 0.569719 0.377690 0.447440 0.160901 0.191493 0.200166 0.225488 0.118420 0.173594 0.482497 0.352831 0.149137 0.179955 0.318077 0.234957 0.121586 0.083231 0.560226 Consensus sequence: HDTYTTGTTWTKDDDT Alignment: HDTYTTGTTWTKDDDT -ATTTTTTTTTTTTT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00025 Foxk1_primary Reverse Complement Reverse Complement Forward 3 14 0.043061 Species: Mus musculus Original motif 0.338172 0.192194 0.207817 0.261817 0.407924 0.117261 0.278236 0.196580 0.595570 0.070480 0.119221 0.214729 0.710845 0.038748 0.052600 0.197807 0.124647 0.116138 0.178053 0.581162 0.201602 0.005514 0.792110 0.000774 0.024590 0.004193 0.001331 0.969886 0.919465 0.077871 0.000760 0.001904 0.972342 0.010395 0.000580 0.016683 0.991045 0.001495 0.003585 0.003875 0.001358 0.885197 0.000980 0.112465 0.990318 0.001846 0.002968 0.004867 0.804563 0.063147 0.023496 0.108795 0.564824 0.087976 0.102865 0.244336 0.269947 0.300278 0.285008 0.144767 0.337905 0.220102 0.253694 0.188299 0.153781 0.274135 0.318343 0.253741 Consensus sequence: DDAATGTAAACAAAVVB Reverse complement motif 0.153781 0.318343 0.274135 0.253741 0.188299 0.220102 0.253694 0.337905 0.269947 0.285008 0.300278 0.144767 0.244336 0.087976 0.102865 0.564824 0.108795 0.063147 0.023496 0.804563 0.004867 0.001846 0.002968 0.990318 0.001358 0.000980 0.885197 0.112465 0.003875 0.001495 0.003585 0.991045 0.016683 0.010395 0.000580 0.972342 0.001904 0.077871 0.000760 0.919465 0.969886 0.004193 0.001331 0.024590 0.201602 0.792110 0.005514 0.000774 0.581162 0.116138 0.178053 0.124647 0.197807 0.038748 0.052600 0.710845 0.214729 0.070480 0.119221 0.595570 0.196580 0.117261 0.278236 0.407924 0.261817 0.192194 0.207817 0.338172 Consensus sequence: BBVTTTGTTTACATTDD Alignment: BBVTTTGTTTACATTDD --ATTTTTTTTTTTTT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00134 Hoxb13 Reverse Complement Reverse Complement Backward 1 14 0.043554 Species: Mus musculus Original motif 0.376100 0.272625 0.202253 0.149021 0.479072 0.116315 0.274952 0.129661 0.297412 0.328646 0.182054 0.191889 0.052067 0.771717 0.088083 0.088133 0.018222 0.666056 0.006952 0.308770 0.755568 0.122362 0.001339 0.120731 0.915413 0.001023 0.052340 0.031225 0.002612 0.028396 0.000695 0.968297 0.831092 0.001851 0.005615 0.161442 0.927869 0.001839 0.001169 0.069123 0.967747 0.009603 0.002871 0.019778 0.843186 0.073812 0.055868 0.027134 0.371084 0.143031 0.086222 0.399662 0.264976 0.212885 0.118960 0.403179 0.215633 0.345186 0.105518 0.333663 0.221910 0.297212 0.329310 0.151568 Consensus sequence: VRHCCAATAAAAWHHV Reverse complement motif 0.221910 0.329310 0.297212 0.151568 0.215633 0.105518 0.345186 0.333663 0.403179 0.212885 0.118960 0.264976 0.399662 0.143031 0.086222 0.371084 0.027134 0.073812 0.055868 0.843186 0.019778 0.009603 0.002871 0.967747 0.069123 0.001839 0.001169 0.927869 0.161442 0.001851 0.005615 0.831092 0.968297 0.028396 0.000695 0.002612 0.031225 0.001023 0.052340 0.915413 0.120731 0.122362 0.001339 0.755568 0.018222 0.006952 0.666056 0.308770 0.052067 0.088083 0.771717 0.088133 0.297412 0.182054 0.328646 0.191889 0.129661 0.116315 0.274952 0.479072 0.149021 0.272625 0.202253 0.376100 Consensus sequence: VDHWTTTTATTGGDKB Alignment: VDHWTTTTATTGGDKB --ATTTTTTTTTTTTT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00025 Foxk1_secondary Reverse Complement Reverse Complement Forward 1 14 0.043907 Species: Mus musculus Original motif 0.240753 0.425595 0.141281 0.192371 0.367715 0.247224 0.117353 0.267708 0.489169 0.220343 0.113844 0.176644 0.742256 0.042809 0.146704 0.068231 0.078936 0.546144 0.032328 0.342592 0.588419 0.293580 0.082117 0.035885 0.913924 0.026256 0.050778 0.009042 0.009007 0.565680 0.010683 0.414630 0.947562 0.020878 0.018821 0.012739 0.901384 0.021519 0.030204 0.046893 0.077157 0.797900 0.026432 0.098511 0.824314 0.040128 0.051910 0.083648 0.254436 0.342235 0.143789 0.259539 0.319400 0.338163 0.129746 0.212691 0.231014 0.260719 0.169042 0.339225 Consensus sequence: HHHAYAAYAACAHHH Reverse complement motif 0.339225 0.260719 0.169042 0.231014 0.319400 0.129746 0.338163 0.212691 0.254436 0.143789 0.342235 0.259539 0.083648 0.040128 0.051910 0.824314 0.077157 0.026432 0.797900 0.098511 0.046893 0.021519 0.030204 0.901384 0.012739 0.020878 0.018821 0.947562 0.009007 0.010683 0.565680 0.414630 0.009042 0.026256 0.050778 0.913924 0.035885 0.293580 0.082117 0.588419 0.078936 0.032328 0.546144 0.342592 0.068231 0.042809 0.146704 0.742256 0.176644 0.220343 0.113844 0.489169 0.267708 0.247224 0.117353 0.367715 0.240753 0.141281 0.425595 0.192371 Consensus sequence: HDDTGTTKTTKTHHD Alignment: HDDTGTTKTTKTHHD ATTTTTTTTTTTTT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00039 Foxj3_primary Original Motif Original Motif Backward 3 14 0.045165 Species: Mus musculus Original motif 0.273456 0.257473 0.208488 0.260583 0.338566 0.133379 0.306363 0.221693 0.475488 0.192852 0.156858 0.174803 0.506619 0.132646 0.170373 0.190362 0.349042 0.127275 0.325924 0.197759 0.303850 0.013619 0.678034 0.004497 0.014136 0.015691 0.003073 0.967100 0.913373 0.082928 0.001910 0.001789 0.956294 0.017745 0.000584 0.025378 0.987796 0.001685 0.004159 0.006360 0.002288 0.814764 0.001427 0.181521 0.986707 0.002688 0.003346 0.007259 0.787378 0.065481 0.057961 0.089180 0.572982 0.089910 0.066184 0.270924 0.224167 0.339979 0.258886 0.176968 0.268414 0.272007 0.239541 0.220038 0.241771 0.394748 0.174273 0.189208 Consensus sequence: HDHADGTAAACAAAVVH Reverse complement motif 0.241771 0.174273 0.394748 0.189208 0.268414 0.239541 0.272007 0.220038 0.224167 0.258886 0.339979 0.176968 0.270924 0.089910 0.066184 0.572982 0.089180 0.065481 0.057961 0.787378 0.007259 0.002688 0.003346 0.986707 0.002288 0.001427 0.814764 0.181521 0.006360 0.001685 0.004159 0.987796 0.025378 0.017745 0.000584 0.956294 0.001789 0.082928 0.001910 0.913373 0.967100 0.015691 0.003073 0.014136 0.303850 0.678034 0.013619 0.004497 0.197759 0.127275 0.325924 0.349042 0.190362 0.132646 0.170373 0.506619 0.174803 0.192852 0.156858 0.475488 0.221693 0.133379 0.306363 0.338566 0.260583 0.257473 0.208488 0.273456 Consensus sequence: DVVTTTGTTTACDTHDH Alignment: HDHADGTAAACAAAVVH -AAAAAAAAAAAAAT-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 2 Motif ID: 50 Motif name: Motif 50 Original motif 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.625000 0.375000 0.000000 0.000000 Consensus sequence: GGAAM Reserve complement motif 0.000000 0.375000 0.000000 0.625000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 Consensus sequence: YTTCC ************************************************************************ Best Matches for Motif ID 50 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00424 Gm4881 Original Motif Reverse Complement Backward 6 5 0.000000 Species: Mus musculus Original motif 0.329653 0.202372 0.295939 0.172036 0.115902 0.257124 0.275681 0.351293 0.166218 0.287124 0.323101 0.223557 0.362654 0.226006 0.172880 0.238460 0.763083 0.011021 0.209049 0.016847 0.002627 0.453407 0.008750 0.535216 0.114520 0.002235 0.003479 0.879767 0.008768 0.002063 0.001821 0.987348 0.002319 0.990917 0.003213 0.003552 0.002458 0.990806 0.002092 0.004645 0.002211 0.005454 0.950960 0.041374 0.055418 0.054277 0.859284 0.031021 0.116069 0.088611 0.037729 0.757591 0.342397 0.173151 0.180376 0.304077 0.246785 0.140058 0.440199 0.172957 0.287474 0.183857 0.212951 0.315718 Consensus sequence: VBBHAYTTCCGGTDDD Reverse complement motif 0.315718 0.183857 0.212951 0.287474 0.246785 0.440199 0.140058 0.172957 0.304077 0.173151 0.180376 0.342397 0.757591 0.088611 0.037729 0.116069 0.055418 0.859284 0.054277 0.031021 0.002211 0.950960 0.005454 0.041374 0.002458 0.002092 0.990806 0.004645 0.002319 0.003213 0.990917 0.003552 0.987348 0.002063 0.001821 0.008768 0.879767 0.002235 0.003479 0.114520 0.535216 0.453407 0.008750 0.002627 0.016847 0.011021 0.209049 0.763083 0.238460 0.226006 0.172880 0.362654 0.166218 0.323101 0.287124 0.223557 0.351293 0.257124 0.275681 0.115902 0.172036 0.202372 0.295939 0.329653 Consensus sequence: DHDACCGGAAMTHBVB Alignment: DHDACCGGAAMTHBVB ------GGAAM----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00416 Fli1 Reverse Complement Original Motif Backward 7 5 0.001638 Species: Mus musculus Original motif 0.306248 0.320757 0.227284 0.145711 0.154859 0.254523 0.255295 0.335323 0.131261 0.300255 0.356247 0.212237 0.349545 0.222549 0.254062 0.173844 0.736280 0.006475 0.242691 0.014555 0.001696 0.522360 0.010544 0.465399 0.082657 0.000819 0.004666 0.911858 0.007818 0.001869 0.001302 0.989011 0.002303 0.992768 0.002361 0.002568 0.002417 0.992259 0.003375 0.001949 0.000360 0.004820 0.907484 0.087336 0.004749 0.022225 0.959164 0.013862 0.197948 0.147167 0.034749 0.620136 0.340568 0.182434 0.187068 0.289930 0.240105 0.146975 0.344334 0.268587 0.189372 0.384338 0.143385 0.282906 Consensus sequence: VBBVAYTTCCGGTDDH Reverse complement motif 0.189372 0.143385 0.384338 0.282906 0.240105 0.344334 0.146975 0.268587 0.289930 0.182434 0.187068 0.340568 0.620136 0.147167 0.034749 0.197948 0.004749 0.959164 0.022225 0.013862 0.000360 0.907484 0.004820 0.087336 0.002417 0.003375 0.992259 0.001949 0.002303 0.002361 0.992768 0.002568 0.989011 0.001869 0.001302 0.007818 0.911858 0.000819 0.004666 0.082657 0.001696 0.010544 0.522360 0.465399 0.014555 0.006475 0.242691 0.736280 0.173844 0.222549 0.254062 0.349545 0.131261 0.356247 0.300255 0.212237 0.335323 0.254523 0.255295 0.154859 0.306248 0.227284 0.320757 0.145711 Consensus sequence: DHDACCGGAAKTBBVV Alignment: VBBVAYTTCCGGTDDH -----YTTCC------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00422 Etv3 Reverse Complement Original Motif Forward 6 5 0.002344 Species: Mus musculus Original motif 0.332809 0.229564 0.274530 0.163097 0.135229 0.358662 0.213133 0.292977 0.175467 0.227303 0.362532 0.234698 0.414668 0.219948 0.135069 0.230314 0.753697 0.016289 0.187301 0.042714 0.004731 0.490263 0.022866 0.482139 0.090430 0.003072 0.014474 0.892025 0.008761 0.004125 0.001801 0.985313 0.003087 0.987821 0.004506 0.004586 0.002955 0.989874 0.002924 0.004247 0.004528 0.010188 0.939087 0.046196 0.103036 0.063134 0.799250 0.034580 0.243182 0.089819 0.055020 0.611978 0.439614 0.180450 0.158093 0.221844 0.214372 0.144123 0.384421 0.257084 0.210021 0.334608 0.177182 0.278189 Consensus sequence: VBBHAYTTCCGGTHDH Reverse complement motif 0.210021 0.177182 0.334608 0.278189 0.214372 0.384421 0.144123 0.257084 0.221844 0.180450 0.158093 0.439614 0.611978 0.089819 0.055020 0.243182 0.103036 0.799250 0.063134 0.034580 0.004528 0.939087 0.010188 0.046196 0.002955 0.002924 0.989874 0.004247 0.003087 0.004506 0.987821 0.004586 0.985313 0.004125 0.001801 0.008761 0.892025 0.003072 0.014474 0.090430 0.004731 0.022866 0.490263 0.482139 0.042714 0.016289 0.187301 0.753697 0.230314 0.219948 0.135069 0.414668 0.175467 0.362532 0.227303 0.234698 0.135229 0.213133 0.358662 0.292977 0.163097 0.229564 0.274530 0.332809 Consensus sequence: DHHACCGGAAKTHBBB Alignment: VBBHAYTTCCGGTHDH -----YTTCC------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00411 Erg Reverse Complement Original Motif Backward 7 5 0.005898 Species: Mus musculus Original motif 0.301267 0.284764 0.255705 0.158264 0.122975 0.233756 0.238767 0.404502 0.154943 0.290275 0.345790 0.208992 0.321204 0.330726 0.177808 0.170262 0.780210 0.006861 0.200535 0.012393 0.001550 0.582732 0.011633 0.404085 0.105245 0.000870 0.004910 0.888976 0.009093 0.001705 0.001205 0.987996 0.002195 0.992811 0.002476 0.002518 0.003021 0.992233 0.002469 0.002278 0.000332 0.004293 0.893671 0.101704 0.005607 0.034448 0.942814 0.017131 0.185818 0.115556 0.035998 0.662628 0.300053 0.198903 0.221728 0.279316 0.186224 0.170560 0.307002 0.336213 0.157640 0.407799 0.198527 0.236034 Consensus sequence: VBBVAYTTCCGGTDDB Reverse complement motif 0.157640 0.198527 0.407799 0.236034 0.336213 0.170560 0.307002 0.186224 0.279316 0.198903 0.221728 0.300053 0.662628 0.115556 0.035998 0.185818 0.005607 0.942814 0.034448 0.017131 0.000332 0.893671 0.004293 0.101704 0.003021 0.002469 0.992233 0.002278 0.002195 0.002476 0.992811 0.002518 0.987996 0.001705 0.001205 0.009093 0.888976 0.000870 0.004910 0.105245 0.001550 0.011633 0.582732 0.404085 0.012393 0.006861 0.200535 0.780210 0.321204 0.177808 0.330726 0.170262 0.154943 0.345790 0.290275 0.208992 0.404502 0.233756 0.238767 0.122975 0.158264 0.284764 0.255705 0.301267 Consensus sequence: BDDACCGGAAKTVBVB Alignment: VBBVAYTTCCGGTDDB -----YTTCC------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00418 Etv6 Reverse Complement Original Motif Backward 7 5 0.006913 Species: Mus musculus Original motif 0.354972 0.069107 0.299350 0.276571 0.209701 0.408003 0.227382 0.154914 0.284336 0.375266 0.162604 0.177794 0.176569 0.181438 0.342172 0.299820 0.106551 0.204378 0.060299 0.628772 0.884088 0.003252 0.103113 0.009546 0.001110 0.704391 0.006294 0.288205 0.014992 0.000892 0.001401 0.982714 0.004842 0.001887 0.002470 0.990801 0.002724 0.992864 0.002206 0.002206 0.001792 0.991200 0.001615 0.005393 0.005151 0.010157 0.940259 0.044433 0.017780 0.199839 0.761921 0.020459 0.230834 0.269936 0.119652 0.379577 0.233019 0.093692 0.034743 0.638546 0.194739 0.181763 0.175340 0.448159 0.145452 0.293709 0.335917 0.224922 Consensus sequence: DVHBTACTTCCGGHTHB Reverse complement motif 0.145452 0.335917 0.293709 0.224922 0.448159 0.181763 0.175340 0.194739 0.638546 0.093692 0.034743 0.233019 0.379577 0.269936 0.119652 0.230834 0.017780 0.761921 0.199839 0.020459 0.005151 0.940259 0.010157 0.044433 0.001792 0.001615 0.991200 0.005393 0.002724 0.002206 0.992864 0.002206 0.990801 0.001887 0.002470 0.004842 0.982714 0.000892 0.001401 0.014992 0.001110 0.006294 0.704391 0.288205 0.009546 0.003252 0.103113 0.884088 0.628772 0.204378 0.060299 0.106551 0.176569 0.342172 0.181438 0.299820 0.284336 0.162604 0.375266 0.177794 0.209701 0.227382 0.408003 0.154914 0.276571 0.069107 0.299350 0.354972 Consensus sequence: BHAHCCGGAAGTABDVD Alignment: DVHBTACTTCCGGHTHB ------YTTCC------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00415 Elk4 Reverse Complement Original Motif Backward 7 5 0.007222 Species: Mus musculus Original motif 0.300853 0.294487 0.280460 0.124201 0.157232 0.233834 0.211586 0.397348 0.159310 0.203905 0.424971 0.211814 0.354339 0.199657 0.183532 0.262473 0.600444 0.009731 0.360126 0.029699 0.003569 0.539578 0.034527 0.422325 0.133878 0.001340 0.015798 0.848984 0.007617 0.004852 0.001324 0.986208 0.002444 0.991121 0.003343 0.003092 0.002826 0.990981 0.004609 0.001584 0.000526 0.003830 0.945849 0.049795 0.017484 0.038092 0.911945 0.032479 0.150144 0.246623 0.061547 0.541686 0.394683 0.150027 0.234684 0.220606 0.303982 0.110838 0.383852 0.201327 0.214111 0.413717 0.133729 0.238442 Consensus sequence: VBBHRYTTCCGGTDDH Reverse complement motif 0.214111 0.133729 0.413717 0.238442 0.303982 0.383852 0.110838 0.201327 0.220606 0.150027 0.234684 0.394683 0.541686 0.246623 0.061547 0.150144 0.017484 0.911945 0.038092 0.032479 0.000526 0.945849 0.003830 0.049795 0.002826 0.004609 0.990981 0.001584 0.002444 0.003343 0.991121 0.003092 0.986208 0.004852 0.001324 0.007617 0.848984 0.001340 0.015798 0.133878 0.003569 0.034527 0.539578 0.422325 0.029699 0.009731 0.360126 0.600444 0.262473 0.199657 0.183532 0.354339 0.159310 0.424971 0.203905 0.211814 0.397348 0.233834 0.211586 0.157232 0.124201 0.294487 0.280460 0.300853 Consensus sequence: DHDACCGGAAKKHBVB Alignment: VBBHRYTTCCGGTDDH -----YTTCC------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00413 Elf4 Reverse Complement Original Motif Backward 7 5 0.015311 Species: Mus musculus Original motif 0.349744 0.139466 0.209326 0.301464 0.080478 0.359482 0.307083 0.252956 0.145756 0.213763 0.350557 0.289924 0.317307 0.199359 0.096089 0.387245 0.868576 0.009724 0.088821 0.032878 0.001975 0.827004 0.014159 0.156862 0.045494 0.000985 0.001907 0.951615 0.011012 0.001203 0.002186 0.985599 0.002743 0.992908 0.002226 0.002123 0.001498 0.990840 0.001556 0.006106 0.000951 0.005138 0.880591 0.113319 0.003127 0.107962 0.867980 0.020930 0.156602 0.055355 0.396563 0.391480 0.421246 0.049379 0.084495 0.444880 0.223879 0.068063 0.203809 0.504249 0.144100 0.323579 0.131544 0.400777 Consensus sequence: DBBHACTTCCGGKWTH Reverse complement motif 0.400777 0.323579 0.131544 0.144100 0.504249 0.068063 0.203809 0.223879 0.444880 0.049379 0.084495 0.421246 0.156602 0.396563 0.055355 0.391480 0.003127 0.867980 0.107962 0.020930 0.000951 0.880591 0.005138 0.113319 0.001498 0.001556 0.990840 0.006106 0.002743 0.002226 0.992908 0.002123 0.985599 0.001203 0.002186 0.011012 0.951615 0.000985 0.001907 0.045494 0.001975 0.014159 0.827004 0.156862 0.032878 0.009724 0.088821 0.868576 0.387245 0.199359 0.096089 0.317307 0.145756 0.350557 0.213763 0.289924 0.080478 0.307083 0.359482 0.252956 0.301464 0.139466 0.209326 0.349744 Consensus sequence: HAWYCCGGAAGTHBBD Alignment: DBBHACTTCCGGKWTH -----YTTCC------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00404 Elf2 Reverse Complement Original Motif Backward 7 5 0.015346 Species: Mus musculus Original motif 0.381592 0.198656 0.201326 0.218426 0.091509 0.331644 0.302830 0.274017 0.165404 0.272650 0.352528 0.209418 0.322145 0.255685 0.129399 0.292771 0.853490 0.012857 0.078563 0.055090 0.002655 0.792907 0.026436 0.178002 0.058923 0.001063 0.002976 0.937038 0.014944 0.001369 0.002865 0.980822 0.003786 0.992305 0.002102 0.001807 0.001365 0.988969 0.001554 0.008111 0.001527 0.009592 0.891056 0.097824 0.003671 0.143708 0.836117 0.016503 0.242982 0.061527 0.305342 0.390148 0.426709 0.117673 0.096260 0.359357 0.202520 0.113885 0.262005 0.421589 0.137957 0.359367 0.163919 0.338758 Consensus sequence: DBBHACTTCCGGDWDB Reverse complement motif 0.137957 0.163919 0.359367 0.338758 0.421589 0.113885 0.262005 0.202520 0.359357 0.117673 0.096260 0.426709 0.390148 0.061527 0.305342 0.242982 0.003671 0.836117 0.143708 0.016503 0.001527 0.891056 0.009592 0.097824 0.001365 0.001554 0.988969 0.008111 0.003786 0.002102 0.992305 0.001807 0.980822 0.001369 0.002865 0.014944 0.937038 0.001063 0.002976 0.058923 0.002655 0.026436 0.792907 0.178002 0.055090 0.012857 0.078563 0.853490 0.292771 0.255685 0.129399 0.322145 0.165404 0.352528 0.272650 0.209418 0.091509 0.302830 0.331644 0.274017 0.218426 0.198656 0.201326 0.381592 Consensus sequence: BDWDCCGGAAGTHBBD Alignment: DBBHACTTCCGGDWDB -----YTTCC------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00417 Etv4 Reverse Complement Original Motif Forward 6 5 0.021968 Species: Mus musculus Original motif 0.184878 0.284434 0.409923 0.120764 0.109377 0.175465 0.236839 0.478318 0.178098 0.256797 0.363549 0.201555 0.364772 0.248187 0.178759 0.208283 0.724780 0.030390 0.208903 0.035927 0.002995 0.613982 0.054050 0.328972 0.343836 0.005047 0.005182 0.645935 0.010738 0.001234 0.002703 0.985325 0.003133 0.992033 0.003651 0.001183 0.002003 0.992420 0.002597 0.002979 0.000776 0.002346 0.925715 0.071164 0.012174 0.089110 0.885352 0.013364 0.240364 0.196426 0.055886 0.507324 0.210052 0.182581 0.413971 0.193396 0.228279 0.169636 0.398631 0.203454 0.155773 0.389556 0.186769 0.267902 Consensus sequence: VBBHAYWTCCGGTDDB Reverse complement motif 0.155773 0.186769 0.389556 0.267902 0.228279 0.398631 0.169636 0.203454 0.210052 0.413971 0.182581 0.193396 0.507324 0.196426 0.055886 0.240364 0.012174 0.885352 0.089110 0.013364 0.000776 0.925715 0.002346 0.071164 0.002003 0.002597 0.992420 0.002979 0.003133 0.003651 0.992033 0.001183 0.985325 0.001234 0.002703 0.010738 0.645935 0.005047 0.005182 0.343836 0.002995 0.054050 0.613982 0.328972 0.035927 0.030390 0.208903 0.724780 0.208283 0.248187 0.178759 0.364772 0.178098 0.363549 0.256797 0.201555 0.478318 0.175465 0.236839 0.109377 0.184878 0.409923 0.284434 0.120764 Consensus sequence: BHHACCGGAWKTHBVV Alignment: VBBHAYWTCCGGTDDB -----YTTCC------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00419 Spic Reverse Complement Reverse Complement Backward 7 5 0.022402 Species: Mus musculus Original motif 0.372554 0.181557 0.296001 0.149888 0.734552 0.057250 0.044752 0.163446 0.707604 0.045049 0.110341 0.137006 0.637848 0.057252 0.071934 0.232966 0.125449 0.108933 0.689441 0.076176 0.266215 0.517339 0.207018 0.009428 0.015016 0.002582 0.979670 0.002732 0.004303 0.002322 0.989973 0.003401 0.982327 0.003552 0.003393 0.010727 0.974155 0.001662 0.003294 0.020889 0.040023 0.128522 0.821560 0.009894 0.027635 0.045828 0.016297 0.910239 0.317500 0.045635 0.172234 0.464631 0.342838 0.107812 0.284775 0.264576 Consensus sequence: VAAAGMGGAAGTWD Reverse complement motif 0.264576 0.107812 0.284775 0.342838 0.464631 0.045635 0.172234 0.317500 0.910239 0.045828 0.016297 0.027635 0.040023 0.821560 0.128522 0.009894 0.020889 0.001662 0.003294 0.974155 0.010727 0.003552 0.003393 0.982327 0.004303 0.989973 0.002322 0.003401 0.015016 0.979670 0.002582 0.002732 0.266215 0.207018 0.517339 0.009428 0.125449 0.689441 0.108933 0.076176 0.232966 0.057252 0.071934 0.637848 0.137006 0.045049 0.110341 0.707604 0.163446 0.057250 0.044752 0.734552 0.149888 0.181557 0.296001 0.372554 Consensus sequence: DWACTTCCRCTTTB Alignment: DWACTTCCRCTTTB ---YTTCC------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 3 Motif ID: 51 Motif name: HNF4A Original motif 0.417910 0.104478 0.402985 0.074627 0.029851 0.029851 0.835821 0.104478 0.179104 0.059701 0.522388 0.238806 0.074627 0.343284 0.298507 0.283582 0.044776 0.761194 0.059701 0.134328 0.880597 0.014925 0.044776 0.059701 0.791045 0.029851 0.149254 0.029851 0.835821 0.014925 0.119403 0.029851 0.059701 0.059701 0.865672 0.014925 0.089552 0.029851 0.492537 0.388060 0.044776 0.328358 0.164179 0.462687 0.059701 0.731343 0.074627 0.134328 0.626866 0.104478 0.149254 0.119403 Consensus sequence: RGGBCAAAGKYCA Reserve complement motif 0.119403 0.104478 0.149254 0.626866 0.059701 0.074627 0.731343 0.134328 0.462687 0.328358 0.164179 0.044776 0.089552 0.492537 0.029851 0.388060 0.059701 0.865672 0.059701 0.014925 0.029851 0.014925 0.119403 0.835821 0.029851 0.029851 0.149254 0.791045 0.059701 0.014925 0.044776 0.880597 0.044776 0.059701 0.761194 0.134328 0.074627 0.298507 0.343284 0.283582 0.179104 0.522388 0.059701 0.238806 0.029851 0.835821 0.029851 0.104478 0.074627 0.104478 0.402985 0.417910 Consensus sequence: TGMYCTTTGBCCK ************************************************************************ Best Matches for Motif ID 51 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00058 Tcf3_primary Original Motif Original Motif Backward 2 13 0.035778 Species: Mus musculus Original motif 0.185864 0.201179 0.183663 0.429294 0.371100 0.233868 0.122934 0.272098 0.249563 0.171285 0.128851 0.450301 0.582940 0.043382 0.129099 0.244578 0.041400 0.395349 0.497087 0.066163 0.759123 0.009670 0.005936 0.225270 0.056579 0.008662 0.003986 0.930772 0.043968 0.865783 0.056001 0.034249 0.962748 0.003731 0.003265 0.030256 0.971318 0.003542 0.012299 0.012841 0.937558 0.003991 0.020195 0.038256 0.125931 0.057976 0.798081 0.018012 0.209401 0.172342 0.483980 0.134277 0.485703 0.129227 0.309936 0.075134 0.397027 0.195902 0.152395 0.254676 0.311636 0.231510 0.157732 0.299122 0.320965 0.206031 0.164299 0.308705 Consensus sequence: HHHASATCAAAGVRHHH Reverse complement motif 0.308705 0.206031 0.164299 0.320965 0.299122 0.231510 0.157732 0.311636 0.254676 0.195902 0.152395 0.397027 0.075134 0.129227 0.309936 0.485703 0.209401 0.483980 0.172342 0.134277 0.125931 0.798081 0.057976 0.018012 0.038256 0.003991 0.020195 0.937558 0.012841 0.003542 0.012299 0.971318 0.030256 0.003731 0.003265 0.962748 0.043968 0.056001 0.865783 0.034249 0.930772 0.008662 0.003986 0.056579 0.225270 0.009670 0.005936 0.759123 0.041400 0.497087 0.395349 0.066163 0.244578 0.043382 0.129099 0.582940 0.450301 0.171285 0.128851 0.249563 0.272098 0.233868 0.122934 0.371100 0.429294 0.201179 0.183663 0.185864 Consensus sequence: HHHKVCTTTGATSTHHH Alignment: HHHASATCAAAGVRHHH ---RGGBCAAAGKYCA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00054 Tcf7_primary Original Motif Original Motif Backward 2 13 0.035779 Species: Mus musculus Original motif 0.170811 0.196976 0.220503 0.411710 0.337231 0.228482 0.140137 0.294150 0.299312 0.173780 0.143426 0.383481 0.603957 0.053557 0.128214 0.214271 0.036338 0.377925 0.534647 0.051091 0.725865 0.010314 0.008501 0.255320 0.067855 0.007849 0.004559 0.919737 0.049387 0.815496 0.098330 0.036787 0.960514 0.005036 0.005137 0.029313 0.960631 0.004550 0.018815 0.016004 0.935245 0.005169 0.023866 0.035720 0.159760 0.060340 0.761341 0.018559 0.228534 0.153897 0.523052 0.094517 0.557984 0.123512 0.254154 0.064350 0.490252 0.211976 0.124557 0.173215 0.310463 0.250279 0.132612 0.306646 0.332720 0.248937 0.120633 0.297711 Consensus sequence: BHHASATCAAAGGAHHH Reverse complement motif 0.297711 0.248937 0.120633 0.332720 0.306646 0.250279 0.132612 0.310463 0.173215 0.211976 0.124557 0.490252 0.064350 0.123512 0.254154 0.557984 0.228534 0.523052 0.153897 0.094517 0.159760 0.761341 0.060340 0.018559 0.035720 0.005169 0.023866 0.935245 0.016004 0.004550 0.018815 0.960631 0.029313 0.005036 0.005137 0.960514 0.049387 0.098330 0.815496 0.036787 0.919737 0.007849 0.004559 0.067855 0.255320 0.010314 0.008501 0.725865 0.036338 0.534647 0.377925 0.051091 0.214271 0.053557 0.128214 0.603957 0.383481 0.173780 0.143426 0.299312 0.294150 0.228482 0.140137 0.337231 0.411710 0.196976 0.220503 0.170811 Consensus sequence: HHHTCCTTTGATSTHHV Alignment: BHHASATCAAAGGAHHH ---RGGBCAAAGKYCA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00067 Lef1_primary Original Motif Reverse Complement Forward 4 13 0.035901 Species: Mus musculus Original motif 0.281920 0.214207 0.278077 0.225796 0.325566 0.151435 0.298797 0.224202 0.290253 0.145824 0.243443 0.320480 0.069286 0.404645 0.141614 0.384454 0.070044 0.621448 0.142647 0.165862 0.007295 0.907657 0.038110 0.046938 0.015587 0.018273 0.000658 0.965482 0.005527 0.005886 0.001905 0.986682 0.024512 0.001189 0.001344 0.972955 0.007384 0.025221 0.952270 0.015125 0.966438 0.000630 0.002693 0.030239 0.082252 0.001173 0.001495 0.915080 0.030255 0.677155 0.275323 0.017267 0.199467 0.118815 0.056814 0.624905 0.345445 0.169597 0.216831 0.268127 0.278106 0.150864 0.173693 0.397336 0.251834 0.339733 0.219703 0.188730 Consensus sequence: DDDYCCTTTGATCTDDV Reverse complement motif 0.251834 0.219703 0.339733 0.188730 0.397336 0.150864 0.173693 0.278106 0.268127 0.169597 0.216831 0.345445 0.624905 0.118815 0.056814 0.199467 0.030255 0.275323 0.677155 0.017267 0.915080 0.001173 0.001495 0.082252 0.030239 0.000630 0.002693 0.966438 0.007384 0.952270 0.025221 0.015125 0.972955 0.001189 0.001344 0.024512 0.986682 0.005886 0.001905 0.005527 0.965482 0.018273 0.000658 0.015587 0.007295 0.038110 0.907657 0.046938 0.070044 0.142647 0.621448 0.165862 0.069286 0.141614 0.404645 0.384454 0.320480 0.145824 0.243443 0.290253 0.224202 0.151435 0.298797 0.325566 0.225796 0.214207 0.278077 0.281920 Consensus sequence: VDDAGATCAAAGGKDDD Alignment: VDDAGATCAAAGGKDDD ---RGGBCAAAGKYCA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00083 Tcf7l2_primary Original Motif Reverse Complement Backward 2 13 0.036079 Species: Mus musculus Original motif 0.285725 0.187143 0.254855 0.272277 0.276264 0.157893 0.258178 0.307665 0.238788 0.161120 0.254018 0.346074 0.076041 0.333901 0.150903 0.439156 0.093376 0.526578 0.180529 0.199517 0.010827 0.880320 0.034150 0.074703 0.016546 0.023834 0.000940 0.958680 0.007166 0.008215 0.001941 0.982678 0.029634 0.001363 0.001379 0.967625 0.010872 0.031751 0.926186 0.031190 0.949407 0.000760 0.002581 0.047253 0.109203 0.001362 0.002094 0.887341 0.044198 0.567994 0.353059 0.034749 0.222623 0.142360 0.041281 0.593736 0.358872 0.167597 0.220534 0.252997 0.233072 0.141480 0.230985 0.394463 0.350703 0.243129 0.233961 0.172207 Consensus sequence: DDDYCCTTTGATSTDDV Reverse complement motif 0.172207 0.243129 0.233961 0.350703 0.394463 0.141480 0.230985 0.233072 0.252997 0.167597 0.220534 0.358872 0.593736 0.142360 0.041281 0.222623 0.044198 0.353059 0.567994 0.034749 0.887341 0.001362 0.002094 0.109203 0.047253 0.000760 0.002581 0.949407 0.010872 0.926186 0.031751 0.031190 0.967625 0.001363 0.001379 0.029634 0.982678 0.008215 0.001941 0.007166 0.958680 0.023834 0.000940 0.016546 0.010827 0.034150 0.880320 0.074703 0.093376 0.180529 0.526578 0.199517 0.439156 0.333901 0.150903 0.076041 0.346074 0.161120 0.254018 0.238788 0.307665 0.157893 0.258178 0.276264 0.272277 0.187143 0.254855 0.285725 Consensus sequence: BDDASATCAAAGGMDDD Alignment: BDDASATCAAAGGMDDD ---RGGBCAAAGKYCA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00046 Tcfe2a_secondary Original Motif Original Motif Backward 4 13 0.040576 Species: Mus musculus Original motif 0.296417 0.247522 0.206749 0.249312 0.410113 0.201959 0.303149 0.084779 0.267313 0.132645 0.452057 0.147985 0.187929 0.136827 0.427628 0.247616 0.198671 0.425254 0.234160 0.141915 0.029244 0.953929 0.004092 0.012734 0.954570 0.014314 0.018695 0.012421 0.010025 0.055055 0.845504 0.089415 0.874802 0.040849 0.069178 0.015172 0.015084 0.010551 0.008736 0.965628 0.012981 0.007192 0.965036 0.014791 0.037724 0.016891 0.495632 0.449753 0.021685 0.438927 0.056118 0.483270 0.209872 0.365671 0.139706 0.284751 0.151815 0.336912 0.289382 0.221891 0.152995 0.262354 0.416434 0.168217 0.227567 0.187603 0.447892 0.136938 Consensus sequence: HVDDVCAGATGKYHBBV Reverse complement motif 0.227567 0.447892 0.187603 0.136938 0.152995 0.416434 0.262354 0.168217 0.151815 0.289382 0.336912 0.221891 0.209872 0.139706 0.365671 0.284751 0.483270 0.438927 0.056118 0.021685 0.037724 0.495632 0.016891 0.449753 0.012981 0.965036 0.007192 0.014791 0.965628 0.010551 0.008736 0.015084 0.015172 0.040849 0.069178 0.874802 0.010025 0.845504 0.055055 0.089415 0.012421 0.014314 0.018695 0.954570 0.029244 0.004092 0.953929 0.012734 0.198671 0.234160 0.425254 0.141915 0.187929 0.427628 0.136827 0.247616 0.267313 0.452057 0.132645 0.147985 0.084779 0.201959 0.303149 0.410113 0.249312 0.247522 0.206749 0.296417 Consensus sequence: VBBDMYCATCTGVHHBH Alignment: HVDDVCAGATGKYHBBV -RGGBCAAAGKYCA--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00062 Sox4_primary Reverse Complement Reverse Complement Forward 2 13 0.040991 Species: Mus musculus Original motif 0.427843 0.231210 0.119424 0.221523 0.196506 0.239531 0.304906 0.259057 0.302488 0.156922 0.290190 0.250401 0.433872 0.149126 0.196496 0.220506 0.258426 0.076511 0.475100 0.189963 0.841714 0.046453 0.099915 0.011918 0.983853 0.001612 0.001362 0.013174 0.003460 0.982032 0.005728 0.008780 0.989743 0.002253 0.002020 0.005984 0.990761 0.003397 0.002843 0.003000 0.770864 0.003540 0.001549 0.224048 0.235342 0.002598 0.757383 0.004677 0.371426 0.089574 0.529959 0.009040 0.480804 0.196949 0.240413 0.081833 0.187158 0.355102 0.216599 0.241142 0.248006 0.232182 0.157452 0.362360 0.403367 0.177684 0.164649 0.254300 Consensus sequence: HBDDDAACAAAGRVBHH Reverse complement motif 0.254300 0.177684 0.164649 0.403367 0.362360 0.232182 0.157452 0.248006 0.187158 0.216599 0.355102 0.241142 0.081833 0.196949 0.240413 0.480804 0.371426 0.529959 0.089574 0.009040 0.235342 0.757383 0.002598 0.004677 0.224048 0.003540 0.001549 0.770864 0.003000 0.003397 0.002843 0.990761 0.005984 0.002253 0.002020 0.989743 0.003460 0.005728 0.982032 0.008780 0.013174 0.001612 0.001362 0.983853 0.011918 0.046453 0.099915 0.841714 0.258426 0.475100 0.076511 0.189963 0.220506 0.149126 0.196496 0.433872 0.250401 0.156922 0.290190 0.302488 0.196506 0.304906 0.239531 0.259057 0.221523 0.231210 0.119424 0.427843 Consensus sequence: HHBBMCTTTGTTHDDBH Alignment: HHBBMCTTTGTTHDDBH -TGMYCTTTGBCCK--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00101 Sox12_secondary Reverse Complement Reverse Complement Forward 1 13 0.041322 Species: Mus musculus Original motif 0.378898 0.318901 0.205859 0.096341 0.352524 0.321236 0.224504 0.101736 0.323551 0.182056 0.210897 0.283496 0.135539 0.325230 0.208031 0.331200 0.663106 0.055471 0.154459 0.126963 0.051748 0.292567 0.537307 0.118378 0.886489 0.042361 0.035742 0.035408 0.043647 0.688744 0.094358 0.173252 0.882052 0.039818 0.018899 0.059231 0.864171 0.036011 0.068363 0.031455 0.790158 0.046868 0.041594 0.121379 0.087447 0.143905 0.707798 0.060849 0.295919 0.132479 0.485703 0.085899 0.653156 0.133004 0.110012 0.103828 0.351764 0.131771 0.217730 0.298736 0.203977 0.196773 0.099958 0.499292 Consensus sequence: VVDBASACAAAGRADH Reverse complement motif 0.499292 0.196773 0.099958 0.203977 0.298736 0.131771 0.217730 0.351764 0.103828 0.133004 0.110012 0.653156 0.295919 0.485703 0.132479 0.085899 0.087447 0.707798 0.143905 0.060849 0.121379 0.046868 0.041594 0.790158 0.031455 0.036011 0.068363 0.864171 0.059231 0.039818 0.018899 0.882052 0.043647 0.094358 0.688744 0.173252 0.035408 0.042361 0.035742 0.886489 0.051748 0.537307 0.292567 0.118378 0.126963 0.055471 0.154459 0.663106 0.331200 0.325230 0.208031 0.135539 0.283496 0.182056 0.210897 0.323551 0.101736 0.321236 0.224504 0.352524 0.096341 0.318901 0.205859 0.378898 Consensus sequence: HDTMCTTTGTSTVDBB Alignment: HDTMCTTTGTSTVDBB TGMYCTTTGBCCK--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00030 Sox11_primary Reverse Complement Reverse Complement Forward 2 13 0.042110 Species: Mus musculus Original motif 0.351812 0.238467 0.143954 0.265768 0.195246 0.235838 0.281473 0.287443 0.349478 0.172616 0.210739 0.267167 0.484061 0.110438 0.173131 0.232370 0.276692 0.070713 0.479604 0.172991 0.859124 0.044167 0.083951 0.012758 0.975608 0.002029 0.002285 0.020079 0.006422 0.978485 0.007124 0.007969 0.987489 0.003025 0.002868 0.006617 0.987739 0.005463 0.002730 0.004067 0.693013 0.004067 0.002445 0.300475 0.189100 0.003677 0.801408 0.005814 0.352090 0.072517 0.567737 0.007656 0.542316 0.176545 0.192768 0.088371 0.196382 0.304176 0.205985 0.293457 0.289415 0.201358 0.182937 0.326290 0.385801 0.216362 0.152363 0.245475 Consensus sequence: HBDDRAACAAAGRABHH Reverse complement motif 0.245475 0.216362 0.152363 0.385801 0.326290 0.201358 0.182937 0.289415 0.196382 0.205985 0.304176 0.293457 0.088371 0.176545 0.192768 0.542316 0.352090 0.567737 0.072517 0.007656 0.189100 0.801408 0.003677 0.005814 0.300475 0.004067 0.002445 0.693013 0.004067 0.005463 0.002730 0.987739 0.006617 0.003025 0.002868 0.987489 0.006422 0.007124 0.978485 0.007969 0.020079 0.002029 0.002285 0.975608 0.012758 0.044167 0.083951 0.859124 0.276692 0.479604 0.070713 0.172991 0.232370 0.110438 0.173131 0.484061 0.267167 0.172616 0.210739 0.349478 0.287443 0.235838 0.281473 0.195246 0.265768 0.238467 0.143954 0.351812 Consensus sequence: HHBTMCTTTGTTMDDVH Alignment: HHBTMCTTTGTTMDDVH -TGMYCTTTGBCCK--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00086 Irf3_secondary Original Motif Original Motif Backward 2 13 0.044200 Species: Mus musculus Original motif 0.236565 0.149020 0.414811 0.199604 0.197737 0.139048 0.436764 0.226451 0.598309 0.089963 0.124245 0.187483 0.212136 0.055296 0.648272 0.084296 0.747144 0.027184 0.047789 0.177884 0.766825 0.051238 0.039008 0.142929 0.479462 0.085743 0.175517 0.259279 0.064625 0.107366 0.753079 0.074929 0.058034 0.074096 0.820937 0.046934 0.270072 0.088714 0.217158 0.424057 0.063867 0.384543 0.418514 0.133076 0.047352 0.597210 0.167770 0.187669 0.266737 0.150063 0.382264 0.200936 0.381079 0.204427 0.218492 0.196003 Consensus sequence: DDAGAADGGDSCDV Reverse complement motif 0.196003 0.204427 0.218492 0.381079 0.266737 0.382264 0.150063 0.200936 0.047352 0.167770 0.597210 0.187669 0.063867 0.418514 0.384543 0.133076 0.424057 0.088714 0.217158 0.270072 0.058034 0.820937 0.074096 0.046934 0.064625 0.753079 0.107366 0.074929 0.259279 0.085743 0.175517 0.479462 0.142929 0.051238 0.039008 0.766825 0.177884 0.027184 0.047789 0.747144 0.212136 0.648272 0.055296 0.084296 0.187483 0.089963 0.124245 0.598309 0.197737 0.436764 0.139048 0.226451 0.236565 0.414811 0.149020 0.199604 Consensus sequence: BHGSDCCDTTCTHH Alignment: DDAGAADGGDSCDV RGGBCAAAGKYCA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00082 Zfp187_secondary Original Motif Reverse Complement Forward 4 13 0.044688 Species: Mus musculus Original motif 0.173063 0.169680 0.440836 0.216421 0.353277 0.179996 0.249403 0.217325 0.307337 0.038055 0.616380 0.038228 0.316636 0.564670 0.023732 0.094962 0.015484 0.923764 0.019439 0.041313 0.011243 0.956300 0.009443 0.023014 0.062273 0.107531 0.010739 0.819456 0.126670 0.201521 0.192005 0.479803 0.093090 0.045924 0.835792 0.025194 0.020165 0.015483 0.009567 0.954786 0.010873 0.672448 0.004559 0.312121 0.018002 0.846860 0.017605 0.117533 0.335703 0.408170 0.104095 0.152031 0.150308 0.362296 0.067408 0.419988 0.286490 0.242211 0.176532 0.294767 0.265022 0.249655 0.272219 0.213104 Consensus sequence: DDGMCCTBGTCCHYHV Reverse complement motif 0.265022 0.272219 0.249655 0.213104 0.294767 0.242211 0.176532 0.286490 0.419988 0.362296 0.067408 0.150308 0.335703 0.104095 0.408170 0.152031 0.018002 0.017605 0.846860 0.117533 0.010873 0.004559 0.672448 0.312121 0.954786 0.015483 0.009567 0.020165 0.093090 0.835792 0.045924 0.025194 0.479803 0.201521 0.192005 0.126670 0.819456 0.107531 0.010739 0.062273 0.011243 0.009443 0.956300 0.023014 0.015484 0.019439 0.923764 0.041313 0.316636 0.023732 0.564670 0.094962 0.307337 0.616380 0.038055 0.038228 0.217325 0.179996 0.249403 0.353277 0.173063 0.440836 0.169680 0.216421 Consensus sequence: VHMDGGACVAGGRCDH Alignment: VHMDGGACVAGGRCDH ---RGGBCAAAGKYCA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 3 Motif ID: 52 Motif name: NR2F1 Original motif 0.000000 0.000000 0.153846 0.846154 0.076923 0.000000 0.923077 0.000000 0.923077 0.000000 0.076923 0.000000 0.461538 0.538462 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.230769 0.000000 0.769231 0.000000 0.153846 0.000000 0.846154 0.076923 0.000000 0.000000 0.923077 0.153846 0.000000 0.846154 0.000000 0.461538 0.307692 0.230769 0.000000 0.461538 0.384615 0.076923 0.076923 0.076923 0.769231 0.076923 0.076923 0.230769 0.461538 0.000000 0.307692 0.000000 0.230769 0.230769 0.538462 Consensus sequence: TGAMCTTTGMMCYT Reserve complement motif 0.538462 0.230769 0.230769 0.000000 0.230769 0.000000 0.461538 0.307692 0.076923 0.076923 0.769231 0.076923 0.076923 0.384615 0.076923 0.461538 0.000000 0.307692 0.230769 0.461538 0.153846 0.846154 0.000000 0.000000 0.923077 0.000000 0.000000 0.076923 0.846154 0.153846 0.000000 0.000000 0.769231 0.230769 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.461538 0.000000 0.538462 0.000000 0.000000 0.000000 0.076923 0.923077 0.076923 0.923077 0.000000 0.000000 0.846154 0.000000 0.153846 0.000000 Consensus sequence: AKGYYCAAAGRTCA ************************************************************************ Best Matches for Motif ID 52 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00083 Tcf7l2_primary Original Motif Original Motif Backward 3 14 0.045236 Species: Mus musculus Original motif 0.285725 0.187143 0.254855 0.272277 0.276264 0.157893 0.258178 0.307665 0.238788 0.161120 0.254018 0.346074 0.076041 0.333901 0.150903 0.439156 0.093376 0.526578 0.180529 0.199517 0.010827 0.880320 0.034150 0.074703 0.016546 0.023834 0.000940 0.958680 0.007166 0.008215 0.001941 0.982678 0.029634 0.001363 0.001379 0.967625 0.010872 0.031751 0.926186 0.031190 0.949407 0.000760 0.002581 0.047253 0.109203 0.001362 0.002094 0.887341 0.044198 0.567994 0.353059 0.034749 0.222623 0.142360 0.041281 0.593736 0.358872 0.167597 0.220534 0.252997 0.233072 0.141480 0.230985 0.394463 0.350703 0.243129 0.233961 0.172207 Consensus sequence: DDDYCCTTTGATSTDDV Reverse complement motif 0.172207 0.243129 0.233961 0.350703 0.394463 0.141480 0.230985 0.233072 0.252997 0.167597 0.220534 0.358872 0.593736 0.142360 0.041281 0.222623 0.044198 0.353059 0.567994 0.034749 0.887341 0.001362 0.002094 0.109203 0.047253 0.000760 0.002581 0.949407 0.010872 0.926186 0.031751 0.031190 0.967625 0.001363 0.001379 0.029634 0.982678 0.008215 0.001941 0.007166 0.958680 0.023834 0.000940 0.016546 0.010827 0.034150 0.880320 0.074703 0.093376 0.180529 0.526578 0.199517 0.439156 0.333901 0.150903 0.076041 0.346074 0.161120 0.254018 0.238788 0.307665 0.157893 0.258178 0.276264 0.272277 0.187143 0.254855 0.285725 Consensus sequence: BDDASATCAAAGGMDDD Alignment: DDDYCCTTTGATSTDDV -TGAMCTTTGMMCYT-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00067 Lef1_primary Reverse Complement Reverse Complement Backward 2 14 0.045345 Species: Mus musculus Original motif 0.281920 0.214207 0.278077 0.225796 0.325566 0.151435 0.298797 0.224202 0.290253 0.145824 0.243443 0.320480 0.069286 0.404645 0.141614 0.384454 0.070044 0.621448 0.142647 0.165862 0.007295 0.907657 0.038110 0.046938 0.015587 0.018273 0.000658 0.965482 0.005527 0.005886 0.001905 0.986682 0.024512 0.001189 0.001344 0.972955 0.007384 0.025221 0.952270 0.015125 0.966438 0.000630 0.002693 0.030239 0.082252 0.001173 0.001495 0.915080 0.030255 0.677155 0.275323 0.017267 0.199467 0.118815 0.056814 0.624905 0.345445 0.169597 0.216831 0.268127 0.278106 0.150864 0.173693 0.397336 0.251834 0.339733 0.219703 0.188730 Consensus sequence: DDDYCCTTTGATCTDDV Reverse complement motif 0.251834 0.219703 0.339733 0.188730 0.397336 0.150864 0.173693 0.278106 0.268127 0.169597 0.216831 0.345445 0.624905 0.118815 0.056814 0.199467 0.030255 0.275323 0.677155 0.017267 0.915080 0.001173 0.001495 0.082252 0.030239 0.000630 0.002693 0.966438 0.007384 0.952270 0.025221 0.015125 0.972955 0.001189 0.001344 0.024512 0.986682 0.005886 0.001905 0.005527 0.965482 0.018273 0.000658 0.015587 0.007295 0.038110 0.907657 0.046938 0.070044 0.142647 0.621448 0.165862 0.069286 0.141614 0.404645 0.384454 0.320480 0.145824 0.243443 0.290253 0.224202 0.151435 0.298797 0.325566 0.225796 0.214207 0.278077 0.281920 Consensus sequence: VDDAGATCAAAGGKDDD Alignment: VDDAGATCAAAGGKDDD --AKGYYCAAAGRTCA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v015681_secondary Original Motif Reverse Complement Backward 2 14 0.046136 Species: Mus musculus Original motif 0.331499 0.188505 0.182841 0.297156 0.328961 0.213025 0.273530 0.184484 0.197213 0.129292 0.524914 0.148581 0.274491 0.226406 0.312118 0.186986 0.103231 0.393726 0.364988 0.138055 0.552594 0.166422 0.186262 0.094722 0.157618 0.064773 0.616497 0.161112 0.139166 0.176098 0.621185 0.063551 0.748420 0.062398 0.012447 0.176735 0.116584 0.009438 0.860326 0.013653 0.005030 0.003646 0.974877 0.016447 0.055257 0.007181 0.921760 0.015802 0.032748 0.058249 0.052709 0.856293 0.105606 0.872231 0.014370 0.007793 0.019480 0.497379 0.125899 0.357242 0.478582 0.269713 0.061464 0.190242 0.253985 0.287006 0.201320 0.257689 0.319384 0.210231 0.175842 0.294543 0.222123 0.287802 0.201294 0.288782 0.139951 0.376041 0.081133 0.402875 0.213450 0.343835 0.383676 0.059039 0.322294 0.355918 0.148062 0.173725 Consensus sequence: HVGVSAGGAGGGTCYHHHHYVH Reverse complement motif 0.322294 0.148062 0.355918 0.173725 0.213450 0.383676 0.343835 0.059039 0.402875 0.376041 0.081133 0.139951 0.288782 0.287802 0.201294 0.222123 0.294543 0.210231 0.175842 0.319384 0.253985 0.201320 0.287006 0.257689 0.190242 0.269713 0.061464 0.478582 0.019480 0.125899 0.497379 0.357242 0.105606 0.014370 0.872231 0.007793 0.856293 0.058249 0.052709 0.032748 0.055257 0.921760 0.007181 0.015802 0.005030 0.974877 0.003646 0.016447 0.116584 0.860326 0.009438 0.013653 0.176735 0.062398 0.012447 0.748420 0.139166 0.621185 0.176098 0.063551 0.157618 0.616497 0.064773 0.161112 0.094722 0.166422 0.186262 0.552594 0.103231 0.364988 0.393726 0.138055 0.274491 0.312118 0.226406 0.186986 0.197213 0.524914 0.129292 0.148581 0.184484 0.213025 0.273530 0.328961 0.297156 0.188505 0.182841 0.331499 Consensus sequence: DVMHHDHKGACCCTCCTSVCBH Alignment: DVMHHDHKGACCCTCCTSVCBH -------TGAMCTTTGMMCYT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00054 Tcf7_primary Reverse Complement Original Motif Backward 2 14 0.046177 Species: Mus musculus Original motif 0.170811 0.196976 0.220503 0.411710 0.337231 0.228482 0.140137 0.294150 0.299312 0.173780 0.143426 0.383481 0.603957 0.053557 0.128214 0.214271 0.036338 0.377925 0.534647 0.051091 0.725865 0.010314 0.008501 0.255320 0.067855 0.007849 0.004559 0.919737 0.049387 0.815496 0.098330 0.036787 0.960514 0.005036 0.005137 0.029313 0.960631 0.004550 0.018815 0.016004 0.935245 0.005169 0.023866 0.035720 0.159760 0.060340 0.761341 0.018559 0.228534 0.153897 0.523052 0.094517 0.557984 0.123512 0.254154 0.064350 0.490252 0.211976 0.124557 0.173215 0.310463 0.250279 0.132612 0.306646 0.332720 0.248937 0.120633 0.297711 Consensus sequence: BHHASATCAAAGGAHHH Reverse complement motif 0.297711 0.248937 0.120633 0.332720 0.306646 0.250279 0.132612 0.310463 0.173215 0.211976 0.124557 0.490252 0.064350 0.123512 0.254154 0.557984 0.228534 0.523052 0.153897 0.094517 0.159760 0.761341 0.060340 0.018559 0.035720 0.005169 0.023866 0.935245 0.016004 0.004550 0.018815 0.960631 0.029313 0.005036 0.005137 0.960514 0.049387 0.098330 0.815496 0.036787 0.919737 0.007849 0.004559 0.067855 0.255320 0.010314 0.008501 0.725865 0.036338 0.534647 0.377925 0.051091 0.214271 0.053557 0.128214 0.603957 0.383481 0.173780 0.143426 0.299312 0.294150 0.228482 0.140137 0.337231 0.411710 0.196976 0.220503 0.170811 Consensus sequence: HHHTCCTTTGATSTHHV Alignment: BHHASATCAAAGGAHHH --AKGYYCAAAGRTCA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00058 Tcf3_primary Reverse Complement Original Motif Backward 2 14 0.047363 Species: Mus musculus Original motif 0.185864 0.201179 0.183663 0.429294 0.371100 0.233868 0.122934 0.272098 0.249563 0.171285 0.128851 0.450301 0.582940 0.043382 0.129099 0.244578 0.041400 0.395349 0.497087 0.066163 0.759123 0.009670 0.005936 0.225270 0.056579 0.008662 0.003986 0.930772 0.043968 0.865783 0.056001 0.034249 0.962748 0.003731 0.003265 0.030256 0.971318 0.003542 0.012299 0.012841 0.937558 0.003991 0.020195 0.038256 0.125931 0.057976 0.798081 0.018012 0.209401 0.172342 0.483980 0.134277 0.485703 0.129227 0.309936 0.075134 0.397027 0.195902 0.152395 0.254676 0.311636 0.231510 0.157732 0.299122 0.320965 0.206031 0.164299 0.308705 Consensus sequence: HHHASATCAAAGVRHHH Reverse complement motif 0.308705 0.206031 0.164299 0.320965 0.299122 0.231510 0.157732 0.311636 0.254676 0.195902 0.152395 0.397027 0.075134 0.129227 0.309936 0.485703 0.209401 0.483980 0.172342 0.134277 0.125931 0.798081 0.057976 0.018012 0.038256 0.003991 0.020195 0.937558 0.012841 0.003542 0.012299 0.971318 0.030256 0.003731 0.003265 0.962748 0.043968 0.056001 0.865783 0.034249 0.930772 0.008662 0.003986 0.056579 0.225270 0.009670 0.005936 0.759123 0.041400 0.497087 0.395349 0.066163 0.244578 0.043382 0.129099 0.582940 0.450301 0.171285 0.128851 0.249563 0.272098 0.233868 0.122934 0.371100 0.429294 0.201179 0.183663 0.185864 Consensus sequence: HHHKVCTTTGATSTHHH Alignment: HHHASATCAAAGVRHHH --AKGYYCAAAGRTCA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00082 Zfp187_secondary Original Motif Original Motif Forward 1 14 0.048019 Species: Mus musculus Original motif 0.173063 0.169680 0.440836 0.216421 0.353277 0.179996 0.249403 0.217325 0.307337 0.038055 0.616380 0.038228 0.316636 0.564670 0.023732 0.094962 0.015484 0.923764 0.019439 0.041313 0.011243 0.956300 0.009443 0.023014 0.062273 0.107531 0.010739 0.819456 0.126670 0.201521 0.192005 0.479803 0.093090 0.045924 0.835792 0.025194 0.020165 0.015483 0.009567 0.954786 0.010873 0.672448 0.004559 0.312121 0.018002 0.846860 0.017605 0.117533 0.335703 0.408170 0.104095 0.152031 0.150308 0.362296 0.067408 0.419988 0.286490 0.242211 0.176532 0.294767 0.265022 0.249655 0.272219 0.213104 Consensus sequence: DDGMCCTBGTCCHYHV Reverse complement motif 0.265022 0.272219 0.249655 0.213104 0.294767 0.242211 0.176532 0.286490 0.419988 0.362296 0.067408 0.150308 0.335703 0.104095 0.408170 0.152031 0.018002 0.017605 0.846860 0.117533 0.010873 0.004559 0.672448 0.312121 0.954786 0.015483 0.009567 0.020165 0.093090 0.835792 0.045924 0.025194 0.479803 0.201521 0.192005 0.126670 0.819456 0.107531 0.010739 0.062273 0.011243 0.009443 0.956300 0.023014 0.015484 0.019439 0.923764 0.041313 0.316636 0.023732 0.564670 0.094962 0.307337 0.616380 0.038055 0.038228 0.217325 0.179996 0.249403 0.353277 0.173063 0.440836 0.169680 0.216421 Consensus sequence: VHMDGGACVAGGRCDH Alignment: DDGMCCTBGTCCHYHV TGAMCTTTGMMCYT-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00062 Sox4_primary Original Motif Reverse Complement Forward 2 14 0.049545 Species: Mus musculus Original motif 0.427843 0.231210 0.119424 0.221523 0.196506 0.239531 0.304906 0.259057 0.302488 0.156922 0.290190 0.250401 0.433872 0.149126 0.196496 0.220506 0.258426 0.076511 0.475100 0.189963 0.841714 0.046453 0.099915 0.011918 0.983853 0.001612 0.001362 0.013174 0.003460 0.982032 0.005728 0.008780 0.989743 0.002253 0.002020 0.005984 0.990761 0.003397 0.002843 0.003000 0.770864 0.003540 0.001549 0.224048 0.235342 0.002598 0.757383 0.004677 0.371426 0.089574 0.529959 0.009040 0.480804 0.196949 0.240413 0.081833 0.187158 0.355102 0.216599 0.241142 0.248006 0.232182 0.157452 0.362360 0.403367 0.177684 0.164649 0.254300 Consensus sequence: HBDDDAACAAAGRVBHH Reverse complement motif 0.254300 0.177684 0.164649 0.403367 0.362360 0.232182 0.157452 0.248006 0.187158 0.216599 0.355102 0.241142 0.081833 0.196949 0.240413 0.480804 0.371426 0.529959 0.089574 0.009040 0.235342 0.757383 0.002598 0.004677 0.224048 0.003540 0.001549 0.770864 0.003000 0.003397 0.002843 0.990761 0.005984 0.002253 0.002020 0.989743 0.003460 0.005728 0.982032 0.008780 0.013174 0.001612 0.001362 0.983853 0.011918 0.046453 0.099915 0.841714 0.258426 0.475100 0.076511 0.189963 0.220506 0.149126 0.196496 0.433872 0.250401 0.156922 0.290190 0.302488 0.196506 0.304906 0.239531 0.259057 0.221523 0.231210 0.119424 0.427843 Consensus sequence: HHBBMCTTTGTTHDDBH Alignment: HHBBMCTTTGTTHDDBH -TGAMCTTTGMMCYT-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00030 Sox11_primary Original Motif Reverse Complement Backward 3 14 0.049903 Species: Mus musculus Original motif 0.351812 0.238467 0.143954 0.265768 0.195246 0.235838 0.281473 0.287443 0.349478 0.172616 0.210739 0.267167 0.484061 0.110438 0.173131 0.232370 0.276692 0.070713 0.479604 0.172991 0.859124 0.044167 0.083951 0.012758 0.975608 0.002029 0.002285 0.020079 0.006422 0.978485 0.007124 0.007969 0.987489 0.003025 0.002868 0.006617 0.987739 0.005463 0.002730 0.004067 0.693013 0.004067 0.002445 0.300475 0.189100 0.003677 0.801408 0.005814 0.352090 0.072517 0.567737 0.007656 0.542316 0.176545 0.192768 0.088371 0.196382 0.304176 0.205985 0.293457 0.289415 0.201358 0.182937 0.326290 0.385801 0.216362 0.152363 0.245475 Consensus sequence: HBDDRAACAAAGRABHH Reverse complement motif 0.245475 0.216362 0.152363 0.385801 0.326290 0.201358 0.182937 0.289415 0.196382 0.205985 0.304176 0.293457 0.088371 0.176545 0.192768 0.542316 0.352090 0.567737 0.072517 0.007656 0.189100 0.801408 0.003677 0.005814 0.300475 0.004067 0.002445 0.693013 0.004067 0.005463 0.002730 0.987739 0.006617 0.003025 0.002868 0.987489 0.006422 0.007124 0.978485 0.007969 0.020079 0.002029 0.002285 0.975608 0.012758 0.044167 0.083951 0.859124 0.276692 0.479604 0.070713 0.172991 0.232370 0.110438 0.173131 0.484061 0.267167 0.172616 0.210739 0.349478 0.287443 0.235838 0.281473 0.195246 0.265768 0.238467 0.143954 0.351812 Consensus sequence: HHBTMCTTTGTTMDDVH Alignment: HHBTMCTTTGTTMDDVH -TGAMCTTTGMMCYT-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00023 Sox30_primary Original Motif Original Motif Forward 3 14 0.051153 Species: Mus musculus Original motif 0.372432 0.102933 0.322145 0.202491 0.328072 0.182071 0.157347 0.332510 0.289417 0.084511 0.292873 0.333198 0.157571 0.227851 0.441662 0.172917 0.716832 0.049010 0.201411 0.032747 0.957368 0.003162 0.004402 0.035068 0.003907 0.862678 0.009407 0.124008 0.977231 0.007658 0.004263 0.010847 0.976481 0.004510 0.015225 0.003784 0.067568 0.004353 0.005071 0.923008 0.158205 0.108442 0.467023 0.266330 0.334549 0.091557 0.510241 0.063654 0.456431 0.182602 0.150234 0.210732 0.387485 0.241062 0.151504 0.219950 0.188387 0.269857 0.176514 0.365242 0.175680 0.243984 0.165833 0.414502 Consensus sequence: DHDBAACAATDRHHHH Reverse complement motif 0.414502 0.243984 0.165833 0.175680 0.365242 0.269857 0.176514 0.188387 0.219950 0.241062 0.151504 0.387485 0.210732 0.182602 0.150234 0.456431 0.334549 0.510241 0.091557 0.063654 0.158205 0.467023 0.108442 0.266330 0.923008 0.004353 0.005071 0.067568 0.003784 0.004510 0.015225 0.976481 0.010847 0.007658 0.004263 0.977231 0.003907 0.009407 0.862678 0.124008 0.035068 0.003162 0.004402 0.957368 0.032747 0.049010 0.201411 0.716832 0.157571 0.441662 0.227851 0.172917 0.333198 0.084511 0.292873 0.289417 0.332510 0.182071 0.157347 0.328072 0.202491 0.102933 0.322145 0.372432 Consensus sequence: HHHHMHATTGTTBDHD Alignment: DHDBAACAATDRHHHH --TGAMCTTTGMMCYT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00005 Tcfap2a_secondary Reverse Complement Reverse Complement Backward 1 14 0.051697 Species: Mus musculus Original motif 0.198427 0.243196 0.159241 0.399136 0.267754 0.388187 0.116811 0.227248 0.448284 0.056403 0.414623 0.080691 0.031469 0.826323 0.055436 0.086772 0.035527 0.756642 0.022985 0.184845 0.127338 0.316078 0.155806 0.400778 0.135021 0.313650 0.287760 0.263570 0.418892 0.082297 0.068352 0.430460 0.201062 0.044735 0.711358 0.042845 0.038934 0.022320 0.903763 0.034982 0.201790 0.065554 0.460526 0.272130 0.006890 0.786923 0.061853 0.144334 0.460666 0.103658 0.196452 0.239224 0.092272 0.204611 0.390375 0.312742 Consensus sequence: HHRCCBBWGGDCDB Reverse complement motif 0.092272 0.390375 0.204611 0.312742 0.239224 0.103658 0.196452 0.460666 0.006890 0.061853 0.786923 0.144334 0.201790 0.460526 0.065554 0.272130 0.038934 0.903763 0.022320 0.034982 0.201062 0.711358 0.044735 0.042845 0.430460 0.082297 0.068352 0.418892 0.135021 0.287760 0.313650 0.263570 0.400778 0.316078 0.155806 0.127338 0.035527 0.022985 0.756642 0.184845 0.031469 0.055436 0.826323 0.086772 0.080691 0.056403 0.414623 0.448284 0.267754 0.116811 0.388187 0.227248 0.399136 0.243196 0.159241 0.198427 Consensus sequence: BDGHCCWBVGGKDH Alignment: BDGHCCWBVGGKDH AKGYYCAAAGRTCA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 3 Motif ID: 53 Motif name: ESR1 Original motif 0.261242 0.256959 0.329764 0.152034 0.228632 0.170940 0.350427 0.250000 0.136752 0.369658 0.318376 0.175214 0.176596 0.487234 0.138298 0.197872 0.285106 0.493617 0.100000 0.121277 0.651163 0.059197 0.188161 0.101480 0.075949 0.016878 0.816456 0.090717 0.040000 0.037895 0.884211 0.037895 0.069474 0.086316 0.191579 0.652632 0.008421 0.829474 0.111579 0.050526 0.837895 0.027368 0.056842 0.077895 0.122105 0.526316 0.225263 0.126316 0.132632 0.581053 0.111579 0.174737 0.134737 0.543158 0.204211 0.117895 0.067368 0.040000 0.016842 0.875789 0.044211 0.046316 0.896842 0.012632 0.642105 0.223158 0.065263 0.069474 0.021053 0.917895 0.025263 0.035789 0.124211 0.743158 0.004211 0.128421 0.054737 0.347368 0.046316 0.551579 Consensus sequence: VDBHMAGGTCACCCTGACCY Reserve complement motif 0.551579 0.347368 0.046316 0.054737 0.124211 0.004211 0.743158 0.128421 0.021053 0.025263 0.917895 0.035789 0.069474 0.223158 0.065263 0.642105 0.044211 0.896842 0.046316 0.012632 0.875789 0.040000 0.016842 0.067368 0.134737 0.204211 0.543158 0.117895 0.132632 0.111579 0.581053 0.174737 0.122105 0.225263 0.526316 0.126316 0.077895 0.027368 0.056842 0.837895 0.008421 0.111579 0.829474 0.050526 0.652632 0.086316 0.191579 0.069474 0.040000 0.884211 0.037895 0.037895 0.075949 0.816456 0.016878 0.090717 0.101480 0.059197 0.188161 0.651163 0.285106 0.100000 0.493617 0.121277 0.176596 0.138298 0.487234 0.197872 0.136752 0.318376 0.369658 0.175214 0.228632 0.350427 0.170940 0.250000 0.261242 0.329764 0.256959 0.152034 Consensus sequence: MGGTCAGGGTGACCTRDBHV ************************************************************************ Best Matches for Motif ID 53 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v016060_secondary Original Motif Reverse Complement Backward 4 20 0.065841 Species: Mus musculus Original motif 0.319838 0.171199 0.138099 0.370865 0.269358 0.196600 0.346909 0.187133 0.176807 0.338888 0.193903 0.290402 0.230268 0.119645 0.310500 0.339587 0.517372 0.257658 0.111673 0.113296 0.159477 0.126524 0.561119 0.152879 0.117072 0.553013 0.130919 0.198996 0.073372 0.163548 0.525014 0.238066 0.143608 0.186896 0.170528 0.498967 0.054943 0.079034 0.722992 0.143031 0.048852 0.015134 0.852458 0.083556 0.029001 0.023938 0.918900 0.028160 0.036727 0.092645 0.090591 0.780037 0.017757 0.057598 0.895222 0.029423 0.026113 0.048113 0.879744 0.046030 0.023041 0.787043 0.123490 0.066426 0.579766 0.004868 0.296873 0.118493 0.303862 0.042931 0.290151 0.363055 0.099672 0.237431 0.262301 0.400597 0.217788 0.163908 0.367628 0.250676 0.450783 0.141108 0.226137 0.181972 0.485086 0.102553 0.242662 0.169700 0.109057 0.454222 0.145665 0.291056 Consensus sequence: HVBDAGCGBGGGTGGCRDBDDDB Reverse complement motif 0.109057 0.145665 0.454222 0.291056 0.169700 0.102553 0.242662 0.485086 0.181972 0.141108 0.226137 0.450783 0.217788 0.367628 0.163908 0.250676 0.400597 0.237431 0.262301 0.099672 0.363055 0.042931 0.290151 0.303862 0.118493 0.004868 0.296873 0.579766 0.023041 0.123490 0.787043 0.066426 0.026113 0.879744 0.048113 0.046030 0.017757 0.895222 0.057598 0.029423 0.780037 0.092645 0.090591 0.036727 0.029001 0.918900 0.023938 0.028160 0.048852 0.852458 0.015134 0.083556 0.054943 0.722992 0.079034 0.143031 0.498967 0.186896 0.170528 0.143608 0.073372 0.525014 0.163548 0.238066 0.117072 0.130919 0.553013 0.198996 0.159477 0.561119 0.126524 0.152879 0.113296 0.257658 0.111673 0.517372 0.339587 0.119645 0.310500 0.230268 0.176807 0.193903 0.338888 0.290402 0.269358 0.346909 0.196600 0.187133 0.370865 0.171199 0.138099 0.319838 Consensus sequence: BDDHVDKGCCACCCVCGCTDBVH Alignment: BDDHVDKGCCACCCVCGCTDBVH VDBHMAGGTCACCCTGACCY--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00098 Rfx3_secondary Original Motif Reverse Complement Forward 1 20 0.068975 Species: Mus musculus Original motif 0.314514 0.275352 0.257617 0.152518 0.126939 0.598294 0.130576 0.144192 0.102265 0.155334 0.177957 0.564445 0.129288 0.282678 0.326990 0.261044 0.318166 0.227823 0.175681 0.278330 0.109019 0.380838 0.278328 0.231815 0.226145 0.289206 0.291300 0.193348 0.035863 0.844339 0.072582 0.047216 0.223793 0.187244 0.088092 0.500871 0.039800 0.029681 0.026201 0.904317 0.298298 0.032147 0.654746 0.014809 0.014729 0.022023 0.944826 0.018422 0.485114 0.004925 0.013785 0.496176 0.035708 0.020381 0.240804 0.703108 0.951152 0.012738 0.017886 0.018224 0.023713 0.944394 0.009538 0.022355 0.291067 0.385205 0.232388 0.091339 0.340334 0.199588 0.311526 0.148552 0.198713 0.472138 0.178319 0.150830 0.321155 0.269932 0.311301 0.097612 0.412646 0.195252 0.231950 0.160152 0.297134 0.180928 0.250400 0.271538 0.151169 0.305386 0.358574 0.184871 Consensus sequence: VCTBHBVCTTGGWTACVVVVVDB Reverse complement motif 0.151169 0.358574 0.305386 0.184871 0.271538 0.180928 0.250400 0.297134 0.160152 0.195252 0.231950 0.412646 0.097612 0.269932 0.311301 0.321155 0.198713 0.178319 0.472138 0.150830 0.148552 0.199588 0.311526 0.340334 0.291067 0.232388 0.385205 0.091339 0.023713 0.009538 0.944394 0.022355 0.018224 0.012738 0.017886 0.951152 0.703108 0.020381 0.240804 0.035708 0.496176 0.004925 0.013785 0.485114 0.014729 0.944826 0.022023 0.018422 0.298298 0.654746 0.032147 0.014809 0.904317 0.029681 0.026201 0.039800 0.500871 0.187244 0.088092 0.223793 0.035863 0.072582 0.844339 0.047216 0.226145 0.291300 0.289206 0.193348 0.109019 0.278328 0.380838 0.231815 0.278330 0.227823 0.175681 0.318166 0.129288 0.326990 0.282678 0.261044 0.564445 0.155334 0.177957 0.102265 0.126939 0.130576 0.598294 0.144192 0.152518 0.275352 0.257617 0.314514 Consensus sequence: BDBBVBVGTAWCCAAGVBHBAGB Alignment: BDBBVBVGTAWCCAAGVBHBAGB VDBHMAGGTCACCCTGACCY--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v015681_primary Reverse Complement Reverse Complement Backward 3 20 0.070125 Species: Mus musculus Original motif 0.472795 0.179227 0.091251 0.256726 0.036521 0.159743 0.204840 0.598896 0.164582 0.312805 0.221324 0.301289 0.237069 0.249050 0.293048 0.220833 0.401949 0.225181 0.229401 0.143469 0.161422 0.494334 0.252207 0.092036 0.252940 0.177721 0.369400 0.199939 0.119630 0.024651 0.849920 0.005798 0.000962 0.002398 0.990616 0.006023 0.937852 0.027016 0.034535 0.000597 0.008963 0.987756 0.000629 0.002652 0.001584 0.992898 0.002349 0.003169 0.956822 0.027342 0.002484 0.013352 0.009873 0.987759 0.000988 0.001381 0.016397 0.980856 0.000369 0.002378 0.081761 0.758555 0.038572 0.121112 0.371713 0.091838 0.448027 0.088423 0.111617 0.121913 0.683885 0.082585 0.334562 0.102916 0.436488 0.126034 0.210362 0.101261 0.238339 0.450037 0.169041 0.271583 0.320799 0.238576 0.140316 0.049885 0.735236 0.074563 Consensus sequence: HTBVVVDGGACCACCCRGRDBG Reverse complement motif 0.140316 0.735236 0.049885 0.074563 0.169041 0.320799 0.271583 0.238576 0.450037 0.101261 0.238339 0.210362 0.334562 0.436488 0.102916 0.126034 0.111617 0.683885 0.121913 0.082585 0.371713 0.448027 0.091838 0.088423 0.081761 0.038572 0.758555 0.121112 0.016397 0.000369 0.980856 0.002378 0.009873 0.000988 0.987759 0.001381 0.013352 0.027342 0.002484 0.956822 0.001584 0.002349 0.992898 0.003169 0.008963 0.000629 0.987756 0.002652 0.000597 0.027016 0.034535 0.937852 0.000962 0.990616 0.002398 0.006023 0.119630 0.849920 0.024651 0.005798 0.252940 0.369400 0.177721 0.199939 0.161422 0.252207 0.494334 0.092036 0.143469 0.225181 0.229401 0.401949 0.237069 0.293048 0.249050 0.220833 0.164582 0.221324 0.312805 0.301289 0.598896 0.159743 0.204840 0.036521 0.256726 0.179227 0.091251 0.472795 Consensus sequence: CBDMCMGGGTGGTCCHVBVBAH Alignment: CBDMCMGGGTGGTCCHVBVBAH MGGTCAGGGTGACCTRDBHV-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v015681_secondary Reverse Complement Original Motif Backward 3 20 0.071127 Species: Mus musculus Original motif 0.331499 0.188505 0.182841 0.297156 0.328961 0.213025 0.273530 0.184484 0.197213 0.129292 0.524914 0.148581 0.274491 0.226406 0.312118 0.186986 0.103231 0.393726 0.364988 0.138055 0.552594 0.166422 0.186262 0.094722 0.157618 0.064773 0.616497 0.161112 0.139166 0.176098 0.621185 0.063551 0.748420 0.062398 0.012447 0.176735 0.116584 0.009438 0.860326 0.013653 0.005030 0.003646 0.974877 0.016447 0.055257 0.007181 0.921760 0.015802 0.032748 0.058249 0.052709 0.856293 0.105606 0.872231 0.014370 0.007793 0.019480 0.497379 0.125899 0.357242 0.478582 0.269713 0.061464 0.190242 0.253985 0.287006 0.201320 0.257689 0.319384 0.210231 0.175842 0.294543 0.222123 0.287802 0.201294 0.288782 0.139951 0.376041 0.081133 0.402875 0.213450 0.343835 0.383676 0.059039 0.322294 0.355918 0.148062 0.173725 Consensus sequence: HVGVSAGGAGGGTCYHHHHYVH Reverse complement motif 0.322294 0.148062 0.355918 0.173725 0.213450 0.383676 0.343835 0.059039 0.402875 0.376041 0.081133 0.139951 0.288782 0.287802 0.201294 0.222123 0.294543 0.210231 0.175842 0.319384 0.253985 0.201320 0.287006 0.257689 0.190242 0.269713 0.061464 0.478582 0.019480 0.125899 0.497379 0.357242 0.105606 0.014370 0.872231 0.007793 0.856293 0.058249 0.052709 0.032748 0.055257 0.921760 0.007181 0.015802 0.005030 0.974877 0.003646 0.016447 0.116584 0.860326 0.009438 0.013653 0.176735 0.062398 0.012447 0.748420 0.139166 0.621185 0.176098 0.063551 0.157618 0.616497 0.064773 0.161112 0.094722 0.166422 0.186262 0.552594 0.103231 0.364988 0.393726 0.138055 0.274491 0.312118 0.226406 0.186986 0.197213 0.524914 0.129292 0.148581 0.184484 0.213025 0.273530 0.328961 0.297156 0.188505 0.182841 0.331499 Consensus sequence: DVMHHDHKGACCCTCCTSVCBH Alignment: HVGVSAGGAGGGTCYHHHHYVH MGGTCAGGGTGACCTRDBHV-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v016060_primary Original Motif Reverse Complement Forward 2 20 0.074243 Species: Mus musculus Original motif 0.180868 0.321661 0.134642 0.362829 0.232215 0.134289 0.315356 0.318141 0.065068 0.093681 0.569842 0.271408 0.370822 0.229680 0.154738 0.244759 0.323039 0.182873 0.173588 0.320500 0.175039 0.266898 0.276080 0.281984 0.412669 0.147730 0.146326 0.293275 0.325953 0.028805 0.629596 0.015646 0.003017 0.001766 0.979711 0.015507 0.888973 0.040666 0.069420 0.000941 0.017309 0.979155 0.000899 0.002637 0.001732 0.988816 0.004856 0.004596 0.889763 0.078125 0.010384 0.021729 0.007566 0.987081 0.001421 0.003932 0.027797 0.966593 0.000878 0.004731 0.025816 0.867003 0.065749 0.041433 0.220658 0.075256 0.582904 0.121182 0.088946 0.283695 0.565345 0.062015 0.328012 0.241332 0.305901 0.124755 0.307302 0.137589 0.375928 0.179181 0.298752 0.231470 0.315255 0.154524 0.094565 0.142901 0.705696 0.056838 Consensus sequence: HDGHHBHRGACCACCCGSVDVG Reverse complement motif 0.094565 0.705696 0.142901 0.056838 0.298752 0.315255 0.231470 0.154524 0.307302 0.375928 0.137589 0.179181 0.124755 0.241332 0.305901 0.328012 0.088946 0.565345 0.283695 0.062015 0.220658 0.582904 0.075256 0.121182 0.025816 0.065749 0.867003 0.041433 0.027797 0.000878 0.966593 0.004731 0.007566 0.001421 0.987081 0.003932 0.021729 0.078125 0.010384 0.889763 0.001732 0.004856 0.988816 0.004596 0.017309 0.000899 0.979155 0.002637 0.000941 0.040666 0.069420 0.888973 0.003017 0.979711 0.001766 0.015507 0.325953 0.629596 0.028805 0.015646 0.293275 0.147730 0.146326 0.412669 0.281984 0.266898 0.276080 0.175039 0.320500 0.182873 0.173588 0.323039 0.244759 0.229680 0.154738 0.370822 0.065068 0.569842 0.093681 0.271408 0.318141 0.134289 0.315356 0.232215 0.362829 0.321661 0.134642 0.180868 Consensus sequence: CVHBSCGGGTGGTCMHVHHCDH Alignment: CVHBSCGGGTGGTCMHVHHCDH -VDBHMAGGTCACCCTGACCY- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v015681_primary Original Motif Original Motif Backward 2 20 0.074705 Species: Mus musculus Original motif 0.641428 0.180211 0.044767 0.133594 0.171696 0.262981 0.334148 0.231174 0.129726 0.322735 0.243462 0.304077 0.165713 0.175735 0.256108 0.402445 0.146090 0.171890 0.412753 0.269266 0.212837 0.439192 0.280990 0.066980 0.251088 0.275516 0.374380 0.099015 0.575438 0.079656 0.338201 0.006704 0.005634 0.003422 0.972597 0.018348 0.890447 0.077034 0.031851 0.000668 0.007128 0.986862 0.000496 0.005515 0.001445 0.991564 0.001925 0.005066 0.738761 0.190157 0.026399 0.044684 0.013384 0.983783 0.000896 0.001937 0.068077 0.929549 0.000773 0.001602 0.040830 0.933742 0.005283 0.020145 0.730274 0.029225 0.145689 0.094812 0.165032 0.572838 0.162001 0.100129 0.383584 0.129942 0.429497 0.056977 0.455959 0.071959 0.208204 0.263878 0.134271 0.262985 0.222626 0.380117 0.071193 0.346594 0.346081 0.236132 0.445661 0.405278 0.053901 0.095160 Consensus sequence: ABBBBVVRGACCACCCACRDBBM Reverse complement motif 0.095160 0.405278 0.053901 0.445661 0.071193 0.346081 0.346594 0.236132 0.380117 0.262985 0.222626 0.134271 0.263878 0.071959 0.208204 0.455959 0.383584 0.429497 0.129942 0.056977 0.165032 0.162001 0.572838 0.100129 0.094812 0.029225 0.145689 0.730274 0.040830 0.005283 0.933742 0.020145 0.068077 0.000773 0.929549 0.001602 0.013384 0.000896 0.983783 0.001937 0.044684 0.190157 0.026399 0.738761 0.001445 0.001925 0.991564 0.005066 0.007128 0.000496 0.986862 0.005515 0.000668 0.077034 0.031851 0.890447 0.005634 0.972597 0.003422 0.018348 0.006704 0.079656 0.338201 0.575438 0.251088 0.374380 0.275516 0.099015 0.212837 0.280990 0.439192 0.066980 0.146090 0.412753 0.171890 0.269266 0.402445 0.175735 0.256108 0.165713 0.129726 0.243462 0.322735 0.304077 0.171696 0.334148 0.262981 0.231174 0.133594 0.180211 0.044767 0.641428 Consensus sequence: YBVDMGTGGGTGGTCKVVBVBBT Alignment: ABBBBVVRGACCACCCACRDBBM --VDBHMAGGTCACCCTGACCY- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v016060_primary Original Motif Original Motif Forward 4 20 0.074917 Species: Mus musculus Original motif 0.204923 0.208846 0.365383 0.220848 0.294304 0.300143 0.167287 0.238266 0.109711 0.619514 0.117379 0.153396 0.178979 0.378580 0.230177 0.212264 0.159594 0.542602 0.118178 0.179627 0.125206 0.430074 0.151826 0.292894 0.097692 0.709845 0.116956 0.075506 0.148292 0.565912 0.037632 0.248164 0.077951 0.034190 0.855503 0.032356 0.001657 0.001061 0.971877 0.025405 0.001926 0.001084 0.991712 0.005278 0.033031 0.012001 0.057796 0.897171 0.002723 0.002647 0.993348 0.001281 0.003261 0.000963 0.987199 0.008577 0.000611 0.090925 0.074857 0.833608 0.015299 0.978878 0.004949 0.000874 0.013368 0.600902 0.033485 0.352245 0.231949 0.149575 0.118804 0.499672 0.267580 0.186002 0.371242 0.175176 0.264884 0.223483 0.110082 0.401551 0.221365 0.170121 0.179559 0.428955 0.112997 0.692930 0.139981 0.054092 0.460305 0.207883 0.155111 0.176702 Consensus sequence: BHCBCBCCGGGTGGTCYHVHDCH Reverse complement motif 0.176702 0.207883 0.155111 0.460305 0.112997 0.139981 0.692930 0.054092 0.428955 0.170121 0.179559 0.221365 0.401551 0.223483 0.110082 0.264884 0.267580 0.371242 0.186002 0.175176 0.499672 0.149575 0.118804 0.231949 0.013368 0.033485 0.600902 0.352245 0.015299 0.004949 0.978878 0.000874 0.833608 0.090925 0.074857 0.000611 0.003261 0.987199 0.000963 0.008577 0.002723 0.993348 0.002647 0.001281 0.897171 0.012001 0.057796 0.033031 0.001926 0.991712 0.001084 0.005278 0.001657 0.971877 0.001061 0.025405 0.077951 0.855503 0.034190 0.032356 0.148292 0.037632 0.565912 0.248164 0.097692 0.116956 0.709845 0.075506 0.125206 0.151826 0.430074 0.292894 0.159594 0.118178 0.542602 0.179627 0.178979 0.230177 0.378580 0.212264 0.109711 0.117379 0.619514 0.153396 0.294304 0.167287 0.300143 0.238266 0.204923 0.365383 0.208846 0.220848 Consensus sequence: HGDHVHKGACCACCCGGBGBGDB Alignment: BHCBCBCCGGGTGGTCYHVHDCH ---VDBHMAGGTCACCCTGACCY ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v015681_primary Original Motif Original Motif Forward 2 20 0.075931 Species: Mus musculus Original motif 0.183797 0.268049 0.330111 0.218043 0.127599 0.330310 0.243614 0.298477 0.143199 0.188046 0.268593 0.400162 0.214690 0.205230 0.247090 0.332990 0.294688 0.299104 0.327152 0.079056 0.221909 0.193223 0.480155 0.104712 0.444072 0.068239 0.481838 0.005852 0.006182 0.015429 0.901278 0.077111 0.766535 0.111138 0.121632 0.000696 0.014848 0.973961 0.000298 0.010893 0.001807 0.992200 0.002669 0.003324 0.795344 0.140510 0.018576 0.045571 0.006990 0.988200 0.002510 0.002299 0.154898 0.842296 0.000998 0.001808 0.029577 0.919262 0.006935 0.044226 0.677987 0.032075 0.185065 0.104874 0.195132 0.364580 0.319321 0.120967 0.225412 0.115034 0.612849 0.046705 0.548628 0.058900 0.162857 0.229616 0.112531 0.340331 0.165910 0.381227 0.073029 0.303078 0.363896 0.259997 0.561485 0.260567 0.092979 0.084969 0.132283 0.457691 0.140159 0.269867 Consensus sequence: BBBDVVRGACCACCCAVGABBAB Reverse complement motif 0.132283 0.140159 0.457691 0.269867 0.084969 0.260567 0.092979 0.561485 0.073029 0.363896 0.303078 0.259997 0.381227 0.340331 0.165910 0.112531 0.229616 0.058900 0.162857 0.548628 0.225412 0.612849 0.115034 0.046705 0.195132 0.319321 0.364580 0.120967 0.104874 0.032075 0.185065 0.677987 0.029577 0.006935 0.919262 0.044226 0.154898 0.000998 0.842296 0.001808 0.006990 0.002510 0.988200 0.002299 0.045571 0.140510 0.018576 0.795344 0.001807 0.002669 0.992200 0.003324 0.014848 0.000298 0.973961 0.010893 0.000696 0.111138 0.121632 0.766535 0.006182 0.901278 0.015429 0.077111 0.444072 0.481838 0.068239 0.005852 0.221909 0.480155 0.193223 0.104712 0.294688 0.327152 0.299104 0.079056 0.332990 0.205230 0.247090 0.214690 0.400162 0.188046 0.268593 0.143199 0.127599 0.243614 0.330310 0.298477 0.183797 0.330111 0.268049 0.218043 Consensus sequence: BTBVTCVTGGGTGGTCMVVDVBB Alignment: BBBDVVRGACCACCCAVGABBAB -VDBHMAGGTCACCCTGACCY-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00400 Zif268 Reverse Complement Reverse Complement Backward 3 20 0.076269 Species: Mus musculus Original motif 0.104824 0.412716 0.254506 0.227955 0.644922 0.065476 0.140479 0.149122 0.201205 0.166164 0.347131 0.285501 0.360606 0.256316 0.150766 0.232313 0.199831 0.240681 0.279350 0.280137 0.234308 0.204076 0.321306 0.240310 0.274112 0.462435 0.111425 0.152028 0.067070 0.717501 0.073934 0.141496 0.106745 0.084442 0.658566 0.150247 0.025128 0.967053 0.003585 0.004234 0.006412 0.982989 0.003227 0.007371 0.009588 0.877620 0.002571 0.110221 0.621521 0.355443 0.015669 0.007366 0.002600 0.980275 0.004191 0.012934 0.118773 0.026658 0.783843 0.070725 0.022358 0.822101 0.024684 0.130857 0.713212 0.080912 0.128793 0.077084 0.166568 0.250955 0.107934 0.474544 0.225040 0.222494 0.163301 0.389166 0.268976 0.223206 0.265314 0.242504 0.137052 0.229058 0.148439 0.485451 0.135819 0.304550 0.141994 0.417637 0.272440 0.319501 0.230580 0.177478 Consensus sequence: BADHBDHCGCCCMCGCAHHDBBV Reverse complement motif 0.272440 0.230580 0.319501 0.177478 0.417637 0.304550 0.141994 0.135819 0.485451 0.229058 0.148439 0.137052 0.242504 0.223206 0.265314 0.268976 0.389166 0.222494 0.163301 0.225040 0.474544 0.250955 0.107934 0.166568 0.077084 0.080912 0.128793 0.713212 0.022358 0.024684 0.822101 0.130857 0.118773 0.783843 0.026658 0.070725 0.002600 0.004191 0.980275 0.012934 0.007366 0.355443 0.015669 0.621521 0.009588 0.002571 0.877620 0.110221 0.006412 0.003227 0.982989 0.007371 0.025128 0.003585 0.967053 0.004234 0.106745 0.658566 0.084442 0.150247 0.067070 0.073934 0.717501 0.141496 0.274112 0.111425 0.462435 0.152028 0.234308 0.321306 0.204076 0.240310 0.280137 0.240681 0.279350 0.199831 0.232313 0.256316 0.150766 0.360606 0.201205 0.347131 0.166164 0.285501 0.149122 0.065476 0.140479 0.644922 0.104824 0.254506 0.412716 0.227955 Consensus sequence: VVVDHHTGCGYGGGCGDHVHHTB Alignment: VVVDHHTGCGYGGGCGDHVHHTB -MGGTCAGGGTGACCTRDBHV-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00034 Sox7_secondary Original Motif Original Motif Forward 1 20 0.078011 Species: Mus musculus Original motif 0.067627 0.131333 0.654425 0.146615 0.156488 0.114442 0.145630 0.583441 0.206450 0.265630 0.358017 0.169903 0.090729 0.460713 0.274712 0.173847 0.285994 0.099998 0.154485 0.459523 0.635908 0.184787 0.072982 0.106323 0.748421 0.039204 0.092605 0.119769 0.081342 0.061327 0.044532 0.812799 0.143120 0.043879 0.024216 0.788785 0.247544 0.092102 0.621453 0.038901 0.295531 0.036295 0.027594 0.640580 0.194561 0.305468 0.339916 0.160055 0.175038 0.193568 0.101212 0.530182 0.145226 0.167488 0.559871 0.127415 0.271501 0.237429 0.206701 0.284369 0.216834 0.109191 0.569605 0.104370 0.182624 0.177160 0.300475 0.339742 0.331737 0.198645 0.265137 0.204482 0.230155 0.359365 0.183450 0.227029 0.056581 0.067297 0.463052 0.413070 0.198891 0.324626 0.304424 0.172059 0.181968 0.287547 0.202419 0.328066 Consensus sequence: GTVBDAATTGTVTGHGDDHKVB Reverse complement motif 0.328066 0.287547 0.202419 0.181968 0.198891 0.304424 0.324626 0.172059 0.056581 0.463052 0.067297 0.413070 0.230155 0.183450 0.359365 0.227029 0.204482 0.198645 0.265137 0.331737 0.339742 0.177160 0.300475 0.182624 0.216834 0.569605 0.109191 0.104370 0.284369 0.237429 0.206701 0.271501 0.145226 0.559871 0.167488 0.127415 0.530182 0.193568 0.101212 0.175038 0.194561 0.339916 0.305468 0.160055 0.640580 0.036295 0.027594 0.295531 0.247544 0.621453 0.092102 0.038901 0.788785 0.043879 0.024216 0.143120 0.812799 0.061327 0.044532 0.081342 0.119769 0.039204 0.092605 0.748421 0.106323 0.184787 0.072982 0.635908 0.459523 0.099998 0.154485 0.285994 0.090729 0.274712 0.460713 0.173847 0.206450 0.358017 0.265630 0.169903 0.583441 0.114442 0.145630 0.156488 0.067627 0.654425 0.131333 0.146615 Consensus sequence: VVYDDDCHCAVACAATTDBVAC Alignment: GTVBDAATTGTVTGHGDDHKVB VDBHMAGGTCACCCTGACCY-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 3 Motif ID: 54 Motif name: Esrrb Original motif 0.290198 0.220264 0.271200 0.218337 0.184941 0.227810 0.376477 0.210772 0.115226 0.332236 0.331687 0.220850 0.070959 0.342466 0.122740 0.463836 0.084862 0.729264 0.171640 0.014235 0.909737 0.008753 0.067834 0.013676 0.975656 0.000547 0.016411 0.007385 0.008758 0.001368 0.981390 0.008484 0.005750 0.003286 0.986309 0.004655 0.049904 0.012613 0.066904 0.870579 0.002473 0.927473 0.046703 0.023352 0.951569 0.005504 0.035498 0.007430 Consensus sequence: VBBYCAAGGTCA Reserve complement motif 0.007430 0.005504 0.035498 0.951569 0.002473 0.046703 0.927473 0.023352 0.870579 0.012613 0.066904 0.049904 0.005750 0.986309 0.003286 0.004655 0.008758 0.981390 0.001368 0.008484 0.007385 0.000547 0.016411 0.975656 0.013676 0.008753 0.067834 0.909737 0.084862 0.171640 0.729264 0.014235 0.463836 0.342466 0.122740 0.070959 0.115226 0.331687 0.332236 0.220850 0.184941 0.376477 0.227810 0.210772 0.218337 0.220264 0.271200 0.290198 Consensus sequence: TGACCTTGMBBB ************************************************************************ Best Matches for Motif ID 54 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00079 Esrra_primary Reverse Complement Reverse Complement Forward 6 12 0.000000 Species: Mus musculus Original motif 0.212524 0.177958 0.293723 0.315796 0.420838 0.283140 0.144938 0.151084 0.198119 0.196347 0.260353 0.345181 0.117752 0.282184 0.137207 0.462857 0.070125 0.781439 0.138093 0.010344 0.965989 0.000956 0.023828 0.009227 0.977263 0.003066 0.019255 0.000416 0.007404 0.000267 0.938934 0.053395 0.007147 0.000287 0.983377 0.009190 0.039608 0.000730 0.040682 0.918981 0.000685 0.905345 0.021930 0.072040 0.800961 0.001126 0.195791 0.002121 0.245039 0.241263 0.038084 0.475614 0.265397 0.238316 0.304963 0.191325 0.203742 0.286208 0.231002 0.279048 0.194132 0.188854 0.346693 0.270322 0.310711 0.263840 0.184317 0.241132 Consensus sequence: DHDBCAAGGTCAHVBDH Reverse complement motif 0.241132 0.263840 0.184317 0.310711 0.194132 0.346693 0.188854 0.270322 0.203742 0.231002 0.286208 0.279048 0.265397 0.304963 0.238316 0.191325 0.475614 0.241263 0.038084 0.245039 0.002121 0.001126 0.195791 0.800961 0.000685 0.021930 0.905345 0.072040 0.918981 0.000730 0.040682 0.039608 0.007147 0.983377 0.000287 0.009190 0.007404 0.938934 0.000267 0.053395 0.000416 0.003066 0.019255 0.977263 0.009227 0.000956 0.023828 0.965989 0.070125 0.138093 0.781439 0.010344 0.462857 0.282184 0.137207 0.117752 0.345181 0.196347 0.260353 0.198119 0.151084 0.283140 0.144938 0.420838 0.315796 0.177958 0.293723 0.212524 Consensus sequence: HHBVHTGACCTTGVDHD Alignment: HHBVHTGACCTTGVDHD -----TGACCTTGMBBB ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00009 Nr2f2_primary Original Motif Original Motif Backward 5 12 0.020547 Species: Mus musculus Original motif 0.253408 0.181904 0.273186 0.291502 0.262827 0.381870 0.153734 0.201569 0.143383 0.243233 0.242562 0.370823 0.247498 0.336892 0.176114 0.239496 0.856654 0.037068 0.049492 0.056786 0.797369 0.012935 0.176463 0.013233 0.808222 0.001309 0.189796 0.000674 0.002583 0.000536 0.989167 0.007714 0.002421 0.000283 0.972777 0.024519 0.000270 0.003650 0.019038 0.977041 0.000184 0.956654 0.005329 0.037833 0.925587 0.000706 0.072434 0.001273 0.307028 0.327297 0.079126 0.286549 0.238576 0.245847 0.384025 0.131552 0.281599 0.234987 0.226211 0.257204 0.211511 0.212695 0.363980 0.211815 Consensus sequence: DHBHAAAGGTCAHVHB Reverse complement motif 0.211511 0.363980 0.212695 0.211815 0.257204 0.234987 0.226211 0.281599 0.238576 0.384025 0.245847 0.131552 0.307028 0.079126 0.327297 0.286549 0.001273 0.000706 0.072434 0.925587 0.000184 0.005329 0.956654 0.037833 0.977041 0.003650 0.019038 0.000270 0.002421 0.972777 0.000283 0.024519 0.002583 0.989167 0.000536 0.007714 0.000674 0.001309 0.189796 0.808222 0.013233 0.012935 0.176463 0.797369 0.056786 0.037068 0.049492 0.856654 0.247498 0.176114 0.336892 0.239496 0.370823 0.243233 0.242562 0.143383 0.262827 0.153734 0.381870 0.201569 0.291502 0.181904 0.273186 0.253408 Consensus sequence: BHVDTGACCTTTDVDD Alignment: DHBHAAAGGTCAHVHB VBBYCAAGGTCA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00048 Rara Original Motif Original Motif Forward 1 12 0.021437 Species: Mus musculus Original motif 0.222478 0.177331 0.266395 0.333797 0.276222 0.360097 0.118354 0.245327 0.106047 0.268455 0.234217 0.391281 0.244163 0.407141 0.146864 0.201832 0.852083 0.050643 0.039941 0.057332 0.814108 0.012894 0.165984 0.007015 0.905198 0.005648 0.088378 0.000776 0.002783 0.000555 0.988205 0.008457 0.001289 0.000626 0.898209 0.099877 0.002878 0.001631 0.008910 0.986582 0.000499 0.975550 0.005264 0.018687 0.963627 0.000883 0.034432 0.001058 0.181490 0.517766 0.077094 0.223650 0.183789 0.384790 0.308350 0.123071 0.229801 0.228801 0.224468 0.316930 0.218244 0.170273 0.366746 0.244736 Consensus sequence: DHBHAAAGGTCACVHD Reverse complement motif 0.218244 0.366746 0.170273 0.244736 0.316930 0.228801 0.224468 0.229801 0.183789 0.308350 0.384790 0.123071 0.181490 0.077094 0.517766 0.223650 0.001058 0.000883 0.034432 0.963627 0.000499 0.005264 0.975550 0.018687 0.986582 0.001631 0.008910 0.002878 0.001289 0.898209 0.000626 0.099877 0.002783 0.988205 0.000555 0.008457 0.000776 0.005648 0.088378 0.905198 0.007015 0.012894 0.165984 0.814108 0.057332 0.050643 0.039941 0.852083 0.244163 0.146864 0.407141 0.201832 0.391281 0.268455 0.234217 0.106047 0.276222 0.118354 0.360097 0.245327 0.333797 0.177331 0.266395 0.222478 Consensus sequence: HHVGTGACCTTTDVDD Alignment: DHBHAAAGGTCACVHD VBBYCAAGGTCA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00009 Nr2f2_secondary Reverse Complement Reverse Complement Forward 5 12 0.043076 Species: Mus musculus Original motif 0.195749 0.435700 0.196915 0.171636 0.131070 0.131912 0.417834 0.319184 0.238959 0.441529 0.174973 0.144539 0.187749 0.189727 0.405849 0.216675 0.006751 0.541370 0.182092 0.269787 0.005388 0.590608 0.339869 0.064135 0.088153 0.004666 0.902351 0.004830 0.002459 0.004278 0.982637 0.010626 0.003618 0.002504 0.985275 0.008602 0.003325 0.004017 0.009244 0.983414 0.002547 0.972864 0.005345 0.019244 0.940260 0.002927 0.053632 0.003181 0.222459 0.390569 0.251497 0.135475 0.151824 0.258444 0.332866 0.256865 0.175811 0.290583 0.232086 0.301520 0.356690 0.198973 0.136050 0.308287 Consensus sequence: VBVBCSGGGTCAVBBH Reverse complement motif 0.308287 0.198973 0.136050 0.356690 0.301520 0.290583 0.232086 0.175811 0.151824 0.332866 0.258444 0.256865 0.222459 0.251497 0.390569 0.135475 0.003181 0.002927 0.053632 0.940260 0.002547 0.005345 0.972864 0.019244 0.983414 0.004017 0.009244 0.003325 0.003618 0.985275 0.002504 0.008602 0.002459 0.982637 0.004278 0.010626 0.088153 0.902351 0.004666 0.004830 0.005388 0.339869 0.590608 0.064135 0.006751 0.182092 0.541370 0.269787 0.187749 0.405849 0.189727 0.216675 0.238959 0.174973 0.441529 0.144539 0.131070 0.417834 0.131912 0.319184 0.195749 0.196915 0.435700 0.171636 Consensus sequence: HVBVTGACCCSGBVBV Alignment: HVBVTGACCCSGBVBV ----TGACCTTGMBBB ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00066 Hnf4a_primary Original Motif Original Motif Forward 1 12 0.045178 Species: Mus musculus Original motif 0.223704 0.280688 0.251889 0.243719 0.198683 0.190981 0.267970 0.342366 0.150012 0.319579 0.206063 0.324347 0.274896 0.302572 0.238597 0.183935 0.438853 0.331148 0.021186 0.208812 0.133937 0.027342 0.832490 0.006231 0.141462 0.002336 0.854359 0.001843 0.003464 0.000753 0.987433 0.008349 0.004388 0.000692 0.884494 0.110426 0.003808 0.001605 0.016793 0.977794 0.001992 0.976605 0.003739 0.017664 0.881237 0.089981 0.026017 0.002764 0.735041 0.106592 0.083260 0.075107 0.164419 0.315518 0.181031 0.339032 0.228285 0.176364 0.157583 0.437768 0.233407 0.193567 0.327076 0.245951 0.320479 0.312566 0.195701 0.171254 Consensus sequence: BDBVMGGGGTCAABHDV Reverse complement motif 0.171254 0.312566 0.195701 0.320479 0.233407 0.327076 0.193567 0.245951 0.437768 0.176364 0.157583 0.228285 0.339032 0.315518 0.181031 0.164419 0.075107 0.106592 0.083260 0.735041 0.002764 0.089981 0.026017 0.881237 0.001992 0.003739 0.976605 0.017664 0.977794 0.001605 0.016793 0.003808 0.004388 0.884494 0.000692 0.110426 0.003464 0.987433 0.000753 0.008349 0.141462 0.854359 0.002336 0.001843 0.133937 0.832490 0.027342 0.006231 0.208812 0.331148 0.021186 0.438853 0.274896 0.238597 0.302572 0.183935 0.324347 0.319579 0.206063 0.150012 0.342366 0.190981 0.267970 0.198683 0.223704 0.251889 0.280688 0.243719 Consensus sequence: BHHVTTGACCCCYVVDB Alignment: BDBVMGGGGTCAABHDV VBBYCAAGGTCA----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00079 Esrra_secondary Original Motif Original Motif Backward 6 12 0.048250 Species: Mus musculus Original motif 0.252126 0.268706 0.351590 0.127578 0.158171 0.083434 0.389646 0.368749 0.180010 0.290882 0.279192 0.249916 0.206905 0.249360 0.275438 0.268296 0.756588 0.046202 0.023921 0.173289 0.018262 0.022596 0.949143 0.010000 0.206468 0.046491 0.745475 0.001566 0.005511 0.001141 0.983152 0.010196 0.004791 0.001893 0.985951 0.007365 0.027643 0.001133 0.008565 0.962659 0.002459 0.970934 0.007826 0.018780 0.924387 0.003164 0.071225 0.001224 0.419387 0.230189 0.111588 0.238836 0.290954 0.163823 0.341233 0.203991 0.196768 0.281307 0.313868 0.208056 0.128428 0.260428 0.378607 0.232537 0.269305 0.378895 0.123480 0.228320 Consensus sequence: VKBBAGGGGTCAHDBBH Reverse complement motif 0.269305 0.123480 0.378895 0.228320 0.128428 0.378607 0.260428 0.232537 0.196768 0.313868 0.281307 0.208056 0.290954 0.341233 0.163823 0.203991 0.238836 0.230189 0.111588 0.419387 0.001224 0.003164 0.071225 0.924387 0.002459 0.007826 0.970934 0.018780 0.962659 0.001133 0.008565 0.027643 0.004791 0.985951 0.001893 0.007365 0.005511 0.983152 0.001141 0.010196 0.206468 0.745475 0.046491 0.001566 0.018262 0.949143 0.022596 0.010000 0.173289 0.046202 0.023921 0.756588 0.206905 0.275438 0.249360 0.268296 0.180010 0.279192 0.290882 0.249916 0.158171 0.389646 0.083434 0.368749 0.252126 0.351590 0.268706 0.127578 Consensus sequence: DBBHHTGACCCCTBBYV Alignment: VKBBAGGGGTCAHDBBH VBBYCAAGGTCA----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00053 Rxra_primary Reverse Complement Original Motif Backward 1 12 0.049902 Species: Mus musculus Original motif 0.235299 0.222264 0.237416 0.305021 0.144778 0.278902 0.341673 0.234648 0.261127 0.261904 0.191591 0.285378 0.119943 0.410774 0.218940 0.250343 0.222672 0.075554 0.365253 0.336521 0.001838 0.046904 0.002828 0.948430 0.030410 0.006359 0.960821 0.002410 0.987391 0.007562 0.002810 0.002237 0.105188 0.888650 0.001163 0.004998 0.006475 0.987074 0.001793 0.004659 0.001816 0.765138 0.003092 0.229953 0.010354 0.846496 0.029899 0.113251 0.328732 0.039382 0.265510 0.366377 0.209638 0.262628 0.145613 0.382121 0.385390 0.177695 0.299828 0.137087 0.403452 0.268924 0.096028 0.231595 0.203082 0.231812 0.213520 0.351585 Consensus sequence: DBHBDTGACCCCDHVHB Reverse complement motif 0.351585 0.231812 0.213520 0.203082 0.231595 0.268924 0.096028 0.403452 0.137087 0.177695 0.299828 0.385390 0.382121 0.262628 0.145613 0.209638 0.366377 0.039382 0.265510 0.328732 0.010354 0.029899 0.846496 0.113251 0.001816 0.003092 0.765138 0.229953 0.006475 0.001793 0.987074 0.004659 0.105188 0.001163 0.888650 0.004998 0.002237 0.007562 0.002810 0.987391 0.030410 0.960821 0.006359 0.002410 0.948430 0.046904 0.002828 0.001838 0.222672 0.365253 0.075554 0.336521 0.119943 0.218940 0.410774 0.250343 0.285378 0.261904 0.191591 0.261127 0.144778 0.341673 0.278902 0.234648 0.305021 0.222264 0.237416 0.235299 Consensus sequence: VHBHDGGGGTCAHBHBD Alignment: DBHBDTGACCCCDHVHB -----TGACCTTGMBBB ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v015681_secondary Reverse Complement Reverse Complement Forward 8 12 0.052535 Species: Mus musculus Original motif 0.331499 0.188505 0.182841 0.297156 0.328961 0.213025 0.273530 0.184484 0.197213 0.129292 0.524914 0.148581 0.274491 0.226406 0.312118 0.186986 0.103231 0.393726 0.364988 0.138055 0.552594 0.166422 0.186262 0.094722 0.157618 0.064773 0.616497 0.161112 0.139166 0.176098 0.621185 0.063551 0.748420 0.062398 0.012447 0.176735 0.116584 0.009438 0.860326 0.013653 0.005030 0.003646 0.974877 0.016447 0.055257 0.007181 0.921760 0.015802 0.032748 0.058249 0.052709 0.856293 0.105606 0.872231 0.014370 0.007793 0.019480 0.497379 0.125899 0.357242 0.478582 0.269713 0.061464 0.190242 0.253985 0.287006 0.201320 0.257689 0.319384 0.210231 0.175842 0.294543 0.222123 0.287802 0.201294 0.288782 0.139951 0.376041 0.081133 0.402875 0.213450 0.343835 0.383676 0.059039 0.322294 0.355918 0.148062 0.173725 Consensus sequence: HVGVSAGGAGGGTCYHHHHYVH Reverse complement motif 0.322294 0.148062 0.355918 0.173725 0.213450 0.383676 0.343835 0.059039 0.402875 0.376041 0.081133 0.139951 0.288782 0.287802 0.201294 0.222123 0.294543 0.210231 0.175842 0.319384 0.253985 0.201320 0.287006 0.257689 0.190242 0.269713 0.061464 0.478582 0.019480 0.125899 0.497379 0.357242 0.105606 0.014370 0.872231 0.007793 0.856293 0.058249 0.052709 0.032748 0.055257 0.921760 0.007181 0.015802 0.005030 0.974877 0.003646 0.016447 0.116584 0.860326 0.009438 0.013653 0.176735 0.062398 0.012447 0.748420 0.139166 0.621185 0.176098 0.063551 0.157618 0.616497 0.064773 0.161112 0.094722 0.166422 0.186262 0.552594 0.103231 0.364988 0.393726 0.138055 0.274491 0.312118 0.226406 0.186986 0.197213 0.524914 0.129292 0.148581 0.184484 0.213025 0.273530 0.328961 0.297156 0.188505 0.182841 0.331499 Consensus sequence: DVMHHDHKGACCCTCCTSVCBH Alignment: DVMHHDHKGACCCTCCTSVCBH -------TGACCTTGMBBB--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00066 Hnf4a_secondary Reverse Complement Reverse Complement Backward 1 12 0.058055 Species: Mus musculus Original motif 0.131680 0.169949 0.346277 0.352094 0.109910 0.144258 0.373681 0.372151 0.196671 0.411335 0.159689 0.232305 0.311086 0.307077 0.122332 0.259505 0.895155 0.013238 0.038874 0.052733 0.779629 0.018399 0.171269 0.030703 0.950546 0.002649 0.041825 0.004980 0.004769 0.002646 0.985847 0.006739 0.004458 0.002117 0.012011 0.981414 0.016789 0.969626 0.003890 0.009695 0.002468 0.982852 0.004754 0.009926 0.891448 0.003193 0.097548 0.007811 0.513330 0.308971 0.070467 0.107232 0.179371 0.115514 0.130898 0.574217 0.285826 0.277536 0.166982 0.269655 0.319407 0.227783 0.129020 0.323790 Consensus sequence: BBHHAAAGTCCAMTHH Reverse complement motif 0.323790 0.227783 0.129020 0.319407 0.269655 0.277536 0.166982 0.285826 0.574217 0.115514 0.130898 0.179371 0.107232 0.308971 0.070467 0.513330 0.007811 0.003193 0.097548 0.891448 0.002468 0.004754 0.982852 0.009926 0.016789 0.003890 0.969626 0.009695 0.981414 0.002117 0.012011 0.004458 0.004769 0.985847 0.002646 0.006739 0.004980 0.002649 0.041825 0.950546 0.030703 0.018399 0.171269 0.779629 0.052733 0.013238 0.038874 0.895155 0.259505 0.307077 0.122332 0.311086 0.196671 0.159689 0.411335 0.232305 0.109910 0.373681 0.144258 0.372151 0.352094 0.169949 0.346277 0.131680 Consensus sequence: HHAYTGGACTTTHDBV Alignment: HHAYTGGACTTTHDBV ----TGACCTTGMBBB ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00098 Rfx3_secondary Reverse Complement Reverse Complement Forward 9 12 0.060974 Species: Mus musculus Original motif 0.314514 0.275352 0.257617 0.152518 0.126939 0.598294 0.130576 0.144192 0.102265 0.155334 0.177957 0.564445 0.129288 0.282678 0.326990 0.261044 0.318166 0.227823 0.175681 0.278330 0.109019 0.380838 0.278328 0.231815 0.226145 0.289206 0.291300 0.193348 0.035863 0.844339 0.072582 0.047216 0.223793 0.187244 0.088092 0.500871 0.039800 0.029681 0.026201 0.904317 0.298298 0.032147 0.654746 0.014809 0.014729 0.022023 0.944826 0.018422 0.485114 0.004925 0.013785 0.496176 0.035708 0.020381 0.240804 0.703108 0.951152 0.012738 0.017886 0.018224 0.023713 0.944394 0.009538 0.022355 0.291067 0.385205 0.232388 0.091339 0.340334 0.199588 0.311526 0.148552 0.198713 0.472138 0.178319 0.150830 0.321155 0.269932 0.311301 0.097612 0.412646 0.195252 0.231950 0.160152 0.297134 0.180928 0.250400 0.271538 0.151169 0.305386 0.358574 0.184871 Consensus sequence: VCTBHBVCTTGGWTACVVVVVDB Reverse complement motif 0.151169 0.358574 0.305386 0.184871 0.271538 0.180928 0.250400 0.297134 0.160152 0.195252 0.231950 0.412646 0.097612 0.269932 0.311301 0.321155 0.198713 0.178319 0.472138 0.150830 0.148552 0.199588 0.311526 0.340334 0.291067 0.232388 0.385205 0.091339 0.023713 0.009538 0.944394 0.022355 0.018224 0.012738 0.017886 0.951152 0.703108 0.020381 0.240804 0.035708 0.496176 0.004925 0.013785 0.485114 0.014729 0.944826 0.022023 0.018422 0.298298 0.654746 0.032147 0.014809 0.904317 0.029681 0.026201 0.039800 0.500871 0.187244 0.088092 0.223793 0.035863 0.072582 0.844339 0.047216 0.226145 0.291300 0.289206 0.193348 0.109019 0.278328 0.380838 0.231815 0.278330 0.227823 0.175681 0.318166 0.129288 0.326990 0.282678 0.261044 0.564445 0.155334 0.177957 0.102265 0.126939 0.130576 0.598294 0.144192 0.152518 0.275352 0.257617 0.314514 Consensus sequence: BDBBVBVGTAWCCAAGVBHBAGB Alignment: BDBBVBVGTAWCCAAGVBHBAGB --------TGACCTTGMBBB--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 3 Motif ID: 55 Motif name: ZEB1 Original motif 0.024390 0.829268 0.024390 0.121951 0.926829 0.000000 0.048780 0.024390 0.000000 0.975610 0.024390 0.000000 0.000000 0.926829 0.073171 0.000000 0.000000 0.024390 0.000000 0.975610 0.243902 0.024390 0.390244 0.341463 Consensus sequence: CACCTD Reserve complement motif 0.243902 0.390244 0.024390 0.341463 0.975610 0.024390 0.000000 0.000000 0.000000 0.073171 0.926829 0.000000 0.000000 0.024390 0.975610 0.000000 0.024390 0.000000 0.048780 0.926829 0.024390 0.024390 0.829268 0.121951 Consensus sequence: HAGGTG ************************************************************************ Best Matches for Motif ID 55 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00068 Eomes_secondary Original Motif Reverse Complement Backward 4 6 0.000000 Species: Mus musculus Original motif 0.253642 0.252604 0.298295 0.195458 0.112892 0.341342 0.341061 0.204704 0.297430 0.215095 0.343350 0.144125 0.241098 0.129378 0.421448 0.208076 0.894201 0.007299 0.061032 0.037468 0.052259 0.054303 0.856609 0.036829 0.005074 0.015048 0.966734 0.013144 0.003258 0.061529 0.002368 0.932845 0.017531 0.005025 0.973155 0.004289 0.116022 0.030172 0.047139 0.806667 0.027749 0.602513 0.009946 0.359792 0.018763 0.048982 0.794648 0.137608 0.177116 0.459591 0.284833 0.078460 0.121483 0.491485 0.148745 0.238287 0.152590 0.245835 0.214717 0.386857 0.221040 0.320773 0.249918 0.208270 Consensus sequence: VBVDAGGTGTYGVBBV Reverse complement motif 0.221040 0.249918 0.320773 0.208270 0.386857 0.245835 0.214717 0.152590 0.121483 0.148745 0.491485 0.238287 0.177116 0.284833 0.459591 0.078460 0.018763 0.794648 0.048982 0.137608 0.027749 0.009946 0.602513 0.359792 0.806667 0.030172 0.047139 0.116022 0.017531 0.973155 0.005025 0.004289 0.932845 0.061529 0.002368 0.003258 0.005074 0.966734 0.015048 0.013144 0.052259 0.856609 0.054303 0.036829 0.037468 0.007299 0.061032 0.894201 0.241098 0.421448 0.129378 0.208076 0.297430 0.343350 0.215095 0.144125 0.112892 0.341061 0.341342 0.204704 0.253642 0.298295 0.252604 0.195458 Consensus sequence: VVBVCKACACCTHVBV Alignment: VVBVCKACACCTHVBV -------CACCTD--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00199 Six4 Reverse Complement Reverse Complement Forward 4 6 0.004331 Species: Mus musculus Original motif 0.523054 0.168817 0.140331 0.167798 0.187385 0.177009 0.246164 0.389442 0.414492 0.118547 0.308876 0.158085 0.345234 0.289795 0.130249 0.234723 0.611522 0.116948 0.098944 0.172586 0.016342 0.029436 0.015062 0.939161 0.014351 0.004796 0.962435 0.018418 0.987454 0.005228 0.002590 0.004727 0.007431 0.812214 0.005849 0.174506 0.969354 0.025386 0.002362 0.002898 0.005123 0.989068 0.003362 0.002447 0.001424 0.969981 0.012011 0.016585 0.209729 0.227411 0.210523 0.352337 0.341679 0.297940 0.104590 0.255792 0.126190 0.288862 0.245018 0.339930 0.173008 0.295896 0.252422 0.278674 0.409639 0.210750 0.296197 0.083415 Consensus sequence: ADDHATGACACCBHBBV Reverse complement motif 0.083415 0.210750 0.296197 0.409639 0.173008 0.252422 0.295896 0.278674 0.339930 0.288862 0.245018 0.126190 0.255792 0.297940 0.104590 0.341679 0.352337 0.227411 0.210523 0.209729 0.001424 0.012011 0.969981 0.016585 0.005123 0.003362 0.989068 0.002447 0.002898 0.025386 0.002362 0.969354 0.007431 0.005849 0.812214 0.174506 0.004727 0.005228 0.002590 0.987454 0.014351 0.962435 0.004796 0.018418 0.939161 0.029436 0.015062 0.016342 0.172586 0.116948 0.098944 0.611522 0.234723 0.289795 0.130249 0.345234 0.158085 0.118547 0.308876 0.414492 0.389442 0.177009 0.246164 0.187385 0.167798 0.168817 0.140331 0.523054 Consensus sequence: BBVHVGGTGTCATHDDT Alignment: BBVHVGGTGTCATHDDT ---HAGGTG-------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00068 Eomes_primary Original Motif Reverse Complement Forward 9 6 0.005241 Species: Mus musculus Original motif 0.186316 0.215541 0.297644 0.300499 0.300381 0.234276 0.266283 0.199061 0.317841 0.211418 0.183235 0.287507 0.482598 0.095323 0.245062 0.177017 0.654197 0.008988 0.261951 0.074864 0.095656 0.022883 0.843364 0.038097 0.002655 0.008355 0.976390 0.012600 0.003287 0.080755 0.001057 0.914900 0.006753 0.001517 0.989917 0.001813 0.039940 0.098800 0.003305 0.857955 0.009015 0.039036 0.844029 0.107921 0.984070 0.002369 0.008852 0.004709 0.789505 0.101528 0.029294 0.079672 0.649685 0.139882 0.090466 0.119966 0.421759 0.205595 0.073074 0.299573 0.214779 0.290522 0.134050 0.360649 0.202141 0.270323 0.176798 0.350738 Consensus sequence: BVHDAGGTGTGAAAHHH Reverse complement motif 0.350738 0.270323 0.176798 0.202141 0.360649 0.290522 0.134050 0.214779 0.299573 0.205595 0.073074 0.421759 0.119966 0.139882 0.090466 0.649685 0.079672 0.101528 0.029294 0.789505 0.004709 0.002369 0.008852 0.984070 0.009015 0.844029 0.039036 0.107921 0.857955 0.098800 0.003305 0.039940 0.006753 0.989917 0.001517 0.001813 0.914900 0.080755 0.001057 0.003287 0.002655 0.976390 0.008355 0.012600 0.095656 0.843364 0.022883 0.038097 0.074864 0.008988 0.261951 0.654197 0.177017 0.095323 0.245062 0.482598 0.287507 0.211418 0.183235 0.317841 0.199061 0.234276 0.266283 0.300381 0.300499 0.215541 0.297644 0.186316 Consensus sequence: HHHTTTCACACCTDHBV Alignment: HHHTTTCACACCTDHBV --------CACCTD--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00046 Tcfe2a_primary Original Motif Reverse Complement Forward 7 6 0.009113 Species: Mus musculus Original motif 0.306209 0.232705 0.244475 0.216611 0.165668 0.171480 0.222584 0.440269 0.213008 0.429038 0.156385 0.201569 0.283226 0.329518 0.160795 0.226461 0.439156 0.283517 0.251270 0.026056 0.014994 0.980987 0.000714 0.003304 0.975741 0.020182 0.002909 0.001168 0.000926 0.191353 0.801648 0.006073 0.015382 0.090853 0.893043 0.000721 0.001549 0.005912 0.001713 0.990826 0.004000 0.000857 0.989667 0.005475 0.016957 0.663726 0.148127 0.171190 0.299047 0.091156 0.448649 0.161148 0.354701 0.214677 0.236757 0.193865 0.399446 0.174508 0.200036 0.226009 0.303545 0.277435 0.200094 0.218926 0.380242 0.148876 0.163367 0.307514 Consensus sequence: VBHHVCAGGTGCDVDHD Reverse complement motif 0.307514 0.148876 0.163367 0.380242 0.218926 0.277435 0.200094 0.303545 0.226009 0.174508 0.200036 0.399446 0.193865 0.214677 0.236757 0.354701 0.299047 0.448649 0.091156 0.161148 0.016957 0.148127 0.663726 0.171190 0.004000 0.989667 0.000857 0.005475 0.990826 0.005912 0.001713 0.001549 0.015382 0.893043 0.090853 0.000721 0.000926 0.801648 0.191353 0.006073 0.001168 0.020182 0.002909 0.975741 0.014994 0.000714 0.980987 0.003304 0.026056 0.283517 0.251270 0.439156 0.283226 0.160795 0.329518 0.226461 0.213008 0.156385 0.429038 0.201569 0.440269 0.171480 0.222584 0.165668 0.216611 0.232705 0.244475 0.306209 Consensus sequence: DHDBHGCACCTGBDDVB Alignment: DHDBHGCACCTGBDDVB ------CACCTD----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00047 Zbtb7b_secondary Original Motif Original Motif Backward 4 6 0.023356 Species: Mus musculus Original motif 0.203365 0.307129 0.203712 0.285795 0.306328 0.182359 0.203143 0.308170 0.220878 0.174035 0.265341 0.339746 0.475421 0.085294 0.281054 0.158231 0.395971 0.330114 0.260810 0.013104 0.001970 0.006366 0.962058 0.029606 0.907785 0.081900 0.001279 0.009036 0.008745 0.981422 0.002970 0.006863 0.006791 0.966163 0.017605 0.009441 0.894233 0.081139 0.004949 0.019679 0.007553 0.970771 0.004892 0.016783 0.016719 0.797465 0.011842 0.173974 0.415678 0.189952 0.165207 0.229163 0.092707 0.182206 0.346121 0.378967 0.175722 0.130498 0.215118 0.478662 0.365762 0.163282 0.315788 0.155168 0.214734 0.272805 0.243194 0.269267 Consensus sequence: BDDRVGACCACCHBDVB Reverse complement motif 0.214734 0.243194 0.272805 0.269267 0.155168 0.163282 0.315788 0.365762 0.478662 0.130498 0.215118 0.175722 0.378967 0.182206 0.346121 0.092707 0.229163 0.189952 0.165207 0.415678 0.016719 0.011842 0.797465 0.173974 0.007553 0.004892 0.970771 0.016783 0.019679 0.081139 0.004949 0.894233 0.006791 0.017605 0.966163 0.009441 0.008745 0.002970 0.981422 0.006863 0.009036 0.081900 0.001279 0.907785 0.001970 0.962058 0.006366 0.029606 0.013104 0.330114 0.260810 0.395971 0.158231 0.085294 0.281054 0.475421 0.339746 0.174035 0.265341 0.220878 0.308170 0.182359 0.203143 0.306328 0.203365 0.203712 0.307129 0.285795 Consensus sequence: BBDVHGGTGGTCBKDDB Alignment: BDDRVGACCACCHBDVB --------CACCTD--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v016060_primary Reverse Complement Original Motif Backward 11 6 0.023393 Species: Mus musculus Original motif 0.204923 0.208846 0.365383 0.220848 0.294304 0.300143 0.167287 0.238266 0.109711 0.619514 0.117379 0.153396 0.178979 0.378580 0.230177 0.212264 0.159594 0.542602 0.118178 0.179627 0.125206 0.430074 0.151826 0.292894 0.097692 0.709845 0.116956 0.075506 0.148292 0.565912 0.037632 0.248164 0.077951 0.034190 0.855503 0.032356 0.001657 0.001061 0.971877 0.025405 0.001926 0.001084 0.991712 0.005278 0.033031 0.012001 0.057796 0.897171 0.002723 0.002647 0.993348 0.001281 0.003261 0.000963 0.987199 0.008577 0.000611 0.090925 0.074857 0.833608 0.015299 0.978878 0.004949 0.000874 0.013368 0.600902 0.033485 0.352245 0.231949 0.149575 0.118804 0.499672 0.267580 0.186002 0.371242 0.175176 0.264884 0.223483 0.110082 0.401551 0.221365 0.170121 0.179559 0.428955 0.112997 0.692930 0.139981 0.054092 0.460305 0.207883 0.155111 0.176702 Consensus sequence: BHCBCBCCGGGTGGTCYHVHDCH Reverse complement motif 0.176702 0.207883 0.155111 0.460305 0.112997 0.139981 0.692930 0.054092 0.428955 0.170121 0.179559 0.221365 0.401551 0.223483 0.110082 0.264884 0.267580 0.371242 0.186002 0.175176 0.499672 0.149575 0.118804 0.231949 0.013368 0.033485 0.600902 0.352245 0.015299 0.004949 0.978878 0.000874 0.833608 0.090925 0.074857 0.000611 0.003261 0.987199 0.000963 0.008577 0.002723 0.993348 0.002647 0.001281 0.897171 0.012001 0.057796 0.033031 0.001926 0.991712 0.001084 0.005278 0.001657 0.971877 0.001061 0.025405 0.077951 0.855503 0.034190 0.032356 0.148292 0.037632 0.565912 0.248164 0.097692 0.116956 0.709845 0.075506 0.125206 0.151826 0.430074 0.292894 0.159594 0.118178 0.542602 0.179627 0.178979 0.230177 0.378580 0.212264 0.109711 0.117379 0.619514 0.153396 0.294304 0.167287 0.300143 0.238266 0.204923 0.365383 0.208846 0.220848 Consensus sequence: HGDHVHKGACCACCCGGBGBGDB Alignment: BHCBCBCCGGGTGGTCYHVHDCH -------HAGGTG---------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v015681_primary Original Motif Original Motif Forward 12 6 0.025434 Species: Mus musculus Original motif 0.472795 0.179227 0.091251 0.256726 0.036521 0.159743 0.204840 0.598896 0.164582 0.312805 0.221324 0.301289 0.237069 0.249050 0.293048 0.220833 0.401949 0.225181 0.229401 0.143469 0.161422 0.494334 0.252207 0.092036 0.252940 0.177721 0.369400 0.199939 0.119630 0.024651 0.849920 0.005798 0.000962 0.002398 0.990616 0.006023 0.937852 0.027016 0.034535 0.000597 0.008963 0.987756 0.000629 0.002652 0.001584 0.992898 0.002349 0.003169 0.956822 0.027342 0.002484 0.013352 0.009873 0.987759 0.000988 0.001381 0.016397 0.980856 0.000369 0.002378 0.081761 0.758555 0.038572 0.121112 0.371713 0.091838 0.448027 0.088423 0.111617 0.121913 0.683885 0.082585 0.334562 0.102916 0.436488 0.126034 0.210362 0.101261 0.238339 0.450037 0.169041 0.271583 0.320799 0.238576 0.140316 0.049885 0.735236 0.074563 Consensus sequence: HTBVVVDGGACCACCCRGRDBG Reverse complement motif 0.140316 0.735236 0.049885 0.074563 0.169041 0.320799 0.271583 0.238576 0.450037 0.101261 0.238339 0.210362 0.334562 0.436488 0.102916 0.126034 0.111617 0.683885 0.121913 0.082585 0.371713 0.448027 0.091838 0.088423 0.081761 0.038572 0.758555 0.121112 0.016397 0.000369 0.980856 0.002378 0.009873 0.000988 0.987759 0.001381 0.013352 0.027342 0.002484 0.956822 0.001584 0.002349 0.992898 0.003169 0.008963 0.000629 0.987756 0.002652 0.000597 0.027016 0.034535 0.937852 0.000962 0.990616 0.002398 0.006023 0.119630 0.849920 0.024651 0.005798 0.252940 0.369400 0.177721 0.199939 0.161422 0.252207 0.494334 0.092036 0.143469 0.225181 0.229401 0.401949 0.237069 0.293048 0.249050 0.220833 0.164582 0.221324 0.312805 0.301289 0.598896 0.159743 0.204840 0.036521 0.256726 0.179227 0.091251 0.472795 Consensus sequence: CBDMCMGGGTGGTCCHVBVBAH Alignment: HTBVVVDGGACCACCCRGRDBG -----------CACCTD----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v016060_primary Original Motif Original Motif Backward 6 6 0.029014 Species: Mus musculus Original motif 0.180868 0.321661 0.134642 0.362829 0.232215 0.134289 0.315356 0.318141 0.065068 0.093681 0.569842 0.271408 0.370822 0.229680 0.154738 0.244759 0.323039 0.182873 0.173588 0.320500 0.175039 0.266898 0.276080 0.281984 0.412669 0.147730 0.146326 0.293275 0.325953 0.028805 0.629596 0.015646 0.003017 0.001766 0.979711 0.015507 0.888973 0.040666 0.069420 0.000941 0.017309 0.979155 0.000899 0.002637 0.001732 0.988816 0.004856 0.004596 0.889763 0.078125 0.010384 0.021729 0.007566 0.987081 0.001421 0.003932 0.027797 0.966593 0.000878 0.004731 0.025816 0.867003 0.065749 0.041433 0.220658 0.075256 0.582904 0.121182 0.088946 0.283695 0.565345 0.062015 0.328012 0.241332 0.305901 0.124755 0.307302 0.137589 0.375928 0.179181 0.298752 0.231470 0.315255 0.154524 0.094565 0.142901 0.705696 0.056838 Consensus sequence: HDGHHBHRGACCACCCGSVDVG Reverse complement motif 0.094565 0.705696 0.142901 0.056838 0.298752 0.315255 0.231470 0.154524 0.307302 0.375928 0.137589 0.179181 0.124755 0.241332 0.305901 0.328012 0.088946 0.565345 0.283695 0.062015 0.220658 0.582904 0.075256 0.121182 0.025816 0.065749 0.867003 0.041433 0.027797 0.000878 0.966593 0.004731 0.007566 0.001421 0.987081 0.003932 0.021729 0.078125 0.010384 0.889763 0.001732 0.004856 0.988816 0.004596 0.017309 0.000899 0.979155 0.002637 0.000941 0.040666 0.069420 0.888973 0.003017 0.979711 0.001766 0.015507 0.325953 0.629596 0.028805 0.015646 0.293275 0.147730 0.146326 0.412669 0.281984 0.266898 0.276080 0.175039 0.320500 0.182873 0.173588 0.323039 0.244759 0.229680 0.154738 0.370822 0.065068 0.569842 0.093681 0.271408 0.318141 0.134289 0.315356 0.232215 0.362829 0.321661 0.134642 0.180868 Consensus sequence: CVHBSCGGGTGGTCMHVHHCDH Alignment: HDGHHBHRGACCACCCGSVDVG -----------CACCTD----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00036 Myf6_primary Reverse Complement Original Motif Forward 7 6 0.030967 Species: Mus musculus Original motif 0.249543 0.203739 0.394131 0.152587 0.349361 0.204136 0.321767 0.124736 0.386930 0.174655 0.250284 0.188131 0.173937 0.233501 0.412360 0.180201 0.663624 0.037653 0.264216 0.034507 0.717265 0.040761 0.206656 0.035318 0.004176 0.985948 0.003219 0.006657 0.967612 0.005543 0.008604 0.018241 0.080781 0.089857 0.746009 0.083354 0.019831 0.270961 0.409808 0.299401 0.019877 0.026996 0.014022 0.939105 0.005169 0.007980 0.978334 0.008518 0.115710 0.200514 0.226485 0.457291 0.032392 0.527196 0.128372 0.312041 0.202049 0.384912 0.106488 0.306551 0.181994 0.192975 0.425582 0.199448 Consensus sequence: VVDBAACAGBTGBYHB Reverse complement motif 0.181994 0.425582 0.192975 0.199448 0.202049 0.106488 0.384912 0.306551 0.032392 0.128372 0.527196 0.312041 0.457291 0.200514 0.226485 0.115710 0.005169 0.978334 0.007980 0.008518 0.939105 0.026996 0.014022 0.019877 0.019831 0.409808 0.270961 0.299401 0.080781 0.746009 0.089857 0.083354 0.018241 0.005543 0.008604 0.967612 0.004176 0.003219 0.985948 0.006657 0.035318 0.040761 0.206656 0.717265 0.034507 0.037653 0.264216 0.663624 0.173937 0.412360 0.233501 0.180201 0.188131 0.174655 0.250284 0.386930 0.124736 0.204136 0.321767 0.349361 0.249543 0.394131 0.203739 0.152587 Consensus sequence: BDKVCABCTGTTBDBV Alignment: VVDBAACAGBTGBYHB ------HAGGTG---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00249 Nkx2-5 Original Motif Original Motif Forward 6 6 0.031502 Species: Mus musculus Original motif 0.284346 0.280937 0.138180 0.296538 0.399663 0.110464 0.327481 0.162392 0.637560 0.029806 0.218321 0.114314 0.184898 0.144379 0.370828 0.299895 0.017459 0.862111 0.118223 0.002207 0.001004 0.958164 0.000888 0.039945 0.947796 0.011499 0.000413 0.040291 0.024268 0.973476 0.000709 0.001546 0.002616 0.001901 0.003337 0.992147 0.006742 0.071290 0.000276 0.921691 0.393078 0.093424 0.490620 0.022879 0.870162 0.007294 0.051952 0.070591 0.632449 0.156278 0.172644 0.038628 0.362798 0.126579 0.085796 0.424828 0.132810 0.206405 0.025084 0.635702 0.094708 0.272324 0.087702 0.545267 Consensus sequence: HDADCCACTTRAAWTT Reverse complement motif 0.545267 0.272324 0.087702 0.094708 0.635702 0.206405 0.025084 0.132810 0.424828 0.126579 0.085796 0.362798 0.038628 0.156278 0.172644 0.632449 0.070591 0.007294 0.051952 0.870162 0.393078 0.490620 0.093424 0.022879 0.921691 0.071290 0.000276 0.006742 0.992147 0.001901 0.003337 0.002616 0.024268 0.000709 0.973476 0.001546 0.040291 0.011499 0.000413 0.947796 0.001004 0.000888 0.958164 0.039945 0.017459 0.118223 0.862111 0.002207 0.184898 0.370828 0.144379 0.299895 0.114314 0.029806 0.218321 0.637560 0.162392 0.110464 0.327481 0.399663 0.296538 0.280937 0.138180 0.284346 Consensus sequence: AAWTTMAAGTGGHTDH Alignment: HDADCCACTTRAAWTT -----CACCTD----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 3 Motif ID: 56 Motif name: Mycn Original motif 0.349315 0.363014 0.143836 0.143836 0.089041 0.388128 0.447489 0.075342 0.015982 0.984018 0.000000 0.000000 0.945205 0.000000 0.041096 0.013699 0.000000 0.961187 0.018265 0.020548 0.070776 0.002283 0.924658 0.002283 0.054795 0.221461 0.004566 0.719178 0.000000 0.000000 0.938356 0.061644 0.061644 0.111872 0.739726 0.086758 0.139269 0.605023 0.091324 0.164384 Consensus sequence: HSCACGTGGC Reserve complement motif 0.139269 0.091324 0.605023 0.164384 0.061644 0.739726 0.111872 0.086758 0.000000 0.938356 0.000000 0.061644 0.719178 0.221461 0.004566 0.054795 0.070776 0.924658 0.002283 0.002283 0.000000 0.018265 0.961187 0.020548 0.013699 0.000000 0.041096 0.945205 0.015982 0.000000 0.984018 0.000000 0.089041 0.447489 0.388128 0.075342 0.349315 0.143836 0.363014 0.143836 Consensus sequence: GCCACGTGSD ************************************************************************ Best Matches for Motif ID 56 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00060 Max_primary Original Motif Original Motif Forward 3 10 0.000000 Species: Mus musculus Original motif 0.234855 0.152539 0.301720 0.310886 0.199226 0.147959 0.439250 0.213565 0.582926 0.274768 0.075866 0.066440 0.138829 0.475428 0.305884 0.079859 0.024979 0.969691 0.001811 0.003520 0.966345 0.003728 0.022320 0.007607 0.000598 0.907006 0.008160 0.084236 0.084236 0.008160 0.907006 0.000598 0.007607 0.022320 0.003728 0.966345 0.003520 0.001811 0.969691 0.024979 0.149140 0.241218 0.389598 0.220044 0.066440 0.075866 0.274768 0.582926 0.186990 0.346199 0.250066 0.216745 0.273437 0.225889 0.300738 0.199936 0.160893 0.111177 0.477963 0.249968 0.171790 0.101256 0.424580 0.302375 Consensus sequence: DDASCACGTGBTBVDD Reverse complement motif 0.171790 0.424580 0.101256 0.302375 0.160893 0.477963 0.111177 0.249968 0.273437 0.300738 0.225889 0.199936 0.186990 0.250066 0.346199 0.216745 0.582926 0.075866 0.274768 0.066440 0.149140 0.389598 0.241218 0.220044 0.003520 0.969691 0.001811 0.024979 0.966345 0.022320 0.003728 0.007607 0.084236 0.907006 0.008160 0.000598 0.000598 0.008160 0.907006 0.084236 0.007607 0.003728 0.022320 0.966345 0.024979 0.001811 0.969691 0.003520 0.138829 0.305884 0.475428 0.079859 0.066440 0.274768 0.075866 0.582926 0.199226 0.439250 0.147959 0.213565 0.310886 0.152539 0.301720 0.234855 Consensus sequence: HHVBABCACGTGSTHD Alignment: DDASCACGTGBTBVDD --HSCACGTGGC---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00050 Bhlhb2_secondary Reverse Complement Reverse Complement Backward 7 10 0.007838 Species: Mus musculus Original motif 0.120938 0.344851 0.124072 0.410138 0.220931 0.169844 0.422396 0.186829 0.127752 0.260812 0.103811 0.507625 0.140641 0.405473 0.287668 0.166218 0.296957 0.155579 0.301094 0.246370 0.219647 0.287193 0.154072 0.339087 0.049294 0.026059 0.121789 0.802859 0.520042 0.289284 0.173423 0.017251 0.049190 0.943472 0.004308 0.003030 0.902609 0.006767 0.074770 0.015854 0.003221 0.971329 0.005512 0.019937 0.019937 0.005512 0.971329 0.003221 0.015854 0.074770 0.006767 0.902609 0.003030 0.004308 0.943472 0.049190 0.003497 0.088920 0.685942 0.221641 0.802859 0.121789 0.026059 0.049294 0.334544 0.155170 0.275193 0.235092 0.275957 0.132104 0.454982 0.136957 0.134097 0.254352 0.422940 0.188611 0.396163 0.432784 0.051281 0.119772 0.276474 0.115627 0.419844 0.188056 0.160759 0.088061 0.649863 0.101318 0.203314 0.166595 0.106821 0.523270 Consensus sequence: YDYBDHTMCACGTGGADDBMDGT Reverse complement motif 0.523270 0.166595 0.106821 0.203314 0.160759 0.649863 0.088061 0.101318 0.276474 0.419844 0.115627 0.188056 0.396163 0.051281 0.432784 0.119772 0.134097 0.422940 0.254352 0.188611 0.275957 0.454982 0.132104 0.136957 0.235092 0.155170 0.275193 0.334544 0.049294 0.121789 0.026059 0.802859 0.003497 0.685942 0.088920 0.221641 0.003030 0.943472 0.004308 0.049190 0.902609 0.074770 0.006767 0.015854 0.019937 0.971329 0.005512 0.003221 0.003221 0.005512 0.971329 0.019937 0.015854 0.006767 0.074770 0.902609 0.049190 0.004308 0.943472 0.003030 0.017251 0.289284 0.173423 0.520042 0.802859 0.026059 0.121789 0.049294 0.339087 0.287193 0.154072 0.219647 0.296957 0.301094 0.155579 0.246370 0.140641 0.287668 0.405473 0.166218 0.507625 0.260812 0.103811 0.127752 0.220931 0.422396 0.169844 0.186829 0.410138 0.344851 0.124072 0.120938 Consensus sequence: ACHRBHDTCCACGTGYAHHBMHM Alignment: ACHRBHDTCCACGTGYAHHBMHM -------GCCACGTGSD------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00050 Bhlhb2_primary Reverse Complement Reverse Complement Backward 7 10 0.013286 Species: Mus musculus Original motif 0.347837 0.112349 0.403713 0.136102 0.298329 0.175329 0.324534 0.201809 0.421791 0.222553 0.113615 0.242041 0.387506 0.130670 0.161435 0.320389 0.197183 0.244864 0.304611 0.253342 0.345884 0.188786 0.278290 0.187041 0.228203 0.142148 0.408269 0.221381 0.037126 0.006772 0.231775 0.724328 0.055214 0.942800 0.001192 0.000794 0.974119 0.004466 0.015535 0.005880 0.000300 0.958145 0.007498 0.034056 0.034056 0.007498 0.958145 0.000300 0.005880 0.015535 0.004466 0.974119 0.000794 0.001192 0.942800 0.055214 0.724328 0.231775 0.006772 0.037126 0.015720 0.466476 0.315208 0.202596 0.173670 0.355170 0.210710 0.260449 0.407419 0.261539 0.134430 0.196612 0.351478 0.209698 0.262426 0.176399 0.207869 0.284582 0.198951 0.308598 0.434482 0.113724 0.184408 0.267386 0.211144 0.363745 0.173978 0.251133 Consensus sequence: RDHDBVDTCACGTGASBHVHDH Reverse complement motif 0.211144 0.173978 0.363745 0.251133 0.267386 0.113724 0.184408 0.434482 0.308598 0.284582 0.198951 0.207869 0.176399 0.209698 0.262426 0.351478 0.196612 0.261539 0.134430 0.407419 0.173670 0.210710 0.355170 0.260449 0.015720 0.315208 0.466476 0.202596 0.037126 0.231775 0.006772 0.724328 0.000794 0.942800 0.001192 0.055214 0.974119 0.015535 0.004466 0.005880 0.034056 0.958145 0.007498 0.000300 0.000300 0.007498 0.958145 0.034056 0.005880 0.004466 0.015535 0.974119 0.055214 0.001192 0.942800 0.000794 0.724328 0.006772 0.231775 0.037126 0.228203 0.408269 0.142148 0.221381 0.187041 0.188786 0.278290 0.345884 0.197183 0.304611 0.244864 0.253342 0.320389 0.130670 0.161435 0.387506 0.242041 0.222553 0.113615 0.421791 0.298329 0.324534 0.175329 0.201809 0.347837 0.403713 0.112349 0.136102 Consensus sequence: DDHBHBSTCACGTGAHBBDHHM Alignment: DDHBHBSTCACGTGAHBBDHHM ------GCCACGTGSD------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00046 Tcfe2a_primary Reverse Complement Original Motif Backward 5 10 0.022793 Species: Mus musculus Original motif 0.306209 0.232705 0.244475 0.216611 0.165668 0.171480 0.222584 0.440269 0.213008 0.429038 0.156385 0.201569 0.283226 0.329518 0.160795 0.226461 0.439156 0.283517 0.251270 0.026056 0.014994 0.980987 0.000714 0.003304 0.975741 0.020182 0.002909 0.001168 0.000926 0.191353 0.801648 0.006073 0.015382 0.090853 0.893043 0.000721 0.001549 0.005912 0.001713 0.990826 0.004000 0.000857 0.989667 0.005475 0.016957 0.663726 0.148127 0.171190 0.299047 0.091156 0.448649 0.161148 0.354701 0.214677 0.236757 0.193865 0.399446 0.174508 0.200036 0.226009 0.303545 0.277435 0.200094 0.218926 0.380242 0.148876 0.163367 0.307514 Consensus sequence: VBHHVCAGGTGCDVDHD Reverse complement motif 0.307514 0.148876 0.163367 0.380242 0.218926 0.277435 0.200094 0.303545 0.226009 0.174508 0.200036 0.399446 0.193865 0.214677 0.236757 0.354701 0.299047 0.448649 0.091156 0.161148 0.016957 0.148127 0.663726 0.171190 0.004000 0.989667 0.000857 0.005475 0.990826 0.005912 0.001713 0.001549 0.015382 0.893043 0.090853 0.000721 0.000926 0.801648 0.191353 0.006073 0.001168 0.020182 0.002909 0.975741 0.014994 0.000714 0.980987 0.003304 0.026056 0.283517 0.251270 0.439156 0.283226 0.160795 0.329518 0.226461 0.213008 0.156385 0.429038 0.201569 0.440269 0.171480 0.222584 0.165668 0.216611 0.232705 0.244475 0.306209 Consensus sequence: DHDBHGCACCTGBDDVB Alignment: VBHHVCAGGTGCDVDHD ---GCCACGTGSD---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00060 Max_secondary Original Motif Original Motif Forward 3 10 0.025701 Species: Mus musculus Original motif 0.127991 0.202889 0.399822 0.269298 0.156940 0.244015 0.182364 0.416681 0.046494 0.050598 0.744311 0.158596 0.196142 0.365183 0.183389 0.255286 0.019306 0.946805 0.015210 0.018680 0.924839 0.022113 0.027620 0.025428 0.007478 0.672138 0.027789 0.292595 0.046702 0.026044 0.906146 0.021107 0.117335 0.610863 0.025132 0.246670 0.044431 0.053581 0.722748 0.179240 0.543713 0.149809 0.190030 0.116447 0.241148 0.722386 0.022547 0.013919 0.265412 0.113032 0.270602 0.350954 0.226186 0.143504 0.332746 0.297564 Consensus sequence: BBGHCACGCGACDD Reverse complement motif 0.226186 0.332746 0.143504 0.297564 0.350954 0.113032 0.270602 0.265412 0.241148 0.022547 0.722386 0.013919 0.116447 0.149809 0.190030 0.543713 0.044431 0.722748 0.053581 0.179240 0.117335 0.025132 0.610863 0.246670 0.046702 0.906146 0.026044 0.021107 0.007478 0.027789 0.672138 0.292595 0.025428 0.022113 0.027620 0.924839 0.019306 0.015210 0.946805 0.018680 0.196142 0.183389 0.365183 0.255286 0.046494 0.744311 0.050598 0.158596 0.416681 0.244015 0.182364 0.156940 0.127991 0.399822 0.202889 0.269298 Consensus sequence: HDGTCGCGTGDCVB Alignment: BBGHCACGCGACDD --HSCACGTGGC-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00165 Titf1 Reverse Complement Original Motif Backward 4 10 0.034483 Species: Mus musculus Original motif 0.142834 0.324493 0.147276 0.385397 0.404842 0.233186 0.227659 0.134313 0.677580 0.044952 0.178774 0.098695 0.137761 0.202622 0.469728 0.189889 0.069301 0.825888 0.093549 0.011262 0.003882 0.876858 0.000966 0.118295 0.904355 0.015154 0.001043 0.079449 0.018912 0.977464 0.001207 0.002417 0.003517 0.004393 0.002428 0.989662 0.007151 0.162279 0.000584 0.829986 0.192074 0.120883 0.670840 0.016203 0.881358 0.002039 0.013253 0.103349 0.450016 0.333144 0.184121 0.032719 0.342018 0.321148 0.066945 0.269889 0.209486 0.122118 0.046367 0.622029 0.174564 0.145894 0.048004 0.631539 Consensus sequence: BVABCCACTTGAMHTT Reverse complement motif 0.631539 0.145894 0.048004 0.174564 0.622029 0.122118 0.046367 0.209486 0.269889 0.321148 0.066945 0.342018 0.032719 0.333144 0.184121 0.450016 0.103349 0.002039 0.013253 0.881358 0.192074 0.670840 0.120883 0.016203 0.829986 0.162279 0.000584 0.007151 0.989662 0.004393 0.002428 0.003517 0.018912 0.001207 0.977464 0.002417 0.079449 0.015154 0.001043 0.904355 0.003882 0.000966 0.876858 0.118295 0.069301 0.093549 0.825888 0.011262 0.137761 0.469728 0.202622 0.189889 0.098695 0.044952 0.178774 0.677580 0.134313 0.233186 0.227659 0.404842 0.385397 0.324493 0.147276 0.142834 Consensus sequence: AAHYTCAAGTGGBTBV Alignment: BVABCCACTTGAMHTT ---GCCACGTGSD--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00231 Nkx2-2 Reverse Complement Original Motif Backward 5 10 0.035228 Species: Mus musculus Original motif 0.299323 0.258429 0.141957 0.300291 0.267631 0.143882 0.146933 0.441554 0.482614 0.212022 0.233631 0.071733 0.430836 0.073912 0.334439 0.160813 0.124944 0.704331 0.166815 0.003910 0.001941 0.876479 0.000828 0.120752 0.920202 0.005985 0.000456 0.073357 0.023544 0.974093 0.000859 0.001505 0.005010 0.003098 0.001328 0.990564 0.003250 0.198149 0.000490 0.798110 0.134659 0.104976 0.753464 0.006901 0.932490 0.000724 0.006140 0.060646 0.504530 0.106203 0.360995 0.028271 0.673257 0.074893 0.106536 0.145314 0.356324 0.097610 0.230142 0.315924 0.129483 0.188353 0.203623 0.478542 0.289071 0.157675 0.231909 0.321345 Consensus sequence: HDVRCCACTTGARADBD Reverse complement motif 0.321345 0.157675 0.231909 0.289071 0.478542 0.188353 0.203623 0.129483 0.315924 0.097610 0.230142 0.356324 0.145314 0.074893 0.106536 0.673257 0.028271 0.106203 0.360995 0.504530 0.060646 0.000724 0.006140 0.932490 0.134659 0.753464 0.104976 0.006901 0.798110 0.198149 0.000490 0.003250 0.990564 0.003098 0.001328 0.005010 0.023544 0.000859 0.974093 0.001505 0.073357 0.005985 0.000456 0.920202 0.001941 0.000828 0.876479 0.120752 0.124944 0.166815 0.704331 0.003910 0.160813 0.073912 0.334439 0.430836 0.071733 0.212022 0.233631 0.482614 0.441554 0.143882 0.146933 0.267631 0.300291 0.258429 0.141957 0.299323 Consensus sequence: DVDTKTCAAGTGGKBDH Alignment: HDVRCCACTTGARADBD ---GCCACGTGSD---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00084 Gmeb1_primary Reverse Complement Reverse Complement Backward 4 10 0.035858 Species: Mus musculus Original motif 0.166569 0.264627 0.345569 0.223235 0.335599 0.314451 0.153336 0.196615 0.105350 0.231839 0.348018 0.314793 0.131274 0.215623 0.291288 0.361815 0.125570 0.072341 0.404848 0.397242 0.049879 0.039110 0.325167 0.585844 0.705098 0.009202 0.284757 0.000943 0.003535 0.986983 0.004275 0.005207 0.005207 0.004275 0.986983 0.003535 0.000943 0.284757 0.009202 0.705098 0.585844 0.325167 0.039110 0.049879 0.397242 0.404848 0.072341 0.125570 0.206857 0.234555 0.371731 0.186857 0.435957 0.145115 0.181033 0.237896 0.176104 0.260127 0.230770 0.333000 0.272102 0.213365 0.312032 0.202501 0.237402 0.250982 0.266977 0.244639 Consensus sequence: BHBBKKACGTMMVDBVB Reverse complement motif 0.237402 0.266977 0.250982 0.244639 0.272102 0.312032 0.213365 0.202501 0.333000 0.260127 0.230770 0.176104 0.237896 0.145115 0.181033 0.435957 0.206857 0.371731 0.234555 0.186857 0.397242 0.072341 0.404848 0.125570 0.049879 0.325167 0.039110 0.585844 0.705098 0.284757 0.009202 0.000943 0.005207 0.986983 0.004275 0.003535 0.003535 0.004275 0.986983 0.005207 0.000943 0.009202 0.284757 0.705098 0.585844 0.039110 0.325167 0.049879 0.125570 0.404848 0.072341 0.397242 0.361815 0.215623 0.291288 0.131274 0.105350 0.348018 0.231839 0.314793 0.196615 0.314451 0.153336 0.335599 0.166569 0.345569 0.264627 0.223235 Consensus sequence: BVVDVRYACGTRYVBHB Alignment: BVVDVRYACGTRYVBHB ----GCCACGTGSD--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00084 Gmeb1_secondary Original Motif Reverse Complement Forward 4 10 0.037250 Species: Mus musculus Original motif 0.171801 0.139045 0.265726 0.423428 0.146597 0.118316 0.577770 0.157317 0.247220 0.191958 0.432935 0.127887 0.119277 0.232191 0.394786 0.253747 0.227546 0.664338 0.016991 0.091125 0.271290 0.146819 0.518707 0.063184 0.693351 0.120942 0.066863 0.118844 0.041459 0.895990 0.042253 0.020298 0.020298 0.042253 0.895990 0.041459 0.118844 0.066863 0.120942 0.693351 0.063184 0.518707 0.146819 0.271290 0.091125 0.016991 0.664338 0.227546 0.122589 0.186959 0.078274 0.612178 0.103039 0.274719 0.113320 0.508922 0.375945 0.289040 0.127861 0.207153 0.429989 0.189120 0.110127 0.270765 Consensus sequence: DGVBCRACGTYGTYHH Reverse complement motif 0.270765 0.189120 0.110127 0.429989 0.207153 0.289040 0.127861 0.375945 0.508922 0.274719 0.113320 0.103039 0.612178 0.186959 0.078274 0.122589 0.091125 0.664338 0.016991 0.227546 0.063184 0.146819 0.518707 0.271290 0.693351 0.066863 0.120942 0.118844 0.020298 0.895990 0.042253 0.041459 0.041459 0.042253 0.895990 0.020298 0.118844 0.120942 0.066863 0.693351 0.271290 0.518707 0.146819 0.063184 0.227546 0.016991 0.664338 0.091125 0.119277 0.394786 0.232191 0.253747 0.247220 0.432935 0.191958 0.127887 0.146597 0.577770 0.118316 0.157317 0.423428 0.139045 0.265726 0.171801 Consensus sequence: HHMACKACGTMGBVCD Alignment: HHMACKACGTMGBVCD ---HSCACGTGGC--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00526 Foxn1_primary Original Motif Original Motif Forward 7 10 0.038319 Species: Mus musculus Original motif 0.456612 0.057181 0.078281 0.407926 0.460529 0.185506 0.083106 0.270859 0.445717 0.179510 0.239355 0.135417 0.116339 0.145186 0.275331 0.463144 0.239398 0.142078 0.480004 0.138520 0.355157 0.217877 0.284296 0.142670 0.318602 0.444835 0.153321 0.083243 0.609569 0.055866 0.280349 0.054216 0.062297 0.769824 0.027844 0.140035 0.151868 0.019245 0.803188 0.025699 0.011842 0.952534 0.017959 0.017665 0.017665 0.017959 0.952534 0.011842 0.025699 0.803188 0.019245 0.151868 0.140035 0.027844 0.769824 0.062297 0.054216 0.280349 0.055866 0.609569 0.013084 0.624655 0.177956 0.184305 0.287647 0.183527 0.295753 0.233074 0.042309 0.345931 0.198458 0.413301 0.338138 0.266033 0.045367 0.350462 0.302850 0.155320 0.074662 0.467168 0.240926 0.068901 0.283055 0.407118 0.409954 0.183157 0.154186 0.252704 Consensus sequence: WHVBVVMACGCGCGTCDYHWDH Reverse complement motif 0.252704 0.183157 0.154186 0.409954 0.407118 0.068901 0.283055 0.240926 0.467168 0.155320 0.074662 0.302850 0.350462 0.266033 0.045367 0.338138 0.413301 0.345931 0.198458 0.042309 0.287647 0.295753 0.183527 0.233074 0.013084 0.177956 0.624655 0.184305 0.609569 0.280349 0.055866 0.054216 0.140035 0.769824 0.027844 0.062297 0.025699 0.019245 0.803188 0.151868 0.017665 0.952534 0.017959 0.011842 0.011842 0.017959 0.952534 0.017665 0.151868 0.803188 0.019245 0.025699 0.062297 0.027844 0.769824 0.140035 0.054216 0.055866 0.280349 0.609569 0.318602 0.153321 0.444835 0.083243 0.142670 0.217877 0.284296 0.355157 0.239398 0.480004 0.142078 0.138520 0.463144 0.145186 0.275331 0.116339 0.135417 0.179510 0.239355 0.445717 0.270859 0.185506 0.083106 0.460529 0.407926 0.057181 0.078281 0.456612 Consensus sequence: HDWHMHGACGCGCGTRBVVBHW Alignment: WHVBVVMACGCGCGTCDYHWDH ------HSCACGTGGC------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 3 Motif ID: 57 Motif name: REST Original motif 0.132621 0.109365 0.230044 0.527970 0.036318 0.168441 0.091421 0.703820 0.047589 0.855354 0.031309 0.065748 0.906367 0.018727 0.058677 0.016230 0.021197 0.027431 0.945137 0.006234 0.076012 0.609346 0.201246 0.113396 0.980697 0.004359 0.007472 0.007472 0.001868 0.987547 0.007472 0.003113 0.021793 0.922167 0.012453 0.043587 0.568847 0.125234 0.100935 0.204984 0.136534 0.233791 0.077307 0.552369 0.024314 0.004364 0.966958 0.004364 0.012469 0.003117 0.983167 0.001247 0.877105 0.069869 0.021210 0.031815 0.008125 0.800000 0.145625 0.046250 0.983750 0.005625 0.004375 0.006250 0.026349 0.008156 0.959849 0.005646 0.128688 0.632141 0.114878 0.124294 0.229899 0.019472 0.432161 0.318467 0.133962 0.586792 0.200629 0.078616 0.112579 0.700629 0.023270 0.163522 Consensus sequence: TTCAGCACCATGGACAGCKCC Reserve complement motif 0.112579 0.023270 0.700629 0.163522 0.133962 0.200629 0.586792 0.078616 0.229899 0.432161 0.019472 0.318467 0.128688 0.114878 0.632141 0.124294 0.026349 0.959849 0.008156 0.005646 0.006250 0.005625 0.004375 0.983750 0.008125 0.145625 0.800000 0.046250 0.031815 0.069869 0.021210 0.877105 0.012469 0.983167 0.003117 0.001247 0.024314 0.966958 0.004364 0.004364 0.552369 0.233791 0.077307 0.136534 0.204984 0.125234 0.100935 0.568847 0.021793 0.012453 0.922167 0.043587 0.001868 0.007472 0.987547 0.003113 0.007472 0.004359 0.007472 0.980697 0.076012 0.201246 0.609346 0.113396 0.021197 0.945137 0.027431 0.006234 0.016230 0.018727 0.058677 0.906367 0.047589 0.031309 0.855354 0.065748 0.703820 0.168441 0.091421 0.036318 0.527970 0.109365 0.230044 0.132621 Consensus sequence: GGYGCTGTCCATGGTGCTGAA ************************************************************************ Best Matches for Motif ID 57 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v015681_primary Original Motif Original Motif Forward 3 21 0.069918 Species: Mus musculus Original motif 0.183797 0.268049 0.330111 0.218043 0.127599 0.330310 0.243614 0.298477 0.143199 0.188046 0.268593 0.400162 0.214690 0.205230 0.247090 0.332990 0.294688 0.299104 0.327152 0.079056 0.221909 0.193223 0.480155 0.104712 0.444072 0.068239 0.481838 0.005852 0.006182 0.015429 0.901278 0.077111 0.766535 0.111138 0.121632 0.000696 0.014848 0.973961 0.000298 0.010893 0.001807 0.992200 0.002669 0.003324 0.795344 0.140510 0.018576 0.045571 0.006990 0.988200 0.002510 0.002299 0.154898 0.842296 0.000998 0.001808 0.029577 0.919262 0.006935 0.044226 0.677987 0.032075 0.185065 0.104874 0.195132 0.364580 0.319321 0.120967 0.225412 0.115034 0.612849 0.046705 0.548628 0.058900 0.162857 0.229616 0.112531 0.340331 0.165910 0.381227 0.073029 0.303078 0.363896 0.259997 0.561485 0.260567 0.092979 0.084969 0.132283 0.457691 0.140159 0.269867 Consensus sequence: BBBDVVRGACCACCCAVGABBAB Reverse complement motif 0.132283 0.140159 0.457691 0.269867 0.084969 0.260567 0.092979 0.561485 0.073029 0.363896 0.303078 0.259997 0.381227 0.340331 0.165910 0.112531 0.229616 0.058900 0.162857 0.548628 0.225412 0.612849 0.115034 0.046705 0.195132 0.319321 0.364580 0.120967 0.104874 0.032075 0.185065 0.677987 0.029577 0.006935 0.919262 0.044226 0.154898 0.000998 0.842296 0.001808 0.006990 0.002510 0.988200 0.002299 0.045571 0.140510 0.018576 0.795344 0.001807 0.002669 0.992200 0.003324 0.014848 0.000298 0.973961 0.010893 0.000696 0.111138 0.121632 0.766535 0.006182 0.901278 0.015429 0.077111 0.444072 0.481838 0.068239 0.005852 0.221909 0.480155 0.193223 0.104712 0.294688 0.327152 0.299104 0.079056 0.332990 0.205230 0.247090 0.214690 0.400162 0.188046 0.268593 0.143199 0.127599 0.243614 0.330310 0.298477 0.183797 0.330111 0.268049 0.218043 Consensus sequence: BTBVTCVTGGGTGGTCMVVDVBB Alignment: BBBDVVRGACCACCCAVGABBAB --TTCAGCACCATGGACAGCKCC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v015681_secondary Reverse Complement Reverse Complement Forward 1 21 0.073468 Species: Mus musculus Original motif 0.214165 0.143436 0.372522 0.269876 0.314445 0.406003 0.160351 0.119201 0.137147 0.092924 0.042921 0.727007 0.044121 0.072843 0.051741 0.831295 0.261292 0.324124 0.298498 0.116086 0.258125 0.323243 0.263362 0.155271 0.204557 0.589399 0.107153 0.098891 0.371021 0.244027 0.291102 0.093849 0.096327 0.572718 0.011797 0.319159 0.027282 0.046183 0.844519 0.082016 0.018921 0.012887 0.915917 0.052275 0.364793 0.166722 0.084229 0.384256 0.028216 0.011233 0.951056 0.009495 0.054974 0.004738 0.890377 0.049911 0.006802 0.312915 0.134247 0.546036 0.241289 0.628210 0.104788 0.025713 0.237863 0.302807 0.213018 0.246311 0.349399 0.203220 0.086635 0.360746 0.386634 0.144693 0.246895 0.221779 0.425101 0.354676 0.093374 0.126849 0.060272 0.391320 0.104905 0.443503 0.162090 0.190233 0.227433 0.420244 Consensus sequence: DVTTVVCVYGGHGGYCHHDMYB Reverse complement motif 0.420244 0.190233 0.227433 0.162090 0.443503 0.391320 0.104905 0.060272 0.126849 0.354676 0.093374 0.425101 0.221779 0.144693 0.246895 0.386634 0.360746 0.203220 0.086635 0.349399 0.237863 0.213018 0.302807 0.246311 0.241289 0.104788 0.628210 0.025713 0.546036 0.312915 0.134247 0.006802 0.054974 0.890377 0.004738 0.049911 0.028216 0.951056 0.011233 0.009495 0.384256 0.166722 0.084229 0.364793 0.018921 0.915917 0.012887 0.052275 0.027282 0.844519 0.046183 0.082016 0.096327 0.011797 0.572718 0.319159 0.093849 0.244027 0.291102 0.371021 0.204557 0.107153 0.589399 0.098891 0.258125 0.263362 0.323243 0.155271 0.261292 0.298498 0.324124 0.116086 0.831295 0.072843 0.051741 0.044121 0.727007 0.092924 0.042921 0.137147 0.314445 0.160351 0.406003 0.119201 0.214165 0.372522 0.143436 0.269876 Consensus sequence: VMYDHDGMCCHCCKBGVVAAVH Alignment: VMYDHDGMCCHCCKBGVVAAVH GGYGCTGTCCATGGTGCTGAA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v016060_secondary Original Motif Original Motif Forward 2 21 0.074065 Species: Mus musculus Original motif 0.168550 0.345968 0.396524 0.088958 0.038113 0.360882 0.114042 0.486963 0.349356 0.180599 0.051416 0.418629 0.258773 0.332518 0.244932 0.163778 0.371663 0.208591 0.263136 0.156609 0.225440 0.321741 0.175932 0.276887 0.100827 0.656850 0.018644 0.223679 0.494140 0.155427 0.327424 0.023009 0.105642 0.805846 0.027712 0.060800 0.065110 0.845072 0.058046 0.031772 0.649343 0.110180 0.180680 0.059797 0.064269 0.853604 0.066860 0.015268 0.437421 0.533797 0.016833 0.011948 0.121694 0.787708 0.016177 0.074421 0.625382 0.066925 0.266070 0.041623 0.117819 0.608153 0.165139 0.108889 0.145639 0.102001 0.604926 0.147434 0.521188 0.184986 0.064607 0.229219 0.180371 0.274237 0.096591 0.448801 0.071055 0.455813 0.332817 0.140315 0.084503 0.199982 0.448293 0.267222 0.389451 0.169545 0.155507 0.285497 0.424314 0.227621 0.101210 0.246855 Consensus sequence: VYWVVHCRCCACMCACGAHSBHH Reverse complement motif 0.246855 0.227621 0.101210 0.424314 0.285497 0.169545 0.155507 0.389451 0.084503 0.448293 0.199982 0.267222 0.071055 0.332817 0.455813 0.140315 0.448801 0.274237 0.096591 0.180371 0.229219 0.184986 0.064607 0.521188 0.145639 0.604926 0.102001 0.147434 0.117819 0.165139 0.608153 0.108889 0.041623 0.066925 0.266070 0.625382 0.121694 0.016177 0.787708 0.074421 0.437421 0.016833 0.533797 0.011948 0.064269 0.066860 0.853604 0.015268 0.059797 0.110180 0.180680 0.649343 0.065110 0.058046 0.845072 0.031772 0.105642 0.027712 0.805846 0.060800 0.023009 0.155427 0.327424 0.494140 0.100827 0.018644 0.656850 0.223679 0.225440 0.175932 0.321741 0.276887 0.156609 0.208591 0.263136 0.371663 0.258773 0.244932 0.332518 0.163778 0.418629 0.180599 0.051416 0.349356 0.486963 0.360882 0.114042 0.038113 0.168550 0.396524 0.345968 0.088958 Consensus sequence: HHBSHTCGTGRGTGGKGDBVWMV Alignment: VYWVVHCRCCACMCACGAHSBHH -TTCAGCACCATGGACAGCKCC- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v015681_secondary Original Motif Original Motif Forward 3 21 0.075015 Species: Mus musculus Original motif 0.404007 0.395873 0.173319 0.026801 0.305977 0.215534 0.215359 0.263130 0.370148 0.250957 0.113088 0.265808 0.324336 0.229498 0.174679 0.271487 0.263563 0.137896 0.079217 0.519324 0.265762 0.222582 0.082555 0.429102 0.206721 0.288405 0.017851 0.487023 0.164361 0.236500 0.061051 0.538088 0.593344 0.348446 0.050304 0.007906 0.031328 0.947050 0.007032 0.014590 0.010428 0.956605 0.029142 0.003825 0.459636 0.207616 0.155368 0.177380 0.014573 0.964608 0.012209 0.008610 0.066291 0.918196 0.008729 0.006784 0.019488 0.866774 0.018897 0.094841 0.767405 0.104198 0.029234 0.099164 0.052494 0.772531 0.039832 0.135142 0.296085 0.243498 0.350935 0.109482 0.518843 0.226659 0.124784 0.129714 0.647901 0.019721 0.159901 0.172477 0.113912 0.231511 0.214864 0.439713 0.223117 0.310596 0.293328 0.172959 0.185557 0.487662 0.136321 0.190459 Consensus sequence: MHHHWHYTMCCHCCCACVAABVH Reverse complement motif 0.185557 0.136321 0.487662 0.190459 0.223117 0.293328 0.310596 0.172959 0.439713 0.231511 0.214864 0.113912 0.172477 0.019721 0.159901 0.647901 0.129714 0.226659 0.124784 0.518843 0.296085 0.350935 0.243498 0.109482 0.052494 0.039832 0.772531 0.135142 0.099164 0.104198 0.029234 0.767405 0.019488 0.018897 0.866774 0.094841 0.066291 0.008729 0.918196 0.006784 0.014573 0.012209 0.964608 0.008610 0.177380 0.207616 0.155368 0.459636 0.010428 0.029142 0.956605 0.003825 0.031328 0.007032 0.947050 0.014590 0.007906 0.348446 0.050304 0.593344 0.538088 0.236500 0.061051 0.164361 0.487023 0.288405 0.017851 0.206721 0.429102 0.222582 0.082555 0.265762 0.519324 0.137896 0.079217 0.263563 0.271487 0.229498 0.174679 0.324336 0.265808 0.250957 0.113088 0.370148 0.263130 0.215534 0.215359 0.305977 0.026801 0.395873 0.173319 0.404007 Consensus sequence: DVVTTVGTGGGHGGYAMHWHHHY Alignment: MHHHWHYTMCCHCCCACVAABVH --TTCAGCACCATGGACAGCKCC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v016060_primary Reverse Complement Original Motif Backward 3 21 0.075145 Species: Mus musculus Original motif 0.204923 0.208846 0.365383 0.220848 0.294304 0.300143 0.167287 0.238266 0.109711 0.619514 0.117379 0.153396 0.178979 0.378580 0.230177 0.212264 0.159594 0.542602 0.118178 0.179627 0.125206 0.430074 0.151826 0.292894 0.097692 0.709845 0.116956 0.075506 0.148292 0.565912 0.037632 0.248164 0.077951 0.034190 0.855503 0.032356 0.001657 0.001061 0.971877 0.025405 0.001926 0.001084 0.991712 0.005278 0.033031 0.012001 0.057796 0.897171 0.002723 0.002647 0.993348 0.001281 0.003261 0.000963 0.987199 0.008577 0.000611 0.090925 0.074857 0.833608 0.015299 0.978878 0.004949 0.000874 0.013368 0.600902 0.033485 0.352245 0.231949 0.149575 0.118804 0.499672 0.267580 0.186002 0.371242 0.175176 0.264884 0.223483 0.110082 0.401551 0.221365 0.170121 0.179559 0.428955 0.112997 0.692930 0.139981 0.054092 0.460305 0.207883 0.155111 0.176702 Consensus sequence: BHCBCBCCGGGTGGTCYHVHDCH Reverse complement motif 0.176702 0.207883 0.155111 0.460305 0.112997 0.139981 0.692930 0.054092 0.428955 0.170121 0.179559 0.221365 0.401551 0.223483 0.110082 0.264884 0.267580 0.371242 0.186002 0.175176 0.499672 0.149575 0.118804 0.231949 0.013368 0.033485 0.600902 0.352245 0.015299 0.004949 0.978878 0.000874 0.833608 0.090925 0.074857 0.000611 0.003261 0.987199 0.000963 0.008577 0.002723 0.993348 0.002647 0.001281 0.897171 0.012001 0.057796 0.033031 0.001926 0.991712 0.001084 0.005278 0.001657 0.971877 0.001061 0.025405 0.077951 0.855503 0.034190 0.032356 0.148292 0.037632 0.565912 0.248164 0.097692 0.116956 0.709845 0.075506 0.125206 0.151826 0.430074 0.292894 0.159594 0.118178 0.542602 0.179627 0.178979 0.230177 0.378580 0.212264 0.109711 0.117379 0.619514 0.153396 0.294304 0.167287 0.300143 0.238266 0.204923 0.365383 0.208846 0.220848 Consensus sequence: HGDHVHKGACCACCCGGBGBGDB Alignment: BHCBCBCCGGGTGGTCYHVHDCH GGYGCTGTCCATGGTGCTGAA-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v016060_secondary Original Motif Reverse Complement Backward 2 21 0.075832 Species: Mus musculus Original motif 0.319838 0.171199 0.138099 0.370865 0.269358 0.196600 0.346909 0.187133 0.176807 0.338888 0.193903 0.290402 0.230268 0.119645 0.310500 0.339587 0.517372 0.257658 0.111673 0.113296 0.159477 0.126524 0.561119 0.152879 0.117072 0.553013 0.130919 0.198996 0.073372 0.163548 0.525014 0.238066 0.143608 0.186896 0.170528 0.498967 0.054943 0.079034 0.722992 0.143031 0.048852 0.015134 0.852458 0.083556 0.029001 0.023938 0.918900 0.028160 0.036727 0.092645 0.090591 0.780037 0.017757 0.057598 0.895222 0.029423 0.026113 0.048113 0.879744 0.046030 0.023041 0.787043 0.123490 0.066426 0.579766 0.004868 0.296873 0.118493 0.303862 0.042931 0.290151 0.363055 0.099672 0.237431 0.262301 0.400597 0.217788 0.163908 0.367628 0.250676 0.450783 0.141108 0.226137 0.181972 0.485086 0.102553 0.242662 0.169700 0.109057 0.454222 0.145665 0.291056 Consensus sequence: HVBDAGCGBGGGTGGCRDBDDDB Reverse complement motif 0.109057 0.145665 0.454222 0.291056 0.169700 0.102553 0.242662 0.485086 0.181972 0.141108 0.226137 0.450783 0.217788 0.367628 0.163908 0.250676 0.400597 0.237431 0.262301 0.099672 0.363055 0.042931 0.290151 0.303862 0.118493 0.004868 0.296873 0.579766 0.023041 0.123490 0.787043 0.066426 0.026113 0.879744 0.048113 0.046030 0.017757 0.895222 0.057598 0.029423 0.780037 0.092645 0.090591 0.036727 0.029001 0.918900 0.023938 0.028160 0.048852 0.852458 0.015134 0.083556 0.054943 0.722992 0.079034 0.143031 0.498967 0.186896 0.170528 0.143608 0.073372 0.525014 0.163548 0.238066 0.117072 0.130919 0.553013 0.198996 0.159477 0.561119 0.126524 0.152879 0.113296 0.257658 0.111673 0.517372 0.339587 0.119645 0.310500 0.230268 0.176807 0.193903 0.338888 0.290402 0.269358 0.346909 0.196600 0.187133 0.370865 0.171199 0.138099 0.319838 Consensus sequence: BDDHVDKGCCACCCVCGCTDBVH Alignment: BDDHVDKGCCACCCVCGCTDBVH -TTCAGCACCATGGACAGCKCC- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v016060_primary Original Motif Original Motif Backward 1 21 0.077345 Species: Mus musculus Original motif 0.137831 0.118922 0.394177 0.349070 0.190108 0.163633 0.138507 0.507753 0.346002 0.332315 0.228621 0.093063 0.113254 0.287554 0.373285 0.225908 0.272578 0.125402 0.328963 0.273057 0.333973 0.115165 0.194267 0.356595 0.381054 0.086215 0.501679 0.031052 0.002232 0.007405 0.966087 0.024276 0.834741 0.112115 0.052053 0.001091 0.009034 0.983239 0.000766 0.006960 0.002054 0.988103 0.003138 0.006705 0.805772 0.171299 0.008415 0.014515 0.020076 0.976846 0.000894 0.002183 0.079914 0.917273 0.001179 0.001634 0.013983 0.950545 0.004205 0.031267 0.789407 0.039441 0.108645 0.062507 0.055453 0.161271 0.595249 0.188028 0.333424 0.128169 0.373270 0.165136 0.536103 0.109520 0.062980 0.291397 0.346477 0.090909 0.279533 0.283081 0.045892 0.190183 0.584314 0.179611 0.088294 0.406148 0.251647 0.253912 0.202467 0.447159 0.162802 0.187571 Consensus sequence: DTVBDDRGACCACCCAGDWDGBH Reverse complement motif 0.202467 0.162802 0.447159 0.187571 0.088294 0.251647 0.406148 0.253912 0.045892 0.584314 0.190183 0.179611 0.283081 0.090909 0.279533 0.346477 0.291397 0.109520 0.062980 0.536103 0.333424 0.373270 0.128169 0.165136 0.055453 0.595249 0.161271 0.188028 0.062507 0.039441 0.108645 0.789407 0.013983 0.004205 0.950545 0.031267 0.079914 0.001179 0.917273 0.001634 0.020076 0.000894 0.976846 0.002183 0.014515 0.171299 0.008415 0.805772 0.002054 0.003138 0.988103 0.006705 0.009034 0.000766 0.983239 0.006960 0.001091 0.112115 0.052053 0.834741 0.002232 0.966087 0.007405 0.024276 0.381054 0.501679 0.086215 0.031052 0.356595 0.115165 0.194267 0.333973 0.272578 0.328963 0.125402 0.273057 0.113254 0.373285 0.287554 0.225908 0.093063 0.332315 0.228621 0.346002 0.507753 0.163633 0.138507 0.190108 0.137831 0.394177 0.118922 0.349070 Consensus sequence: DBCDWHCTGGGTGGTCMDHBBAH Alignment: DTVBDDRGACCACCCAGDWDGBH --TTCAGCACCATGGACAGCKCC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00050 Bhlhb2_secondary Original Motif Original Motif Forward 3 21 0.077537 Species: Mus musculus Original motif 0.120938 0.344851 0.124072 0.410138 0.220931 0.169844 0.422396 0.186829 0.127752 0.260812 0.103811 0.507625 0.140641 0.405473 0.287668 0.166218 0.296957 0.155579 0.301094 0.246370 0.219647 0.287193 0.154072 0.339087 0.049294 0.026059 0.121789 0.802859 0.520042 0.289284 0.173423 0.017251 0.049190 0.943472 0.004308 0.003030 0.902609 0.006767 0.074770 0.015854 0.003221 0.971329 0.005512 0.019937 0.019937 0.005512 0.971329 0.003221 0.015854 0.074770 0.006767 0.902609 0.003030 0.004308 0.943472 0.049190 0.003497 0.088920 0.685942 0.221641 0.802859 0.121789 0.026059 0.049294 0.334544 0.155170 0.275193 0.235092 0.275957 0.132104 0.454982 0.136957 0.134097 0.254352 0.422940 0.188611 0.396163 0.432784 0.051281 0.119772 0.276474 0.115627 0.419844 0.188056 0.160759 0.088061 0.649863 0.101318 0.203314 0.166595 0.106821 0.523270 Consensus sequence: YDYBDHTMCACGTGGADDBMDGT Reverse complement motif 0.523270 0.166595 0.106821 0.203314 0.160759 0.649863 0.088061 0.101318 0.276474 0.419844 0.115627 0.188056 0.396163 0.051281 0.432784 0.119772 0.134097 0.422940 0.254352 0.188611 0.275957 0.454982 0.132104 0.136957 0.235092 0.155170 0.275193 0.334544 0.049294 0.121789 0.026059 0.802859 0.003497 0.685942 0.088920 0.221641 0.003030 0.943472 0.004308 0.049190 0.902609 0.074770 0.006767 0.015854 0.019937 0.971329 0.005512 0.003221 0.003221 0.005512 0.971329 0.019937 0.015854 0.006767 0.074770 0.902609 0.049190 0.004308 0.943472 0.003030 0.017251 0.289284 0.173423 0.520042 0.802859 0.026059 0.121789 0.049294 0.339087 0.287193 0.154072 0.219647 0.296957 0.301094 0.155579 0.246370 0.140641 0.287668 0.405473 0.166218 0.507625 0.260812 0.103811 0.127752 0.220931 0.422396 0.169844 0.186829 0.410138 0.344851 0.124072 0.120938 Consensus sequence: ACHRBHDTCCACGTGYAHHBMHM Alignment: YDYBDHTMCACGTGGADDBMDGT --TTCAGCACCATGGACAGCKCC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00528 Foxm1_secondary Reverse Complement Reverse Complement Backward 1 21 0.077977 Species: Mus musculus Original motif 0.399785 0.446658 0.111435 0.042122 0.535175 0.103991 0.089706 0.271128 0.078171 0.387987 0.375083 0.158759 0.309001 0.519142 0.070618 0.101239 0.201844 0.255818 0.323149 0.219190 0.534101 0.109845 0.235026 0.121028 0.656038 0.037473 0.261484 0.045006 0.315713 0.164290 0.471815 0.048182 0.651960 0.009412 0.328237 0.010391 0.937365 0.017313 0.007516 0.037807 0.019983 0.044238 0.012387 0.923392 0.061195 0.021485 0.881645 0.035675 0.017521 0.952998 0.013139 0.016342 0.254160 0.029735 0.493023 0.223082 0.239200 0.593324 0.114503 0.052973 0.610822 0.071539 0.099169 0.218470 0.166610 0.389712 0.204400 0.239278 0.227752 0.361626 0.178497 0.232125 0.537030 0.182466 0.026035 0.254470 0.235902 0.151006 0.043788 0.569304 0.081851 0.250397 0.590059 0.077693 0.340417 0.189613 0.272075 0.197895 Consensus sequence: MWSMBAARRATGCDCABHATGD Reverse complement motif 0.197895 0.189613 0.272075 0.340417 0.081851 0.590059 0.250397 0.077693 0.569304 0.151006 0.043788 0.235902 0.254470 0.182466 0.026035 0.537030 0.227752 0.178497 0.361626 0.232125 0.166610 0.204400 0.389712 0.239278 0.218470 0.071539 0.099169 0.610822 0.239200 0.114503 0.593324 0.052973 0.254160 0.493023 0.029735 0.223082 0.017521 0.013139 0.952998 0.016342 0.061195 0.881645 0.021485 0.035675 0.923392 0.044238 0.012387 0.019983 0.037807 0.017313 0.007516 0.937365 0.010391 0.009412 0.328237 0.651960 0.315713 0.471815 0.164290 0.048182 0.045006 0.037473 0.261484 0.656038 0.121028 0.109845 0.235026 0.534101 0.201844 0.323149 0.255818 0.219190 0.309001 0.070618 0.519142 0.101239 0.078171 0.375083 0.387987 0.158759 0.271128 0.103991 0.089706 0.535175 0.399785 0.111435 0.446658 0.042122 Consensus sequence: DCATDBTGHGCATKMTTBRSWR Alignment: DCATDBTGHGCATKMTTBRSWR -GGYGCTGTCCATGGTGCTGAA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00400 Zif268 Reverse Complement Original Motif Backward 1 21 0.078597 Species: Mus musculus Original motif 0.104824 0.412716 0.254506 0.227955 0.644922 0.065476 0.140479 0.149122 0.201205 0.166164 0.347131 0.285501 0.360606 0.256316 0.150766 0.232313 0.199831 0.240681 0.279350 0.280137 0.234308 0.204076 0.321306 0.240310 0.274112 0.462435 0.111425 0.152028 0.067070 0.717501 0.073934 0.141496 0.106745 0.084442 0.658566 0.150247 0.025128 0.967053 0.003585 0.004234 0.006412 0.982989 0.003227 0.007371 0.009588 0.877620 0.002571 0.110221 0.621521 0.355443 0.015669 0.007366 0.002600 0.980275 0.004191 0.012934 0.118773 0.026658 0.783843 0.070725 0.022358 0.822101 0.024684 0.130857 0.713212 0.080912 0.128793 0.077084 0.166568 0.250955 0.107934 0.474544 0.225040 0.222494 0.163301 0.389166 0.268976 0.223206 0.265314 0.242504 0.137052 0.229058 0.148439 0.485451 0.135819 0.304550 0.141994 0.417637 0.272440 0.319501 0.230580 0.177478 Consensus sequence: BADHBDHCGCCCMCGCAHHDBBV Reverse complement motif 0.272440 0.230580 0.319501 0.177478 0.417637 0.304550 0.141994 0.135819 0.485451 0.229058 0.148439 0.137052 0.242504 0.223206 0.265314 0.268976 0.389166 0.222494 0.163301 0.225040 0.474544 0.250955 0.107934 0.166568 0.077084 0.080912 0.128793 0.713212 0.022358 0.024684 0.822101 0.130857 0.118773 0.783843 0.026658 0.070725 0.002600 0.004191 0.980275 0.012934 0.007366 0.355443 0.015669 0.621521 0.009588 0.002571 0.877620 0.110221 0.006412 0.003227 0.982989 0.007371 0.025128 0.003585 0.967053 0.004234 0.106745 0.658566 0.084442 0.150247 0.067070 0.073934 0.717501 0.141496 0.274112 0.111425 0.462435 0.152028 0.234308 0.321306 0.204076 0.240310 0.280137 0.240681 0.279350 0.199831 0.232313 0.256316 0.150766 0.360606 0.201205 0.347131 0.166164 0.285501 0.149122 0.065476 0.140479 0.644922 0.104824 0.254506 0.412716 0.227955 Consensus sequence: VVVDHHTGCGYGGGCGDHVHHTB Alignment: VVVDHHTGCGYGGGCGDHVHHTB --GGYGCTGTCCATGGTGCTGAA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 3 Motif ID: 58 Motif name: Myc Original motif 0.295154 0.422907 0.158590 0.123348 0.149780 0.233480 0.572687 0.044053 0.035242 0.964758 0.000000 0.000000 0.955947 0.017621 0.022026 0.004405 0.000000 0.933921 0.013216 0.052863 0.083700 0.008811 0.898678 0.008811 0.039648 0.193833 0.000000 0.766520 0.000000 0.008811 0.951542 0.039648 0.000000 0.074890 0.806167 0.118943 0.198238 0.471366 0.105727 0.224670 Consensus sequence: VGCACGTGGH Reserve complement motif 0.198238 0.105727 0.471366 0.224670 0.000000 0.806167 0.074890 0.118943 0.000000 0.951542 0.008811 0.039648 0.766520 0.193833 0.000000 0.039648 0.083700 0.898678 0.008811 0.008811 0.000000 0.013216 0.933921 0.052863 0.004405 0.017621 0.022026 0.955947 0.035242 0.000000 0.964758 0.000000 0.149780 0.572687 0.233480 0.044053 0.295154 0.158590 0.422907 0.123348 Consensus sequence: DCCACGTGCV ************************************************************************ Best Matches for Motif ID 58 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00060 Max_primary Original Motif Original Motif Backward 5 10 0.000000 Species: Mus musculus Original motif 0.234855 0.152539 0.301720 0.310886 0.199226 0.147959 0.439250 0.213565 0.582926 0.274768 0.075866 0.066440 0.138829 0.475428 0.305884 0.079859 0.024979 0.969691 0.001811 0.003520 0.966345 0.003728 0.022320 0.007607 0.000598 0.907006 0.008160 0.084236 0.084236 0.008160 0.907006 0.000598 0.007607 0.022320 0.003728 0.966345 0.003520 0.001811 0.969691 0.024979 0.149140 0.241218 0.389598 0.220044 0.066440 0.075866 0.274768 0.582926 0.186990 0.346199 0.250066 0.216745 0.273437 0.225889 0.300738 0.199936 0.160893 0.111177 0.477963 0.249968 0.171790 0.101256 0.424580 0.302375 Consensus sequence: DDASCACGTGBTBVDD Reverse complement motif 0.171790 0.424580 0.101256 0.302375 0.160893 0.477963 0.111177 0.249968 0.273437 0.300738 0.225889 0.199936 0.186990 0.250066 0.346199 0.216745 0.582926 0.075866 0.274768 0.066440 0.149140 0.389598 0.241218 0.220044 0.003520 0.969691 0.001811 0.024979 0.966345 0.022320 0.003728 0.007607 0.084236 0.907006 0.008160 0.000598 0.000598 0.008160 0.907006 0.084236 0.007607 0.003728 0.022320 0.966345 0.024979 0.001811 0.969691 0.003520 0.138829 0.305884 0.475428 0.079859 0.066440 0.274768 0.075866 0.582926 0.199226 0.439250 0.147959 0.213565 0.310886 0.152539 0.301720 0.234855 Consensus sequence: HHVBABCACGTGSTHD Alignment: DDASCACGTGBTBVDD --VGCACGTGGH---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00050 Bhlhb2_secondary Reverse Complement Reverse Complement Forward 8 10 0.006319 Species: Mus musculus Original motif 0.120938 0.344851 0.124072 0.410138 0.220931 0.169844 0.422396 0.186829 0.127752 0.260812 0.103811 0.507625 0.140641 0.405473 0.287668 0.166218 0.296957 0.155579 0.301094 0.246370 0.219647 0.287193 0.154072 0.339087 0.049294 0.026059 0.121789 0.802859 0.520042 0.289284 0.173423 0.017251 0.049190 0.943472 0.004308 0.003030 0.902609 0.006767 0.074770 0.015854 0.003221 0.971329 0.005512 0.019937 0.019937 0.005512 0.971329 0.003221 0.015854 0.074770 0.006767 0.902609 0.003030 0.004308 0.943472 0.049190 0.003497 0.088920 0.685942 0.221641 0.802859 0.121789 0.026059 0.049294 0.334544 0.155170 0.275193 0.235092 0.275957 0.132104 0.454982 0.136957 0.134097 0.254352 0.422940 0.188611 0.396163 0.432784 0.051281 0.119772 0.276474 0.115627 0.419844 0.188056 0.160759 0.088061 0.649863 0.101318 0.203314 0.166595 0.106821 0.523270 Consensus sequence: YDYBDHTMCACGTGGADDBMDGT Reverse complement motif 0.523270 0.166595 0.106821 0.203314 0.160759 0.649863 0.088061 0.101318 0.276474 0.419844 0.115627 0.188056 0.396163 0.051281 0.432784 0.119772 0.134097 0.422940 0.254352 0.188611 0.275957 0.454982 0.132104 0.136957 0.235092 0.155170 0.275193 0.334544 0.049294 0.121789 0.026059 0.802859 0.003497 0.685942 0.088920 0.221641 0.003030 0.943472 0.004308 0.049190 0.902609 0.074770 0.006767 0.015854 0.019937 0.971329 0.005512 0.003221 0.003221 0.005512 0.971329 0.019937 0.015854 0.006767 0.074770 0.902609 0.049190 0.004308 0.943472 0.003030 0.017251 0.289284 0.173423 0.520042 0.802859 0.026059 0.121789 0.049294 0.339087 0.287193 0.154072 0.219647 0.296957 0.301094 0.155579 0.246370 0.140641 0.287668 0.405473 0.166218 0.507625 0.260812 0.103811 0.127752 0.220931 0.422396 0.169844 0.186829 0.410138 0.344851 0.124072 0.120938 Consensus sequence: ACHRBHDTCCACGTGYAHHBMHM Alignment: ACHRBHDTCCACGTGYAHHBMHM -------DCCACGTGCV------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00050 Bhlhb2_primary Reverse Complement Reverse Complement Backward 7 10 0.008217 Species: Mus musculus Original motif 0.347837 0.112349 0.403713 0.136102 0.298329 0.175329 0.324534 0.201809 0.421791 0.222553 0.113615 0.242041 0.387506 0.130670 0.161435 0.320389 0.197183 0.244864 0.304611 0.253342 0.345884 0.188786 0.278290 0.187041 0.228203 0.142148 0.408269 0.221381 0.037126 0.006772 0.231775 0.724328 0.055214 0.942800 0.001192 0.000794 0.974119 0.004466 0.015535 0.005880 0.000300 0.958145 0.007498 0.034056 0.034056 0.007498 0.958145 0.000300 0.005880 0.015535 0.004466 0.974119 0.000794 0.001192 0.942800 0.055214 0.724328 0.231775 0.006772 0.037126 0.015720 0.466476 0.315208 0.202596 0.173670 0.355170 0.210710 0.260449 0.407419 0.261539 0.134430 0.196612 0.351478 0.209698 0.262426 0.176399 0.207869 0.284582 0.198951 0.308598 0.434482 0.113724 0.184408 0.267386 0.211144 0.363745 0.173978 0.251133 Consensus sequence: RDHDBVDTCACGTGASBHVHDH Reverse complement motif 0.211144 0.173978 0.363745 0.251133 0.267386 0.113724 0.184408 0.434482 0.308598 0.284582 0.198951 0.207869 0.176399 0.209698 0.262426 0.351478 0.196612 0.261539 0.134430 0.407419 0.173670 0.210710 0.355170 0.260449 0.015720 0.315208 0.466476 0.202596 0.037126 0.231775 0.006772 0.724328 0.000794 0.942800 0.001192 0.055214 0.974119 0.015535 0.004466 0.005880 0.034056 0.958145 0.007498 0.000300 0.000300 0.007498 0.958145 0.034056 0.005880 0.004466 0.015535 0.974119 0.055214 0.001192 0.942800 0.000794 0.724328 0.006772 0.231775 0.037126 0.228203 0.408269 0.142148 0.221381 0.187041 0.188786 0.278290 0.345884 0.197183 0.304611 0.244864 0.253342 0.320389 0.130670 0.161435 0.387506 0.242041 0.222553 0.113615 0.421791 0.298329 0.324534 0.175329 0.201809 0.347837 0.403713 0.112349 0.136102 Consensus sequence: DDHBHBSTCACGTGAHBBDHHM Alignment: DDHBHBSTCACGTGAHBBDHHM ------DCCACGTGCV------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00046 Tcfe2a_primary Original Motif Reverse Complement Backward 4 10 0.014001 Species: Mus musculus Original motif 0.306209 0.232705 0.244475 0.216611 0.165668 0.171480 0.222584 0.440269 0.213008 0.429038 0.156385 0.201569 0.283226 0.329518 0.160795 0.226461 0.439156 0.283517 0.251270 0.026056 0.014994 0.980987 0.000714 0.003304 0.975741 0.020182 0.002909 0.001168 0.000926 0.191353 0.801648 0.006073 0.015382 0.090853 0.893043 0.000721 0.001549 0.005912 0.001713 0.990826 0.004000 0.000857 0.989667 0.005475 0.016957 0.663726 0.148127 0.171190 0.299047 0.091156 0.448649 0.161148 0.354701 0.214677 0.236757 0.193865 0.399446 0.174508 0.200036 0.226009 0.303545 0.277435 0.200094 0.218926 0.380242 0.148876 0.163367 0.307514 Consensus sequence: VBHHVCAGGTGCDVDHD Reverse complement motif 0.307514 0.148876 0.163367 0.380242 0.218926 0.277435 0.200094 0.303545 0.226009 0.174508 0.200036 0.399446 0.193865 0.214677 0.236757 0.354701 0.299047 0.448649 0.091156 0.161148 0.016957 0.148127 0.663726 0.171190 0.004000 0.989667 0.000857 0.005475 0.990826 0.005912 0.001713 0.001549 0.015382 0.893043 0.090853 0.000721 0.000926 0.801648 0.191353 0.006073 0.001168 0.020182 0.002909 0.975741 0.014994 0.000714 0.980987 0.003304 0.026056 0.283517 0.251270 0.439156 0.283226 0.160795 0.329518 0.226461 0.213008 0.156385 0.429038 0.201569 0.440269 0.171480 0.222584 0.165668 0.216611 0.232705 0.244475 0.306209 Consensus sequence: DHDBHGCACCTGBDDVB Alignment: DHDBHGCACCTGBDDVB ----VGCACGTGGH--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00060 Max_secondary Original Motif Original Motif Backward 3 10 0.030891 Species: Mus musculus Original motif 0.127991 0.202889 0.399822 0.269298 0.156940 0.244015 0.182364 0.416681 0.046494 0.050598 0.744311 0.158596 0.196142 0.365183 0.183389 0.255286 0.019306 0.946805 0.015210 0.018680 0.924839 0.022113 0.027620 0.025428 0.007478 0.672138 0.027789 0.292595 0.046702 0.026044 0.906146 0.021107 0.117335 0.610863 0.025132 0.246670 0.044431 0.053581 0.722748 0.179240 0.543713 0.149809 0.190030 0.116447 0.241148 0.722386 0.022547 0.013919 0.265412 0.113032 0.270602 0.350954 0.226186 0.143504 0.332746 0.297564 Consensus sequence: BBGHCACGCGACDD Reverse complement motif 0.226186 0.332746 0.143504 0.297564 0.350954 0.113032 0.270602 0.265412 0.241148 0.022547 0.722386 0.013919 0.116447 0.149809 0.190030 0.543713 0.044431 0.722748 0.053581 0.179240 0.117335 0.025132 0.610863 0.246670 0.046702 0.906146 0.026044 0.021107 0.007478 0.027789 0.672138 0.292595 0.025428 0.022113 0.027620 0.924839 0.019306 0.015210 0.946805 0.018680 0.196142 0.183389 0.365183 0.255286 0.046494 0.744311 0.050598 0.158596 0.416681 0.244015 0.182364 0.156940 0.127991 0.399822 0.202889 0.269298 Consensus sequence: HDGTCGCGTGDCVB Alignment: BBGHCACGCGACDD --VGCACGTGGH-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00165 Titf1 Reverse Complement Original Motif Backward 4 10 0.031172 Species: Mus musculus Original motif 0.142834 0.324493 0.147276 0.385397 0.404842 0.233186 0.227659 0.134313 0.677580 0.044952 0.178774 0.098695 0.137761 0.202622 0.469728 0.189889 0.069301 0.825888 0.093549 0.011262 0.003882 0.876858 0.000966 0.118295 0.904355 0.015154 0.001043 0.079449 0.018912 0.977464 0.001207 0.002417 0.003517 0.004393 0.002428 0.989662 0.007151 0.162279 0.000584 0.829986 0.192074 0.120883 0.670840 0.016203 0.881358 0.002039 0.013253 0.103349 0.450016 0.333144 0.184121 0.032719 0.342018 0.321148 0.066945 0.269889 0.209486 0.122118 0.046367 0.622029 0.174564 0.145894 0.048004 0.631539 Consensus sequence: BVABCCACTTGAMHTT Reverse complement motif 0.631539 0.145894 0.048004 0.174564 0.622029 0.122118 0.046367 0.209486 0.269889 0.321148 0.066945 0.342018 0.032719 0.333144 0.184121 0.450016 0.103349 0.002039 0.013253 0.881358 0.192074 0.670840 0.120883 0.016203 0.829986 0.162279 0.000584 0.007151 0.989662 0.004393 0.002428 0.003517 0.018912 0.001207 0.977464 0.002417 0.079449 0.015154 0.001043 0.904355 0.003882 0.000966 0.876858 0.118295 0.069301 0.093549 0.825888 0.011262 0.137761 0.469728 0.202622 0.189889 0.098695 0.044952 0.178774 0.677580 0.134313 0.233186 0.227659 0.404842 0.385397 0.324493 0.147276 0.142834 Consensus sequence: AAHYTCAAGTGGBTBV Alignment: BVABCCACTTGAMHTT ---DCCACGTGCV--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00249 Nkx2-5 Reverse Complement Original Motif Backward 4 10 0.031308 Species: Mus musculus Original motif 0.284346 0.280937 0.138180 0.296538 0.399663 0.110464 0.327481 0.162392 0.637560 0.029806 0.218321 0.114314 0.184898 0.144379 0.370828 0.299895 0.017459 0.862111 0.118223 0.002207 0.001004 0.958164 0.000888 0.039945 0.947796 0.011499 0.000413 0.040291 0.024268 0.973476 0.000709 0.001546 0.002616 0.001901 0.003337 0.992147 0.006742 0.071290 0.000276 0.921691 0.393078 0.093424 0.490620 0.022879 0.870162 0.007294 0.051952 0.070591 0.632449 0.156278 0.172644 0.038628 0.362798 0.126579 0.085796 0.424828 0.132810 0.206405 0.025084 0.635702 0.094708 0.272324 0.087702 0.545267 Consensus sequence: HDADCCACTTRAAWTT Reverse complement motif 0.545267 0.272324 0.087702 0.094708 0.635702 0.206405 0.025084 0.132810 0.424828 0.126579 0.085796 0.362798 0.038628 0.156278 0.172644 0.632449 0.070591 0.007294 0.051952 0.870162 0.393078 0.490620 0.093424 0.022879 0.921691 0.071290 0.000276 0.006742 0.992147 0.001901 0.003337 0.002616 0.024268 0.000709 0.973476 0.001546 0.040291 0.011499 0.000413 0.947796 0.001004 0.000888 0.958164 0.039945 0.017459 0.118223 0.862111 0.002207 0.184898 0.370828 0.144379 0.299895 0.114314 0.029806 0.218321 0.637560 0.162392 0.110464 0.327481 0.399663 0.296538 0.280937 0.138180 0.284346 Consensus sequence: AAWTTMAAGTGGHTDH Alignment: HDADCCACTTRAAWTT ---DCCACGTGCV--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00231 Nkx2-2 Reverse Complement Original Motif Forward 4 10 0.033485 Species: Mus musculus Original motif 0.299323 0.258429 0.141957 0.300291 0.267631 0.143882 0.146933 0.441554 0.482614 0.212022 0.233631 0.071733 0.430836 0.073912 0.334439 0.160813 0.124944 0.704331 0.166815 0.003910 0.001941 0.876479 0.000828 0.120752 0.920202 0.005985 0.000456 0.073357 0.023544 0.974093 0.000859 0.001505 0.005010 0.003098 0.001328 0.990564 0.003250 0.198149 0.000490 0.798110 0.134659 0.104976 0.753464 0.006901 0.932490 0.000724 0.006140 0.060646 0.504530 0.106203 0.360995 0.028271 0.673257 0.074893 0.106536 0.145314 0.356324 0.097610 0.230142 0.315924 0.129483 0.188353 0.203623 0.478542 0.289071 0.157675 0.231909 0.321345 Consensus sequence: HDVRCCACTTGARADBD Reverse complement motif 0.321345 0.157675 0.231909 0.289071 0.478542 0.188353 0.203623 0.129483 0.315924 0.097610 0.230142 0.356324 0.145314 0.074893 0.106536 0.673257 0.028271 0.106203 0.360995 0.504530 0.060646 0.000724 0.006140 0.932490 0.134659 0.753464 0.104976 0.006901 0.798110 0.198149 0.000490 0.003250 0.990564 0.003098 0.001328 0.005010 0.023544 0.000859 0.974093 0.001505 0.073357 0.005985 0.000456 0.920202 0.001941 0.000828 0.876479 0.120752 0.124944 0.166815 0.704331 0.003910 0.160813 0.073912 0.334439 0.430836 0.071733 0.212022 0.233631 0.482614 0.441554 0.143882 0.146933 0.267631 0.300291 0.258429 0.141957 0.299323 Consensus sequence: DVDTKTCAAGTGGKBDH Alignment: HDVRCCACTTGARADBD ---DCCACGTGCV---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00147 Nkx2-6 Reverse Complement Original Motif Backward 4 10 0.034555 Species: Mus musculus Original motif 0.217416 0.196318 0.223786 0.362479 0.398508 0.155537 0.270546 0.175410 0.791392 0.022106 0.126944 0.059558 0.211671 0.145452 0.349401 0.293476 0.023830 0.847357 0.127125 0.001688 0.001426 0.942475 0.000495 0.055604 0.969354 0.001012 0.000987 0.028646 0.017358 0.980969 0.000778 0.000894 0.001816 0.004181 0.001573 0.992430 0.000925 0.059099 0.000431 0.939544 0.670672 0.011130 0.312570 0.005628 0.757147 0.010903 0.032137 0.199813 0.335600 0.359053 0.277277 0.028070 0.440449 0.199116 0.111993 0.248442 0.126577 0.210049 0.039661 0.623714 0.088481 0.233166 0.032706 0.645647 Consensus sequence: DDADCCACTTAAVHTT Reverse complement motif 0.645647 0.233166 0.032706 0.088481 0.623714 0.210049 0.039661 0.126577 0.248442 0.199116 0.111993 0.440449 0.335600 0.277277 0.359053 0.028070 0.199813 0.010903 0.032137 0.757147 0.005628 0.011130 0.312570 0.670672 0.939544 0.059099 0.000431 0.000925 0.992430 0.004181 0.001573 0.001816 0.017358 0.000778 0.980969 0.000894 0.028646 0.001012 0.000987 0.969354 0.001426 0.000495 0.942475 0.055604 0.023830 0.127125 0.847357 0.001688 0.211671 0.349401 0.145452 0.293476 0.059558 0.022106 0.126944 0.791392 0.175410 0.155537 0.270546 0.398508 0.362479 0.196318 0.223786 0.217416 Consensus sequence: AAHVTTAAGTGGHTDD Alignment: DDADCCACTTAAVHTT ---DCCACGTGCV--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00527 Foxn4_secondary Original Motif Original Motif Forward 6 10 0.036382 Species: Mus musculus Original motif 0.298336 0.418632 0.208054 0.074978 0.289907 0.015608 0.457100 0.237385 0.273583 0.077889 0.107860 0.540668 0.184954 0.161611 0.384390 0.269045 0.521826 0.156340 0.089019 0.232815 0.356716 0.131104 0.394857 0.117323 0.266669 0.108765 0.505273 0.119293 0.020778 0.047199 0.919524 0.012500 0.948536 0.018775 0.008113 0.024576 0.010822 0.964042 0.014701 0.010434 0.007428 0.019505 0.966351 0.006717 0.010025 0.975678 0.008648 0.005649 0.043796 0.120935 0.742979 0.092289 0.008252 0.250704 0.541132 0.199913 0.474428 0.044681 0.134430 0.346461 0.146597 0.421317 0.143166 0.288920 0.020540 0.181479 0.553811 0.244170 0.129612 0.173360 0.535219 0.161808 0.506084 0.158156 0.130983 0.204776 0.054872 0.103043 0.545792 0.296293 0.389882 0.171037 0.164162 0.274918 0.225861 0.314031 0.288872 0.171237 Consensus sequence: VDWDARRGACGCGGWHGGAKHV Reverse complement motif 0.225861 0.288872 0.314031 0.171237 0.274918 0.171037 0.164162 0.389882 0.054872 0.545792 0.103043 0.296293 0.204776 0.158156 0.130983 0.506084 0.129612 0.535219 0.173360 0.161808 0.020540 0.553811 0.181479 0.244170 0.146597 0.143166 0.421317 0.288920 0.346461 0.044681 0.134430 0.474428 0.008252 0.541132 0.250704 0.199913 0.043796 0.742979 0.120935 0.092289 0.010025 0.008648 0.975678 0.005649 0.007428 0.966351 0.019505 0.006717 0.010822 0.014701 0.964042 0.010434 0.024576 0.018775 0.008113 0.948536 0.020778 0.919524 0.047199 0.012500 0.266669 0.505273 0.108765 0.119293 0.356716 0.394857 0.131104 0.117323 0.232815 0.156340 0.089019 0.521826 0.184954 0.384390 0.161611 0.269045 0.540668 0.077889 0.107860 0.273583 0.289907 0.457100 0.015608 0.237385 0.298336 0.208054 0.418632 0.074978 Consensus sequence: VHYTCCDWCCGCGTCMMTHWHV Alignment: VDWDARRGACGCGGWHGGAKHV -----VGCACGTGGH------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 3 Motif ID: 59 Motif name: ESR2 Original motif 0.218487 0.450980 0.176471 0.154062 0.442577 0.142857 0.114846 0.299720 0.521008 0.042017 0.431373 0.005602 0.075630 0.000000 0.770308 0.154062 0.050420 0.056022 0.893557 0.000000 0.036415 0.053221 0.092437 0.817927 0.000000 1.000000 0.000000 0.000000 0.943978 0.002801 0.000000 0.053221 0.137255 0.344538 0.316527 0.201681 0.179272 0.176471 0.417367 0.226891 0.145658 0.170868 0.411765 0.271709 0.058824 0.092437 0.067227 0.781513 0.176471 0.070028 0.742297 0.011204 0.498599 0.277311 0.053221 0.170868 0.095238 0.750700 0.005602 0.148459 0.128852 0.809524 0.000000 0.061625 0.075630 0.252101 0.000000 0.672269 0.168067 0.263305 0.380952 0.187675 Consensus sequence: VHRGGTCABDBTGMCCTB Reserve complement motif 0.168067 0.380952 0.263305 0.187675 0.672269 0.252101 0.000000 0.075630 0.128852 0.000000 0.809524 0.061625 0.095238 0.005602 0.750700 0.148459 0.170868 0.277311 0.053221 0.498599 0.176471 0.742297 0.070028 0.011204 0.781513 0.092437 0.067227 0.058824 0.145658 0.411765 0.170868 0.271709 0.179272 0.417367 0.176471 0.226891 0.137255 0.316527 0.344538 0.201681 0.053221 0.002801 0.000000 0.943978 0.000000 0.000000 1.000000 0.000000 0.817927 0.053221 0.092437 0.036415 0.050420 0.893557 0.056022 0.000000 0.075630 0.770308 0.000000 0.154062 0.005602 0.042017 0.431373 0.521008 0.299720 0.142857 0.114846 0.442577 0.218487 0.176471 0.450980 0.154062 Consensus sequence: BAGGYCABHBTGACCKHV ************************************************************************ Best Matches for Motif ID 59 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00034 Sox7_secondary Original Motif Original Motif Backward 2 18 0.044389 Species: Mus musculus Original motif 0.067627 0.131333 0.654425 0.146615 0.156488 0.114442 0.145630 0.583441 0.206450 0.265630 0.358017 0.169903 0.090729 0.460713 0.274712 0.173847 0.285994 0.099998 0.154485 0.459523 0.635908 0.184787 0.072982 0.106323 0.748421 0.039204 0.092605 0.119769 0.081342 0.061327 0.044532 0.812799 0.143120 0.043879 0.024216 0.788785 0.247544 0.092102 0.621453 0.038901 0.295531 0.036295 0.027594 0.640580 0.194561 0.305468 0.339916 0.160055 0.175038 0.193568 0.101212 0.530182 0.145226 0.167488 0.559871 0.127415 0.271501 0.237429 0.206701 0.284369 0.216834 0.109191 0.569605 0.104370 0.182624 0.177160 0.300475 0.339742 0.331737 0.198645 0.265137 0.204482 0.230155 0.359365 0.183450 0.227029 0.056581 0.067297 0.463052 0.413070 0.198891 0.324626 0.304424 0.172059 0.181968 0.287547 0.202419 0.328066 Consensus sequence: GTVBDAATTGTVTGHGDDHKVB Reverse complement motif 0.328066 0.287547 0.202419 0.181968 0.198891 0.304424 0.324626 0.172059 0.056581 0.463052 0.067297 0.413070 0.230155 0.183450 0.359365 0.227029 0.204482 0.198645 0.265137 0.331737 0.339742 0.177160 0.300475 0.182624 0.216834 0.569605 0.109191 0.104370 0.284369 0.237429 0.206701 0.271501 0.145226 0.559871 0.167488 0.127415 0.530182 0.193568 0.101212 0.175038 0.194561 0.339916 0.305468 0.160055 0.640580 0.036295 0.027594 0.295531 0.247544 0.621453 0.092102 0.038901 0.788785 0.043879 0.024216 0.143120 0.812799 0.061327 0.044532 0.081342 0.119769 0.039204 0.092605 0.748421 0.106323 0.184787 0.072982 0.635908 0.459523 0.099998 0.154485 0.285994 0.090729 0.274712 0.460713 0.173847 0.206450 0.358017 0.265630 0.169903 0.583441 0.114442 0.145630 0.156488 0.067627 0.654425 0.131333 0.146615 Consensus sequence: VVYDDDCHCAVACAATTDBVAC Alignment: GTVBDAATTGTVTGHGDDHKVB ---VHRGGTCABDBTGMCCTB- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v016060_secondary Original Motif Reverse Complement Forward 4 18 0.049219 Species: Mus musculus Original motif 0.319838 0.171199 0.138099 0.370865 0.269358 0.196600 0.346909 0.187133 0.176807 0.338888 0.193903 0.290402 0.230268 0.119645 0.310500 0.339587 0.517372 0.257658 0.111673 0.113296 0.159477 0.126524 0.561119 0.152879 0.117072 0.553013 0.130919 0.198996 0.073372 0.163548 0.525014 0.238066 0.143608 0.186896 0.170528 0.498967 0.054943 0.079034 0.722992 0.143031 0.048852 0.015134 0.852458 0.083556 0.029001 0.023938 0.918900 0.028160 0.036727 0.092645 0.090591 0.780037 0.017757 0.057598 0.895222 0.029423 0.026113 0.048113 0.879744 0.046030 0.023041 0.787043 0.123490 0.066426 0.579766 0.004868 0.296873 0.118493 0.303862 0.042931 0.290151 0.363055 0.099672 0.237431 0.262301 0.400597 0.217788 0.163908 0.367628 0.250676 0.450783 0.141108 0.226137 0.181972 0.485086 0.102553 0.242662 0.169700 0.109057 0.454222 0.145665 0.291056 Consensus sequence: HVBDAGCGBGGGTGGCRDBDDDB Reverse complement motif 0.109057 0.145665 0.454222 0.291056 0.169700 0.102553 0.242662 0.485086 0.181972 0.141108 0.226137 0.450783 0.217788 0.367628 0.163908 0.250676 0.400597 0.237431 0.262301 0.099672 0.363055 0.042931 0.290151 0.303862 0.118493 0.004868 0.296873 0.579766 0.023041 0.123490 0.787043 0.066426 0.026113 0.879744 0.048113 0.046030 0.017757 0.895222 0.057598 0.029423 0.780037 0.092645 0.090591 0.036727 0.029001 0.918900 0.023938 0.028160 0.048852 0.852458 0.015134 0.083556 0.054943 0.722992 0.079034 0.143031 0.498967 0.186896 0.170528 0.143608 0.073372 0.525014 0.163548 0.238066 0.117072 0.130919 0.553013 0.198996 0.159477 0.561119 0.126524 0.152879 0.113296 0.257658 0.111673 0.517372 0.339587 0.119645 0.310500 0.230268 0.176807 0.193903 0.338888 0.290402 0.269358 0.346909 0.196600 0.187133 0.370865 0.171199 0.138099 0.319838 Consensus sequence: BDDHVDKGCCACCCVCGCTDBVH Alignment: BDDHVDKGCCACCCVCGCTDBVH ---VHRGGTCABDBTGMCCTB-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00050 Bhlhb2_primary Original Motif Reverse Complement Backward 3 18 0.050918 Species: Mus musculus Original motif 0.347837 0.112349 0.403713 0.136102 0.298329 0.175329 0.324534 0.201809 0.421791 0.222553 0.113615 0.242041 0.387506 0.130670 0.161435 0.320389 0.197183 0.244864 0.304611 0.253342 0.345884 0.188786 0.278290 0.187041 0.228203 0.142148 0.408269 0.221381 0.037126 0.006772 0.231775 0.724328 0.055214 0.942800 0.001192 0.000794 0.974119 0.004466 0.015535 0.005880 0.000300 0.958145 0.007498 0.034056 0.034056 0.007498 0.958145 0.000300 0.005880 0.015535 0.004466 0.974119 0.000794 0.001192 0.942800 0.055214 0.724328 0.231775 0.006772 0.037126 0.015720 0.466476 0.315208 0.202596 0.173670 0.355170 0.210710 0.260449 0.407419 0.261539 0.134430 0.196612 0.351478 0.209698 0.262426 0.176399 0.207869 0.284582 0.198951 0.308598 0.434482 0.113724 0.184408 0.267386 0.211144 0.363745 0.173978 0.251133 Consensus sequence: RDHDBVDTCACGTGASBHVHDH Reverse complement motif 0.211144 0.173978 0.363745 0.251133 0.267386 0.113724 0.184408 0.434482 0.308598 0.284582 0.198951 0.207869 0.176399 0.209698 0.262426 0.351478 0.196612 0.261539 0.134430 0.407419 0.173670 0.210710 0.355170 0.260449 0.015720 0.315208 0.466476 0.202596 0.037126 0.231775 0.006772 0.724328 0.000794 0.942800 0.001192 0.055214 0.974119 0.015535 0.004466 0.005880 0.034056 0.958145 0.007498 0.000300 0.000300 0.007498 0.958145 0.034056 0.005880 0.004466 0.015535 0.974119 0.055214 0.001192 0.942800 0.000794 0.724328 0.006772 0.231775 0.037126 0.228203 0.408269 0.142148 0.221381 0.187041 0.188786 0.278290 0.345884 0.197183 0.304611 0.244864 0.253342 0.320389 0.130670 0.161435 0.387506 0.242041 0.222553 0.113615 0.421791 0.298329 0.324534 0.175329 0.201809 0.347837 0.403713 0.112349 0.136102 Consensus sequence: DDHBHBSTCACGTGAHBBDHHM Alignment: DDHBHBSTCACGTGAHBBDHHM --VHRGGTCABDBTGMCCTB-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v015681_secondary Reverse Complement Original Motif Forward 2 18 0.052708 Species: Mus musculus Original motif 0.214165 0.143436 0.372522 0.269876 0.314445 0.406003 0.160351 0.119201 0.137147 0.092924 0.042921 0.727007 0.044121 0.072843 0.051741 0.831295 0.261292 0.324124 0.298498 0.116086 0.258125 0.323243 0.263362 0.155271 0.204557 0.589399 0.107153 0.098891 0.371021 0.244027 0.291102 0.093849 0.096327 0.572718 0.011797 0.319159 0.027282 0.046183 0.844519 0.082016 0.018921 0.012887 0.915917 0.052275 0.364793 0.166722 0.084229 0.384256 0.028216 0.011233 0.951056 0.009495 0.054974 0.004738 0.890377 0.049911 0.006802 0.312915 0.134247 0.546036 0.241289 0.628210 0.104788 0.025713 0.237863 0.302807 0.213018 0.246311 0.349399 0.203220 0.086635 0.360746 0.386634 0.144693 0.246895 0.221779 0.425101 0.354676 0.093374 0.126849 0.060272 0.391320 0.104905 0.443503 0.162090 0.190233 0.227433 0.420244 Consensus sequence: DVTTVVCVYGGHGGYCHHDMYB Reverse complement motif 0.420244 0.190233 0.227433 0.162090 0.443503 0.391320 0.104905 0.060272 0.126849 0.354676 0.093374 0.425101 0.221779 0.144693 0.246895 0.386634 0.360746 0.203220 0.086635 0.349399 0.237863 0.213018 0.302807 0.246311 0.241289 0.104788 0.628210 0.025713 0.546036 0.312915 0.134247 0.006802 0.054974 0.890377 0.004738 0.049911 0.028216 0.951056 0.011233 0.009495 0.384256 0.166722 0.084229 0.364793 0.018921 0.915917 0.012887 0.052275 0.027282 0.844519 0.046183 0.082016 0.096327 0.011797 0.572718 0.319159 0.093849 0.244027 0.291102 0.371021 0.204557 0.107153 0.589399 0.098891 0.258125 0.263362 0.323243 0.155271 0.261292 0.298498 0.324124 0.116086 0.831295 0.072843 0.051741 0.044121 0.727007 0.092924 0.042921 0.137147 0.314445 0.160351 0.406003 0.119201 0.214165 0.372522 0.143436 0.269876 Consensus sequence: VMYDHDGMCCHCCKBGVVAAVH Alignment: DVTTVVCVYGGHGGYCHHDMYB -BAGGYCABHBTGACCKHV--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00034 Sox7_primary Reverse Complement Reverse Complement Forward 2 18 0.054104 Species: Mus musculus Original motif 0.360997 0.300272 0.115555 0.223177 0.309749 0.228429 0.166233 0.295589 0.149419 0.176868 0.240155 0.433558 0.379704 0.095791 0.276373 0.248133 0.394549 0.174184 0.130641 0.300626 0.443749 0.070776 0.211081 0.274393 0.364301 0.074356 0.370406 0.190936 0.791976 0.038475 0.093390 0.076159 0.963721 0.001826 0.002456 0.031997 0.004516 0.954596 0.008092 0.032796 0.981080 0.002062 0.002161 0.014697 0.986185 0.001846 0.006976 0.004992 0.059567 0.003649 0.002189 0.934595 0.495328 0.024257 0.240450 0.239965 0.305027 0.094878 0.526069 0.074025 0.418442 0.196237 0.158323 0.226998 0.336713 0.220452 0.191155 0.251680 0.192296 0.300342 0.169047 0.338315 0.240387 0.144634 0.128513 0.486465 0.290763 0.271259 0.116600 0.321377 0.224825 0.296233 0.229255 0.249687 0.493240 0.171285 0.075148 0.260326 Consensus sequence: HHBDHDDAACAATDRHHHHHBW Reverse complement motif 0.260326 0.171285 0.075148 0.493240 0.224825 0.229255 0.296233 0.249687 0.321377 0.271259 0.116600 0.290763 0.486465 0.144634 0.128513 0.240387 0.338315 0.300342 0.169047 0.192296 0.251680 0.220452 0.191155 0.336713 0.226998 0.196237 0.158323 0.418442 0.305027 0.526069 0.094878 0.074025 0.239965 0.024257 0.240450 0.495328 0.934595 0.003649 0.002189 0.059567 0.004992 0.001846 0.006976 0.986185 0.014697 0.002062 0.002161 0.981080 0.004516 0.008092 0.954596 0.032796 0.031997 0.001826 0.002456 0.963721 0.076159 0.038475 0.093390 0.791976 0.364301 0.370406 0.074356 0.190936 0.274393 0.070776 0.211081 0.443749 0.300626 0.174184 0.130641 0.394549 0.248133 0.095791 0.276373 0.379704 0.433558 0.176868 0.240155 0.149419 0.295589 0.228429 0.166233 0.309749 0.223177 0.300272 0.115555 0.360997 Consensus sequence: WBHHHHHMDATTGTTHDHDVHH Alignment: WBHHHHHMDATTGTTHDHDVHH -BAGGYCABHBTGACCKHV--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00098 Rfx3_secondary Reverse Complement Original Motif Forward 3 18 0.054111 Species: Mus musculus Original motif 0.314514 0.275352 0.257617 0.152518 0.126939 0.598294 0.130576 0.144192 0.102265 0.155334 0.177957 0.564445 0.129288 0.282678 0.326990 0.261044 0.318166 0.227823 0.175681 0.278330 0.109019 0.380838 0.278328 0.231815 0.226145 0.289206 0.291300 0.193348 0.035863 0.844339 0.072582 0.047216 0.223793 0.187244 0.088092 0.500871 0.039800 0.029681 0.026201 0.904317 0.298298 0.032147 0.654746 0.014809 0.014729 0.022023 0.944826 0.018422 0.485114 0.004925 0.013785 0.496176 0.035708 0.020381 0.240804 0.703108 0.951152 0.012738 0.017886 0.018224 0.023713 0.944394 0.009538 0.022355 0.291067 0.385205 0.232388 0.091339 0.340334 0.199588 0.311526 0.148552 0.198713 0.472138 0.178319 0.150830 0.321155 0.269932 0.311301 0.097612 0.412646 0.195252 0.231950 0.160152 0.297134 0.180928 0.250400 0.271538 0.151169 0.305386 0.358574 0.184871 Consensus sequence: VCTBHBVCTTGGWTACVVVVVDB Reverse complement motif 0.151169 0.358574 0.305386 0.184871 0.271538 0.180928 0.250400 0.297134 0.160152 0.195252 0.231950 0.412646 0.097612 0.269932 0.311301 0.321155 0.198713 0.178319 0.472138 0.150830 0.148552 0.199588 0.311526 0.340334 0.291067 0.232388 0.385205 0.091339 0.023713 0.009538 0.944394 0.022355 0.018224 0.012738 0.017886 0.951152 0.703108 0.020381 0.240804 0.035708 0.496176 0.004925 0.013785 0.485114 0.014729 0.944826 0.022023 0.018422 0.298298 0.654746 0.032147 0.014809 0.904317 0.029681 0.026201 0.039800 0.500871 0.187244 0.088092 0.223793 0.035863 0.072582 0.844339 0.047216 0.226145 0.291300 0.289206 0.193348 0.109019 0.278328 0.380838 0.231815 0.278330 0.227823 0.175681 0.318166 0.129288 0.326990 0.282678 0.261044 0.564445 0.155334 0.177957 0.102265 0.126939 0.130576 0.598294 0.144192 0.152518 0.275352 0.257617 0.314514 Consensus sequence: BDBBVBVGTAWCCAAGVBHBAGB Alignment: VCTBHBVCTTGGWTACVVVVVDB --BAGGYCABHBTGACCKHV--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00527 Foxn4_secondary Original Motif Original Motif Backward 2 18 0.054373 Species: Mus musculus Original motif 0.298336 0.418632 0.208054 0.074978 0.289907 0.015608 0.457100 0.237385 0.273583 0.077889 0.107860 0.540668 0.184954 0.161611 0.384390 0.269045 0.521826 0.156340 0.089019 0.232815 0.356716 0.131104 0.394857 0.117323 0.266669 0.108765 0.505273 0.119293 0.020778 0.047199 0.919524 0.012500 0.948536 0.018775 0.008113 0.024576 0.010822 0.964042 0.014701 0.010434 0.007428 0.019505 0.966351 0.006717 0.010025 0.975678 0.008648 0.005649 0.043796 0.120935 0.742979 0.092289 0.008252 0.250704 0.541132 0.199913 0.474428 0.044681 0.134430 0.346461 0.146597 0.421317 0.143166 0.288920 0.020540 0.181479 0.553811 0.244170 0.129612 0.173360 0.535219 0.161808 0.506084 0.158156 0.130983 0.204776 0.054872 0.103043 0.545792 0.296293 0.389882 0.171037 0.164162 0.274918 0.225861 0.314031 0.288872 0.171237 Consensus sequence: VDWDARRGACGCGGWHGGAKHV Reverse complement motif 0.225861 0.288872 0.314031 0.171237 0.274918 0.171037 0.164162 0.389882 0.054872 0.545792 0.103043 0.296293 0.204776 0.158156 0.130983 0.506084 0.129612 0.535219 0.173360 0.161808 0.020540 0.553811 0.181479 0.244170 0.146597 0.143166 0.421317 0.288920 0.346461 0.044681 0.134430 0.474428 0.008252 0.541132 0.250704 0.199913 0.043796 0.742979 0.120935 0.092289 0.010025 0.008648 0.975678 0.005649 0.007428 0.966351 0.019505 0.006717 0.010822 0.014701 0.964042 0.010434 0.024576 0.018775 0.008113 0.948536 0.020778 0.919524 0.047199 0.012500 0.266669 0.505273 0.108765 0.119293 0.356716 0.394857 0.131104 0.117323 0.232815 0.156340 0.089019 0.521826 0.184954 0.384390 0.161611 0.269045 0.540668 0.077889 0.107860 0.273583 0.289907 0.457100 0.015608 0.237385 0.298336 0.208054 0.418632 0.074978 Consensus sequence: VHYTCCDWCCGCGTCMMTHWHV Alignment: VDWDARRGACGCGGWHGGAKHV ---VHRGGTCABDBTGMCCTB- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v016060_primary Reverse Complement Original Motif Backward 5 18 0.054809 Species: Mus musculus Original motif 0.204923 0.208846 0.365383 0.220848 0.294304 0.300143 0.167287 0.238266 0.109711 0.619514 0.117379 0.153396 0.178979 0.378580 0.230177 0.212264 0.159594 0.542602 0.118178 0.179627 0.125206 0.430074 0.151826 0.292894 0.097692 0.709845 0.116956 0.075506 0.148292 0.565912 0.037632 0.248164 0.077951 0.034190 0.855503 0.032356 0.001657 0.001061 0.971877 0.025405 0.001926 0.001084 0.991712 0.005278 0.033031 0.012001 0.057796 0.897171 0.002723 0.002647 0.993348 0.001281 0.003261 0.000963 0.987199 0.008577 0.000611 0.090925 0.074857 0.833608 0.015299 0.978878 0.004949 0.000874 0.013368 0.600902 0.033485 0.352245 0.231949 0.149575 0.118804 0.499672 0.267580 0.186002 0.371242 0.175176 0.264884 0.223483 0.110082 0.401551 0.221365 0.170121 0.179559 0.428955 0.112997 0.692930 0.139981 0.054092 0.460305 0.207883 0.155111 0.176702 Consensus sequence: BHCBCBCCGGGTGGTCYHVHDCH Reverse complement motif 0.176702 0.207883 0.155111 0.460305 0.112997 0.139981 0.692930 0.054092 0.428955 0.170121 0.179559 0.221365 0.401551 0.223483 0.110082 0.264884 0.267580 0.371242 0.186002 0.175176 0.499672 0.149575 0.118804 0.231949 0.013368 0.033485 0.600902 0.352245 0.015299 0.004949 0.978878 0.000874 0.833608 0.090925 0.074857 0.000611 0.003261 0.987199 0.000963 0.008577 0.002723 0.993348 0.002647 0.001281 0.897171 0.012001 0.057796 0.033031 0.001926 0.991712 0.001084 0.005278 0.001657 0.971877 0.001061 0.025405 0.077951 0.855503 0.034190 0.032356 0.148292 0.037632 0.565912 0.248164 0.097692 0.116956 0.709845 0.075506 0.125206 0.151826 0.430074 0.292894 0.159594 0.118178 0.542602 0.179627 0.178979 0.230177 0.378580 0.212264 0.109711 0.117379 0.619514 0.153396 0.294304 0.167287 0.300143 0.238266 0.204923 0.365383 0.208846 0.220848 Consensus sequence: HGDHVHKGACCACCCGGBGBGDB Alignment: BHCBCBCCGGGTGGTCYHVHDCH -BAGGYCABHBTGACCKHV---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00528 Foxm1_secondary Original Motif Reverse Complement Forward 5 18 0.055453 Species: Mus musculus Original motif 0.399785 0.446658 0.111435 0.042122 0.535175 0.103991 0.089706 0.271128 0.078171 0.387987 0.375083 0.158759 0.309001 0.519142 0.070618 0.101239 0.201844 0.255818 0.323149 0.219190 0.534101 0.109845 0.235026 0.121028 0.656038 0.037473 0.261484 0.045006 0.315713 0.164290 0.471815 0.048182 0.651960 0.009412 0.328237 0.010391 0.937365 0.017313 0.007516 0.037807 0.019983 0.044238 0.012387 0.923392 0.061195 0.021485 0.881645 0.035675 0.017521 0.952998 0.013139 0.016342 0.254160 0.029735 0.493023 0.223082 0.239200 0.593324 0.114503 0.052973 0.610822 0.071539 0.099169 0.218470 0.166610 0.389712 0.204400 0.239278 0.227752 0.361626 0.178497 0.232125 0.537030 0.182466 0.026035 0.254470 0.235902 0.151006 0.043788 0.569304 0.081851 0.250397 0.590059 0.077693 0.340417 0.189613 0.272075 0.197895 Consensus sequence: MWSMBAARRATGCDCABHATGD Reverse complement motif 0.197895 0.189613 0.272075 0.340417 0.081851 0.590059 0.250397 0.077693 0.569304 0.151006 0.043788 0.235902 0.254470 0.182466 0.026035 0.537030 0.227752 0.178497 0.361626 0.232125 0.166610 0.204400 0.389712 0.239278 0.218470 0.071539 0.099169 0.610822 0.239200 0.114503 0.593324 0.052973 0.254160 0.493023 0.029735 0.223082 0.017521 0.013139 0.952998 0.016342 0.061195 0.881645 0.021485 0.035675 0.923392 0.044238 0.012387 0.019983 0.037807 0.017313 0.007516 0.937365 0.010391 0.009412 0.328237 0.651960 0.315713 0.471815 0.164290 0.048182 0.045006 0.037473 0.261484 0.656038 0.121028 0.109845 0.235026 0.534101 0.201844 0.323149 0.255818 0.219190 0.309001 0.070618 0.519142 0.101239 0.078171 0.375083 0.387987 0.158759 0.271128 0.103991 0.089706 0.535175 0.399785 0.111435 0.446658 0.042122 Consensus sequence: DCATDBTGHGCATKMTTBRSWR Alignment: DCATDBTGHGCATKMTTBRSWR ----VHRGGTCABDBTGMCCTB ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00032 Gata3_secondary Original Motif Original Motif Backward 4 18 0.056643 Species: Mus musculus Original motif 0.177641 0.319872 0.115137 0.387350 0.136644 0.182137 0.205873 0.475347 0.254263 0.244280 0.165207 0.336250 0.240415 0.207557 0.237497 0.314530 0.271041 0.214702 0.364395 0.149863 0.095475 0.320104 0.191738 0.392682 0.500902 0.142722 0.026556 0.329820 0.051221 0.023698 0.897245 0.027836 0.922410 0.027509 0.024058 0.026023 0.030735 0.070903 0.024248 0.874114 0.242120 0.231992 0.225143 0.300745 0.106956 0.220471 0.283490 0.389083 0.152079 0.165830 0.135066 0.547025 0.839205 0.051581 0.060119 0.049095 0.041204 0.069147 0.070830 0.818819 0.051861 0.848177 0.027599 0.072363 0.383793 0.016807 0.397470 0.201931 0.381899 0.215846 0.255908 0.146347 0.094792 0.358651 0.280905 0.265652 0.296132 0.181545 0.178433 0.343890 0.301997 0.254722 0.108566 0.334714 0.349481 0.270693 0.137507 0.242319 Consensus sequence: HBHDVBWGATHBTATCRVBHHH Reverse complement motif 0.242319 0.270693 0.137507 0.349481 0.334714 0.254722 0.108566 0.301997 0.343890 0.181545 0.178433 0.296132 0.094792 0.280905 0.358651 0.265652 0.146347 0.215846 0.255908 0.381899 0.383793 0.397470 0.016807 0.201931 0.051861 0.027599 0.848177 0.072363 0.818819 0.069147 0.070830 0.041204 0.049095 0.051581 0.060119 0.839205 0.547025 0.165830 0.135066 0.152079 0.389083 0.220471 0.283490 0.106956 0.300745 0.231992 0.225143 0.242120 0.874114 0.070903 0.024248 0.030735 0.026023 0.027509 0.024058 0.922410 0.051221 0.897245 0.023698 0.027836 0.329820 0.142722 0.026556 0.500902 0.392682 0.320104 0.191738 0.095475 0.271041 0.364395 0.214702 0.149863 0.314530 0.207557 0.237497 0.240415 0.336250 0.244280 0.165207 0.254263 0.475347 0.182137 0.205873 0.136644 0.387350 0.319872 0.115137 0.177641 Consensus sequence: HHHBBMGATAVHATCWVVDHVH Alignment: HBHDVBWGATHBTATCRVBHHH -VHRGGTCABDBTGMCCTB--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 3 Motif ID: 60 Motif name: NR1H2RXRA Original motif 0.680000 0.200000 0.000000 0.120000 0.680000 0.040000 0.200000 0.080000 0.800000 0.000000 0.200000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.040000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.000000 0.040000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.800000 0.040000 0.080000 0.080000 0.000000 0.600000 0.240000 0.160000 Consensus sequence: AAAGGTCAAAGGTCAAC Reserve complement motif 0.000000 0.240000 0.600000 0.160000 0.080000 0.040000 0.080000 0.800000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.040000 0.000000 0.000000 0.960000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.040000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.200000 0.800000 0.080000 0.040000 0.200000 0.680000 0.120000 0.200000 0.000000 0.680000 Consensus sequence: GTTGACCTTTGACCTTT ************************************************************************ Best Matches for Motif ID 60 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v015681_secondary Reverse Complement Reverse Complement Backward 1 17 0.053845 Species: Mus musculus Original motif 0.331499 0.188505 0.182841 0.297156 0.328961 0.213025 0.273530 0.184484 0.197213 0.129292 0.524914 0.148581 0.274491 0.226406 0.312118 0.186986 0.103231 0.393726 0.364988 0.138055 0.552594 0.166422 0.186262 0.094722 0.157618 0.064773 0.616497 0.161112 0.139166 0.176098 0.621185 0.063551 0.748420 0.062398 0.012447 0.176735 0.116584 0.009438 0.860326 0.013653 0.005030 0.003646 0.974877 0.016447 0.055257 0.007181 0.921760 0.015802 0.032748 0.058249 0.052709 0.856293 0.105606 0.872231 0.014370 0.007793 0.019480 0.497379 0.125899 0.357242 0.478582 0.269713 0.061464 0.190242 0.253985 0.287006 0.201320 0.257689 0.319384 0.210231 0.175842 0.294543 0.222123 0.287802 0.201294 0.288782 0.139951 0.376041 0.081133 0.402875 0.213450 0.343835 0.383676 0.059039 0.322294 0.355918 0.148062 0.173725 Consensus sequence: HVGVSAGGAGGGTCYHHHHYVH Reverse complement motif 0.322294 0.148062 0.355918 0.173725 0.213450 0.383676 0.343835 0.059039 0.402875 0.376041 0.081133 0.139951 0.288782 0.287802 0.201294 0.222123 0.294543 0.210231 0.175842 0.319384 0.253985 0.201320 0.287006 0.257689 0.190242 0.269713 0.061464 0.478582 0.019480 0.125899 0.497379 0.357242 0.105606 0.014370 0.872231 0.007793 0.856293 0.058249 0.052709 0.032748 0.055257 0.921760 0.007181 0.015802 0.005030 0.974877 0.003646 0.016447 0.116584 0.860326 0.009438 0.013653 0.176735 0.062398 0.012447 0.748420 0.139166 0.621185 0.176098 0.063551 0.157618 0.616497 0.064773 0.161112 0.094722 0.166422 0.186262 0.552594 0.103231 0.364988 0.393726 0.138055 0.274491 0.312118 0.226406 0.186986 0.197213 0.524914 0.129292 0.148581 0.184484 0.213025 0.273530 0.328961 0.297156 0.188505 0.182841 0.331499 Consensus sequence: DVMHHDHKGACCCTCCTSVCBH Alignment: DVMHHDHKGACCCTCCTSVCBH -----GTTGACCTTTGACCTTT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00032 Gata3_primary Original Motif Original Motif Backward 1 17 0.054510 Species: Mus musculus Original motif 0.151572 0.262753 0.258275 0.327401 0.221834 0.113385 0.275380 0.389400 0.297769 0.136928 0.134678 0.430625 0.270099 0.110415 0.271106 0.348380 0.265471 0.090253 0.223340 0.420936 0.616582 0.090091 0.171960 0.121367 0.197318 0.107541 0.406904 0.288237 0.798258 0.046950 0.001406 0.153385 0.003195 0.002516 0.989707 0.004582 0.991503 0.002748 0.002617 0.003132 0.005015 0.002764 0.003026 0.989195 0.948394 0.008932 0.001344 0.041330 0.973109 0.004100 0.004081 0.018710 0.040365 0.113905 0.828185 0.017545 0.736608 0.130524 0.113464 0.019404 0.415921 0.106101 0.316613 0.161365 0.376582 0.170927 0.155572 0.296919 0.137731 0.197151 0.211055 0.454064 0.324853 0.122747 0.246107 0.306293 0.462490 0.207311 0.159392 0.170807 0.380420 0.188972 0.311990 0.118618 0.222178 0.157873 0.380486 0.239463 Consensus sequence: BDHDDADAGATAAGADHBDHVD Reverse complement motif 0.222178 0.380486 0.157873 0.239463 0.118618 0.188972 0.311990 0.380420 0.170807 0.207311 0.159392 0.462490 0.306293 0.122747 0.246107 0.324853 0.454064 0.197151 0.211055 0.137731 0.296919 0.170927 0.155572 0.376582 0.161365 0.106101 0.316613 0.415921 0.019404 0.130524 0.113464 0.736608 0.040365 0.828185 0.113905 0.017545 0.018710 0.004100 0.004081 0.973109 0.041330 0.008932 0.001344 0.948394 0.989195 0.002764 0.003026 0.005015 0.003132 0.002748 0.002617 0.991503 0.003195 0.989707 0.002516 0.004582 0.153385 0.046950 0.001406 0.798258 0.197318 0.406904 0.107541 0.288237 0.121367 0.090091 0.171960 0.616582 0.420936 0.090253 0.223340 0.265471 0.348380 0.110415 0.271106 0.270099 0.430625 0.136928 0.134678 0.297769 0.389400 0.113385 0.275380 0.221834 0.327401 0.262753 0.258275 0.151572 Consensus sequence: HBHDVHDTCTTATCTHTDDHDV Alignment: BDHDDADAGATAAGADHBDHVD -----AAAGGTCAAAGGTCAAC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00067 Lef1_primary Original Motif Reverse Complement Forward 2 16 0.521114 Species: Mus musculus Original motif 0.281920 0.214207 0.278077 0.225796 0.325566 0.151435 0.298797 0.224202 0.290253 0.145824 0.243443 0.320480 0.069286 0.404645 0.141614 0.384454 0.070044 0.621448 0.142647 0.165862 0.007295 0.907657 0.038110 0.046938 0.015587 0.018273 0.000658 0.965482 0.005527 0.005886 0.001905 0.986682 0.024512 0.001189 0.001344 0.972955 0.007384 0.025221 0.952270 0.015125 0.966438 0.000630 0.002693 0.030239 0.082252 0.001173 0.001495 0.915080 0.030255 0.677155 0.275323 0.017267 0.199467 0.118815 0.056814 0.624905 0.345445 0.169597 0.216831 0.268127 0.278106 0.150864 0.173693 0.397336 0.251834 0.339733 0.219703 0.188730 Consensus sequence: DDDYCCTTTGATCTDDV Reverse complement motif 0.251834 0.219703 0.339733 0.188730 0.397336 0.150864 0.173693 0.278106 0.268127 0.169597 0.216831 0.345445 0.624905 0.118815 0.056814 0.199467 0.030255 0.275323 0.677155 0.017267 0.915080 0.001173 0.001495 0.082252 0.030239 0.000630 0.002693 0.966438 0.007384 0.952270 0.025221 0.015125 0.972955 0.001189 0.001344 0.024512 0.986682 0.005886 0.001905 0.005527 0.965482 0.018273 0.000658 0.015587 0.007295 0.038110 0.907657 0.046938 0.070044 0.142647 0.621448 0.165862 0.069286 0.141614 0.404645 0.384454 0.320480 0.145824 0.243443 0.290253 0.224202 0.151435 0.298797 0.325566 0.225796 0.214207 0.278077 0.281920 Consensus sequence: VDDAGATCAAAGGKDDD Alignment: VDDAGATCAAAGGKDDD- -AAAGGTCAAAGGTCAAC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00083 Tcf7l2_primary Reverse Complement Original Motif Backward 2 16 0.527825 Species: Mus musculus Original motif 0.285725 0.187143 0.254855 0.272277 0.276264 0.157893 0.258178 0.307665 0.238788 0.161120 0.254018 0.346074 0.076041 0.333901 0.150903 0.439156 0.093376 0.526578 0.180529 0.199517 0.010827 0.880320 0.034150 0.074703 0.016546 0.023834 0.000940 0.958680 0.007166 0.008215 0.001941 0.982678 0.029634 0.001363 0.001379 0.967625 0.010872 0.031751 0.926186 0.031190 0.949407 0.000760 0.002581 0.047253 0.109203 0.001362 0.002094 0.887341 0.044198 0.567994 0.353059 0.034749 0.222623 0.142360 0.041281 0.593736 0.358872 0.167597 0.220534 0.252997 0.233072 0.141480 0.230985 0.394463 0.350703 0.243129 0.233961 0.172207 Consensus sequence: DDDYCCTTTGATSTDDV Reverse complement motif 0.172207 0.243129 0.233961 0.350703 0.394463 0.141480 0.230985 0.233072 0.252997 0.167597 0.220534 0.358872 0.593736 0.142360 0.041281 0.222623 0.044198 0.353059 0.567994 0.034749 0.887341 0.001362 0.002094 0.109203 0.047253 0.000760 0.002581 0.949407 0.010872 0.926186 0.031751 0.031190 0.967625 0.001363 0.001379 0.029634 0.982678 0.008215 0.001941 0.007166 0.958680 0.023834 0.000940 0.016546 0.010827 0.034150 0.880320 0.074703 0.093376 0.180529 0.526578 0.199517 0.439156 0.333901 0.150903 0.076041 0.346074 0.161120 0.254018 0.238788 0.307665 0.157893 0.258178 0.276264 0.272277 0.187143 0.254855 0.285725 Consensus sequence: BDDASATCAAAGGMDDD Alignment: -DDDYCCTTTGATSTDDV GTTGACCTTTGACCTTT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00054 Tcf7_primary Original Motif Original Motif Forward 2 16 0.531154 Species: Mus musculus Original motif 0.170811 0.196976 0.220503 0.411710 0.337231 0.228482 0.140137 0.294150 0.299312 0.173780 0.143426 0.383481 0.603957 0.053557 0.128214 0.214271 0.036338 0.377925 0.534647 0.051091 0.725865 0.010314 0.008501 0.255320 0.067855 0.007849 0.004559 0.919737 0.049387 0.815496 0.098330 0.036787 0.960514 0.005036 0.005137 0.029313 0.960631 0.004550 0.018815 0.016004 0.935245 0.005169 0.023866 0.035720 0.159760 0.060340 0.761341 0.018559 0.228534 0.153897 0.523052 0.094517 0.557984 0.123512 0.254154 0.064350 0.490252 0.211976 0.124557 0.173215 0.310463 0.250279 0.132612 0.306646 0.332720 0.248937 0.120633 0.297711 Consensus sequence: BHHASATCAAAGGAHHH Reverse complement motif 0.297711 0.248937 0.120633 0.332720 0.306646 0.250279 0.132612 0.310463 0.173215 0.211976 0.124557 0.490252 0.064350 0.123512 0.254154 0.557984 0.228534 0.523052 0.153897 0.094517 0.159760 0.761341 0.060340 0.018559 0.035720 0.005169 0.023866 0.935245 0.016004 0.004550 0.018815 0.960631 0.029313 0.005036 0.005137 0.960514 0.049387 0.098330 0.815496 0.036787 0.919737 0.007849 0.004559 0.067855 0.255320 0.010314 0.008501 0.725865 0.036338 0.534647 0.377925 0.051091 0.214271 0.053557 0.128214 0.603957 0.383481 0.173780 0.143426 0.299312 0.294150 0.228482 0.140137 0.337231 0.411710 0.196976 0.220503 0.170811 Consensus sequence: HHHTCCTTTGATSTHHV Alignment: BHHASATCAAAGGAHHH- -AAAGGTCAAAGGTCAAC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00058 Tcf3_primary Original Motif Original Motif Backward 2 16 0.531876 Species: Mus musculus Original motif 0.185864 0.201179 0.183663 0.429294 0.371100 0.233868 0.122934 0.272098 0.249563 0.171285 0.128851 0.450301 0.582940 0.043382 0.129099 0.244578 0.041400 0.395349 0.497087 0.066163 0.759123 0.009670 0.005936 0.225270 0.056579 0.008662 0.003986 0.930772 0.043968 0.865783 0.056001 0.034249 0.962748 0.003731 0.003265 0.030256 0.971318 0.003542 0.012299 0.012841 0.937558 0.003991 0.020195 0.038256 0.125931 0.057976 0.798081 0.018012 0.209401 0.172342 0.483980 0.134277 0.485703 0.129227 0.309936 0.075134 0.397027 0.195902 0.152395 0.254676 0.311636 0.231510 0.157732 0.299122 0.320965 0.206031 0.164299 0.308705 Consensus sequence: HHHASATCAAAGVRHHH Reverse complement motif 0.308705 0.206031 0.164299 0.320965 0.299122 0.231510 0.157732 0.311636 0.254676 0.195902 0.152395 0.397027 0.075134 0.129227 0.309936 0.485703 0.209401 0.483980 0.172342 0.134277 0.125931 0.798081 0.057976 0.018012 0.038256 0.003991 0.020195 0.937558 0.012841 0.003542 0.012299 0.971318 0.030256 0.003731 0.003265 0.962748 0.043968 0.056001 0.865783 0.034249 0.930772 0.008662 0.003986 0.056579 0.225270 0.009670 0.005936 0.759123 0.041400 0.497087 0.395349 0.066163 0.244578 0.043382 0.129099 0.582940 0.450301 0.171285 0.128851 0.249563 0.272098 0.233868 0.122934 0.371100 0.429294 0.201179 0.183663 0.185864 Consensus sequence: HHHKVCTTTGATSTHHH Alignment: -HHHASATCAAAGVRHHH AAAGGTCAAAGGTCAAC- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00030 Sox11_primary Original Motif Original Motif Forward 2 16 0.544403 Species: Mus musculus Original motif 0.351812 0.238467 0.143954 0.265768 0.195246 0.235838 0.281473 0.287443 0.349478 0.172616 0.210739 0.267167 0.484061 0.110438 0.173131 0.232370 0.276692 0.070713 0.479604 0.172991 0.859124 0.044167 0.083951 0.012758 0.975608 0.002029 0.002285 0.020079 0.006422 0.978485 0.007124 0.007969 0.987489 0.003025 0.002868 0.006617 0.987739 0.005463 0.002730 0.004067 0.693013 0.004067 0.002445 0.300475 0.189100 0.003677 0.801408 0.005814 0.352090 0.072517 0.567737 0.007656 0.542316 0.176545 0.192768 0.088371 0.196382 0.304176 0.205985 0.293457 0.289415 0.201358 0.182937 0.326290 0.385801 0.216362 0.152363 0.245475 Consensus sequence: HBDDRAACAAAGRABHH Reverse complement motif 0.245475 0.216362 0.152363 0.385801 0.326290 0.201358 0.182937 0.289415 0.196382 0.205985 0.304176 0.293457 0.088371 0.176545 0.192768 0.542316 0.352090 0.567737 0.072517 0.007656 0.189100 0.801408 0.003677 0.005814 0.300475 0.004067 0.002445 0.693013 0.004067 0.005463 0.002730 0.987739 0.006617 0.003025 0.002868 0.987489 0.006422 0.007124 0.978485 0.007969 0.020079 0.002029 0.002285 0.975608 0.012758 0.044167 0.083951 0.859124 0.276692 0.479604 0.070713 0.172991 0.232370 0.110438 0.173131 0.484061 0.267167 0.172616 0.210739 0.349478 0.287443 0.235838 0.281473 0.195246 0.265768 0.238467 0.143954 0.351812 Consensus sequence: HHBTMCTTTGTTMDDVH Alignment: HBDDRAACAAAGRABHH- -AAAGGTCAAAGGTCAAC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00062 Sox4_primary Reverse Complement Reverse Complement Backward 2 16 0.544565 Species: Mus musculus Original motif 0.427843 0.231210 0.119424 0.221523 0.196506 0.239531 0.304906 0.259057 0.302488 0.156922 0.290190 0.250401 0.433872 0.149126 0.196496 0.220506 0.258426 0.076511 0.475100 0.189963 0.841714 0.046453 0.099915 0.011918 0.983853 0.001612 0.001362 0.013174 0.003460 0.982032 0.005728 0.008780 0.989743 0.002253 0.002020 0.005984 0.990761 0.003397 0.002843 0.003000 0.770864 0.003540 0.001549 0.224048 0.235342 0.002598 0.757383 0.004677 0.371426 0.089574 0.529959 0.009040 0.480804 0.196949 0.240413 0.081833 0.187158 0.355102 0.216599 0.241142 0.248006 0.232182 0.157452 0.362360 0.403367 0.177684 0.164649 0.254300 Consensus sequence: HBDDDAACAAAGRVBHH Reverse complement motif 0.254300 0.177684 0.164649 0.403367 0.362360 0.232182 0.157452 0.248006 0.187158 0.216599 0.355102 0.241142 0.081833 0.196949 0.240413 0.480804 0.371426 0.529959 0.089574 0.009040 0.235342 0.757383 0.002598 0.004677 0.224048 0.003540 0.001549 0.770864 0.003000 0.003397 0.002843 0.990761 0.005984 0.002253 0.002020 0.989743 0.003460 0.005728 0.982032 0.008780 0.013174 0.001612 0.001362 0.983853 0.011918 0.046453 0.099915 0.841714 0.258426 0.475100 0.076511 0.189963 0.220506 0.149126 0.196496 0.433872 0.250401 0.156922 0.290190 0.302488 0.196506 0.304906 0.239531 0.259057 0.221523 0.231210 0.119424 0.427843 Consensus sequence: HHBBMCTTTGTTHDDBH Alignment: -HHBBMCTTTGTTHDDBH GTTGACCTTTGACCTTT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00019 Zbtb12_primary Reverse Complement Reverse Complement Backward 2 16 0.550511 Species: Mus musculus Original motif 0.163348 0.349811 0.273573 0.213268 0.212612 0.211975 0.220400 0.355012 0.325879 0.220972 0.186720 0.266430 0.510632 0.041115 0.419323 0.028930 0.067550 0.203499 0.411224 0.317727 0.023546 0.002038 0.972278 0.002138 0.017818 0.006841 0.006478 0.968864 0.019791 0.001443 0.009338 0.969428 0.003084 0.992130 0.002654 0.002131 0.001031 0.039768 0.003588 0.955613 0.980811 0.006260 0.008964 0.003965 0.013624 0.002796 0.979716 0.003863 0.841198 0.016422 0.129217 0.013163 0.169265 0.145424 0.085753 0.599558 0.068235 0.584950 0.065758 0.281057 0.378189 0.252218 0.209355 0.160238 0.167389 0.305726 0.229730 0.297156 Consensus sequence: BDHRBGTTCTAGATCVB Reverse complement motif 0.167389 0.229730 0.305726 0.297156 0.160238 0.252218 0.209355 0.378189 0.068235 0.065758 0.584950 0.281057 0.599558 0.145424 0.085753 0.169265 0.013163 0.016422 0.129217 0.841198 0.013624 0.979716 0.002796 0.003863 0.003965 0.006260 0.008964 0.980811 0.955613 0.039768 0.003588 0.001031 0.003084 0.002654 0.992130 0.002131 0.969428 0.001443 0.009338 0.019791 0.968864 0.006841 0.006478 0.017818 0.023546 0.972278 0.002038 0.002138 0.067550 0.411224 0.203499 0.317727 0.028930 0.041115 0.419323 0.510632 0.266430 0.220972 0.186720 0.325879 0.355012 0.211975 0.220400 0.212612 0.163348 0.273573 0.349811 0.213268 Consensus sequence: BBGATCTAGAACBKHDB Alignment: -BBGATCTAGAACBKHDB GTTGACCTTTGACCTTT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00046 Tcfe2a_secondary Original Motif Original Motif Forward 2 16 0.552064 Species: Mus musculus Original motif 0.296417 0.247522 0.206749 0.249312 0.410113 0.201959 0.303149 0.084779 0.267313 0.132645 0.452057 0.147985 0.187929 0.136827 0.427628 0.247616 0.198671 0.425254 0.234160 0.141915 0.029244 0.953929 0.004092 0.012734 0.954570 0.014314 0.018695 0.012421 0.010025 0.055055 0.845504 0.089415 0.874802 0.040849 0.069178 0.015172 0.015084 0.010551 0.008736 0.965628 0.012981 0.007192 0.965036 0.014791 0.037724 0.016891 0.495632 0.449753 0.021685 0.438927 0.056118 0.483270 0.209872 0.365671 0.139706 0.284751 0.151815 0.336912 0.289382 0.221891 0.152995 0.262354 0.416434 0.168217 0.227567 0.187603 0.447892 0.136938 Consensus sequence: HVDDVCAGATGKYHBBV Reverse complement motif 0.227567 0.447892 0.187603 0.136938 0.152995 0.416434 0.262354 0.168217 0.151815 0.289382 0.336912 0.221891 0.209872 0.139706 0.365671 0.284751 0.483270 0.438927 0.056118 0.021685 0.037724 0.495632 0.016891 0.449753 0.012981 0.965036 0.007192 0.014791 0.965628 0.010551 0.008736 0.015084 0.015172 0.040849 0.069178 0.874802 0.010025 0.845504 0.055055 0.089415 0.012421 0.014314 0.018695 0.954570 0.029244 0.004092 0.953929 0.012734 0.198671 0.234160 0.425254 0.141915 0.187929 0.427628 0.136827 0.247616 0.267313 0.452057 0.132645 0.147985 0.084779 0.201959 0.303149 0.410113 0.249312 0.247522 0.206749 0.296417 Consensus sequence: VBBDMYCATCTGVHHBH Alignment: HVDDVCAGATGKYHBBV- -AAAGGTCAAAGGTCAAC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 3 Motif ID: 61 Motif name: NR4A2 Original motif 0.615385 0.076923 0.230769 0.076923 0.928571 0.000000 0.071429 0.000000 0.000000 0.000000 0.928571 0.071429 0.214286 0.000000 0.785714 0.000000 0.142857 0.142857 0.000000 0.714286 0.000000 0.928571 0.000000 0.071429 1.000000 0.000000 0.000000 0.000000 0.230769 0.615385 0.153846 0.000000 Consensus sequence: AAGGTCAC Reserve complement motif 0.230769 0.153846 0.615385 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.928571 0.071429 0.714286 0.142857 0.000000 0.142857 0.214286 0.785714 0.000000 0.000000 0.000000 0.928571 0.000000 0.071429 0.000000 0.000000 0.071429 0.928571 0.076923 0.076923 0.230769 0.615385 Consensus sequence: GTGACCTT ************************************************************************ Best Matches for Motif ID 61 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00048 Rara Original Motif Original Motif Backward 4 8 0.000000 Species: Mus musculus Original motif 0.222478 0.177331 0.266395 0.333797 0.276222 0.360097 0.118354 0.245327 0.106047 0.268455 0.234217 0.391281 0.244163 0.407141 0.146864 0.201832 0.852083 0.050643 0.039941 0.057332 0.814108 0.012894 0.165984 0.007015 0.905198 0.005648 0.088378 0.000776 0.002783 0.000555 0.988205 0.008457 0.001289 0.000626 0.898209 0.099877 0.002878 0.001631 0.008910 0.986582 0.000499 0.975550 0.005264 0.018687 0.963627 0.000883 0.034432 0.001058 0.181490 0.517766 0.077094 0.223650 0.183789 0.384790 0.308350 0.123071 0.229801 0.228801 0.224468 0.316930 0.218244 0.170273 0.366746 0.244736 Consensus sequence: DHBHAAAGGTCACVHD Reverse complement motif 0.218244 0.366746 0.170273 0.244736 0.316930 0.228801 0.224468 0.229801 0.183789 0.308350 0.384790 0.123071 0.181490 0.077094 0.517766 0.223650 0.001058 0.000883 0.034432 0.963627 0.000499 0.005264 0.975550 0.018687 0.986582 0.001631 0.008910 0.002878 0.001289 0.898209 0.000626 0.099877 0.002783 0.988205 0.000555 0.008457 0.000776 0.005648 0.088378 0.905198 0.007015 0.012894 0.165984 0.814108 0.057332 0.050643 0.039941 0.852083 0.244163 0.146864 0.407141 0.201832 0.391281 0.268455 0.234217 0.106047 0.276222 0.118354 0.360097 0.245327 0.333797 0.177331 0.266395 0.222478 Consensus sequence: HHVGTGACCTTTDVDD Alignment: DHBHAAAGGTCACVHD -----AAGGTCAC--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00009 Nr2f2_primary Original Motif Original Motif Backward 4 8 0.007453 Species: Mus musculus Original motif 0.253408 0.181904 0.273186 0.291502 0.262827 0.381870 0.153734 0.201569 0.143383 0.243233 0.242562 0.370823 0.247498 0.336892 0.176114 0.239496 0.856654 0.037068 0.049492 0.056786 0.797369 0.012935 0.176463 0.013233 0.808222 0.001309 0.189796 0.000674 0.002583 0.000536 0.989167 0.007714 0.002421 0.000283 0.972777 0.024519 0.000270 0.003650 0.019038 0.977041 0.000184 0.956654 0.005329 0.037833 0.925587 0.000706 0.072434 0.001273 0.307028 0.327297 0.079126 0.286549 0.238576 0.245847 0.384025 0.131552 0.281599 0.234987 0.226211 0.257204 0.211511 0.212695 0.363980 0.211815 Consensus sequence: DHBHAAAGGTCAHVHB Reverse complement motif 0.211511 0.363980 0.212695 0.211815 0.257204 0.234987 0.226211 0.281599 0.238576 0.384025 0.245847 0.131552 0.307028 0.079126 0.327297 0.286549 0.001273 0.000706 0.072434 0.925587 0.000184 0.005329 0.956654 0.037833 0.977041 0.003650 0.019038 0.000270 0.002421 0.972777 0.000283 0.024519 0.002583 0.989167 0.000536 0.007714 0.000674 0.001309 0.189796 0.808222 0.013233 0.012935 0.176463 0.797369 0.056786 0.037068 0.049492 0.856654 0.247498 0.176114 0.336892 0.239496 0.370823 0.243233 0.242562 0.143383 0.262827 0.153734 0.381870 0.201569 0.291502 0.181904 0.273186 0.253408 Consensus sequence: BHVDTGACCTTTDVDD Alignment: DHBHAAAGGTCAHVHB -----AAGGTCAC--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00079 Esrra_primary Original Motif Original Motif Backward 5 8 0.015420 Species: Mus musculus Original motif 0.212524 0.177958 0.293723 0.315796 0.420838 0.283140 0.144938 0.151084 0.198119 0.196347 0.260353 0.345181 0.117752 0.282184 0.137207 0.462857 0.070125 0.781439 0.138093 0.010344 0.965989 0.000956 0.023828 0.009227 0.977263 0.003066 0.019255 0.000416 0.007404 0.000267 0.938934 0.053395 0.007147 0.000287 0.983377 0.009190 0.039608 0.000730 0.040682 0.918981 0.000685 0.905345 0.021930 0.072040 0.800961 0.001126 0.195791 0.002121 0.245039 0.241263 0.038084 0.475614 0.265397 0.238316 0.304963 0.191325 0.203742 0.286208 0.231002 0.279048 0.194132 0.188854 0.346693 0.270322 0.310711 0.263840 0.184317 0.241132 Consensus sequence: DHDBCAAGGTCAHVBDH Reverse complement motif 0.241132 0.263840 0.184317 0.310711 0.194132 0.346693 0.188854 0.270322 0.203742 0.231002 0.286208 0.279048 0.265397 0.304963 0.238316 0.191325 0.475614 0.241263 0.038084 0.245039 0.002121 0.001126 0.195791 0.800961 0.000685 0.021930 0.905345 0.072040 0.918981 0.000730 0.040682 0.039608 0.007147 0.983377 0.000287 0.009190 0.007404 0.938934 0.000267 0.053395 0.000416 0.003066 0.019255 0.977263 0.009227 0.000956 0.023828 0.965989 0.070125 0.138093 0.781439 0.010344 0.462857 0.282184 0.137207 0.117752 0.345181 0.196347 0.260353 0.198119 0.151084 0.283140 0.144938 0.420838 0.315796 0.177958 0.293723 0.212524 Consensus sequence: HHBVHTGACCTTGVDHD Alignment: DHDBCAAGGTCAHVBDH -----AAGGTCAC---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00009 Nr2f2_secondary Original Motif Original Motif Forward 6 8 0.039564 Species: Mus musculus Original motif 0.195749 0.435700 0.196915 0.171636 0.131070 0.131912 0.417834 0.319184 0.238959 0.441529 0.174973 0.144539 0.187749 0.189727 0.405849 0.216675 0.006751 0.541370 0.182092 0.269787 0.005388 0.590608 0.339869 0.064135 0.088153 0.004666 0.902351 0.004830 0.002459 0.004278 0.982637 0.010626 0.003618 0.002504 0.985275 0.008602 0.003325 0.004017 0.009244 0.983414 0.002547 0.972864 0.005345 0.019244 0.940260 0.002927 0.053632 0.003181 0.222459 0.390569 0.251497 0.135475 0.151824 0.258444 0.332866 0.256865 0.175811 0.290583 0.232086 0.301520 0.356690 0.198973 0.136050 0.308287 Consensus sequence: VBVBCSGGGTCAVBBH Reverse complement motif 0.308287 0.198973 0.136050 0.356690 0.301520 0.290583 0.232086 0.175811 0.151824 0.332866 0.258444 0.256865 0.222459 0.251497 0.390569 0.135475 0.003181 0.002927 0.053632 0.940260 0.002547 0.005345 0.972864 0.019244 0.983414 0.004017 0.009244 0.003325 0.003618 0.985275 0.002504 0.008602 0.002459 0.982637 0.004278 0.010626 0.088153 0.902351 0.004666 0.004830 0.005388 0.339869 0.590608 0.064135 0.006751 0.182092 0.541370 0.269787 0.187749 0.405849 0.189727 0.216675 0.238959 0.174973 0.441529 0.144539 0.131070 0.417834 0.131912 0.319184 0.195749 0.196915 0.435700 0.171636 Consensus sequence: HVBVTGACCCSGBVBV Alignment: VBVBCSGGGTCAVBBH -----AAGGTCAC--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00082 Zfp187_secondary Reverse Complement Original Motif Backward 9 8 0.040787 Species: Mus musculus Original motif 0.173063 0.169680 0.440836 0.216421 0.353277 0.179996 0.249403 0.217325 0.307337 0.038055 0.616380 0.038228 0.316636 0.564670 0.023732 0.094962 0.015484 0.923764 0.019439 0.041313 0.011243 0.956300 0.009443 0.023014 0.062273 0.107531 0.010739 0.819456 0.126670 0.201521 0.192005 0.479803 0.093090 0.045924 0.835792 0.025194 0.020165 0.015483 0.009567 0.954786 0.010873 0.672448 0.004559 0.312121 0.018002 0.846860 0.017605 0.117533 0.335703 0.408170 0.104095 0.152031 0.150308 0.362296 0.067408 0.419988 0.286490 0.242211 0.176532 0.294767 0.265022 0.249655 0.272219 0.213104 Consensus sequence: DDGMCCTBGTCCHYHV Reverse complement motif 0.265022 0.272219 0.249655 0.213104 0.294767 0.242211 0.176532 0.286490 0.419988 0.362296 0.067408 0.150308 0.335703 0.104095 0.408170 0.152031 0.018002 0.017605 0.846860 0.117533 0.010873 0.004559 0.672448 0.312121 0.954786 0.015483 0.009567 0.020165 0.093090 0.835792 0.045924 0.025194 0.479803 0.201521 0.192005 0.126670 0.819456 0.107531 0.010739 0.062273 0.011243 0.009443 0.956300 0.023014 0.015484 0.019439 0.923764 0.041313 0.316636 0.023732 0.564670 0.094962 0.307337 0.616380 0.038055 0.038228 0.217325 0.179996 0.249403 0.353277 0.173063 0.440836 0.169680 0.216421 Consensus sequence: VHMDGGACVAGGRCDH Alignment: DDGMCCTBGTCCHYHV GTGACCTT-------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00053 Rxra_primary Reverse Complement Original Motif Backward 6 8 0.042293 Species: Mus musculus Original motif 0.235299 0.222264 0.237416 0.305021 0.144778 0.278902 0.341673 0.234648 0.261127 0.261904 0.191591 0.285378 0.119943 0.410774 0.218940 0.250343 0.222672 0.075554 0.365253 0.336521 0.001838 0.046904 0.002828 0.948430 0.030410 0.006359 0.960821 0.002410 0.987391 0.007562 0.002810 0.002237 0.105188 0.888650 0.001163 0.004998 0.006475 0.987074 0.001793 0.004659 0.001816 0.765138 0.003092 0.229953 0.010354 0.846496 0.029899 0.113251 0.328732 0.039382 0.265510 0.366377 0.209638 0.262628 0.145613 0.382121 0.385390 0.177695 0.299828 0.137087 0.403452 0.268924 0.096028 0.231595 0.203082 0.231812 0.213520 0.351585 Consensus sequence: DBHBDTGACCCCDHVHB Reverse complement motif 0.351585 0.231812 0.213520 0.203082 0.231595 0.268924 0.096028 0.403452 0.137087 0.177695 0.299828 0.385390 0.382121 0.262628 0.145613 0.209638 0.366377 0.039382 0.265510 0.328732 0.010354 0.029899 0.846496 0.113251 0.001816 0.003092 0.765138 0.229953 0.006475 0.001793 0.987074 0.004659 0.105188 0.001163 0.888650 0.004998 0.002237 0.007562 0.002810 0.987391 0.030410 0.960821 0.006359 0.002410 0.948430 0.046904 0.002828 0.001838 0.222672 0.365253 0.075554 0.336521 0.119943 0.218940 0.410774 0.250343 0.285378 0.261904 0.191591 0.261127 0.144778 0.341673 0.278902 0.234648 0.305021 0.222264 0.237416 0.235299 Consensus sequence: VHBHDGGGGTCAHBHBD Alignment: DBHBDTGACCCCDHVHB ----GTGACCTT----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00079 Esrra_secondary Original Motif Original Motif Backward 5 8 0.044744 Species: Mus musculus Original motif 0.252126 0.268706 0.351590 0.127578 0.158171 0.083434 0.389646 0.368749 0.180010 0.290882 0.279192 0.249916 0.206905 0.249360 0.275438 0.268296 0.756588 0.046202 0.023921 0.173289 0.018262 0.022596 0.949143 0.010000 0.206468 0.046491 0.745475 0.001566 0.005511 0.001141 0.983152 0.010196 0.004791 0.001893 0.985951 0.007365 0.027643 0.001133 0.008565 0.962659 0.002459 0.970934 0.007826 0.018780 0.924387 0.003164 0.071225 0.001224 0.419387 0.230189 0.111588 0.238836 0.290954 0.163823 0.341233 0.203991 0.196768 0.281307 0.313868 0.208056 0.128428 0.260428 0.378607 0.232537 0.269305 0.378895 0.123480 0.228320 Consensus sequence: VKBBAGGGGTCAHDBBH Reverse complement motif 0.269305 0.123480 0.378895 0.228320 0.128428 0.378607 0.260428 0.232537 0.196768 0.313868 0.281307 0.208056 0.290954 0.341233 0.163823 0.203991 0.238836 0.230189 0.111588 0.419387 0.001224 0.003164 0.071225 0.924387 0.002459 0.007826 0.970934 0.018780 0.962659 0.001133 0.008565 0.027643 0.004791 0.985951 0.001893 0.007365 0.005511 0.983152 0.001141 0.010196 0.206468 0.745475 0.046491 0.001566 0.018262 0.949143 0.022596 0.010000 0.173289 0.046202 0.023921 0.756588 0.206905 0.275438 0.249360 0.268296 0.180010 0.279192 0.290882 0.249916 0.158171 0.389646 0.083434 0.368749 0.252126 0.351590 0.268706 0.127578 Consensus sequence: DBBHHTGACCCCTBBYV Alignment: VKBBAGGGGTCAHDBBH -----AAGGTCAC---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00066 Hnf4a_secondary Original Motif Original Motif Forward 6 8 0.048142 Species: Mus musculus Original motif 0.131680 0.169949 0.346277 0.352094 0.109910 0.144258 0.373681 0.372151 0.196671 0.411335 0.159689 0.232305 0.311086 0.307077 0.122332 0.259505 0.895155 0.013238 0.038874 0.052733 0.779629 0.018399 0.171269 0.030703 0.950546 0.002649 0.041825 0.004980 0.004769 0.002646 0.985847 0.006739 0.004458 0.002117 0.012011 0.981414 0.016789 0.969626 0.003890 0.009695 0.002468 0.982852 0.004754 0.009926 0.891448 0.003193 0.097548 0.007811 0.513330 0.308971 0.070467 0.107232 0.179371 0.115514 0.130898 0.574217 0.285826 0.277536 0.166982 0.269655 0.319407 0.227783 0.129020 0.323790 Consensus sequence: BBHHAAAGTCCAMTHH Reverse complement motif 0.323790 0.227783 0.129020 0.319407 0.269655 0.277536 0.166982 0.285826 0.574217 0.115514 0.130898 0.179371 0.107232 0.308971 0.070467 0.513330 0.007811 0.003193 0.097548 0.891448 0.002468 0.004754 0.982852 0.009926 0.016789 0.003890 0.969626 0.009695 0.981414 0.002117 0.012011 0.004458 0.004769 0.985847 0.002646 0.006739 0.004980 0.002649 0.041825 0.950546 0.030703 0.018399 0.171269 0.779629 0.052733 0.013238 0.038874 0.895155 0.259505 0.307077 0.122332 0.311086 0.196671 0.159689 0.411335 0.232305 0.109910 0.373681 0.144258 0.372151 0.352094 0.169949 0.346277 0.131680 Consensus sequence: HHAYTGGACTTTHDBV Alignment: BBHHAAAGTCCAMTHH -----AAGGTCAC--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00197 Hoxc9 Reverse Complement Reverse Complement Forward 8 8 0.049768 Species: Mus musculus Original motif 0.279588 0.205946 0.337877 0.176588 0.212819 0.121136 0.376165 0.289881 0.371836 0.224291 0.240111 0.163762 0.200999 0.056254 0.589311 0.153436 0.141203 0.048864 0.796449 0.013484 0.026376 0.197045 0.009146 0.767433 0.286968 0.688278 0.011985 0.012769 0.890619 0.006181 0.098071 0.005129 0.019680 0.011114 0.002539 0.966668 0.287238 0.007432 0.002166 0.703164 0.975510 0.006204 0.005667 0.012620 0.949137 0.017111 0.006224 0.027528 0.241729 0.296577 0.052768 0.408926 0.212400 0.269675 0.090007 0.427918 0.333376 0.091783 0.259582 0.315259 0.182024 0.203528 0.245531 0.368917 Consensus sequence: VDVGGTCATTAAHHDB Reverse complement motif 0.368917 0.203528 0.245531 0.182024 0.315259 0.091783 0.259582 0.333376 0.427918 0.269675 0.090007 0.212400 0.408926 0.296577 0.052768 0.241729 0.027528 0.017111 0.006224 0.949137 0.012620 0.006204 0.005667 0.975510 0.703164 0.007432 0.002166 0.287238 0.966668 0.011114 0.002539 0.019680 0.005129 0.006181 0.098071 0.890619 0.286968 0.011985 0.688278 0.012769 0.767433 0.197045 0.009146 0.026376 0.141203 0.796449 0.048864 0.013484 0.200999 0.589311 0.056254 0.153436 0.163762 0.224291 0.240111 0.371836 0.212819 0.376165 0.121136 0.289881 0.279588 0.337877 0.205946 0.176588 Consensus sequence: VDHHTTAATGACCBHV Alignment: VDHHTTAATGACCBHV -------GTGACCTT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00035 Hic1_secondary Reverse Complement Original Motif Forward 5 8 0.050006 Species: Mus musculus Original motif 0.204898 0.149951 0.363373 0.281778 0.112946 0.243700 0.437938 0.205417 0.205232 0.182319 0.383143 0.229305 0.242063 0.152491 0.296426 0.309020 0.312922 0.028523 0.585026 0.073529 0.006754 0.011178 0.005346 0.976723 0.127589 0.005562 0.859436 0.007414 0.010046 0.974694 0.007001 0.008259 0.010262 0.974769 0.006069 0.008899 0.015122 0.966101 0.007970 0.010807 0.556511 0.167389 0.114635 0.161465 0.586459 0.044786 0.073450 0.295305 0.297710 0.194666 0.223655 0.283969 0.303202 0.250809 0.206475 0.239514 0.279338 0.160655 0.314457 0.245550 0.266477 0.266890 0.299970 0.166662 Consensus sequence: DBDDRTGCCCAWDHDV Reverse complement motif 0.266477 0.299970 0.266890 0.166662 0.279338 0.314457 0.160655 0.245550 0.239514 0.250809 0.206475 0.303202 0.283969 0.194666 0.223655 0.297710 0.295305 0.044786 0.073450 0.586459 0.161465 0.167389 0.114635 0.556511 0.015122 0.007970 0.966101 0.010807 0.010262 0.006069 0.974769 0.008899 0.010046 0.007001 0.974694 0.008259 0.127589 0.859436 0.005562 0.007414 0.976723 0.011178 0.005346 0.006754 0.312922 0.585026 0.028523 0.073529 0.309020 0.152491 0.296426 0.242063 0.205232 0.383143 0.182319 0.229305 0.112946 0.437938 0.243700 0.205417 0.204898 0.363373 0.149951 0.281778 Consensus sequence: VHHDWTGGGCAMDHBH Alignment: DBDDRTGCCCAWDHDV ----GTGACCTT---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 3 Motif ID: 62 Motif name: RORA_1 Original motif 0.600000 0.040000 0.080000 0.280000 0.360000 0.040000 0.000000 0.600000 0.240000 0.480000 0.160000 0.120000 0.440000 0.080000 0.200000 0.280000 0.840000 0.000000 0.160000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 Consensus sequence: AWVDAGGTCA Reserve complement motif 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.160000 0.840000 0.280000 0.080000 0.200000 0.440000 0.240000 0.160000 0.480000 0.120000 0.600000 0.040000 0.000000 0.360000 0.280000 0.040000 0.080000 0.600000 Consensus sequence: TGACCTDVWT ************************************************************************ Best Matches for Motif ID 62 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00009 Nr2f2_primary Original Motif Original Motif Backward 5 10 0.015475 Species: Mus musculus Original motif 0.253408 0.181904 0.273186 0.291502 0.262827 0.381870 0.153734 0.201569 0.143383 0.243233 0.242562 0.370823 0.247498 0.336892 0.176114 0.239496 0.856654 0.037068 0.049492 0.056786 0.797369 0.012935 0.176463 0.013233 0.808222 0.001309 0.189796 0.000674 0.002583 0.000536 0.989167 0.007714 0.002421 0.000283 0.972777 0.024519 0.000270 0.003650 0.019038 0.977041 0.000184 0.956654 0.005329 0.037833 0.925587 0.000706 0.072434 0.001273 0.307028 0.327297 0.079126 0.286549 0.238576 0.245847 0.384025 0.131552 0.281599 0.234987 0.226211 0.257204 0.211511 0.212695 0.363980 0.211815 Consensus sequence: DHBHAAAGGTCAHVHB Reverse complement motif 0.211511 0.363980 0.212695 0.211815 0.257204 0.234987 0.226211 0.281599 0.238576 0.384025 0.245847 0.131552 0.307028 0.079126 0.327297 0.286549 0.001273 0.000706 0.072434 0.925587 0.000184 0.005329 0.956654 0.037833 0.977041 0.003650 0.019038 0.000270 0.002421 0.972777 0.000283 0.024519 0.002583 0.989167 0.000536 0.007714 0.000674 0.001309 0.189796 0.808222 0.013233 0.012935 0.176463 0.797369 0.056786 0.037068 0.049492 0.856654 0.247498 0.176114 0.336892 0.239496 0.370823 0.243233 0.242562 0.143383 0.262827 0.153734 0.381870 0.201569 0.291502 0.181904 0.273186 0.253408 Consensus sequence: BHVDTGACCTTTDVDD Alignment: DHBHAAAGGTCAHVHB --AWVDAGGTCA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00079 Esrra_primary Reverse Complement Reverse Complement Forward 6 10 0.017666 Species: Mus musculus Original motif 0.212524 0.177958 0.293723 0.315796 0.420838 0.283140 0.144938 0.151084 0.198119 0.196347 0.260353 0.345181 0.117752 0.282184 0.137207 0.462857 0.070125 0.781439 0.138093 0.010344 0.965989 0.000956 0.023828 0.009227 0.977263 0.003066 0.019255 0.000416 0.007404 0.000267 0.938934 0.053395 0.007147 0.000287 0.983377 0.009190 0.039608 0.000730 0.040682 0.918981 0.000685 0.905345 0.021930 0.072040 0.800961 0.001126 0.195791 0.002121 0.245039 0.241263 0.038084 0.475614 0.265397 0.238316 0.304963 0.191325 0.203742 0.286208 0.231002 0.279048 0.194132 0.188854 0.346693 0.270322 0.310711 0.263840 0.184317 0.241132 Consensus sequence: DHDBCAAGGTCAHVBDH Reverse complement motif 0.241132 0.263840 0.184317 0.310711 0.194132 0.346693 0.188854 0.270322 0.203742 0.231002 0.286208 0.279048 0.265397 0.304963 0.238316 0.191325 0.475614 0.241263 0.038084 0.245039 0.002121 0.001126 0.195791 0.800961 0.000685 0.021930 0.905345 0.072040 0.918981 0.000730 0.040682 0.039608 0.007147 0.983377 0.000287 0.009190 0.007404 0.938934 0.000267 0.053395 0.000416 0.003066 0.019255 0.977263 0.009227 0.000956 0.023828 0.965989 0.070125 0.138093 0.781439 0.010344 0.462857 0.282184 0.137207 0.117752 0.345181 0.196347 0.260353 0.198119 0.151084 0.283140 0.144938 0.420838 0.315796 0.177958 0.293723 0.212524 Consensus sequence: HHBVHTGACCTTGVDHD Alignment: HHBVHTGACCTTGVDHD -----TGACCTDVWT-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00048 Rara Original Motif Original Motif Backward 5 10 0.018960 Species: Mus musculus Original motif 0.222478 0.177331 0.266395 0.333797 0.276222 0.360097 0.118354 0.245327 0.106047 0.268455 0.234217 0.391281 0.244163 0.407141 0.146864 0.201832 0.852083 0.050643 0.039941 0.057332 0.814108 0.012894 0.165984 0.007015 0.905198 0.005648 0.088378 0.000776 0.002783 0.000555 0.988205 0.008457 0.001289 0.000626 0.898209 0.099877 0.002878 0.001631 0.008910 0.986582 0.000499 0.975550 0.005264 0.018687 0.963627 0.000883 0.034432 0.001058 0.181490 0.517766 0.077094 0.223650 0.183789 0.384790 0.308350 0.123071 0.229801 0.228801 0.224468 0.316930 0.218244 0.170273 0.366746 0.244736 Consensus sequence: DHBHAAAGGTCACVHD Reverse complement motif 0.218244 0.366746 0.170273 0.244736 0.316930 0.228801 0.224468 0.229801 0.183789 0.308350 0.384790 0.123071 0.181490 0.077094 0.517766 0.223650 0.001058 0.000883 0.034432 0.963627 0.000499 0.005264 0.975550 0.018687 0.986582 0.001631 0.008910 0.002878 0.001289 0.898209 0.000626 0.099877 0.002783 0.988205 0.000555 0.008457 0.000776 0.005648 0.088378 0.905198 0.007015 0.012894 0.165984 0.814108 0.057332 0.050643 0.039941 0.852083 0.244163 0.146864 0.407141 0.201832 0.391281 0.268455 0.234217 0.106047 0.276222 0.118354 0.360097 0.245327 0.333797 0.177331 0.266395 0.222478 Consensus sequence: HHVGTGACCTTTDVDD Alignment: DHBHAAAGGTCACVHD --AWVDAGGTCA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00009 Nr2f2_secondary Original Motif Original Motif Backward 5 10 0.033200 Species: Mus musculus Original motif 0.195749 0.435700 0.196915 0.171636 0.131070 0.131912 0.417834 0.319184 0.238959 0.441529 0.174973 0.144539 0.187749 0.189727 0.405849 0.216675 0.006751 0.541370 0.182092 0.269787 0.005388 0.590608 0.339869 0.064135 0.088153 0.004666 0.902351 0.004830 0.002459 0.004278 0.982637 0.010626 0.003618 0.002504 0.985275 0.008602 0.003325 0.004017 0.009244 0.983414 0.002547 0.972864 0.005345 0.019244 0.940260 0.002927 0.053632 0.003181 0.222459 0.390569 0.251497 0.135475 0.151824 0.258444 0.332866 0.256865 0.175811 0.290583 0.232086 0.301520 0.356690 0.198973 0.136050 0.308287 Consensus sequence: VBVBCSGGGTCAVBBH Reverse complement motif 0.308287 0.198973 0.136050 0.356690 0.301520 0.290583 0.232086 0.175811 0.151824 0.332866 0.258444 0.256865 0.222459 0.251497 0.390569 0.135475 0.003181 0.002927 0.053632 0.940260 0.002547 0.005345 0.972864 0.019244 0.983414 0.004017 0.009244 0.003325 0.003618 0.985275 0.002504 0.008602 0.002459 0.982637 0.004278 0.010626 0.088153 0.902351 0.004666 0.004830 0.005388 0.339869 0.590608 0.064135 0.006751 0.182092 0.541370 0.269787 0.187749 0.405849 0.189727 0.216675 0.238959 0.174973 0.441529 0.144539 0.131070 0.417834 0.131912 0.319184 0.195749 0.196915 0.435700 0.171636 Consensus sequence: HVBVTGACCCSGBVBV Alignment: VBVBCSGGGTCAVBBH --AWVDAGGTCA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00066 Hnf4a_primary Original Motif Original Motif Forward 3 10 0.034177 Species: Mus musculus Original motif 0.223704 0.280688 0.251889 0.243719 0.198683 0.190981 0.267970 0.342366 0.150012 0.319579 0.206063 0.324347 0.274896 0.302572 0.238597 0.183935 0.438853 0.331148 0.021186 0.208812 0.133937 0.027342 0.832490 0.006231 0.141462 0.002336 0.854359 0.001843 0.003464 0.000753 0.987433 0.008349 0.004388 0.000692 0.884494 0.110426 0.003808 0.001605 0.016793 0.977794 0.001992 0.976605 0.003739 0.017664 0.881237 0.089981 0.026017 0.002764 0.735041 0.106592 0.083260 0.075107 0.164419 0.315518 0.181031 0.339032 0.228285 0.176364 0.157583 0.437768 0.233407 0.193567 0.327076 0.245951 0.320479 0.312566 0.195701 0.171254 Consensus sequence: BDBVMGGGGTCAABHDV Reverse complement motif 0.171254 0.312566 0.195701 0.320479 0.233407 0.327076 0.193567 0.245951 0.437768 0.176364 0.157583 0.228285 0.339032 0.315518 0.181031 0.164419 0.075107 0.106592 0.083260 0.735041 0.002764 0.089981 0.026017 0.881237 0.001992 0.003739 0.976605 0.017664 0.977794 0.001605 0.016793 0.003808 0.004388 0.884494 0.000692 0.110426 0.003464 0.987433 0.000753 0.008349 0.141462 0.854359 0.002336 0.001843 0.133937 0.832490 0.027342 0.006231 0.208812 0.331148 0.021186 0.438853 0.274896 0.238597 0.302572 0.183935 0.324347 0.319579 0.206063 0.150012 0.342366 0.190981 0.267970 0.198683 0.223704 0.251889 0.280688 0.243719 Consensus sequence: BHHVTTGACCCCYVVDB Alignment: BDBVMGGGGTCAABHDV --AWVDAGGTCA----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00053 Rxra_primary Reverse Complement Original Motif Forward 6 10 0.036357 Species: Mus musculus Original motif 0.235299 0.222264 0.237416 0.305021 0.144778 0.278902 0.341673 0.234648 0.261127 0.261904 0.191591 0.285378 0.119943 0.410774 0.218940 0.250343 0.222672 0.075554 0.365253 0.336521 0.001838 0.046904 0.002828 0.948430 0.030410 0.006359 0.960821 0.002410 0.987391 0.007562 0.002810 0.002237 0.105188 0.888650 0.001163 0.004998 0.006475 0.987074 0.001793 0.004659 0.001816 0.765138 0.003092 0.229953 0.010354 0.846496 0.029899 0.113251 0.328732 0.039382 0.265510 0.366377 0.209638 0.262628 0.145613 0.382121 0.385390 0.177695 0.299828 0.137087 0.403452 0.268924 0.096028 0.231595 0.203082 0.231812 0.213520 0.351585 Consensus sequence: DBHBDTGACCCCDHVHB Reverse complement motif 0.351585 0.231812 0.213520 0.203082 0.231595 0.268924 0.096028 0.403452 0.137087 0.177695 0.299828 0.385390 0.382121 0.262628 0.145613 0.209638 0.366377 0.039382 0.265510 0.328732 0.010354 0.029899 0.846496 0.113251 0.001816 0.003092 0.765138 0.229953 0.006475 0.001793 0.987074 0.004659 0.105188 0.001163 0.888650 0.004998 0.002237 0.007562 0.002810 0.987391 0.030410 0.960821 0.006359 0.002410 0.948430 0.046904 0.002828 0.001838 0.222672 0.365253 0.075554 0.336521 0.119943 0.218940 0.410774 0.250343 0.285378 0.261904 0.191591 0.261127 0.144778 0.341673 0.278902 0.234648 0.305021 0.222264 0.237416 0.235299 Consensus sequence: VHBHDGGGGTCAHBHBD Alignment: DBHBDTGACCCCDHVHB -----TGACCTDVWT-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00079 Esrra_secondary Original Motif Original Motif Backward 6 10 0.039128 Species: Mus musculus Original motif 0.252126 0.268706 0.351590 0.127578 0.158171 0.083434 0.389646 0.368749 0.180010 0.290882 0.279192 0.249916 0.206905 0.249360 0.275438 0.268296 0.756588 0.046202 0.023921 0.173289 0.018262 0.022596 0.949143 0.010000 0.206468 0.046491 0.745475 0.001566 0.005511 0.001141 0.983152 0.010196 0.004791 0.001893 0.985951 0.007365 0.027643 0.001133 0.008565 0.962659 0.002459 0.970934 0.007826 0.018780 0.924387 0.003164 0.071225 0.001224 0.419387 0.230189 0.111588 0.238836 0.290954 0.163823 0.341233 0.203991 0.196768 0.281307 0.313868 0.208056 0.128428 0.260428 0.378607 0.232537 0.269305 0.378895 0.123480 0.228320 Consensus sequence: VKBBAGGGGTCAHDBBH Reverse complement motif 0.269305 0.123480 0.378895 0.228320 0.128428 0.378607 0.260428 0.232537 0.196768 0.313868 0.281307 0.208056 0.290954 0.341233 0.163823 0.203991 0.238836 0.230189 0.111588 0.419387 0.001224 0.003164 0.071225 0.924387 0.002459 0.007826 0.970934 0.018780 0.962659 0.001133 0.008565 0.027643 0.004791 0.985951 0.001893 0.007365 0.005511 0.983152 0.001141 0.010196 0.206468 0.745475 0.046491 0.001566 0.018262 0.949143 0.022596 0.010000 0.173289 0.046202 0.023921 0.756588 0.206905 0.275438 0.249360 0.268296 0.180010 0.279192 0.290882 0.249916 0.158171 0.389646 0.083434 0.368749 0.252126 0.351590 0.268706 0.127578 Consensus sequence: DBBHHTGACCCCTBBYV Alignment: VKBBAGGGGTCAHDBBH --AWVDAGGTCA----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00035 Hic1_secondary Reverse Complement Original Motif Backward 2 10 0.044421 Species: Mus musculus Original motif 0.204898 0.149951 0.363373 0.281778 0.112946 0.243700 0.437938 0.205417 0.205232 0.182319 0.383143 0.229305 0.242063 0.152491 0.296426 0.309020 0.312922 0.028523 0.585026 0.073529 0.006754 0.011178 0.005346 0.976723 0.127589 0.005562 0.859436 0.007414 0.010046 0.974694 0.007001 0.008259 0.010262 0.974769 0.006069 0.008899 0.015122 0.966101 0.007970 0.010807 0.556511 0.167389 0.114635 0.161465 0.586459 0.044786 0.073450 0.295305 0.297710 0.194666 0.223655 0.283969 0.303202 0.250809 0.206475 0.239514 0.279338 0.160655 0.314457 0.245550 0.266477 0.266890 0.299970 0.166662 Consensus sequence: DBDDRTGCCCAWDHDV Reverse complement motif 0.266477 0.299970 0.266890 0.166662 0.279338 0.314457 0.160655 0.245550 0.239514 0.250809 0.206475 0.303202 0.283969 0.194666 0.223655 0.297710 0.295305 0.044786 0.073450 0.586459 0.161465 0.167389 0.114635 0.556511 0.015122 0.007970 0.966101 0.010807 0.010262 0.006069 0.974769 0.008899 0.010046 0.007001 0.974694 0.008259 0.127589 0.859436 0.005562 0.007414 0.976723 0.011178 0.005346 0.006754 0.312922 0.585026 0.028523 0.073529 0.309020 0.152491 0.296426 0.242063 0.205232 0.383143 0.182319 0.229305 0.112946 0.437938 0.243700 0.205417 0.204898 0.363373 0.149951 0.281778 Consensus sequence: VHHDWTGGGCAMDHBH Alignment: DBDDRTGCCCAWDHDV -----TGACCTDVWT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00050 Bhlhb2_primary Original Motif Reverse Complement Forward 1 10 0.046143 Species: Mus musculus Original motif 0.347837 0.112349 0.403713 0.136102 0.298329 0.175329 0.324534 0.201809 0.421791 0.222553 0.113615 0.242041 0.387506 0.130670 0.161435 0.320389 0.197183 0.244864 0.304611 0.253342 0.345884 0.188786 0.278290 0.187041 0.228203 0.142148 0.408269 0.221381 0.037126 0.006772 0.231775 0.724328 0.055214 0.942800 0.001192 0.000794 0.974119 0.004466 0.015535 0.005880 0.000300 0.958145 0.007498 0.034056 0.034056 0.007498 0.958145 0.000300 0.005880 0.015535 0.004466 0.974119 0.000794 0.001192 0.942800 0.055214 0.724328 0.231775 0.006772 0.037126 0.015720 0.466476 0.315208 0.202596 0.173670 0.355170 0.210710 0.260449 0.407419 0.261539 0.134430 0.196612 0.351478 0.209698 0.262426 0.176399 0.207869 0.284582 0.198951 0.308598 0.434482 0.113724 0.184408 0.267386 0.211144 0.363745 0.173978 0.251133 Consensus sequence: RDHDBVDTCACGTGASBHVHDH Reverse complement motif 0.211144 0.173978 0.363745 0.251133 0.267386 0.113724 0.184408 0.434482 0.308598 0.284582 0.198951 0.207869 0.176399 0.209698 0.262426 0.351478 0.196612 0.261539 0.134430 0.407419 0.173670 0.210710 0.355170 0.260449 0.015720 0.315208 0.466476 0.202596 0.037126 0.231775 0.006772 0.724328 0.000794 0.942800 0.001192 0.055214 0.974119 0.015535 0.004466 0.005880 0.034056 0.958145 0.007498 0.000300 0.000300 0.007498 0.958145 0.034056 0.005880 0.004466 0.015535 0.974119 0.055214 0.001192 0.942800 0.000794 0.724328 0.006772 0.231775 0.037126 0.228203 0.408269 0.142148 0.221381 0.187041 0.188786 0.278290 0.345884 0.197183 0.304611 0.244864 0.253342 0.320389 0.130670 0.161435 0.387506 0.242041 0.222553 0.113615 0.421791 0.298329 0.324534 0.175329 0.201809 0.347837 0.403713 0.112349 0.136102 Consensus sequence: DDHBHBSTCACGTGAHBBDHHM Alignment: DDHBHBSTCACGTGAHBBDHHM AWVDAGGTCA------------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v016060_primary Reverse Complement Original Motif Backward 3 10 0.048957 Species: Mus musculus Original motif 0.204923 0.208846 0.365383 0.220848 0.294304 0.300143 0.167287 0.238266 0.109711 0.619514 0.117379 0.153396 0.178979 0.378580 0.230177 0.212264 0.159594 0.542602 0.118178 0.179627 0.125206 0.430074 0.151826 0.292894 0.097692 0.709845 0.116956 0.075506 0.148292 0.565912 0.037632 0.248164 0.077951 0.034190 0.855503 0.032356 0.001657 0.001061 0.971877 0.025405 0.001926 0.001084 0.991712 0.005278 0.033031 0.012001 0.057796 0.897171 0.002723 0.002647 0.993348 0.001281 0.003261 0.000963 0.987199 0.008577 0.000611 0.090925 0.074857 0.833608 0.015299 0.978878 0.004949 0.000874 0.013368 0.600902 0.033485 0.352245 0.231949 0.149575 0.118804 0.499672 0.267580 0.186002 0.371242 0.175176 0.264884 0.223483 0.110082 0.401551 0.221365 0.170121 0.179559 0.428955 0.112997 0.692930 0.139981 0.054092 0.460305 0.207883 0.155111 0.176702 Consensus sequence: BHCBCBCCGGGTGGTCYHVHDCH Reverse complement motif 0.176702 0.207883 0.155111 0.460305 0.112997 0.139981 0.692930 0.054092 0.428955 0.170121 0.179559 0.221365 0.401551 0.223483 0.110082 0.264884 0.267580 0.371242 0.186002 0.175176 0.499672 0.149575 0.118804 0.231949 0.013368 0.033485 0.600902 0.352245 0.015299 0.004949 0.978878 0.000874 0.833608 0.090925 0.074857 0.000611 0.003261 0.987199 0.000963 0.008577 0.002723 0.993348 0.002647 0.001281 0.897171 0.012001 0.057796 0.033031 0.001926 0.991712 0.001084 0.005278 0.001657 0.971877 0.001061 0.025405 0.077951 0.855503 0.034190 0.032356 0.148292 0.037632 0.565912 0.248164 0.097692 0.116956 0.709845 0.075506 0.125206 0.151826 0.430074 0.292894 0.159594 0.118178 0.542602 0.179627 0.178979 0.230177 0.378580 0.212264 0.109711 0.117379 0.619514 0.153396 0.294304 0.167287 0.300143 0.238266 0.204923 0.365383 0.208846 0.220848 Consensus sequence: HGDHVHKGACCACCCGGBGBGDB Alignment: BHCBCBCCGGGTGGTCYHVHDCH -----------TGACCTDVWT-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 3 Motif ID: 63 Motif name: MIZF Original motif 0.100000 0.300000 0.250000 0.350000 0.650000 0.050000 0.000000 0.300000 1.000000 0.000000 0.000000 0.000000 0.100000 0.850000 0.050000 0.000000 0.000000 0.000000 0.950000 0.050000 0.000000 0.050000 0.000000 0.950000 0.000000 0.950000 0.000000 0.050000 0.000000 0.900000 0.100000 0.000000 0.000000 0.000000 0.950000 0.050000 0.100000 0.650000 0.050000 0.200000 Consensus sequence: BAACGTCCGC Reserve complement motif 0.100000 0.050000 0.650000 0.200000 0.000000 0.950000 0.000000 0.050000 0.000000 0.100000 0.900000 0.000000 0.000000 0.000000 0.950000 0.050000 0.950000 0.050000 0.000000 0.000000 0.000000 0.950000 0.000000 0.050000 0.100000 0.050000 0.850000 0.000000 0.000000 0.000000 0.000000 1.000000 0.300000 0.050000 0.000000 0.650000 0.350000 0.300000 0.250000 0.100000 Consensus sequence: GCGGACGTTV ************************************************************************ Best Matches for Motif ID 63 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00419 Spic Original Motif Reverse Complement Forward 1 10 0.000000 Species: Mus musculus Original motif 0.372554 0.181557 0.296001 0.149888 0.734552 0.057250 0.044752 0.163446 0.707604 0.045049 0.110341 0.137006 0.637848 0.057252 0.071934 0.232966 0.125449 0.108933 0.689441 0.076176 0.266215 0.517339 0.207018 0.009428 0.015016 0.002582 0.979670 0.002732 0.004303 0.002322 0.989973 0.003401 0.982327 0.003552 0.003393 0.010727 0.974155 0.001662 0.003294 0.020889 0.040023 0.128522 0.821560 0.009894 0.027635 0.045828 0.016297 0.910239 0.317500 0.045635 0.172234 0.464631 0.342838 0.107812 0.284775 0.264576 Consensus sequence: VAAAGMGGAAGTWD Reverse complement motif 0.264576 0.107812 0.284775 0.342838 0.464631 0.045635 0.172234 0.317500 0.910239 0.045828 0.016297 0.027635 0.040023 0.821560 0.128522 0.009894 0.020889 0.001662 0.003294 0.974155 0.010727 0.003552 0.003393 0.982327 0.004303 0.989973 0.002322 0.003401 0.015016 0.979670 0.002582 0.002732 0.266215 0.207018 0.517339 0.009428 0.125449 0.689441 0.108933 0.076176 0.232966 0.057252 0.071934 0.637848 0.137006 0.045049 0.110341 0.707604 0.163446 0.057250 0.044752 0.734552 0.149888 0.181557 0.296001 0.372554 Consensus sequence: DWACTTCCRCTTTB Alignment: VAAAGMGGAAGTWD BAACGTCCGC---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00409 Elf5 Original Motif Reverse Complement Forward 1 10 0.003800 Species: Mus musculus Original motif 0.179167 0.229135 0.279326 0.312372 0.421239 0.102900 0.145609 0.330252 0.791978 0.009721 0.028951 0.169350 0.237609 0.375543 0.161526 0.225321 0.145845 0.325411 0.516045 0.012699 0.431007 0.516333 0.051679 0.000982 0.005750 0.001408 0.990928 0.001915 0.002025 0.001886 0.992021 0.004068 0.986405 0.001705 0.001039 0.010851 0.950652 0.003619 0.000482 0.045248 0.165221 0.013897 0.819076 0.001805 0.032042 0.049374 0.014632 0.903953 0.285325 0.108010 0.127373 0.479292 0.366131 0.141246 0.290661 0.201963 Consensus sequence: BWAHSMGGAAGTWD Reverse complement motif 0.201963 0.141246 0.290661 0.366131 0.479292 0.108010 0.127373 0.285325 0.903953 0.049374 0.014632 0.032042 0.165221 0.819076 0.013897 0.001805 0.045248 0.003619 0.000482 0.950652 0.010851 0.001705 0.001039 0.986405 0.002025 0.992021 0.001886 0.004068 0.005750 0.990928 0.001408 0.001915 0.431007 0.051679 0.516333 0.000982 0.145845 0.516045 0.325411 0.012699 0.237609 0.161526 0.375543 0.225321 0.169350 0.009721 0.028951 0.791978 0.330252 0.102900 0.145609 0.421239 0.312372 0.229135 0.279326 0.179167 Consensus sequence: DWACTTCCRSDTWV Alignment: DWACTTCCRSDTWV BAACGTCCGC---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00413 Elf4 Original Motif Original Motif Backward 5 10 0.012410 Species: Mus musculus Original motif 0.349744 0.139466 0.209326 0.301464 0.080478 0.359482 0.307083 0.252956 0.145756 0.213763 0.350557 0.289924 0.317307 0.199359 0.096089 0.387245 0.868576 0.009724 0.088821 0.032878 0.001975 0.827004 0.014159 0.156862 0.045494 0.000985 0.001907 0.951615 0.011012 0.001203 0.002186 0.985599 0.002743 0.992908 0.002226 0.002123 0.001498 0.990840 0.001556 0.006106 0.000951 0.005138 0.880591 0.113319 0.003127 0.107962 0.867980 0.020930 0.156602 0.055355 0.396563 0.391480 0.421246 0.049379 0.084495 0.444880 0.223879 0.068063 0.203809 0.504249 0.144100 0.323579 0.131544 0.400777 Consensus sequence: DBBHACTTCCGGKWTH Reverse complement motif 0.400777 0.323579 0.131544 0.144100 0.504249 0.068063 0.203809 0.223879 0.444880 0.049379 0.084495 0.421246 0.156602 0.396563 0.055355 0.391480 0.003127 0.867980 0.107962 0.020930 0.000951 0.880591 0.005138 0.113319 0.001498 0.001556 0.990840 0.006106 0.002743 0.002226 0.992908 0.002123 0.985599 0.001203 0.002186 0.011012 0.951615 0.000985 0.001907 0.045494 0.001975 0.014159 0.827004 0.156862 0.032878 0.009724 0.088821 0.868576 0.387245 0.199359 0.096089 0.317307 0.145756 0.350557 0.213763 0.289924 0.080478 0.307083 0.359482 0.252956 0.301464 0.139466 0.209326 0.349744 Consensus sequence: HAWYCCGGAAGTHBBD Alignment: DBBHACTTCCGGKWTH --BAACGTCCGC---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00404 Elf2 Original Motif Original Motif Forward 3 10 0.012835 Species: Mus musculus Original motif 0.381592 0.198656 0.201326 0.218426 0.091509 0.331644 0.302830 0.274017 0.165404 0.272650 0.352528 0.209418 0.322145 0.255685 0.129399 0.292771 0.853490 0.012857 0.078563 0.055090 0.002655 0.792907 0.026436 0.178002 0.058923 0.001063 0.002976 0.937038 0.014944 0.001369 0.002865 0.980822 0.003786 0.992305 0.002102 0.001807 0.001365 0.988969 0.001554 0.008111 0.001527 0.009592 0.891056 0.097824 0.003671 0.143708 0.836117 0.016503 0.242982 0.061527 0.305342 0.390148 0.426709 0.117673 0.096260 0.359357 0.202520 0.113885 0.262005 0.421589 0.137957 0.359367 0.163919 0.338758 Consensus sequence: DBBHACTTCCGGDWDB Reverse complement motif 0.137957 0.163919 0.359367 0.338758 0.421589 0.113885 0.262005 0.202520 0.359357 0.117673 0.096260 0.426709 0.390148 0.061527 0.305342 0.242982 0.003671 0.836117 0.143708 0.016503 0.001527 0.891056 0.009592 0.097824 0.001365 0.001554 0.988969 0.008111 0.003786 0.002102 0.992305 0.001807 0.980822 0.001369 0.002865 0.014944 0.937038 0.001063 0.002976 0.058923 0.002655 0.026436 0.792907 0.178002 0.055090 0.012857 0.078563 0.853490 0.292771 0.255685 0.129399 0.322145 0.165404 0.352528 0.272650 0.209418 0.091509 0.302830 0.331644 0.274017 0.218426 0.198656 0.201326 0.381592 Consensus sequence: BDWDCCGGAAGTHBBD Alignment: DBBHACTTCCGGDWDB --BAACGTCCGC---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00085 Sfpi1_primary Original Motif Reverse Complement Backward 5 10 0.014152 Species: Mus musculus Original motif 0.211586 0.273653 0.234763 0.279998 0.298032 0.104818 0.290385 0.306764 0.593467 0.048056 0.154602 0.203875 0.459746 0.052697 0.169949 0.317608 0.188623 0.155357 0.591543 0.064477 0.402746 0.286227 0.290285 0.020742 0.048569 0.001240 0.946397 0.003793 0.004354 0.001387 0.990819 0.003441 0.974272 0.001416 0.001466 0.022847 0.938748 0.003090 0.000833 0.057329 0.045831 0.270321 0.674644 0.009204 0.055664 0.092552 0.026061 0.825722 0.301235 0.122653 0.267039 0.309073 0.278680 0.276099 0.219159 0.226061 Consensus sequence: BDAWGVGGAAGTDH Reverse complement motif 0.226061 0.276099 0.219159 0.278680 0.309073 0.122653 0.267039 0.301235 0.825722 0.092552 0.026061 0.055664 0.045831 0.674644 0.270321 0.009204 0.057329 0.003090 0.000833 0.938748 0.022847 0.001416 0.001466 0.974272 0.004354 0.990819 0.001387 0.003441 0.048569 0.946397 0.001240 0.003793 0.020742 0.286227 0.290285 0.402746 0.188623 0.591543 0.155357 0.064477 0.317608 0.052697 0.169949 0.459746 0.203875 0.048056 0.154602 0.593467 0.306764 0.104818 0.290385 0.298032 0.279998 0.273653 0.234763 0.211586 Consensus sequence: HDACTTCCBCWTDV Alignment: HDACTTCCBCWTDV BAACGTCCGC---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00423 Gm5454 Reverse Complement Reverse Complement Forward 5 10 0.014467 Species: Mus musculus Original motif 0.189373 0.396200 0.238705 0.175722 0.271321 0.176458 0.265627 0.286594 0.266229 0.324575 0.201073 0.208123 0.468162 0.220280 0.143160 0.168399 0.828556 0.009006 0.155963 0.006475 0.000965 0.820477 0.022769 0.155789 0.259255 0.001186 0.002221 0.737339 0.006364 0.001548 0.002346 0.989741 0.002267 0.993010 0.002221 0.002502 0.002365 0.993176 0.001987 0.002473 0.000528 0.001790 0.953300 0.044382 0.002238 0.032836 0.958384 0.006542 0.230236 0.143256 0.029199 0.597309 0.285226 0.282789 0.207699 0.224286 0.271642 0.251065 0.289590 0.187703 0.219881 0.390525 0.157704 0.231890 Consensus sequence: VDHHACTTCCGGTHVH Reverse complement motif 0.219881 0.157704 0.390525 0.231890 0.271642 0.289590 0.251065 0.187703 0.224286 0.282789 0.207699 0.285226 0.597309 0.143256 0.029199 0.230236 0.002238 0.958384 0.032836 0.006542 0.000528 0.953300 0.001790 0.044382 0.002365 0.001987 0.993176 0.002473 0.002267 0.002221 0.993010 0.002502 0.989741 0.001548 0.002346 0.006364 0.737339 0.001186 0.002221 0.259255 0.000965 0.022769 0.820477 0.155789 0.006475 0.009006 0.155963 0.828556 0.168399 0.220280 0.143160 0.468162 0.266229 0.201073 0.324575 0.208123 0.286594 0.176458 0.265627 0.271321 0.189373 0.238705 0.396200 0.175722 Consensus sequence: DVHACCGGAAGTHDDV Alignment: DVHACCGGAAGTHDDV ----GCGGACGTTV-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00412 Etv5 Reverse Complement Reverse Complement Backward 3 10 0.015583 Species: Mus musculus Original motif 0.163863 0.478739 0.234818 0.122579 0.298203 0.128058 0.250907 0.322832 0.304907 0.352627 0.141386 0.201081 0.505689 0.209260 0.108917 0.176133 0.755659 0.019470 0.214957 0.009914 0.001392 0.808267 0.034638 0.155703 0.341720 0.002244 0.003969 0.652068 0.011512 0.000955 0.002369 0.985163 0.003522 0.992404 0.002813 0.001261 0.002303 0.993216 0.002157 0.002324 0.000502 0.002139 0.938005 0.059354 0.004246 0.041666 0.947484 0.006604 0.177758 0.143265 0.023436 0.655542 0.278473 0.235398 0.218872 0.267257 0.225212 0.275898 0.211908 0.286982 0.193184 0.385135 0.190634 0.231048 Consensus sequence: VDHAACWTCCGGTHHH Reverse complement motif 0.193184 0.190634 0.385135 0.231048 0.286982 0.275898 0.211908 0.225212 0.267257 0.235398 0.218872 0.278473 0.655542 0.143265 0.023436 0.177758 0.004246 0.947484 0.041666 0.006604 0.000502 0.938005 0.002139 0.059354 0.002303 0.002157 0.993216 0.002324 0.003522 0.002813 0.992404 0.001261 0.985163 0.000955 0.002369 0.011512 0.652068 0.002244 0.003969 0.341720 0.001392 0.034638 0.808267 0.155703 0.009914 0.019470 0.214957 0.755659 0.176133 0.209260 0.108917 0.505689 0.304907 0.141386 0.352627 0.201081 0.322832 0.128058 0.250907 0.298203 0.163863 0.234818 0.478739 0.122579 Consensus sequence: DHHACCGGAWGTTDDV Alignment: DHHACCGGAWGTTDDV ----GCGGACGTTV-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00015 Ehf_primary Reverse Complement Original Motif Forward 6 10 0.016202 Species: Mus musculus Original motif 0.327238 0.304037 0.232174 0.136551 0.198306 0.222758 0.316421 0.262515 0.252373 0.217079 0.267210 0.263337 0.633781 0.039800 0.036914 0.289504 0.160405 0.384709 0.220671 0.234215 0.134205 0.590541 0.266074 0.009179 0.210933 0.755978 0.030378 0.002710 0.011856 0.001472 0.984138 0.002533 0.003235 0.001605 0.989465 0.005695 0.984189 0.002418 0.002842 0.010551 0.884492 0.002651 0.002095 0.110762 0.249047 0.054607 0.690939 0.005407 0.124602 0.154669 0.047597 0.673132 0.375217 0.110561 0.230374 0.283848 0.402951 0.186789 0.219551 0.190710 Consensus sequence: VBDABCCGGAAGTDD Reverse complement motif 0.190710 0.186789 0.219551 0.402951 0.283848 0.110561 0.230374 0.375217 0.673132 0.154669 0.047597 0.124602 0.249047 0.690939 0.054607 0.005407 0.110762 0.002651 0.002095 0.884492 0.010551 0.002418 0.002842 0.984189 0.003235 0.989465 0.001605 0.005695 0.011856 0.984138 0.001472 0.002533 0.210933 0.030378 0.755978 0.002710 0.134205 0.266074 0.590541 0.009179 0.160405 0.220671 0.384709 0.234215 0.289504 0.039800 0.036914 0.633781 0.252373 0.267210 0.217079 0.263337 0.198306 0.316421 0.222758 0.262515 0.136551 0.304037 0.232174 0.327238 Consensus sequence: DDACTTCCGGBTHBB Alignment: VBDABCCGGAAGTDD -----GCGGACGTTV ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00418 Etv6 Original Motif Original Motif Forward 4 10 0.017123 Species: Mus musculus Original motif 0.354972 0.069107 0.299350 0.276571 0.209701 0.408003 0.227382 0.154914 0.284336 0.375266 0.162604 0.177794 0.176569 0.181438 0.342172 0.299820 0.106551 0.204378 0.060299 0.628772 0.884088 0.003252 0.103113 0.009546 0.001110 0.704391 0.006294 0.288205 0.014992 0.000892 0.001401 0.982714 0.004842 0.001887 0.002470 0.990801 0.002724 0.992864 0.002206 0.002206 0.001792 0.991200 0.001615 0.005393 0.005151 0.010157 0.940259 0.044433 0.017780 0.199839 0.761921 0.020459 0.230834 0.269936 0.119652 0.379577 0.233019 0.093692 0.034743 0.638546 0.194739 0.181763 0.175340 0.448159 0.145452 0.293709 0.335917 0.224922 Consensus sequence: DVHBTACTTCCGGHTHB Reverse complement motif 0.145452 0.335917 0.293709 0.224922 0.448159 0.181763 0.175340 0.194739 0.638546 0.093692 0.034743 0.233019 0.379577 0.269936 0.119652 0.230834 0.017780 0.761921 0.199839 0.020459 0.005151 0.940259 0.010157 0.044433 0.001792 0.001615 0.991200 0.005393 0.002724 0.002206 0.992864 0.002206 0.990801 0.001887 0.002470 0.004842 0.982714 0.000892 0.001401 0.014992 0.001110 0.006294 0.704391 0.288205 0.009546 0.003252 0.103113 0.884088 0.628772 0.204378 0.060299 0.106551 0.176569 0.342172 0.181438 0.299820 0.284336 0.162604 0.375266 0.177794 0.209701 0.227382 0.408003 0.154914 0.276571 0.069107 0.299350 0.354972 Consensus sequence: BHAHCCGGAAGTABDVD Alignment: DVHBTACTTCCGGHTHB ---BAACGTCCGC---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00421 Etv1 Reverse Complement Original Motif Forward 6 10 0.018415 Species: Mus musculus Original motif 0.481848 0.274378 0.165047 0.078727 0.153123 0.322109 0.385794 0.138974 0.257711 0.198309 0.118559 0.425422 0.102329 0.255032 0.373097 0.269542 0.655995 0.027594 0.168796 0.147615 0.012836 0.906067 0.077134 0.003962 0.079806 0.917232 0.002438 0.000524 0.005217 0.001765 0.991859 0.001159 0.001691 0.002097 0.993588 0.002624 0.991087 0.001016 0.001937 0.005961 0.751484 0.005147 0.002324 0.241044 0.112494 0.076460 0.805095 0.005951 0.012019 0.198497 0.022413 0.767071 0.482843 0.140306 0.249898 0.126953 0.298792 0.191769 0.286874 0.222565 0.395216 0.302575 0.172247 0.129961 0.364642 0.219734 0.190320 0.225304 Consensus sequence: MVHBACCGGAAGTVDVH Reverse complement motif 0.225304 0.219734 0.190320 0.364642 0.129961 0.302575 0.172247 0.395216 0.222565 0.191769 0.286874 0.298792 0.126953 0.140306 0.249898 0.482843 0.767071 0.198497 0.022413 0.012019 0.112494 0.805095 0.076460 0.005951 0.241044 0.005147 0.002324 0.751484 0.005961 0.001016 0.001937 0.991087 0.001691 0.993588 0.002097 0.002624 0.005217 0.991859 0.001765 0.001159 0.079806 0.002438 0.917232 0.000524 0.012836 0.077134 0.906067 0.003962 0.147615 0.027594 0.168796 0.655995 0.102329 0.373097 0.255032 0.269542 0.425422 0.198309 0.118559 0.257711 0.153123 0.385794 0.322109 0.138974 0.078727 0.274378 0.165047 0.481848 Consensus sequence: HBDBACTTCCGGTBHVY Alignment: MVHBACCGGAAGTVDVH -----GCGGACGTTV-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 3 Motif ID: 64 Motif name: PPARGRXRA Original motif 0.109685 0.369895 0.373396 0.147025 0.117716 0.193473 0.148019 0.540793 0.453488 0.026744 0.427907 0.091860 0.116144 0.003484 0.779326 0.101045 0.161253 0.017401 0.781903 0.039443 0.168213 0.149652 0.458237 0.223898 0.082271 0.633835 0.207416 0.076477 0.949015 0.024334 0.017381 0.009270 0.604867 0.055620 0.312862 0.026651 0.825231 0.005787 0.158565 0.010417 0.095017 0.002317 0.888760 0.013905 0.047509 0.010429 0.803013 0.139050 0.025492 0.114716 0.304751 0.555041 0.062645 0.643852 0.167053 0.126450 0.784223 0.067285 0.054524 0.093968 Consensus sequence: BTRGGDCARAGGKCA Reserve complement motif 0.093968 0.067285 0.054524 0.784223 0.062645 0.167053 0.643852 0.126450 0.555041 0.114716 0.304751 0.025492 0.047509 0.803013 0.010429 0.139050 0.095017 0.888760 0.002317 0.013905 0.010417 0.005787 0.158565 0.825231 0.026651 0.055620 0.312862 0.604867 0.009270 0.024334 0.017381 0.949015 0.082271 0.207416 0.633835 0.076477 0.168213 0.458237 0.149652 0.223898 0.161253 0.781903 0.017401 0.039443 0.116144 0.779326 0.003484 0.101045 0.091860 0.026744 0.427907 0.453488 0.540793 0.193473 0.148019 0.117716 0.109685 0.373396 0.369895 0.147025 Consensus sequence: TGRCCTKTGHCCKAB ************************************************************************ Best Matches for Motif ID 64 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00067 Lef1_primary Original Motif Reverse Complement Backward 2 15 0.030495 Species: Mus musculus Original motif 0.281920 0.214207 0.278077 0.225796 0.325566 0.151435 0.298797 0.224202 0.290253 0.145824 0.243443 0.320480 0.069286 0.404645 0.141614 0.384454 0.070044 0.621448 0.142647 0.165862 0.007295 0.907657 0.038110 0.046938 0.015587 0.018273 0.000658 0.965482 0.005527 0.005886 0.001905 0.986682 0.024512 0.001189 0.001344 0.972955 0.007384 0.025221 0.952270 0.015125 0.966438 0.000630 0.002693 0.030239 0.082252 0.001173 0.001495 0.915080 0.030255 0.677155 0.275323 0.017267 0.199467 0.118815 0.056814 0.624905 0.345445 0.169597 0.216831 0.268127 0.278106 0.150864 0.173693 0.397336 0.251834 0.339733 0.219703 0.188730 Consensus sequence: DDDYCCTTTGATCTDDV Reverse complement motif 0.251834 0.219703 0.339733 0.188730 0.397336 0.150864 0.173693 0.278106 0.268127 0.169597 0.216831 0.345445 0.624905 0.118815 0.056814 0.199467 0.030255 0.275323 0.677155 0.017267 0.915080 0.001173 0.001495 0.082252 0.030239 0.000630 0.002693 0.966438 0.007384 0.952270 0.025221 0.015125 0.972955 0.001189 0.001344 0.024512 0.986682 0.005886 0.001905 0.005527 0.965482 0.018273 0.000658 0.015587 0.007295 0.038110 0.907657 0.046938 0.070044 0.142647 0.621448 0.165862 0.069286 0.141614 0.404645 0.384454 0.320480 0.145824 0.243443 0.290253 0.224202 0.151435 0.298797 0.325566 0.225796 0.214207 0.278077 0.281920 Consensus sequence: VDDAGATCAAAGGKDDD Alignment: VDDAGATCAAAGGKDDD -BTRGGDCARAGGKCA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00058 Tcf3_primary Original Motif Original Motif Forward 2 15 0.031947 Species: Mus musculus Original motif 0.185864 0.201179 0.183663 0.429294 0.371100 0.233868 0.122934 0.272098 0.249563 0.171285 0.128851 0.450301 0.582940 0.043382 0.129099 0.244578 0.041400 0.395349 0.497087 0.066163 0.759123 0.009670 0.005936 0.225270 0.056579 0.008662 0.003986 0.930772 0.043968 0.865783 0.056001 0.034249 0.962748 0.003731 0.003265 0.030256 0.971318 0.003542 0.012299 0.012841 0.937558 0.003991 0.020195 0.038256 0.125931 0.057976 0.798081 0.018012 0.209401 0.172342 0.483980 0.134277 0.485703 0.129227 0.309936 0.075134 0.397027 0.195902 0.152395 0.254676 0.311636 0.231510 0.157732 0.299122 0.320965 0.206031 0.164299 0.308705 Consensus sequence: HHHASATCAAAGVRHHH Reverse complement motif 0.308705 0.206031 0.164299 0.320965 0.299122 0.231510 0.157732 0.311636 0.254676 0.195902 0.152395 0.397027 0.075134 0.129227 0.309936 0.485703 0.209401 0.483980 0.172342 0.134277 0.125931 0.798081 0.057976 0.018012 0.038256 0.003991 0.020195 0.937558 0.012841 0.003542 0.012299 0.971318 0.030256 0.003731 0.003265 0.962748 0.043968 0.056001 0.865783 0.034249 0.930772 0.008662 0.003986 0.056579 0.225270 0.009670 0.005936 0.759123 0.041400 0.497087 0.395349 0.066163 0.244578 0.043382 0.129099 0.582940 0.450301 0.171285 0.128851 0.249563 0.272098 0.233868 0.122934 0.371100 0.429294 0.201179 0.183663 0.185864 Consensus sequence: HHHKVCTTTGATSTHHH Alignment: HHHASATCAAAGVRHHH -BTRGGDCARAGGKCA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00054 Tcf7_primary Original Motif Original Motif Backward 2 15 0.032779 Species: Mus musculus Original motif 0.170811 0.196976 0.220503 0.411710 0.337231 0.228482 0.140137 0.294150 0.299312 0.173780 0.143426 0.383481 0.603957 0.053557 0.128214 0.214271 0.036338 0.377925 0.534647 0.051091 0.725865 0.010314 0.008501 0.255320 0.067855 0.007849 0.004559 0.919737 0.049387 0.815496 0.098330 0.036787 0.960514 0.005036 0.005137 0.029313 0.960631 0.004550 0.018815 0.016004 0.935245 0.005169 0.023866 0.035720 0.159760 0.060340 0.761341 0.018559 0.228534 0.153897 0.523052 0.094517 0.557984 0.123512 0.254154 0.064350 0.490252 0.211976 0.124557 0.173215 0.310463 0.250279 0.132612 0.306646 0.332720 0.248937 0.120633 0.297711 Consensus sequence: BHHASATCAAAGGAHHH Reverse complement motif 0.297711 0.248937 0.120633 0.332720 0.306646 0.250279 0.132612 0.310463 0.173215 0.211976 0.124557 0.490252 0.064350 0.123512 0.254154 0.557984 0.228534 0.523052 0.153897 0.094517 0.159760 0.761341 0.060340 0.018559 0.035720 0.005169 0.023866 0.935245 0.016004 0.004550 0.018815 0.960631 0.029313 0.005036 0.005137 0.960514 0.049387 0.098330 0.815496 0.036787 0.919737 0.007849 0.004559 0.067855 0.255320 0.010314 0.008501 0.725865 0.036338 0.534647 0.377925 0.051091 0.214271 0.053557 0.128214 0.603957 0.383481 0.173780 0.143426 0.299312 0.294150 0.228482 0.140137 0.337231 0.411710 0.196976 0.220503 0.170811 Consensus sequence: HHHTCCTTTGATSTHHV Alignment: BHHASATCAAAGGAHHH -BTRGGDCARAGGKCA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00082 Zfp187_secondary Original Motif Reverse Complement Backward 2 15 0.033418 Species: Mus musculus Original motif 0.173063 0.169680 0.440836 0.216421 0.353277 0.179996 0.249403 0.217325 0.307337 0.038055 0.616380 0.038228 0.316636 0.564670 0.023732 0.094962 0.015484 0.923764 0.019439 0.041313 0.011243 0.956300 0.009443 0.023014 0.062273 0.107531 0.010739 0.819456 0.126670 0.201521 0.192005 0.479803 0.093090 0.045924 0.835792 0.025194 0.020165 0.015483 0.009567 0.954786 0.010873 0.672448 0.004559 0.312121 0.018002 0.846860 0.017605 0.117533 0.335703 0.408170 0.104095 0.152031 0.150308 0.362296 0.067408 0.419988 0.286490 0.242211 0.176532 0.294767 0.265022 0.249655 0.272219 0.213104 Consensus sequence: DDGMCCTBGTCCHYHV Reverse complement motif 0.265022 0.272219 0.249655 0.213104 0.294767 0.242211 0.176532 0.286490 0.419988 0.362296 0.067408 0.150308 0.335703 0.104095 0.408170 0.152031 0.018002 0.017605 0.846860 0.117533 0.010873 0.004559 0.672448 0.312121 0.954786 0.015483 0.009567 0.020165 0.093090 0.835792 0.045924 0.025194 0.479803 0.201521 0.192005 0.126670 0.819456 0.107531 0.010739 0.062273 0.011243 0.009443 0.956300 0.023014 0.015484 0.019439 0.923764 0.041313 0.316636 0.023732 0.564670 0.094962 0.307337 0.616380 0.038055 0.038228 0.217325 0.179996 0.249403 0.353277 0.173063 0.440836 0.169680 0.216421 Consensus sequence: VHMDGGACVAGGRCDH Alignment: VHMDGGACVAGGRCDH BTRGGDCARAGGKCA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00062 Sox4_primary Original Motif Original Motif Backward 2 15 0.035254 Species: Mus musculus Original motif 0.427843 0.231210 0.119424 0.221523 0.196506 0.239531 0.304906 0.259057 0.302488 0.156922 0.290190 0.250401 0.433872 0.149126 0.196496 0.220506 0.258426 0.076511 0.475100 0.189963 0.841714 0.046453 0.099915 0.011918 0.983853 0.001612 0.001362 0.013174 0.003460 0.982032 0.005728 0.008780 0.989743 0.002253 0.002020 0.005984 0.990761 0.003397 0.002843 0.003000 0.770864 0.003540 0.001549 0.224048 0.235342 0.002598 0.757383 0.004677 0.371426 0.089574 0.529959 0.009040 0.480804 0.196949 0.240413 0.081833 0.187158 0.355102 0.216599 0.241142 0.248006 0.232182 0.157452 0.362360 0.403367 0.177684 0.164649 0.254300 Consensus sequence: HBDDDAACAAAGRVBHH Reverse complement motif 0.254300 0.177684 0.164649 0.403367 0.362360 0.232182 0.157452 0.248006 0.187158 0.216599 0.355102 0.241142 0.081833 0.196949 0.240413 0.480804 0.371426 0.529959 0.089574 0.009040 0.235342 0.757383 0.002598 0.004677 0.224048 0.003540 0.001549 0.770864 0.003000 0.003397 0.002843 0.990761 0.005984 0.002253 0.002020 0.989743 0.003460 0.005728 0.982032 0.008780 0.013174 0.001612 0.001362 0.983853 0.011918 0.046453 0.099915 0.841714 0.258426 0.475100 0.076511 0.189963 0.220506 0.149126 0.196496 0.433872 0.250401 0.156922 0.290190 0.302488 0.196506 0.304906 0.239531 0.259057 0.221523 0.231210 0.119424 0.427843 Consensus sequence: HHBBMCTTTGTTHDDBH Alignment: HBDDDAACAAAGRVBHH -BTRGGDCARAGGKCA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00030 Sox11_primary Original Motif Original Motif Backward 2 15 0.035878 Species: Mus musculus Original motif 0.351812 0.238467 0.143954 0.265768 0.195246 0.235838 0.281473 0.287443 0.349478 0.172616 0.210739 0.267167 0.484061 0.110438 0.173131 0.232370 0.276692 0.070713 0.479604 0.172991 0.859124 0.044167 0.083951 0.012758 0.975608 0.002029 0.002285 0.020079 0.006422 0.978485 0.007124 0.007969 0.987489 0.003025 0.002868 0.006617 0.987739 0.005463 0.002730 0.004067 0.693013 0.004067 0.002445 0.300475 0.189100 0.003677 0.801408 0.005814 0.352090 0.072517 0.567737 0.007656 0.542316 0.176545 0.192768 0.088371 0.196382 0.304176 0.205985 0.293457 0.289415 0.201358 0.182937 0.326290 0.385801 0.216362 0.152363 0.245475 Consensus sequence: HBDDRAACAAAGRABHH Reverse complement motif 0.245475 0.216362 0.152363 0.385801 0.326290 0.201358 0.182937 0.289415 0.196382 0.205985 0.304176 0.293457 0.088371 0.176545 0.192768 0.542316 0.352090 0.567737 0.072517 0.007656 0.189100 0.801408 0.003677 0.005814 0.300475 0.004067 0.002445 0.693013 0.004067 0.005463 0.002730 0.987739 0.006617 0.003025 0.002868 0.987489 0.006422 0.007124 0.978485 0.007969 0.020079 0.002029 0.002285 0.975608 0.012758 0.044167 0.083951 0.859124 0.276692 0.479604 0.070713 0.172991 0.232370 0.110438 0.173131 0.484061 0.267167 0.172616 0.210739 0.349478 0.287443 0.235838 0.281473 0.195246 0.265768 0.238467 0.143954 0.351812 Consensus sequence: HHBTMCTTTGTTMDDVH Alignment: HBDDRAACAAAGRABHH -BTRGGDCARAGGKCA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00101 Sox12_secondary Reverse Complement Reverse Complement Backward 2 15 0.037473 Species: Mus musculus Original motif 0.378898 0.318901 0.205859 0.096341 0.352524 0.321236 0.224504 0.101736 0.323551 0.182056 0.210897 0.283496 0.135539 0.325230 0.208031 0.331200 0.663106 0.055471 0.154459 0.126963 0.051748 0.292567 0.537307 0.118378 0.886489 0.042361 0.035742 0.035408 0.043647 0.688744 0.094358 0.173252 0.882052 0.039818 0.018899 0.059231 0.864171 0.036011 0.068363 0.031455 0.790158 0.046868 0.041594 0.121379 0.087447 0.143905 0.707798 0.060849 0.295919 0.132479 0.485703 0.085899 0.653156 0.133004 0.110012 0.103828 0.351764 0.131771 0.217730 0.298736 0.203977 0.196773 0.099958 0.499292 Consensus sequence: VVDBASACAAAGRADH Reverse complement motif 0.499292 0.196773 0.099958 0.203977 0.298736 0.131771 0.217730 0.351764 0.103828 0.133004 0.110012 0.653156 0.295919 0.485703 0.132479 0.085899 0.087447 0.707798 0.143905 0.060849 0.121379 0.046868 0.041594 0.790158 0.031455 0.036011 0.068363 0.864171 0.059231 0.039818 0.018899 0.882052 0.043647 0.094358 0.688744 0.173252 0.035408 0.042361 0.035742 0.886489 0.051748 0.537307 0.292567 0.118378 0.126963 0.055471 0.154459 0.663106 0.331200 0.325230 0.208031 0.135539 0.283496 0.182056 0.210897 0.323551 0.101736 0.321236 0.224504 0.352524 0.096341 0.318901 0.205859 0.378898 Consensus sequence: HDTMCTTTGTSTVDBB Alignment: HDTMCTTTGTSTVDBB TGRCCTKTGHCCKAB- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00083 Tcf7l2_primary Original Motif Reverse Complement Backward 2 15 0.037976 Species: Mus musculus Original motif 0.285725 0.187143 0.254855 0.272277 0.276264 0.157893 0.258178 0.307665 0.238788 0.161120 0.254018 0.346074 0.076041 0.333901 0.150903 0.439156 0.093376 0.526578 0.180529 0.199517 0.010827 0.880320 0.034150 0.074703 0.016546 0.023834 0.000940 0.958680 0.007166 0.008215 0.001941 0.982678 0.029634 0.001363 0.001379 0.967625 0.010872 0.031751 0.926186 0.031190 0.949407 0.000760 0.002581 0.047253 0.109203 0.001362 0.002094 0.887341 0.044198 0.567994 0.353059 0.034749 0.222623 0.142360 0.041281 0.593736 0.358872 0.167597 0.220534 0.252997 0.233072 0.141480 0.230985 0.394463 0.350703 0.243129 0.233961 0.172207 Consensus sequence: DDDYCCTTTGATSTDDV Reverse complement motif 0.172207 0.243129 0.233961 0.350703 0.394463 0.141480 0.230985 0.233072 0.252997 0.167597 0.220534 0.358872 0.593736 0.142360 0.041281 0.222623 0.044198 0.353059 0.567994 0.034749 0.887341 0.001362 0.002094 0.109203 0.047253 0.000760 0.002581 0.949407 0.010872 0.926186 0.031751 0.031190 0.967625 0.001363 0.001379 0.029634 0.982678 0.008215 0.001941 0.007166 0.958680 0.023834 0.000940 0.016546 0.010827 0.034150 0.880320 0.074703 0.093376 0.180529 0.526578 0.199517 0.439156 0.333901 0.150903 0.076041 0.346074 0.161120 0.254018 0.238788 0.307665 0.157893 0.258178 0.276264 0.272277 0.187143 0.254855 0.285725 Consensus sequence: BDDASATCAAAGGMDDD Alignment: BDDASATCAAAGGMDDD -BTRGGDCARAGGKCA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00093 Klf7_primary Original Motif Reverse Complement Backward 2 15 0.038273 Species: Mus musculus Original motif 0.204514 0.198353 0.171218 0.425915 0.167188 0.296785 0.246082 0.289946 0.267330 0.148001 0.398674 0.185994 0.549386 0.060167 0.337100 0.053347 0.050746 0.900013 0.022169 0.027073 0.037905 0.920332 0.008360 0.033403 0.410356 0.566702 0.016267 0.006675 0.009526 0.982354 0.001060 0.007060 0.204292 0.001084 0.748567 0.046056 0.003955 0.988490 0.002821 0.004735 0.004264 0.988826 0.004311 0.002598 0.002758 0.929549 0.001244 0.066448 0.260332 0.421683 0.024720 0.293265 0.184798 0.247697 0.085237 0.482268 0.347537 0.197344 0.139961 0.315159 0.255281 0.166620 0.242297 0.335802 Consensus sequence: HBDRCCMCGCCCHHHD Reverse complement motif 0.335802 0.166620 0.242297 0.255281 0.315159 0.197344 0.139961 0.347537 0.482268 0.247697 0.085237 0.184798 0.260332 0.024720 0.421683 0.293265 0.002758 0.001244 0.929549 0.066448 0.004264 0.004311 0.988826 0.002598 0.003955 0.002821 0.988490 0.004735 0.204292 0.748567 0.001084 0.046056 0.009526 0.001060 0.982354 0.007060 0.410356 0.016267 0.566702 0.006675 0.037905 0.008360 0.920332 0.033403 0.050746 0.022169 0.900013 0.027073 0.053347 0.060167 0.337100 0.549386 0.267330 0.398674 0.148001 0.185994 0.167188 0.246082 0.296785 0.289946 0.425915 0.198353 0.171218 0.204514 Consensus sequence: DHHDGGGCGRGGKHBH Alignment: DHHDGGGCGRGGKHBH BTRGGDCARAGGKCA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00055 Hbp1_secondary Original Motif Reverse Complement Forward 1 15 0.039717 Species: Mus musculus Original motif 0.313621 0.149049 0.200899 0.336432 0.262644 0.147616 0.334882 0.254859 0.175848 0.137857 0.292272 0.394023 0.045910 0.364107 0.180535 0.409448 0.093235 0.718630 0.093516 0.094619 0.095552 0.724866 0.044589 0.134993 0.058227 0.785149 0.029814 0.126810 0.897368 0.023735 0.019064 0.059832 0.043826 0.041750 0.020731 0.893692 0.044268 0.013557 0.014689 0.927487 0.102208 0.026005 0.709573 0.162214 0.058404 0.046118 0.135257 0.760221 0.303689 0.280676 0.320259 0.095375 0.258633 0.262177 0.197029 0.282161 0.564761 0.122466 0.194691 0.118082 0.104738 0.358061 0.310533 0.226668 0.267450 0.230099 0.197859 0.304593 Consensus sequence: DDDYCCCATTGTVHABH Reverse complement motif 0.304593 0.230099 0.197859 0.267450 0.104738 0.310533 0.358061 0.226668 0.118082 0.122466 0.194691 0.564761 0.282161 0.262177 0.197029 0.258633 0.303689 0.320259 0.280676 0.095375 0.760221 0.046118 0.135257 0.058404 0.102208 0.709573 0.026005 0.162214 0.927487 0.013557 0.014689 0.044268 0.893692 0.041750 0.020731 0.043826 0.059832 0.023735 0.019064 0.897368 0.058227 0.029814 0.785149 0.126810 0.095552 0.044589 0.724866 0.134993 0.093235 0.093516 0.718630 0.094619 0.409448 0.364107 0.180535 0.045910 0.394023 0.137857 0.292272 0.175848 0.262644 0.334882 0.147616 0.254859 0.336432 0.149049 0.200899 0.313621 Consensus sequence: HBTHVACAATGGGMDHD Alignment: DDDYCCCATTGTVHABH BTRGGDCARAGGKCA-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 3 Motif ID: 65 Motif name: Tcfcp2l1 Original motif 0.001968 0.925480 0.062715 0.009838 0.069973 0.807513 0.005401 0.117113 0.594508 0.005148 0.275803 0.124540 0.005884 0.023780 0.967149 0.003187 0.175477 0.336270 0.025698 0.462555 0.098385 0.289280 0.062163 0.550171 0.173924 0.397260 0.151174 0.277642 0.357213 0.224939 0.252323 0.165526 0.631540 0.069682 0.190954 0.107824 0.394421 0.051382 0.310497 0.243700 0.003669 0.933219 0.054795 0.008317 0.061719 0.812148 0.002939 0.123194 0.536555 0.007360 0.305937 0.150147 0.012039 0.028993 0.954791 0.004177 Consensus sequence: CCAGYYHVADCCRG Reserve complement motif 0.012039 0.954791 0.028993 0.004177 0.150147 0.007360 0.305937 0.536555 0.061719 0.002939 0.812148 0.123194 0.003669 0.054795 0.933219 0.008317 0.243700 0.051382 0.310497 0.394421 0.107824 0.069682 0.190954 0.631540 0.165526 0.224939 0.252323 0.357213 0.173924 0.151174 0.397260 0.277642 0.550171 0.289280 0.062163 0.098385 0.462555 0.336270 0.025698 0.175477 0.005884 0.967149 0.023780 0.003187 0.124540 0.005148 0.275803 0.594508 0.069973 0.005401 0.807513 0.117113 0.001968 0.062715 0.925480 0.009838 Consensus sequence: CKGGDTBDMMCTGG ************************************************************************ Best Matches for Motif ID 65 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00032 Gata3_secondary Original Motif Original Motif Backward 5 14 0.052725 Species: Mus musculus Original motif 0.177641 0.319872 0.115137 0.387350 0.136644 0.182137 0.205873 0.475347 0.254263 0.244280 0.165207 0.336250 0.240415 0.207557 0.237497 0.314530 0.271041 0.214702 0.364395 0.149863 0.095475 0.320104 0.191738 0.392682 0.500902 0.142722 0.026556 0.329820 0.051221 0.023698 0.897245 0.027836 0.922410 0.027509 0.024058 0.026023 0.030735 0.070903 0.024248 0.874114 0.242120 0.231992 0.225143 0.300745 0.106956 0.220471 0.283490 0.389083 0.152079 0.165830 0.135066 0.547025 0.839205 0.051581 0.060119 0.049095 0.041204 0.069147 0.070830 0.818819 0.051861 0.848177 0.027599 0.072363 0.383793 0.016807 0.397470 0.201931 0.381899 0.215846 0.255908 0.146347 0.094792 0.358651 0.280905 0.265652 0.296132 0.181545 0.178433 0.343890 0.301997 0.254722 0.108566 0.334714 0.349481 0.270693 0.137507 0.242319 Consensus sequence: HBHDVBWGATHBTATCRVBHHH Reverse complement motif 0.242319 0.270693 0.137507 0.349481 0.334714 0.254722 0.108566 0.301997 0.343890 0.181545 0.178433 0.296132 0.094792 0.280905 0.358651 0.265652 0.146347 0.215846 0.255908 0.381899 0.383793 0.397470 0.016807 0.201931 0.051861 0.027599 0.848177 0.072363 0.818819 0.069147 0.070830 0.041204 0.049095 0.051581 0.060119 0.839205 0.547025 0.165830 0.135066 0.152079 0.389083 0.220471 0.283490 0.106956 0.300745 0.231992 0.225143 0.242120 0.874114 0.070903 0.024248 0.030735 0.026023 0.027509 0.024058 0.922410 0.051221 0.897245 0.023698 0.027836 0.329820 0.142722 0.026556 0.500902 0.392682 0.320104 0.191738 0.095475 0.271041 0.364395 0.214702 0.149863 0.314530 0.207557 0.237497 0.240415 0.336250 0.244280 0.165207 0.254263 0.475347 0.182137 0.205873 0.136644 0.387350 0.319872 0.115137 0.177641 Consensus sequence: HHHBBMGATAVHATCWVVDHVH Alignment: HBHDVBWGATHBTATCRVBHHH ----CCAGYYHVADCCRG---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v016060_secondary Original Motif Original Motif Backward 1 14 0.055169 Species: Mus musculus Original motif 0.533199 0.080715 0.330435 0.055650 0.152031 0.212841 0.110234 0.524893 0.223934 0.264217 0.087037 0.424811 0.115097 0.339994 0.343861 0.201048 0.124993 0.418259 0.365642 0.091106 0.158365 0.292428 0.088361 0.460847 0.165479 0.561778 0.022254 0.250489 0.136873 0.259822 0.579763 0.023543 0.109570 0.747495 0.055128 0.087807 0.061912 0.792986 0.109031 0.036071 0.508703 0.267806 0.169766 0.053725 0.040912 0.838888 0.057470 0.062730 0.330554 0.606077 0.016192 0.047177 0.068079 0.563969 0.029742 0.338209 0.388799 0.291667 0.191284 0.128249 0.183283 0.578079 0.171100 0.067538 0.165163 0.097206 0.631377 0.106253 0.128564 0.435496 0.253275 0.182665 0.103395 0.088222 0.234758 0.573625 0.432879 0.276641 0.155895 0.134585 0.339199 0.148928 0.311036 0.200836 0.211958 0.298526 0.158443 0.331072 Consensus sequence: RTHBSYCGCCMCMYVCGBTVDH Reverse complement motif 0.331072 0.298526 0.158443 0.211958 0.200836 0.148928 0.311036 0.339199 0.134585 0.276641 0.155895 0.432879 0.573625 0.088222 0.234758 0.103395 0.128564 0.253275 0.435496 0.182665 0.165163 0.631377 0.097206 0.106253 0.183283 0.171100 0.578079 0.067538 0.128249 0.291667 0.191284 0.388799 0.068079 0.029742 0.563969 0.338209 0.330554 0.016192 0.606077 0.047177 0.040912 0.057470 0.838888 0.062730 0.053725 0.267806 0.169766 0.508703 0.061912 0.109031 0.792986 0.036071 0.109570 0.055128 0.747495 0.087807 0.136873 0.579763 0.259822 0.023543 0.165479 0.022254 0.561778 0.250489 0.460847 0.292428 0.088361 0.158365 0.124993 0.365642 0.418259 0.091106 0.115097 0.343861 0.339994 0.201048 0.424811 0.264217 0.087037 0.223934 0.524893 0.212841 0.110234 0.152031 0.055650 0.080715 0.330435 0.533199 Consensus sequence: HDBABCGBKRGYGGCGMSBHAK Alignment: RTHBSYCGCCMCMYVCGBTVDH --------CCAGYYHVADCCRG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00005 Tcfap2a_secondary Original Motif Original Motif Forward 1 14 0.056098 Species: Mus musculus Original motif 0.198427 0.243196 0.159241 0.399136 0.267754 0.388187 0.116811 0.227248 0.448284 0.056403 0.414623 0.080691 0.031469 0.826323 0.055436 0.086772 0.035527 0.756642 0.022985 0.184845 0.127338 0.316078 0.155806 0.400778 0.135021 0.313650 0.287760 0.263570 0.418892 0.082297 0.068352 0.430460 0.201062 0.044735 0.711358 0.042845 0.038934 0.022320 0.903763 0.034982 0.201790 0.065554 0.460526 0.272130 0.006890 0.786923 0.061853 0.144334 0.460666 0.103658 0.196452 0.239224 0.092272 0.204611 0.390375 0.312742 Consensus sequence: HHRCCBBWGGDCDB Reverse complement motif 0.092272 0.390375 0.204611 0.312742 0.239224 0.103658 0.196452 0.460666 0.006890 0.061853 0.786923 0.144334 0.201790 0.460526 0.065554 0.272130 0.038934 0.903763 0.022320 0.034982 0.201062 0.711358 0.044735 0.042845 0.430460 0.082297 0.068352 0.418892 0.135021 0.287760 0.313650 0.263570 0.400778 0.316078 0.155806 0.127338 0.035527 0.022985 0.756642 0.184845 0.031469 0.055436 0.826323 0.086772 0.080691 0.056403 0.414623 0.448284 0.267754 0.116811 0.388187 0.227248 0.399136 0.243196 0.159241 0.198427 Consensus sequence: BDGHCCWBVGGKDH Alignment: HHRCCBBWGGDCDB CCAGYYHVADCCRG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00013 Gabpa_secondary Original Motif Original Motif Backward 3 14 0.056647 Species: Mus musculus Original motif 0.233133 0.551828 0.139009 0.076030 0.100085 0.525562 0.101688 0.272665 0.252996 0.198121 0.299171 0.249711 0.141471 0.195290 0.234560 0.428679 0.160993 0.442765 0.082653 0.313590 0.307890 0.127950 0.071713 0.492448 0.093453 0.148935 0.080288 0.677324 0.083535 0.634212 0.074652 0.207601 0.098119 0.639328 0.099957 0.162596 0.067430 0.451776 0.357188 0.123606 0.286259 0.466975 0.063013 0.183753 0.203211 0.422637 0.133368 0.240783 0.111206 0.315595 0.192833 0.380366 0.199462 0.324652 0.305491 0.170395 0.347919 0.292387 0.230724 0.128970 0.254648 0.294196 0.194942 0.256214 Consensus sequence: CYDBYWTCCSMHBVVH Reverse complement motif 0.254648 0.194942 0.294196 0.256214 0.128970 0.292387 0.230724 0.347919 0.199462 0.305491 0.324652 0.170395 0.380366 0.315595 0.192833 0.111206 0.203211 0.133368 0.422637 0.240783 0.286259 0.063013 0.466975 0.183753 0.067430 0.357188 0.451776 0.123606 0.098119 0.099957 0.639328 0.162596 0.083535 0.074652 0.634212 0.207601 0.677324 0.148935 0.080288 0.093453 0.492448 0.127950 0.071713 0.307890 0.160993 0.082653 0.442765 0.313590 0.428679 0.195290 0.234560 0.141471 0.252996 0.299171 0.198121 0.249711 0.100085 0.101688 0.525562 0.272665 0.233133 0.139009 0.551828 0.076030 Consensus sequence: DBVVDRSGGAWKVHKG Alignment: CYDBYWTCCSMHBVVH CCAGYYHVADCCRG-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00075 Sox15_secondary Original Motif Reverse Complement Backward 1 14 0.057764 Species: Mus musculus Original motif 0.110714 0.252497 0.291511 0.345278 0.164622 0.184062 0.190197 0.461119 0.287350 0.199874 0.330362 0.182414 0.616693 0.089218 0.166132 0.127957 0.525717 0.258234 0.059744 0.156305 0.083274 0.096411 0.076805 0.743510 0.049512 0.096815 0.691840 0.161833 0.410479 0.121470 0.156168 0.311883 0.522715 0.308171 0.070073 0.099041 0.708200 0.050818 0.138346 0.102635 0.095092 0.056144 0.158664 0.690100 0.126419 0.145616 0.080224 0.647741 0.167179 0.424187 0.154592 0.254042 0.222121 0.318065 0.377920 0.081893 0.532720 0.168320 0.257188 0.041771 Consensus sequence: BBVAATGDMATTHVA Reverse complement motif 0.041771 0.168320 0.257188 0.532720 0.222121 0.377920 0.318065 0.081893 0.167179 0.154592 0.424187 0.254042 0.647741 0.145616 0.080224 0.126419 0.690100 0.056144 0.158664 0.095092 0.102635 0.050818 0.138346 0.708200 0.099041 0.308171 0.070073 0.522715 0.311883 0.121470 0.156168 0.410479 0.049512 0.691840 0.096815 0.161833 0.743510 0.096411 0.076805 0.083274 0.156305 0.258234 0.059744 0.525717 0.127957 0.089218 0.166132 0.616693 0.287350 0.330362 0.199874 0.182414 0.461119 0.184062 0.190197 0.164622 0.345278 0.252497 0.291511 0.110714 Consensus sequence: TVDAATYDCATTVVV Alignment: BBVAATGDMATTHVA -CCAGYYHVADCCRG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00096 Sox13_secondary Reverse Complement Original Motif Forward 4 14 0.058789 Species: Mus musculus Original motif 0.262581 0.115233 0.405525 0.216661 0.246681 0.142854 0.145056 0.465409 0.341041 0.154355 0.306628 0.197976 0.242211 0.263918 0.113187 0.380684 0.119326 0.241913 0.117198 0.521563 0.054120 0.036135 0.784219 0.125525 0.076634 0.048399 0.788586 0.086381 0.215316 0.044119 0.663927 0.076638 0.248538 0.159141 0.015452 0.576869 0.047049 0.083570 0.788798 0.080583 0.071948 0.035098 0.768849 0.124105 0.123777 0.030383 0.713425 0.132415 0.294760 0.182119 0.181553 0.341567 0.516589 0.129377 0.116698 0.237336 0.350326 0.186505 0.112598 0.350571 0.311469 0.198085 0.147986 0.342460 0.185126 0.130721 0.242572 0.441582 Consensus sequence: DDDHTGGGTGGGHAHHD Reverse complement motif 0.441582 0.130721 0.242572 0.185126 0.342460 0.198085 0.147986 0.311469 0.350571 0.186505 0.112598 0.350326 0.237336 0.129377 0.116698 0.516589 0.341567 0.182119 0.181553 0.294760 0.123777 0.713425 0.030383 0.132415 0.071948 0.768849 0.035098 0.124105 0.047049 0.788798 0.083570 0.080583 0.576869 0.159141 0.015452 0.248538 0.215316 0.663927 0.044119 0.076638 0.076634 0.788586 0.048399 0.086381 0.054120 0.784219 0.036135 0.125525 0.521563 0.241913 0.117198 0.119326 0.380684 0.263918 0.113187 0.242211 0.197976 0.154355 0.306628 0.341041 0.465409 0.142854 0.145056 0.246681 0.262581 0.405525 0.115233 0.216661 Consensus sequence: DHHTHCCCACCCAHDDH Alignment: DDDHTGGGTGGGHAHHD ---CKGGDTBDMMCTGG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00034 Sox7_secondary Original Motif Reverse Complement Forward 3 14 0.059024 Species: Mus musculus Original motif 0.067627 0.131333 0.654425 0.146615 0.156488 0.114442 0.145630 0.583441 0.206450 0.265630 0.358017 0.169903 0.090729 0.460713 0.274712 0.173847 0.285994 0.099998 0.154485 0.459523 0.635908 0.184787 0.072982 0.106323 0.748421 0.039204 0.092605 0.119769 0.081342 0.061327 0.044532 0.812799 0.143120 0.043879 0.024216 0.788785 0.247544 0.092102 0.621453 0.038901 0.295531 0.036295 0.027594 0.640580 0.194561 0.305468 0.339916 0.160055 0.175038 0.193568 0.101212 0.530182 0.145226 0.167488 0.559871 0.127415 0.271501 0.237429 0.206701 0.284369 0.216834 0.109191 0.569605 0.104370 0.182624 0.177160 0.300475 0.339742 0.331737 0.198645 0.265137 0.204482 0.230155 0.359365 0.183450 0.227029 0.056581 0.067297 0.463052 0.413070 0.198891 0.324626 0.304424 0.172059 0.181968 0.287547 0.202419 0.328066 Consensus sequence: GTVBDAATTGTVTGHGDDHKVB Reverse complement motif 0.328066 0.287547 0.202419 0.181968 0.198891 0.304424 0.324626 0.172059 0.056581 0.463052 0.067297 0.413070 0.230155 0.183450 0.359365 0.227029 0.204482 0.198645 0.265137 0.331737 0.339742 0.177160 0.300475 0.182624 0.216834 0.569605 0.109191 0.104370 0.284369 0.237429 0.206701 0.271501 0.145226 0.559871 0.167488 0.127415 0.530182 0.193568 0.101212 0.175038 0.194561 0.339916 0.305468 0.160055 0.640580 0.036295 0.027594 0.295531 0.247544 0.621453 0.092102 0.038901 0.788785 0.043879 0.024216 0.143120 0.812799 0.061327 0.044532 0.081342 0.119769 0.039204 0.092605 0.748421 0.106323 0.184787 0.072982 0.635908 0.459523 0.099998 0.154485 0.285994 0.090729 0.274712 0.460713 0.173847 0.206450 0.358017 0.265630 0.169903 0.583441 0.114442 0.145630 0.156488 0.067627 0.654425 0.131333 0.146615 Consensus sequence: VVYDDDCHCAVACAATTDBVAC Alignment: VVYDDDCHCAVACAATTDBVAC --CCAGYYHVADCCRG------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v016060_secondary Original Motif Original Motif Forward 9 14 0.059690 Species: Mus musculus Original motif 0.168550 0.345968 0.396524 0.088958 0.038113 0.360882 0.114042 0.486963 0.349356 0.180599 0.051416 0.418629 0.258773 0.332518 0.244932 0.163778 0.371663 0.208591 0.263136 0.156609 0.225440 0.321741 0.175932 0.276887 0.100827 0.656850 0.018644 0.223679 0.494140 0.155427 0.327424 0.023009 0.105642 0.805846 0.027712 0.060800 0.065110 0.845072 0.058046 0.031772 0.649343 0.110180 0.180680 0.059797 0.064269 0.853604 0.066860 0.015268 0.437421 0.533797 0.016833 0.011948 0.121694 0.787708 0.016177 0.074421 0.625382 0.066925 0.266070 0.041623 0.117819 0.608153 0.165139 0.108889 0.145639 0.102001 0.604926 0.147434 0.521188 0.184986 0.064607 0.229219 0.180371 0.274237 0.096591 0.448801 0.071055 0.455813 0.332817 0.140315 0.084503 0.199982 0.448293 0.267222 0.389451 0.169545 0.155507 0.285497 0.424314 0.227621 0.101210 0.246855 Consensus sequence: VYWVVHCRCCACMCACGAHSBHH Reverse complement motif 0.246855 0.227621 0.101210 0.424314 0.285497 0.169545 0.155507 0.389451 0.084503 0.448293 0.199982 0.267222 0.071055 0.332817 0.455813 0.140315 0.448801 0.274237 0.096591 0.180371 0.229219 0.184986 0.064607 0.521188 0.145639 0.604926 0.102001 0.147434 0.117819 0.165139 0.608153 0.108889 0.041623 0.066925 0.266070 0.625382 0.121694 0.016177 0.787708 0.074421 0.437421 0.016833 0.533797 0.011948 0.064269 0.066860 0.853604 0.015268 0.059797 0.110180 0.180680 0.649343 0.065110 0.058046 0.845072 0.031772 0.105642 0.027712 0.805846 0.060800 0.023009 0.155427 0.327424 0.494140 0.100827 0.018644 0.656850 0.223679 0.225440 0.175932 0.321741 0.276887 0.156609 0.208591 0.263136 0.371663 0.258773 0.244932 0.332518 0.163778 0.418629 0.180599 0.051416 0.349356 0.486963 0.360882 0.114042 0.038113 0.168550 0.396524 0.345968 0.088958 Consensus sequence: HHBSHTCGTGRGTGGKGDBVWMV Alignment: VYWVVHCRCCACMCACGAHSBHH --------CCAGYYHVADCCRG- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v015681_primary Original Motif Original Motif Backward 1 14 0.059769 Species: Mus musculus Original motif 0.183797 0.268049 0.330111 0.218043 0.127599 0.330310 0.243614 0.298477 0.143199 0.188046 0.268593 0.400162 0.214690 0.205230 0.247090 0.332990 0.294688 0.299104 0.327152 0.079056 0.221909 0.193223 0.480155 0.104712 0.444072 0.068239 0.481838 0.005852 0.006182 0.015429 0.901278 0.077111 0.766535 0.111138 0.121632 0.000696 0.014848 0.973961 0.000298 0.010893 0.001807 0.992200 0.002669 0.003324 0.795344 0.140510 0.018576 0.045571 0.006990 0.988200 0.002510 0.002299 0.154898 0.842296 0.000998 0.001808 0.029577 0.919262 0.006935 0.044226 0.677987 0.032075 0.185065 0.104874 0.195132 0.364580 0.319321 0.120967 0.225412 0.115034 0.612849 0.046705 0.548628 0.058900 0.162857 0.229616 0.112531 0.340331 0.165910 0.381227 0.073029 0.303078 0.363896 0.259997 0.561485 0.260567 0.092979 0.084969 0.132283 0.457691 0.140159 0.269867 Consensus sequence: BBBDVVRGACCACCCAVGABBAB Reverse complement motif 0.132283 0.140159 0.457691 0.269867 0.084969 0.260567 0.092979 0.561485 0.073029 0.363896 0.303078 0.259997 0.381227 0.340331 0.165910 0.112531 0.229616 0.058900 0.162857 0.548628 0.225412 0.612849 0.115034 0.046705 0.195132 0.319321 0.364580 0.120967 0.104874 0.032075 0.185065 0.677987 0.029577 0.006935 0.919262 0.044226 0.154898 0.000998 0.842296 0.001808 0.006990 0.002510 0.988200 0.002299 0.045571 0.140510 0.018576 0.795344 0.001807 0.002669 0.992200 0.003324 0.014848 0.000298 0.973961 0.010893 0.000696 0.111138 0.121632 0.766535 0.006182 0.901278 0.015429 0.077111 0.444072 0.481838 0.068239 0.005852 0.221909 0.480155 0.193223 0.104712 0.294688 0.327152 0.299104 0.079056 0.332990 0.205230 0.247090 0.214690 0.400162 0.188046 0.268593 0.143199 0.127599 0.243614 0.330310 0.298477 0.183797 0.330111 0.268049 0.218043 Consensus sequence: BTBVTCVTGGGTGGTCMVVDVBB Alignment: BBBDVVRGACCACCCAVGABBAB ---------CCAGYYHVADCCRG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v015681_secondary Reverse Complement Original Motif Backward 2 14 0.059836 Species: Mus musculus Original motif 0.331499 0.188505 0.182841 0.297156 0.328961 0.213025 0.273530 0.184484 0.197213 0.129292 0.524914 0.148581 0.274491 0.226406 0.312118 0.186986 0.103231 0.393726 0.364988 0.138055 0.552594 0.166422 0.186262 0.094722 0.157618 0.064773 0.616497 0.161112 0.139166 0.176098 0.621185 0.063551 0.748420 0.062398 0.012447 0.176735 0.116584 0.009438 0.860326 0.013653 0.005030 0.003646 0.974877 0.016447 0.055257 0.007181 0.921760 0.015802 0.032748 0.058249 0.052709 0.856293 0.105606 0.872231 0.014370 0.007793 0.019480 0.497379 0.125899 0.357242 0.478582 0.269713 0.061464 0.190242 0.253985 0.287006 0.201320 0.257689 0.319384 0.210231 0.175842 0.294543 0.222123 0.287802 0.201294 0.288782 0.139951 0.376041 0.081133 0.402875 0.213450 0.343835 0.383676 0.059039 0.322294 0.355918 0.148062 0.173725 Consensus sequence: HVGVSAGGAGGGTCYHHHHYVH Reverse complement motif 0.322294 0.148062 0.355918 0.173725 0.213450 0.383676 0.343835 0.059039 0.402875 0.376041 0.081133 0.139951 0.288782 0.287802 0.201294 0.222123 0.294543 0.210231 0.175842 0.319384 0.253985 0.201320 0.287006 0.257689 0.190242 0.269713 0.061464 0.478582 0.019480 0.125899 0.497379 0.357242 0.105606 0.014370 0.872231 0.007793 0.856293 0.058249 0.052709 0.032748 0.055257 0.921760 0.007181 0.015802 0.005030 0.974877 0.003646 0.016447 0.116584 0.860326 0.009438 0.013653 0.176735 0.062398 0.012447 0.748420 0.139166 0.621185 0.176098 0.063551 0.157618 0.616497 0.064773 0.161112 0.094722 0.166422 0.186262 0.552594 0.103231 0.364988 0.393726 0.138055 0.274491 0.312118 0.226406 0.186986 0.197213 0.524914 0.129292 0.148581 0.184484 0.213025 0.273530 0.328961 0.297156 0.188505 0.182841 0.331499 Consensus sequence: DVMHHDHKGACCCTCCTSVCBH Alignment: HVGVSAGGAGGGTCYHHHHYVH -------CKGGDTBDMMCTGG- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 3 Motif ID: 66 Motif name: CTCF Original motif 0.095290 0.318729 0.083242 0.502738 0.182913 0.158817 0.453450 0.204819 0.307777 0.053669 0.491785 0.146769 0.061336 0.876232 0.023001 0.039430 0.008762 0.989047 0.000000 0.002191 0.814896 0.014239 0.071194 0.099671 0.043812 0.578313 0.365827 0.012048 0.117325 0.474781 0.052632 0.355263 0.933114 0.012061 0.035088 0.019737 0.005488 0.000000 0.991218 0.003293 0.365532 0.003293 0.621295 0.009879 0.059276 0.013172 0.553238 0.374314 0.013187 0.000000 0.978022 0.008791 0.061538 0.008791 0.851648 0.078022 0.114411 0.806381 0.005501 0.073707 0.409241 0.014301 0.557756 0.018702 0.090308 0.530837 0.338106 0.040749 0.128855 0.354626 0.080396 0.436123 0.442731 0.199339 0.292952 0.064978 Consensus sequence: YDRCCASYAGRKGGCRSYV Reserve complement motif 0.064978 0.199339 0.292952 0.442731 0.436123 0.354626 0.080396 0.128855 0.090308 0.338106 0.530837 0.040749 0.409241 0.557756 0.014301 0.018702 0.114411 0.005501 0.806381 0.073707 0.061538 0.851648 0.008791 0.078022 0.013187 0.978022 0.000000 0.008791 0.059276 0.553238 0.013172 0.374314 0.365532 0.621295 0.003293 0.009879 0.005488 0.991218 0.000000 0.003293 0.019737 0.012061 0.035088 0.933114 0.117325 0.052632 0.474781 0.355263 0.043812 0.365827 0.578313 0.012048 0.099671 0.014239 0.071194 0.814896 0.008762 0.000000 0.989047 0.002191 0.061336 0.023001 0.876232 0.039430 0.307777 0.491785 0.053669 0.146769 0.182913 0.453450 0.158817 0.204819 0.502738 0.318729 0.083242 0.095290 Consensus sequence: BMSMGCCYMCTKSTGGMHM ************************************************************************ Best Matches for Motif ID 66 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00400 Zif268 Reverse Complement Original Motif Backward 1 19 0.040937 Species: Mus musculus Original motif 0.104824 0.412716 0.254506 0.227955 0.644922 0.065476 0.140479 0.149122 0.201205 0.166164 0.347131 0.285501 0.360606 0.256316 0.150766 0.232313 0.199831 0.240681 0.279350 0.280137 0.234308 0.204076 0.321306 0.240310 0.274112 0.462435 0.111425 0.152028 0.067070 0.717501 0.073934 0.141496 0.106745 0.084442 0.658566 0.150247 0.025128 0.967053 0.003585 0.004234 0.006412 0.982989 0.003227 0.007371 0.009588 0.877620 0.002571 0.110221 0.621521 0.355443 0.015669 0.007366 0.002600 0.980275 0.004191 0.012934 0.118773 0.026658 0.783843 0.070725 0.022358 0.822101 0.024684 0.130857 0.713212 0.080912 0.128793 0.077084 0.166568 0.250955 0.107934 0.474544 0.225040 0.222494 0.163301 0.389166 0.268976 0.223206 0.265314 0.242504 0.137052 0.229058 0.148439 0.485451 0.135819 0.304550 0.141994 0.417637 0.272440 0.319501 0.230580 0.177478 Consensus sequence: BADHBDHCGCCCMCGCAHHDBBV Reverse complement motif 0.272440 0.230580 0.319501 0.177478 0.417637 0.304550 0.141994 0.135819 0.485451 0.229058 0.148439 0.137052 0.242504 0.223206 0.265314 0.268976 0.389166 0.222494 0.163301 0.225040 0.474544 0.250955 0.107934 0.166568 0.077084 0.080912 0.128793 0.713212 0.022358 0.024684 0.822101 0.130857 0.118773 0.783843 0.026658 0.070725 0.002600 0.004191 0.980275 0.012934 0.007366 0.355443 0.015669 0.621521 0.009588 0.002571 0.877620 0.110221 0.006412 0.003227 0.982989 0.007371 0.025128 0.003585 0.967053 0.004234 0.106745 0.658566 0.084442 0.150247 0.067070 0.073934 0.717501 0.141496 0.274112 0.111425 0.462435 0.152028 0.234308 0.321306 0.204076 0.240310 0.280137 0.240681 0.279350 0.199831 0.232313 0.256316 0.150766 0.360606 0.201205 0.347131 0.166164 0.285501 0.149122 0.065476 0.140479 0.644922 0.104824 0.254506 0.412716 0.227955 Consensus sequence: VVVDHHTGCGYGGGCGDHVHHTB Alignment: VVVDHHTGCGYGGGCGDHVHHTB ----BMSMGCCYMCTKSTGGMHM ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v016060_secondary Original Motif Original Motif Backward 4 19 0.040982 Species: Mus musculus Original motif 0.319838 0.171199 0.138099 0.370865 0.269358 0.196600 0.346909 0.187133 0.176807 0.338888 0.193903 0.290402 0.230268 0.119645 0.310500 0.339587 0.517372 0.257658 0.111673 0.113296 0.159477 0.126524 0.561119 0.152879 0.117072 0.553013 0.130919 0.198996 0.073372 0.163548 0.525014 0.238066 0.143608 0.186896 0.170528 0.498967 0.054943 0.079034 0.722992 0.143031 0.048852 0.015134 0.852458 0.083556 0.029001 0.023938 0.918900 0.028160 0.036727 0.092645 0.090591 0.780037 0.017757 0.057598 0.895222 0.029423 0.026113 0.048113 0.879744 0.046030 0.023041 0.787043 0.123490 0.066426 0.579766 0.004868 0.296873 0.118493 0.303862 0.042931 0.290151 0.363055 0.099672 0.237431 0.262301 0.400597 0.217788 0.163908 0.367628 0.250676 0.450783 0.141108 0.226137 0.181972 0.485086 0.102553 0.242662 0.169700 0.109057 0.454222 0.145665 0.291056 Consensus sequence: HVBDAGCGBGGGTGGCRDBDDDB Reverse complement motif 0.109057 0.145665 0.454222 0.291056 0.169700 0.102553 0.242662 0.485086 0.181972 0.141108 0.226137 0.450783 0.217788 0.367628 0.163908 0.250676 0.400597 0.237431 0.262301 0.099672 0.363055 0.042931 0.290151 0.303862 0.118493 0.004868 0.296873 0.579766 0.023041 0.123490 0.787043 0.066426 0.026113 0.879744 0.048113 0.046030 0.017757 0.895222 0.057598 0.029423 0.780037 0.092645 0.090591 0.036727 0.029001 0.918900 0.023938 0.028160 0.048852 0.852458 0.015134 0.083556 0.054943 0.722992 0.079034 0.143031 0.498967 0.186896 0.170528 0.143608 0.073372 0.525014 0.163548 0.238066 0.117072 0.130919 0.553013 0.198996 0.159477 0.561119 0.126524 0.152879 0.113296 0.257658 0.111673 0.517372 0.339587 0.119645 0.310500 0.230268 0.176807 0.193903 0.338888 0.290402 0.269358 0.346909 0.196600 0.187133 0.370865 0.171199 0.138099 0.319838 Consensus sequence: BDDHVDKGCCACCCVCGCTDBVH Alignment: HVBDAGCGBGGGTGGCRDBDDDB -YDRCCASYAGRKGGCRSYV--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v015681_secondary Reverse Complement Reverse Complement Backward 1 19 0.043195 Species: Mus musculus Original motif 0.214165 0.143436 0.372522 0.269876 0.314445 0.406003 0.160351 0.119201 0.137147 0.092924 0.042921 0.727007 0.044121 0.072843 0.051741 0.831295 0.261292 0.324124 0.298498 0.116086 0.258125 0.323243 0.263362 0.155271 0.204557 0.589399 0.107153 0.098891 0.371021 0.244027 0.291102 0.093849 0.096327 0.572718 0.011797 0.319159 0.027282 0.046183 0.844519 0.082016 0.018921 0.012887 0.915917 0.052275 0.364793 0.166722 0.084229 0.384256 0.028216 0.011233 0.951056 0.009495 0.054974 0.004738 0.890377 0.049911 0.006802 0.312915 0.134247 0.546036 0.241289 0.628210 0.104788 0.025713 0.237863 0.302807 0.213018 0.246311 0.349399 0.203220 0.086635 0.360746 0.386634 0.144693 0.246895 0.221779 0.425101 0.354676 0.093374 0.126849 0.060272 0.391320 0.104905 0.443503 0.162090 0.190233 0.227433 0.420244 Consensus sequence: DVTTVVCVYGGHGGYCHHDMYB Reverse complement motif 0.420244 0.190233 0.227433 0.162090 0.443503 0.391320 0.104905 0.060272 0.126849 0.354676 0.093374 0.425101 0.221779 0.144693 0.246895 0.386634 0.360746 0.203220 0.086635 0.349399 0.237863 0.213018 0.302807 0.246311 0.241289 0.104788 0.628210 0.025713 0.546036 0.312915 0.134247 0.006802 0.054974 0.890377 0.004738 0.049911 0.028216 0.951056 0.011233 0.009495 0.384256 0.166722 0.084229 0.364793 0.018921 0.915917 0.012887 0.052275 0.027282 0.844519 0.046183 0.082016 0.096327 0.011797 0.572718 0.319159 0.093849 0.244027 0.291102 0.371021 0.204557 0.107153 0.589399 0.098891 0.258125 0.263362 0.323243 0.155271 0.261292 0.298498 0.324124 0.116086 0.831295 0.072843 0.051741 0.044121 0.727007 0.092924 0.042921 0.137147 0.314445 0.160351 0.406003 0.119201 0.214165 0.372522 0.143436 0.269876 Consensus sequence: VMYDHDGMCCHCCKBGVVAAVH Alignment: VMYDHDGMCCHCCKBGVVAAVH ---BMSMGCCYMCTKSTGGMHM ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v016060_secondary Reverse Complement Original Motif Forward 4 19 0.046979 Species: Mus musculus Original motif 0.533199 0.080715 0.330435 0.055650 0.152031 0.212841 0.110234 0.524893 0.223934 0.264217 0.087037 0.424811 0.115097 0.339994 0.343861 0.201048 0.124993 0.418259 0.365642 0.091106 0.158365 0.292428 0.088361 0.460847 0.165479 0.561778 0.022254 0.250489 0.136873 0.259822 0.579763 0.023543 0.109570 0.747495 0.055128 0.087807 0.061912 0.792986 0.109031 0.036071 0.508703 0.267806 0.169766 0.053725 0.040912 0.838888 0.057470 0.062730 0.330554 0.606077 0.016192 0.047177 0.068079 0.563969 0.029742 0.338209 0.388799 0.291667 0.191284 0.128249 0.183283 0.578079 0.171100 0.067538 0.165163 0.097206 0.631377 0.106253 0.128564 0.435496 0.253275 0.182665 0.103395 0.088222 0.234758 0.573625 0.432879 0.276641 0.155895 0.134585 0.339199 0.148928 0.311036 0.200836 0.211958 0.298526 0.158443 0.331072 Consensus sequence: RTHBSYCGCCMCMYVCGBTVDH Reverse complement motif 0.331072 0.298526 0.158443 0.211958 0.200836 0.148928 0.311036 0.339199 0.134585 0.276641 0.155895 0.432879 0.573625 0.088222 0.234758 0.103395 0.128564 0.253275 0.435496 0.182665 0.165163 0.631377 0.097206 0.106253 0.183283 0.171100 0.578079 0.067538 0.128249 0.291667 0.191284 0.388799 0.068079 0.029742 0.563969 0.338209 0.330554 0.016192 0.606077 0.047177 0.040912 0.057470 0.838888 0.062730 0.053725 0.267806 0.169766 0.508703 0.061912 0.109031 0.792986 0.036071 0.109570 0.055128 0.747495 0.087807 0.136873 0.579763 0.259822 0.023543 0.165479 0.022254 0.561778 0.250489 0.460847 0.292428 0.088361 0.158365 0.124993 0.365642 0.418259 0.091106 0.115097 0.343861 0.339994 0.201048 0.424811 0.264217 0.087037 0.223934 0.524893 0.212841 0.110234 0.152031 0.055650 0.080715 0.330435 0.533199 Consensus sequence: HDBABCGBKRGYGGCGMSBHAK Alignment: RTHBSYCGCCMCMYVCGBTVDH ---BMSMGCCYMCTKSTGGMHM ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v016060_primary Original Motif Original Motif Backward 5 19 0.048220 Species: Mus musculus Original motif 0.204923 0.208846 0.365383 0.220848 0.294304 0.300143 0.167287 0.238266 0.109711 0.619514 0.117379 0.153396 0.178979 0.378580 0.230177 0.212264 0.159594 0.542602 0.118178 0.179627 0.125206 0.430074 0.151826 0.292894 0.097692 0.709845 0.116956 0.075506 0.148292 0.565912 0.037632 0.248164 0.077951 0.034190 0.855503 0.032356 0.001657 0.001061 0.971877 0.025405 0.001926 0.001084 0.991712 0.005278 0.033031 0.012001 0.057796 0.897171 0.002723 0.002647 0.993348 0.001281 0.003261 0.000963 0.987199 0.008577 0.000611 0.090925 0.074857 0.833608 0.015299 0.978878 0.004949 0.000874 0.013368 0.600902 0.033485 0.352245 0.231949 0.149575 0.118804 0.499672 0.267580 0.186002 0.371242 0.175176 0.264884 0.223483 0.110082 0.401551 0.221365 0.170121 0.179559 0.428955 0.112997 0.692930 0.139981 0.054092 0.460305 0.207883 0.155111 0.176702 Consensus sequence: BHCBCBCCGGGTGGTCYHVHDCH Reverse complement motif 0.176702 0.207883 0.155111 0.460305 0.112997 0.139981 0.692930 0.054092 0.428955 0.170121 0.179559 0.221365 0.401551 0.223483 0.110082 0.264884 0.267580 0.371242 0.186002 0.175176 0.499672 0.149575 0.118804 0.231949 0.013368 0.033485 0.600902 0.352245 0.015299 0.004949 0.978878 0.000874 0.833608 0.090925 0.074857 0.000611 0.003261 0.987199 0.000963 0.008577 0.002723 0.993348 0.002647 0.001281 0.897171 0.012001 0.057796 0.033031 0.001926 0.991712 0.001084 0.005278 0.001657 0.971877 0.001061 0.025405 0.077951 0.855503 0.034190 0.032356 0.148292 0.037632 0.565912 0.248164 0.097692 0.116956 0.709845 0.075506 0.125206 0.151826 0.430074 0.292894 0.159594 0.118178 0.542602 0.179627 0.178979 0.230177 0.378580 0.212264 0.109711 0.117379 0.619514 0.153396 0.294304 0.167287 0.300143 0.238266 0.204923 0.365383 0.208846 0.220848 Consensus sequence: HGDHVHKGACCACCCGGBGBGDB Alignment: BHCBCBCCGGGTGGTCYHVHDCH YDRCCASYAGRKGGCRSYV---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v016060_secondary Original Motif Reverse Complement Backward 4 19 0.049160 Species: Mus musculus Original motif 0.168550 0.345968 0.396524 0.088958 0.038113 0.360882 0.114042 0.486963 0.349356 0.180599 0.051416 0.418629 0.258773 0.332518 0.244932 0.163778 0.371663 0.208591 0.263136 0.156609 0.225440 0.321741 0.175932 0.276887 0.100827 0.656850 0.018644 0.223679 0.494140 0.155427 0.327424 0.023009 0.105642 0.805846 0.027712 0.060800 0.065110 0.845072 0.058046 0.031772 0.649343 0.110180 0.180680 0.059797 0.064269 0.853604 0.066860 0.015268 0.437421 0.533797 0.016833 0.011948 0.121694 0.787708 0.016177 0.074421 0.625382 0.066925 0.266070 0.041623 0.117819 0.608153 0.165139 0.108889 0.145639 0.102001 0.604926 0.147434 0.521188 0.184986 0.064607 0.229219 0.180371 0.274237 0.096591 0.448801 0.071055 0.455813 0.332817 0.140315 0.084503 0.199982 0.448293 0.267222 0.389451 0.169545 0.155507 0.285497 0.424314 0.227621 0.101210 0.246855 Consensus sequence: VYWVVHCRCCACMCACGAHSBHH Reverse complement motif 0.246855 0.227621 0.101210 0.424314 0.285497 0.169545 0.155507 0.389451 0.084503 0.448293 0.199982 0.267222 0.071055 0.332817 0.455813 0.140315 0.448801 0.274237 0.096591 0.180371 0.229219 0.184986 0.064607 0.521188 0.145639 0.604926 0.102001 0.147434 0.117819 0.165139 0.608153 0.108889 0.041623 0.066925 0.266070 0.625382 0.121694 0.016177 0.787708 0.074421 0.437421 0.016833 0.533797 0.011948 0.064269 0.066860 0.853604 0.015268 0.059797 0.110180 0.180680 0.649343 0.065110 0.058046 0.845072 0.031772 0.105642 0.027712 0.805846 0.060800 0.023009 0.155427 0.327424 0.494140 0.100827 0.018644 0.656850 0.223679 0.225440 0.175932 0.321741 0.276887 0.156609 0.208591 0.263136 0.371663 0.258773 0.244932 0.332518 0.163778 0.418629 0.180599 0.051416 0.349356 0.486963 0.360882 0.114042 0.038113 0.168550 0.396524 0.345968 0.088958 Consensus sequence: HHBSHTCGTGRGTGGKGDBVWMV Alignment: HHBSHTCGTGRGTGGKGDBVWMV -YDRCCASYAGRKGGCRSYV--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v015681_primary Reverse Complement Original Motif Backward 2 19 0.051154 Species: Mus musculus Original motif 0.183797 0.268049 0.330111 0.218043 0.127599 0.330310 0.243614 0.298477 0.143199 0.188046 0.268593 0.400162 0.214690 0.205230 0.247090 0.332990 0.294688 0.299104 0.327152 0.079056 0.221909 0.193223 0.480155 0.104712 0.444072 0.068239 0.481838 0.005852 0.006182 0.015429 0.901278 0.077111 0.766535 0.111138 0.121632 0.000696 0.014848 0.973961 0.000298 0.010893 0.001807 0.992200 0.002669 0.003324 0.795344 0.140510 0.018576 0.045571 0.006990 0.988200 0.002510 0.002299 0.154898 0.842296 0.000998 0.001808 0.029577 0.919262 0.006935 0.044226 0.677987 0.032075 0.185065 0.104874 0.195132 0.364580 0.319321 0.120967 0.225412 0.115034 0.612849 0.046705 0.548628 0.058900 0.162857 0.229616 0.112531 0.340331 0.165910 0.381227 0.073029 0.303078 0.363896 0.259997 0.561485 0.260567 0.092979 0.084969 0.132283 0.457691 0.140159 0.269867 Consensus sequence: BBBDVVRGACCACCCAVGABBAB Reverse complement motif 0.132283 0.140159 0.457691 0.269867 0.084969 0.260567 0.092979 0.561485 0.073029 0.363896 0.303078 0.259997 0.381227 0.340331 0.165910 0.112531 0.229616 0.058900 0.162857 0.548628 0.225412 0.612849 0.115034 0.046705 0.195132 0.319321 0.364580 0.120967 0.104874 0.032075 0.185065 0.677987 0.029577 0.006935 0.919262 0.044226 0.154898 0.000998 0.842296 0.001808 0.006990 0.002510 0.988200 0.002299 0.045571 0.140510 0.018576 0.795344 0.001807 0.002669 0.992200 0.003324 0.014848 0.000298 0.973961 0.010893 0.000696 0.111138 0.121632 0.766535 0.006182 0.901278 0.015429 0.077111 0.444072 0.481838 0.068239 0.005852 0.221909 0.480155 0.193223 0.104712 0.294688 0.327152 0.299104 0.079056 0.332990 0.205230 0.247090 0.214690 0.400162 0.188046 0.268593 0.143199 0.127599 0.243614 0.330310 0.298477 0.183797 0.330111 0.268049 0.218043 Consensus sequence: BTBVTCVTGGGTGGTCMVVDVBB Alignment: BBBDVVRGACCACCCAVGABBAB ---BMSMGCCYMCTKSTGGMHM- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v015681_secondary Original Motif Original Motif Forward 1 19 0.052074 Species: Mus musculus Original motif 0.331499 0.188505 0.182841 0.297156 0.328961 0.213025 0.273530 0.184484 0.197213 0.129292 0.524914 0.148581 0.274491 0.226406 0.312118 0.186986 0.103231 0.393726 0.364988 0.138055 0.552594 0.166422 0.186262 0.094722 0.157618 0.064773 0.616497 0.161112 0.139166 0.176098 0.621185 0.063551 0.748420 0.062398 0.012447 0.176735 0.116584 0.009438 0.860326 0.013653 0.005030 0.003646 0.974877 0.016447 0.055257 0.007181 0.921760 0.015802 0.032748 0.058249 0.052709 0.856293 0.105606 0.872231 0.014370 0.007793 0.019480 0.497379 0.125899 0.357242 0.478582 0.269713 0.061464 0.190242 0.253985 0.287006 0.201320 0.257689 0.319384 0.210231 0.175842 0.294543 0.222123 0.287802 0.201294 0.288782 0.139951 0.376041 0.081133 0.402875 0.213450 0.343835 0.383676 0.059039 0.322294 0.355918 0.148062 0.173725 Consensus sequence: HVGVSAGGAGGGTCYHHHHYVH Reverse complement motif 0.322294 0.148062 0.355918 0.173725 0.213450 0.383676 0.343835 0.059039 0.402875 0.376041 0.081133 0.139951 0.288782 0.287802 0.201294 0.222123 0.294543 0.210231 0.175842 0.319384 0.253985 0.201320 0.287006 0.257689 0.190242 0.269713 0.061464 0.478582 0.019480 0.125899 0.497379 0.357242 0.105606 0.014370 0.872231 0.007793 0.856293 0.058249 0.052709 0.032748 0.055257 0.921760 0.007181 0.015802 0.005030 0.974877 0.003646 0.016447 0.116584 0.860326 0.009438 0.013653 0.176735 0.062398 0.012447 0.748420 0.139166 0.621185 0.176098 0.063551 0.157618 0.616497 0.064773 0.161112 0.094722 0.166422 0.186262 0.552594 0.103231 0.364988 0.393726 0.138055 0.274491 0.312118 0.226406 0.186986 0.197213 0.524914 0.129292 0.148581 0.184484 0.213025 0.273530 0.328961 0.297156 0.188505 0.182841 0.331499 Consensus sequence: DVMHHDHKGACCCTCCTSVCBH Alignment: HVGVSAGGAGGGTCYHHHHYVH YDRCCASYAGRKGGCRSYV--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v015681_secondary Original Motif Reverse Complement Backward 5 19 0.053233 Species: Mus musculus Original motif 0.404007 0.395873 0.173319 0.026801 0.305977 0.215534 0.215359 0.263130 0.370148 0.250957 0.113088 0.265808 0.324336 0.229498 0.174679 0.271487 0.263563 0.137896 0.079217 0.519324 0.265762 0.222582 0.082555 0.429102 0.206721 0.288405 0.017851 0.487023 0.164361 0.236500 0.061051 0.538088 0.593344 0.348446 0.050304 0.007906 0.031328 0.947050 0.007032 0.014590 0.010428 0.956605 0.029142 0.003825 0.459636 0.207616 0.155368 0.177380 0.014573 0.964608 0.012209 0.008610 0.066291 0.918196 0.008729 0.006784 0.019488 0.866774 0.018897 0.094841 0.767405 0.104198 0.029234 0.099164 0.052494 0.772531 0.039832 0.135142 0.296085 0.243498 0.350935 0.109482 0.518843 0.226659 0.124784 0.129714 0.647901 0.019721 0.159901 0.172477 0.113912 0.231511 0.214864 0.439713 0.223117 0.310596 0.293328 0.172959 0.185557 0.487662 0.136321 0.190459 Consensus sequence: MHHHWHYTMCCHCCCACVAABVH Reverse complement motif 0.185557 0.136321 0.487662 0.190459 0.223117 0.293328 0.310596 0.172959 0.439713 0.231511 0.214864 0.113912 0.172477 0.019721 0.159901 0.647901 0.129714 0.226659 0.124784 0.518843 0.296085 0.350935 0.243498 0.109482 0.052494 0.039832 0.772531 0.135142 0.099164 0.104198 0.029234 0.767405 0.019488 0.018897 0.866774 0.094841 0.066291 0.008729 0.918196 0.006784 0.014573 0.012209 0.964608 0.008610 0.177380 0.207616 0.155368 0.459636 0.010428 0.029142 0.956605 0.003825 0.031328 0.007032 0.947050 0.014590 0.007906 0.348446 0.050304 0.593344 0.538088 0.236500 0.061051 0.164361 0.487023 0.288405 0.017851 0.206721 0.429102 0.222582 0.082555 0.265762 0.519324 0.137896 0.079217 0.263563 0.271487 0.229498 0.174679 0.324336 0.265808 0.250957 0.113088 0.370148 0.263130 0.215534 0.215359 0.305977 0.026801 0.395873 0.173319 0.404007 Consensus sequence: DVVTTVGTGGGHGGYAMHWHHHY Alignment: DVVTTVGTGGGHGGYAMHWHHHY YDRCCASYAGRKGGCRSYV---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00050 Bhlhb2_secondary Reverse Complement Reverse Complement Forward 3 19 0.053568 Species: Mus musculus Original motif 0.120938 0.344851 0.124072 0.410138 0.220931 0.169844 0.422396 0.186829 0.127752 0.260812 0.103811 0.507625 0.140641 0.405473 0.287668 0.166218 0.296957 0.155579 0.301094 0.246370 0.219647 0.287193 0.154072 0.339087 0.049294 0.026059 0.121789 0.802859 0.520042 0.289284 0.173423 0.017251 0.049190 0.943472 0.004308 0.003030 0.902609 0.006767 0.074770 0.015854 0.003221 0.971329 0.005512 0.019937 0.019937 0.005512 0.971329 0.003221 0.015854 0.074770 0.006767 0.902609 0.003030 0.004308 0.943472 0.049190 0.003497 0.088920 0.685942 0.221641 0.802859 0.121789 0.026059 0.049294 0.334544 0.155170 0.275193 0.235092 0.275957 0.132104 0.454982 0.136957 0.134097 0.254352 0.422940 0.188611 0.396163 0.432784 0.051281 0.119772 0.276474 0.115627 0.419844 0.188056 0.160759 0.088061 0.649863 0.101318 0.203314 0.166595 0.106821 0.523270 Consensus sequence: YDYBDHTMCACGTGGADDBMDGT Reverse complement motif 0.523270 0.166595 0.106821 0.203314 0.160759 0.649863 0.088061 0.101318 0.276474 0.419844 0.115627 0.188056 0.396163 0.051281 0.432784 0.119772 0.134097 0.422940 0.254352 0.188611 0.275957 0.454982 0.132104 0.136957 0.235092 0.155170 0.275193 0.334544 0.049294 0.121789 0.026059 0.802859 0.003497 0.685942 0.088920 0.221641 0.003030 0.943472 0.004308 0.049190 0.902609 0.074770 0.006767 0.015854 0.019937 0.971329 0.005512 0.003221 0.003221 0.005512 0.971329 0.019937 0.015854 0.006767 0.074770 0.902609 0.049190 0.004308 0.943472 0.003030 0.017251 0.289284 0.173423 0.520042 0.802859 0.026059 0.121789 0.049294 0.339087 0.287193 0.154072 0.219647 0.296957 0.301094 0.155579 0.246370 0.140641 0.287668 0.405473 0.166218 0.507625 0.260812 0.103811 0.127752 0.220931 0.422396 0.169844 0.186829 0.410138 0.344851 0.124072 0.120938 Consensus sequence: ACHRBHDTCCACGTGYAHHBMHM Alignment: ACHRBHDTCCACGTGYAHHBMHM --BMSMGCCYMCTKSTGGMHM-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 4 Motif ID: 67 Motif name: TgTGgTGTCACAGTGCTCC Original motif 0.111111 0.083333 0.055556 0.750000 0.125000 0.097222 0.652778 0.125000 0.041667 0.097222 0.027778 0.833333 0.027778 0.027778 0.791667 0.152778 0.055556 0.166667 0.652778 0.125000 0.000000 0.041667 0.013889 0.944444 0.041667 0.000000 0.888889 0.069444 0.027778 0.027778 0.000000 0.944444 0.041667 0.944444 0.013889 0.000000 0.916667 0.027778 0.000000 0.055556 0.069444 0.875000 0.000000 0.055556 0.833333 0.013889 0.013889 0.138889 0.041667 0.069444 0.819444 0.069444 0.027778 0.027778 0.027778 0.916667 0.069444 0.013889 0.847222 0.069444 0.069444 0.777778 0.027778 0.125000 0.055556 0.041667 0.027778 0.875000 0.041667 0.708333 0.125000 0.125000 0.111111 0.819444 0.055556 0.013889 Consensus sequence: TGTGGTGTCACAGTGCTCC Reserve complement motif 0.111111 0.055556 0.819444 0.013889 0.041667 0.125000 0.708333 0.125000 0.875000 0.041667 0.027778 0.055556 0.069444 0.027778 0.777778 0.125000 0.069444 0.847222 0.013889 0.069444 0.916667 0.027778 0.027778 0.027778 0.041667 0.819444 0.069444 0.069444 0.138889 0.013889 0.013889 0.833333 0.069444 0.000000 0.875000 0.055556 0.055556 0.027778 0.000000 0.916667 0.041667 0.013889 0.944444 0.000000 0.944444 0.027778 0.000000 0.027778 0.041667 0.888889 0.000000 0.069444 0.944444 0.041667 0.013889 0.000000 0.055556 0.652778 0.166667 0.125000 0.027778 0.791667 0.027778 0.152778 0.833333 0.097222 0.027778 0.041667 0.125000 0.652778 0.097222 0.125000 0.750000 0.083333 0.055556 0.111111 Consensus sequence: GGAGCACTGTGACACCACA ************************************************************************ Best Matches for Motif ID 67 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00098 Rfx3_secondary Original Motif Reverse Complement Backward 2 19 0.043204 Species: Mus musculus Original motif 0.314514 0.275352 0.257617 0.152518 0.126939 0.598294 0.130576 0.144192 0.102265 0.155334 0.177957 0.564445 0.129288 0.282678 0.326990 0.261044 0.318166 0.227823 0.175681 0.278330 0.109019 0.380838 0.278328 0.231815 0.226145 0.289206 0.291300 0.193348 0.035863 0.844339 0.072582 0.047216 0.223793 0.187244 0.088092 0.500871 0.039800 0.029681 0.026201 0.904317 0.298298 0.032147 0.654746 0.014809 0.014729 0.022023 0.944826 0.018422 0.485114 0.004925 0.013785 0.496176 0.035708 0.020381 0.240804 0.703108 0.951152 0.012738 0.017886 0.018224 0.023713 0.944394 0.009538 0.022355 0.291067 0.385205 0.232388 0.091339 0.340334 0.199588 0.311526 0.148552 0.198713 0.472138 0.178319 0.150830 0.321155 0.269932 0.311301 0.097612 0.412646 0.195252 0.231950 0.160152 0.297134 0.180928 0.250400 0.271538 0.151169 0.305386 0.358574 0.184871 Consensus sequence: VCTBHBVCTTGGWTACVVVVVDB Reverse complement motif 0.151169 0.358574 0.305386 0.184871 0.271538 0.180928 0.250400 0.297134 0.160152 0.195252 0.231950 0.412646 0.097612 0.269932 0.311301 0.321155 0.198713 0.178319 0.472138 0.150830 0.148552 0.199588 0.311526 0.340334 0.291067 0.232388 0.385205 0.091339 0.023713 0.009538 0.944394 0.022355 0.018224 0.012738 0.017886 0.951152 0.703108 0.020381 0.240804 0.035708 0.496176 0.004925 0.013785 0.485114 0.014729 0.944826 0.022023 0.018422 0.298298 0.654746 0.032147 0.014809 0.904317 0.029681 0.026201 0.039800 0.500871 0.187244 0.088092 0.223793 0.035863 0.072582 0.844339 0.047216 0.226145 0.291300 0.289206 0.193348 0.109019 0.278328 0.380838 0.231815 0.278330 0.227823 0.175681 0.318166 0.129288 0.326990 0.282678 0.261044 0.564445 0.155334 0.177957 0.102265 0.126939 0.130576 0.598294 0.144192 0.152518 0.275352 0.257617 0.314514 Consensus sequence: BDBBVBVGTAWCCAAGVBHBAGB Alignment: BDBBVBVGTAWCCAAGVBHBAGB ---TGTGGTGTCACAGTGCTCC- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v016060_secondary Original Motif Original Motif Forward 6 18 0.553914 Species: Mus musculus Original motif 0.319838 0.171199 0.138099 0.370865 0.269358 0.196600 0.346909 0.187133 0.176807 0.338888 0.193903 0.290402 0.230268 0.119645 0.310500 0.339587 0.517372 0.257658 0.111673 0.113296 0.159477 0.126524 0.561119 0.152879 0.117072 0.553013 0.130919 0.198996 0.073372 0.163548 0.525014 0.238066 0.143608 0.186896 0.170528 0.498967 0.054943 0.079034 0.722992 0.143031 0.048852 0.015134 0.852458 0.083556 0.029001 0.023938 0.918900 0.028160 0.036727 0.092645 0.090591 0.780037 0.017757 0.057598 0.895222 0.029423 0.026113 0.048113 0.879744 0.046030 0.023041 0.787043 0.123490 0.066426 0.579766 0.004868 0.296873 0.118493 0.303862 0.042931 0.290151 0.363055 0.099672 0.237431 0.262301 0.400597 0.217788 0.163908 0.367628 0.250676 0.450783 0.141108 0.226137 0.181972 0.485086 0.102553 0.242662 0.169700 0.109057 0.454222 0.145665 0.291056 Consensus sequence: HVBDAGCGBGGGTGGCRDBDDDB Reverse complement motif 0.109057 0.145665 0.454222 0.291056 0.169700 0.102553 0.242662 0.485086 0.181972 0.141108 0.226137 0.450783 0.217788 0.367628 0.163908 0.250676 0.400597 0.237431 0.262301 0.099672 0.363055 0.042931 0.290151 0.303862 0.118493 0.004868 0.296873 0.579766 0.023041 0.123490 0.787043 0.066426 0.026113 0.879744 0.048113 0.046030 0.017757 0.895222 0.057598 0.029423 0.780037 0.092645 0.090591 0.036727 0.029001 0.918900 0.023938 0.028160 0.048852 0.852458 0.015134 0.083556 0.054943 0.722992 0.079034 0.143031 0.498967 0.186896 0.170528 0.143608 0.073372 0.525014 0.163548 0.238066 0.117072 0.130919 0.553013 0.198996 0.159477 0.561119 0.126524 0.152879 0.113296 0.257658 0.111673 0.517372 0.339587 0.119645 0.310500 0.230268 0.176807 0.193903 0.338888 0.290402 0.269358 0.346909 0.196600 0.187133 0.370865 0.171199 0.138099 0.319838 Consensus sequence: BDDHVDKGCCACCCVCGCTDBVH Alignment: HVBDAGCGBGGGTGGCRDBDDDB- -----TGTGGTGTCACAGTGCTCC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00192 Six1 Reverse Complement Reverse Complement Backward 1 17 1.045284 Species: Mus musculus Original motif 0.319306 0.130147 0.399309 0.151238 0.482636 0.211172 0.085871 0.220321 0.214292 0.085504 0.207353 0.492851 0.392819 0.136859 0.403883 0.066438 0.215886 0.049341 0.685932 0.048842 0.039793 0.053756 0.870240 0.036211 0.202525 0.005026 0.791396 0.001053 0.001092 0.001021 0.052968 0.944919 0.963185 0.001738 0.033596 0.001480 0.002017 0.001886 0.002847 0.993250 0.009914 0.974962 0.001987 0.013137 0.909252 0.021586 0.037899 0.031263 0.177851 0.274190 0.117998 0.429961 0.228906 0.159459 0.303955 0.307681 0.330938 0.158106 0.118706 0.392251 0.160453 0.267920 0.280244 0.291383 0.176707 0.068175 0.229538 0.525580 Consensus sequence: DHDRGGGTATCAHDHBT Reverse complement motif 0.525580 0.068175 0.229538 0.176707 0.291383 0.267920 0.280244 0.160453 0.392251 0.158106 0.118706 0.330938 0.307681 0.159459 0.303955 0.228906 0.429961 0.274190 0.117998 0.177851 0.031263 0.021586 0.037899 0.909252 0.009914 0.001987 0.974962 0.013137 0.993250 0.001886 0.002847 0.002017 0.001480 0.001738 0.033596 0.963185 0.944919 0.001021 0.052968 0.001092 0.202525 0.791396 0.005026 0.001053 0.039793 0.870240 0.053756 0.036211 0.215886 0.685932 0.049341 0.048842 0.392819 0.403883 0.136859 0.066438 0.492851 0.085504 0.207353 0.214292 0.220321 0.211172 0.085871 0.482636 0.319306 0.399309 0.130147 0.151238 Consensus sequence: AVHDHTGATACCCMDHH Alignment: --AVHDHTGATACCCMDHH GGAGCACTGTGACACCACA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00193 Rhox11_2205.1 Original Motif Reverse Complement Backward 1 17 1.045899 Species: Mus musculus Original motif 0.504898 0.140204 0.135418 0.219480 0.282348 0.244881 0.300572 0.172199 0.183939 0.100670 0.384783 0.330608 0.326709 0.269523 0.194043 0.209724 0.142989 0.557393 0.066826 0.232792 0.038356 0.014052 0.932450 0.015142 0.092102 0.778844 0.125082 0.003972 0.010254 0.001252 0.005231 0.983263 0.033486 0.000891 0.947486 0.018137 0.005360 0.007407 0.003729 0.983504 0.603485 0.007179 0.003482 0.385853 0.798026 0.029788 0.032370 0.139816 0.529622 0.100632 0.016507 0.353238 0.243581 0.126094 0.401402 0.228923 0.207484 0.285456 0.353715 0.153346 0.282413 0.188410 0.441463 0.087715 0.422774 0.152965 0.094106 0.330155 Consensus sequence: AVDHCGCTGTWAWDVVW Reverse complement motif 0.330155 0.152965 0.094106 0.422774 0.282413 0.441463 0.188410 0.087715 0.207484 0.353715 0.285456 0.153346 0.243581 0.401402 0.126094 0.228923 0.353238 0.100632 0.016507 0.529622 0.139816 0.029788 0.032370 0.798026 0.385853 0.007179 0.003482 0.603485 0.983504 0.007407 0.003729 0.005360 0.033486 0.947486 0.000891 0.018137 0.983263 0.001252 0.005231 0.010254 0.092102 0.125082 0.778844 0.003972 0.038356 0.932450 0.014052 0.015142 0.142989 0.066826 0.557393 0.232792 0.209724 0.269523 0.194043 0.326709 0.183939 0.384783 0.100670 0.330608 0.282348 0.300572 0.244881 0.172199 0.219480 0.140204 0.135418 0.504898 Consensus sequence: WVVHWTWACAGCGHHVT Alignment: --AVDHCGCTGTWAWDVVW TGTGGTGTCACAGTGCTCC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00193 Rhox11_1765.2 Original Motif Reverse Complement Backward 1 17 1.046201 Species: Mus musculus Original motif 0.538735 0.129821 0.147336 0.184107 0.331267 0.275123 0.227609 0.166001 0.174654 0.113319 0.383610 0.328417 0.296734 0.281670 0.230068 0.191527 0.128222 0.561296 0.062928 0.247554 0.027028 0.014676 0.949335 0.008962 0.087209 0.761581 0.147964 0.003246 0.006796 0.000741 0.006037 0.986427 0.039496 0.000533 0.943453 0.016517 0.005541 0.005164 0.002805 0.986489 0.561957 0.002761 0.004207 0.431075 0.780197 0.037155 0.031222 0.151425 0.518642 0.104220 0.012670 0.364468 0.314451 0.111366 0.333508 0.240676 0.236936 0.357992 0.280813 0.124259 0.314846 0.163774 0.426195 0.095185 0.408340 0.134111 0.102987 0.354562 Consensus sequence: AVDVCGCTGTWAWDVVW Reverse complement motif 0.354562 0.134111 0.102987 0.408340 0.314846 0.426195 0.163774 0.095185 0.236936 0.280813 0.357992 0.124259 0.314451 0.333508 0.111366 0.240676 0.364468 0.104220 0.012670 0.518642 0.151425 0.037155 0.031222 0.780197 0.431075 0.002761 0.004207 0.561957 0.986489 0.005164 0.002805 0.005541 0.039496 0.943453 0.000533 0.016517 0.986427 0.000741 0.006037 0.006796 0.087209 0.147964 0.761581 0.003246 0.027028 0.949335 0.014676 0.008962 0.128222 0.062928 0.561296 0.247554 0.191527 0.281670 0.230068 0.296734 0.174654 0.383610 0.113319 0.328417 0.166001 0.275123 0.227609 0.331267 0.184107 0.129821 0.147336 0.538735 Consensus sequence: WVVHWTWACAGCGBHBT Alignment: --WVVHWTWACAGCGBHBT TGTGGTGTCACAGTGCTCC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00068 Eomes_primary Reverse Complement Original Motif Forward 1 17 1.046309 Species: Mus musculus Original motif 0.186316 0.215541 0.297644 0.300499 0.300381 0.234276 0.266283 0.199061 0.317841 0.211418 0.183235 0.287507 0.482598 0.095323 0.245062 0.177017 0.654197 0.008988 0.261951 0.074864 0.095656 0.022883 0.843364 0.038097 0.002655 0.008355 0.976390 0.012600 0.003287 0.080755 0.001057 0.914900 0.006753 0.001517 0.989917 0.001813 0.039940 0.098800 0.003305 0.857955 0.009015 0.039036 0.844029 0.107921 0.984070 0.002369 0.008852 0.004709 0.789505 0.101528 0.029294 0.079672 0.649685 0.139882 0.090466 0.119966 0.421759 0.205595 0.073074 0.299573 0.214779 0.290522 0.134050 0.360649 0.202141 0.270323 0.176798 0.350738 Consensus sequence: BVHDAGGTGTGAAAHHH Reverse complement motif 0.350738 0.270323 0.176798 0.202141 0.360649 0.290522 0.134050 0.214779 0.299573 0.205595 0.073074 0.421759 0.119966 0.139882 0.090466 0.649685 0.079672 0.101528 0.029294 0.789505 0.004709 0.002369 0.008852 0.984070 0.009015 0.844029 0.039036 0.107921 0.857955 0.098800 0.003305 0.039940 0.006753 0.989917 0.001517 0.001813 0.914900 0.080755 0.001057 0.003287 0.002655 0.976390 0.008355 0.012600 0.095656 0.843364 0.022883 0.038097 0.074864 0.008988 0.261951 0.654197 0.177017 0.095323 0.245062 0.482598 0.287507 0.211418 0.183235 0.317841 0.199061 0.234276 0.266283 0.300381 0.300499 0.215541 0.297644 0.186316 Consensus sequence: HHHTTTCACACCTDHBV Alignment: HHHTTTCACACCTDHBV-- GGAGCACTGTGACACCACA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00067 Lef1_primary Reverse Complement Original Motif Backward 2 17 1.048067 Species: Mus musculus Original motif 0.281920 0.214207 0.278077 0.225796 0.325566 0.151435 0.298797 0.224202 0.290253 0.145824 0.243443 0.320480 0.069286 0.404645 0.141614 0.384454 0.070044 0.621448 0.142647 0.165862 0.007295 0.907657 0.038110 0.046938 0.015587 0.018273 0.000658 0.965482 0.005527 0.005886 0.001905 0.986682 0.024512 0.001189 0.001344 0.972955 0.007384 0.025221 0.952270 0.015125 0.966438 0.000630 0.002693 0.030239 0.082252 0.001173 0.001495 0.915080 0.030255 0.677155 0.275323 0.017267 0.199467 0.118815 0.056814 0.624905 0.345445 0.169597 0.216831 0.268127 0.278106 0.150864 0.173693 0.397336 0.251834 0.339733 0.219703 0.188730 Consensus sequence: DDDYCCTTTGATCTDDV Reverse complement motif 0.251834 0.219703 0.339733 0.188730 0.397336 0.150864 0.173693 0.278106 0.268127 0.169597 0.216831 0.345445 0.624905 0.118815 0.056814 0.199467 0.030255 0.275323 0.677155 0.017267 0.915080 0.001173 0.001495 0.082252 0.030239 0.000630 0.002693 0.966438 0.007384 0.952270 0.025221 0.015125 0.972955 0.001189 0.001344 0.024512 0.986682 0.005886 0.001905 0.005527 0.965482 0.018273 0.000658 0.015587 0.007295 0.038110 0.907657 0.046938 0.070044 0.142647 0.621448 0.165862 0.069286 0.141614 0.404645 0.384454 0.320480 0.145824 0.243443 0.290253 0.224202 0.151435 0.298797 0.325566 0.225796 0.214207 0.278077 0.281920 Consensus sequence: VDDAGATCAAAGGKDDD Alignment: --VDDAGATCAAAGGKDDD GGAGCACTGTGACACCACA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v015681_primary Reverse Complement Original Motif Forward 3 17 1.048311 Species: Mus musculus Original motif 0.641428 0.180211 0.044767 0.133594 0.171696 0.262981 0.334148 0.231174 0.129726 0.322735 0.243462 0.304077 0.165713 0.175735 0.256108 0.402445 0.146090 0.171890 0.412753 0.269266 0.212837 0.439192 0.280990 0.066980 0.251088 0.275516 0.374380 0.099015 0.575438 0.079656 0.338201 0.006704 0.005634 0.003422 0.972597 0.018348 0.890447 0.077034 0.031851 0.000668 0.007128 0.986862 0.000496 0.005515 0.001445 0.991564 0.001925 0.005066 0.738761 0.190157 0.026399 0.044684 0.013384 0.983783 0.000896 0.001937 0.068077 0.929549 0.000773 0.001602 0.040830 0.933742 0.005283 0.020145 0.730274 0.029225 0.145689 0.094812 0.165032 0.572838 0.162001 0.100129 0.383584 0.129942 0.429497 0.056977 0.455959 0.071959 0.208204 0.263878 0.134271 0.262985 0.222626 0.380117 0.071193 0.346594 0.346081 0.236132 0.445661 0.405278 0.053901 0.095160 Consensus sequence: ABBBBVVRGACCACCCACRDBBM Reverse complement motif 0.095160 0.405278 0.053901 0.445661 0.071193 0.346081 0.346594 0.236132 0.380117 0.262985 0.222626 0.134271 0.263878 0.071959 0.208204 0.455959 0.383584 0.429497 0.129942 0.056977 0.165032 0.162001 0.572838 0.100129 0.094812 0.029225 0.145689 0.730274 0.040830 0.005283 0.933742 0.020145 0.068077 0.000773 0.929549 0.001602 0.013384 0.000896 0.983783 0.001937 0.044684 0.190157 0.026399 0.738761 0.001445 0.001925 0.991564 0.005066 0.007128 0.000496 0.986862 0.005515 0.000668 0.077034 0.031851 0.890447 0.005634 0.972597 0.003422 0.018348 0.006704 0.079656 0.338201 0.575438 0.251088 0.374380 0.275516 0.099015 0.212837 0.280990 0.439192 0.066980 0.146090 0.412753 0.171890 0.269266 0.402445 0.175735 0.256108 0.165713 0.129726 0.243462 0.322735 0.304077 0.171696 0.334148 0.262981 0.231174 0.133594 0.180211 0.044767 0.641428 Consensus sequence: YBVDMGTGGGTGGTCKVVBVBBT Alignment: YBVDMGTGGGTGGTCKVVBVBBT-- --GGAGCACTGTGACACCACA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00053 Rxra_primary Original Motif Original Motif Backward 3 17 1.048667 Species: Mus musculus Original motif 0.235299 0.222264 0.237416 0.305021 0.144778 0.278902 0.341673 0.234648 0.261127 0.261904 0.191591 0.285378 0.119943 0.410774 0.218940 0.250343 0.222672 0.075554 0.365253 0.336521 0.001838 0.046904 0.002828 0.948430 0.030410 0.006359 0.960821 0.002410 0.987391 0.007562 0.002810 0.002237 0.105188 0.888650 0.001163 0.004998 0.006475 0.987074 0.001793 0.004659 0.001816 0.765138 0.003092 0.229953 0.010354 0.846496 0.029899 0.113251 0.328732 0.039382 0.265510 0.366377 0.209638 0.262628 0.145613 0.382121 0.385390 0.177695 0.299828 0.137087 0.403452 0.268924 0.096028 0.231595 0.203082 0.231812 0.213520 0.351585 Consensus sequence: DBHBDTGACCCCDHVHB Reverse complement motif 0.351585 0.231812 0.213520 0.203082 0.231595 0.268924 0.096028 0.403452 0.137087 0.177695 0.299828 0.385390 0.382121 0.262628 0.145613 0.209638 0.366377 0.039382 0.265510 0.328732 0.010354 0.029899 0.846496 0.113251 0.001816 0.003092 0.765138 0.229953 0.006475 0.001793 0.987074 0.004659 0.105188 0.001163 0.888650 0.004998 0.002237 0.007562 0.002810 0.987391 0.030410 0.960821 0.006359 0.002410 0.948430 0.046904 0.002828 0.001838 0.222672 0.365253 0.075554 0.336521 0.119943 0.218940 0.410774 0.250343 0.285378 0.261904 0.191591 0.261127 0.144778 0.341673 0.278902 0.234648 0.305021 0.222264 0.237416 0.235299 Consensus sequence: VHBHDGGGGTCAHBHBD Alignment: --DBHBDTGACCCCDHVHB TGTGGTGTCACAGTGCTCC-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00388 Six6_2267.4 Reverse Complement Reverse Complement Forward 3 17 1.049102 Species: Mus musculus Original motif 0.330559 0.118371 0.278738 0.272331 0.605486 0.104492 0.066247 0.223775 0.180170 0.051522 0.131669 0.636639 0.431457 0.173748 0.323416 0.071378 0.131729 0.037944 0.812991 0.017337 0.022726 0.033975 0.914981 0.028317 0.138556 0.012597 0.847660 0.001188 0.001916 0.001156 0.046653 0.950276 0.965626 0.001518 0.031319 0.001536 0.003782 0.001412 0.002175 0.992631 0.006601 0.979412 0.002328 0.011660 0.947233 0.007670 0.017734 0.027363 0.374066 0.305253 0.063914 0.256767 0.267070 0.210201 0.216997 0.305732 0.294988 0.127424 0.094154 0.483434 0.354130 0.195592 0.176636 0.273642 0.094874 0.110275 0.192261 0.602591 Consensus sequence: DATRGGGTATCAHDWHT Reverse complement motif 0.602591 0.110275 0.192261 0.094874 0.273642 0.195592 0.176636 0.354130 0.483434 0.127424 0.094154 0.294988 0.305732 0.210201 0.216997 0.267070 0.256767 0.305253 0.063914 0.374066 0.027363 0.007670 0.017734 0.947233 0.006601 0.002328 0.979412 0.011660 0.992631 0.001412 0.002175 0.003782 0.001536 0.001518 0.031319 0.965626 0.950276 0.001156 0.046653 0.001916 0.138556 0.847660 0.012597 0.001188 0.022726 0.914981 0.033975 0.028317 0.131729 0.812991 0.037944 0.017337 0.071378 0.173748 0.323416 0.431457 0.636639 0.051522 0.131669 0.180170 0.223775 0.104492 0.066247 0.605486 0.272331 0.118371 0.278738 0.330559 Consensus sequence: AHWDHTGATACCCKATD Alignment: AHWDHTGATACCCKATD-- --GGAGCACTGTGACACCACA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 4 Motif ID: 68 Motif name: sscCCCGCGcs Original motif 0.147059 0.441176 0.264706 0.147059 0.117647 0.529412 0.294118 0.058824 0.000000 0.676471 0.235294 0.088235 0.029412 0.852941 0.117647 0.000000 0.000000 0.823529 0.176471 0.000000 0.000000 0.794118 0.205882 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.058824 0.941176 0.000000 0.117647 0.470588 0.235294 0.176471 0.000000 0.323529 0.529412 0.147059 Consensus sequence: BSCCCCGCGBS Reserve complement motif 0.000000 0.529412 0.323529 0.147059 0.117647 0.235294 0.470588 0.176471 0.000000 0.941176 0.058824 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.205882 0.794118 0.000000 0.000000 0.176471 0.823529 0.000000 0.029412 0.117647 0.852941 0.000000 0.000000 0.235294 0.676471 0.088235 0.117647 0.294118 0.529412 0.058824 0.147059 0.264706 0.441176 0.147059 Consensus sequence: SBCGCGGGGSB ************************************************************************ Best Matches for Motif ID 68 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00000 Smad3_secondary Reverse Complement Reverse Complement Forward 5 11 0.009342 Species: Mus musculus Original motif 0.150668 0.131779 0.245665 0.471887 0.316817 0.287314 0.150829 0.245040 0.256473 0.409066 0.109700 0.224761 0.210646 0.220222 0.345010 0.224122 0.166679 0.508939 0.081676 0.242705 0.049351 0.759380 0.088489 0.102780 0.047598 0.785546 0.121957 0.044898 0.004606 0.944933 0.034696 0.015764 0.040252 0.050652 0.890382 0.018713 0.003038 0.913699 0.022449 0.060814 0.028672 0.941477 0.012276 0.017575 0.635243 0.139731 0.110495 0.114531 0.240016 0.385948 0.182848 0.191188 0.210430 0.274127 0.085171 0.430272 0.088118 0.454598 0.208989 0.248295 0.181269 0.265028 0.149023 0.404680 0.101070 0.252682 0.368542 0.277706 Consensus sequence: DHHBCCCCGCCAHHBHB Reverse complement motif 0.101070 0.368542 0.252682 0.277706 0.404680 0.265028 0.149023 0.181269 0.088118 0.208989 0.454598 0.248295 0.430272 0.274127 0.085171 0.210430 0.240016 0.182848 0.385948 0.191188 0.114531 0.139731 0.110495 0.635243 0.028672 0.012276 0.941477 0.017575 0.003038 0.022449 0.913699 0.060814 0.040252 0.890382 0.050652 0.018713 0.004606 0.034696 0.944933 0.015764 0.047598 0.121957 0.785546 0.044898 0.049351 0.088489 0.759380 0.102780 0.166679 0.081676 0.508939 0.242705 0.210646 0.345010 0.220222 0.224122 0.256473 0.109700 0.409066 0.224761 0.245040 0.287314 0.150829 0.316817 0.471887 0.131779 0.245665 0.150668 Consensus sequence: BHBHDTGGCGGGGBDHD Alignment: BHBHDTGGCGGGGBDHD ----SBCGCGGGGSB-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00006 Zic3_primary Original Motif Original Motif Forward 2 11 0.010579 Species: Mus musculus Original motif 0.133123 0.374622 0.252864 0.239392 0.305344 0.451195 0.093638 0.149822 0.125347 0.723516 0.027695 0.123442 0.129457 0.754873 0.045215 0.070455 0.117681 0.809987 0.036742 0.035590 0.046565 0.817263 0.077300 0.058872 0.047132 0.790594 0.143506 0.018768 0.059681 0.087688 0.665195 0.187436 0.058872 0.077300 0.817263 0.046565 0.035590 0.036742 0.809987 0.117681 0.070455 0.045215 0.754873 0.129457 0.123442 0.027695 0.723516 0.125347 0.104029 0.069439 0.636026 0.190506 0.070968 0.197801 0.581172 0.150060 0.147077 0.235294 0.230097 0.387531 Consensus sequence: BMCCCCCGGGGGGGB Reverse complement motif 0.387531 0.235294 0.230097 0.147077 0.070968 0.581172 0.197801 0.150060 0.104029 0.636026 0.069439 0.190506 0.123442 0.723516 0.027695 0.125347 0.070455 0.754873 0.045215 0.129457 0.035590 0.809987 0.036742 0.117681 0.058872 0.817263 0.077300 0.046565 0.059681 0.665195 0.087688 0.187436 0.047132 0.143506 0.790594 0.018768 0.046565 0.077300 0.817263 0.058872 0.117681 0.036742 0.809987 0.035590 0.129457 0.045215 0.754873 0.070455 0.125347 0.027695 0.723516 0.123442 0.305344 0.093638 0.451195 0.149822 0.133123 0.252864 0.374622 0.239392 Consensus sequence: VCCCCCCCGGGGGRB Alignment: BMCCCCCGGGGGGGB -BSCCCCGCGBS--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00057 Zic2_primary Original Motif Original Motif Backward 4 11 0.011249 Species: Mus musculus Original motif 0.171475 0.300729 0.275648 0.252148 0.274948 0.494479 0.090926 0.139646 0.136266 0.716563 0.033328 0.113843 0.116272 0.772964 0.046083 0.064680 0.103529 0.835329 0.032215 0.028927 0.057023 0.813129 0.071277 0.058571 0.057483 0.766273 0.157290 0.018955 0.071535 0.110226 0.631760 0.186479 0.058571 0.071277 0.813129 0.057023 0.028927 0.032215 0.835329 0.103529 0.064680 0.046083 0.772964 0.116272 0.113843 0.033328 0.716563 0.136266 0.119744 0.068294 0.609218 0.202743 0.065793 0.215443 0.562951 0.155813 0.178819 0.196535 0.205955 0.418691 Consensus sequence: BMCCCCCGGGGGGGB Reverse complement motif 0.418691 0.196535 0.205955 0.178819 0.065793 0.562951 0.215443 0.155813 0.119744 0.609218 0.068294 0.202743 0.113843 0.716563 0.033328 0.136266 0.064680 0.772964 0.046083 0.116272 0.028927 0.835329 0.032215 0.103529 0.058571 0.813129 0.071277 0.057023 0.071535 0.631760 0.110226 0.186479 0.057483 0.157290 0.766273 0.018955 0.057023 0.071277 0.813129 0.058571 0.103529 0.032215 0.835329 0.028927 0.116272 0.046083 0.772964 0.064680 0.136266 0.033328 0.716563 0.113843 0.274948 0.090926 0.494479 0.139646 0.171475 0.275648 0.300729 0.252148 Consensus sequence: VCCCCCCCGGGGGRB Alignment: BMCCCCCGGGGGGGB -BSCCCCGCGBS--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00400 Zif268 Reverse Complement Reverse Complement Backward 7 11 0.014467 Species: Mus musculus Original motif 0.104824 0.412716 0.254506 0.227955 0.644922 0.065476 0.140479 0.149122 0.201205 0.166164 0.347131 0.285501 0.360606 0.256316 0.150766 0.232313 0.199831 0.240681 0.279350 0.280137 0.234308 0.204076 0.321306 0.240310 0.274112 0.462435 0.111425 0.152028 0.067070 0.717501 0.073934 0.141496 0.106745 0.084442 0.658566 0.150247 0.025128 0.967053 0.003585 0.004234 0.006412 0.982989 0.003227 0.007371 0.009588 0.877620 0.002571 0.110221 0.621521 0.355443 0.015669 0.007366 0.002600 0.980275 0.004191 0.012934 0.118773 0.026658 0.783843 0.070725 0.022358 0.822101 0.024684 0.130857 0.713212 0.080912 0.128793 0.077084 0.166568 0.250955 0.107934 0.474544 0.225040 0.222494 0.163301 0.389166 0.268976 0.223206 0.265314 0.242504 0.137052 0.229058 0.148439 0.485451 0.135819 0.304550 0.141994 0.417637 0.272440 0.319501 0.230580 0.177478 Consensus sequence: BADHBDHCGCCCMCGCAHHDBBV Reverse complement motif 0.272440 0.230580 0.319501 0.177478 0.417637 0.304550 0.141994 0.135819 0.485451 0.229058 0.148439 0.137052 0.242504 0.223206 0.265314 0.268976 0.389166 0.222494 0.163301 0.225040 0.474544 0.250955 0.107934 0.166568 0.077084 0.080912 0.128793 0.713212 0.022358 0.024684 0.822101 0.130857 0.118773 0.783843 0.026658 0.070725 0.002600 0.004191 0.980275 0.012934 0.007366 0.355443 0.015669 0.621521 0.009588 0.002571 0.877620 0.110221 0.006412 0.003227 0.982989 0.007371 0.025128 0.003585 0.967053 0.004234 0.106745 0.658566 0.084442 0.150247 0.067070 0.073934 0.717501 0.141496 0.274112 0.111425 0.462435 0.152028 0.234308 0.321306 0.204076 0.240310 0.280137 0.240681 0.279350 0.199831 0.232313 0.256316 0.150766 0.360606 0.201205 0.347131 0.166164 0.285501 0.149122 0.065476 0.140479 0.644922 0.104824 0.254506 0.412716 0.227955 Consensus sequence: VVVDHHTGCGYGGGCGDHVHHTB Alignment: VVVDHHTGCGYGGGCGDHVHHTB ------SBCGCGGGGSB------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00526 Foxn1_primary Reverse Complement Reverse Complement Backward 4 11 0.015056 Species: Mus musculus Original motif 0.456612 0.057181 0.078281 0.407926 0.460529 0.185506 0.083106 0.270859 0.445717 0.179510 0.239355 0.135417 0.116339 0.145186 0.275331 0.463144 0.239398 0.142078 0.480004 0.138520 0.355157 0.217877 0.284296 0.142670 0.318602 0.444835 0.153321 0.083243 0.609569 0.055866 0.280349 0.054216 0.062297 0.769824 0.027844 0.140035 0.151868 0.019245 0.803188 0.025699 0.011842 0.952534 0.017959 0.017665 0.017665 0.017959 0.952534 0.011842 0.025699 0.803188 0.019245 0.151868 0.140035 0.027844 0.769824 0.062297 0.054216 0.280349 0.055866 0.609569 0.013084 0.624655 0.177956 0.184305 0.287647 0.183527 0.295753 0.233074 0.042309 0.345931 0.198458 0.413301 0.338138 0.266033 0.045367 0.350462 0.302850 0.155320 0.074662 0.467168 0.240926 0.068901 0.283055 0.407118 0.409954 0.183157 0.154186 0.252704 Consensus sequence: WHVBVVMACGCGCGTCDYHWDH Reverse complement motif 0.252704 0.183157 0.154186 0.409954 0.407118 0.068901 0.283055 0.240926 0.467168 0.155320 0.074662 0.302850 0.350462 0.266033 0.045367 0.338138 0.413301 0.345931 0.198458 0.042309 0.287647 0.295753 0.183527 0.233074 0.013084 0.177956 0.624655 0.184305 0.609569 0.280349 0.055866 0.054216 0.140035 0.769824 0.027844 0.062297 0.025699 0.019245 0.803188 0.151868 0.017665 0.952534 0.017959 0.011842 0.011842 0.017959 0.952534 0.017665 0.151868 0.803188 0.019245 0.025699 0.062297 0.027844 0.769824 0.140035 0.054216 0.055866 0.280349 0.609569 0.318602 0.153321 0.444835 0.083243 0.142670 0.217877 0.284296 0.355157 0.239398 0.480004 0.142078 0.138520 0.463144 0.145186 0.275331 0.116339 0.135417 0.179510 0.239355 0.445717 0.270859 0.185506 0.083106 0.460529 0.407926 0.057181 0.078281 0.456612 Consensus sequence: HDWHMHGACGCGCGTRBVVBHW Alignment: HDWHMHGACGCGCGTRBVVBHW --------SBCGCGGGGSB--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00065 Zfp161_primary Original Motif Reverse Complement Backward 4 11 0.016905 Species: Mus musculus Original motif 0.142624 0.111294 0.283688 0.462394 0.221170 0.081404 0.499138 0.198288 0.290070 0.042114 0.604904 0.062912 0.109755 0.559510 0.215454 0.115281 0.111745 0.022727 0.850580 0.014948 0.015907 0.942291 0.005561 0.036241 0.088509 0.003729 0.902805 0.004957 0.004957 0.902805 0.003729 0.088509 0.036241 0.005561 0.942291 0.015907 0.014948 0.850580 0.022727 0.111745 0.325358 0.049424 0.519652 0.105566 0.062912 0.604904 0.042114 0.290070 0.214335 0.388248 0.125912 0.271505 0.128984 0.372787 0.092390 0.405839 0.269058 0.098422 0.484016 0.148504 0.362176 0.156050 0.188642 0.293132 Consensus sequence: DDGCGCGCGCRCHYRD Reverse complement motif 0.293132 0.156050 0.188642 0.362176 0.269058 0.484016 0.098422 0.148504 0.405839 0.372787 0.092390 0.128984 0.214335 0.125912 0.388248 0.271505 0.062912 0.042114 0.604904 0.290070 0.325358 0.519652 0.049424 0.105566 0.014948 0.022727 0.850580 0.111745 0.036241 0.942291 0.005561 0.015907 0.004957 0.003729 0.902805 0.088509 0.088509 0.902805 0.003729 0.004957 0.015907 0.005561 0.942291 0.036241 0.111745 0.850580 0.022727 0.014948 0.109755 0.215454 0.559510 0.115281 0.290070 0.604904 0.042114 0.062912 0.221170 0.499138 0.081404 0.198288 0.462394 0.111294 0.283688 0.142624 Consensus sequence: DMMDGMGCGCGCGCHD Alignment: DMMDGMGCGCGCGCHD --BSCCCCGCGBS--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00102 Zic1_primary Original Motif Original Motif Backward 3 11 0.018611 Species: Mus musculus Original motif 0.174040 0.367918 0.270176 0.187866 0.359560 0.309872 0.111047 0.219520 0.094468 0.790352 0.026034 0.089145 0.114860 0.779490 0.050895 0.054755 0.105195 0.837712 0.031857 0.025237 0.045234 0.825039 0.073990 0.055737 0.145555 0.592986 0.228415 0.033044 0.045273 0.175001 0.607615 0.172111 0.055737 0.073990 0.825039 0.045234 0.025237 0.031857 0.837712 0.105195 0.054755 0.050895 0.779490 0.114860 0.089145 0.026034 0.790352 0.094468 0.060833 0.067787 0.717352 0.154028 0.097742 0.194545 0.591608 0.116104 Consensus sequence: BHCCCCCGGGGGGG Reverse complement motif 0.097742 0.591608 0.194545 0.116104 0.060833 0.717352 0.067787 0.154028 0.089145 0.790352 0.026034 0.094468 0.054755 0.779490 0.050895 0.114860 0.025237 0.837712 0.031857 0.105195 0.055737 0.825039 0.073990 0.045234 0.045273 0.607615 0.175001 0.172111 0.145555 0.228415 0.592986 0.033044 0.045234 0.073990 0.825039 0.055737 0.105195 0.031857 0.837712 0.025237 0.114860 0.050895 0.779490 0.054755 0.094468 0.026034 0.790352 0.089145 0.219520 0.309872 0.111047 0.359560 0.174040 0.270176 0.367918 0.187866 Consensus sequence: CCCCCCCGGGGGHB Alignment: BHCCCCCGGGGGGG -BSCCCCGCGBS-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00527 Foxn4_secondary Original Motif Reverse Complement Backward 8 11 0.019240 Species: Mus musculus Original motif 0.298336 0.418632 0.208054 0.074978 0.289907 0.015608 0.457100 0.237385 0.273583 0.077889 0.107860 0.540668 0.184954 0.161611 0.384390 0.269045 0.521826 0.156340 0.089019 0.232815 0.356716 0.131104 0.394857 0.117323 0.266669 0.108765 0.505273 0.119293 0.020778 0.047199 0.919524 0.012500 0.948536 0.018775 0.008113 0.024576 0.010822 0.964042 0.014701 0.010434 0.007428 0.019505 0.966351 0.006717 0.010025 0.975678 0.008648 0.005649 0.043796 0.120935 0.742979 0.092289 0.008252 0.250704 0.541132 0.199913 0.474428 0.044681 0.134430 0.346461 0.146597 0.421317 0.143166 0.288920 0.020540 0.181479 0.553811 0.244170 0.129612 0.173360 0.535219 0.161808 0.506084 0.158156 0.130983 0.204776 0.054872 0.103043 0.545792 0.296293 0.389882 0.171037 0.164162 0.274918 0.225861 0.314031 0.288872 0.171237 Consensus sequence: VDWDARRGACGCGGWHGGAKHV Reverse complement motif 0.225861 0.288872 0.314031 0.171237 0.274918 0.171037 0.164162 0.389882 0.054872 0.545792 0.103043 0.296293 0.204776 0.158156 0.130983 0.506084 0.129612 0.535219 0.173360 0.161808 0.020540 0.553811 0.181479 0.244170 0.146597 0.143166 0.421317 0.288920 0.346461 0.044681 0.134430 0.474428 0.008252 0.541132 0.250704 0.199913 0.043796 0.742979 0.120935 0.092289 0.010025 0.008648 0.975678 0.005649 0.007428 0.966351 0.019505 0.006717 0.010822 0.014701 0.964042 0.010434 0.024576 0.018775 0.008113 0.948536 0.020778 0.919524 0.047199 0.012500 0.266669 0.505273 0.108765 0.119293 0.356716 0.394857 0.131104 0.117323 0.232815 0.156340 0.089019 0.521826 0.184954 0.384390 0.161611 0.269045 0.540668 0.077889 0.107860 0.273583 0.289907 0.457100 0.015608 0.237385 0.298336 0.208054 0.418632 0.074978 Consensus sequence: VHYTCCDWCCGCGTCMMTHWHV Alignment: VHYTCCDWCCGCGTCMMTHWHV ----BSCCCCGCGBS------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00022 Zfp740_primary Reverse Complement Reverse Complement Forward 3 11 0.020460 Species: Mus musculus Original motif 0.136946 0.396508 0.135309 0.331236 0.185528 0.417538 0.215409 0.181525 0.171276 0.341901 0.172832 0.313991 0.145641 0.590572 0.146376 0.117412 0.138035 0.660416 0.114016 0.087533 0.222728 0.750532 0.007528 0.019212 0.024633 0.963314 0.001894 0.010159 0.009557 0.979956 0.000642 0.009844 0.010416 0.977424 0.000541 0.011619 0.026401 0.956740 0.001544 0.015314 0.195502 0.755959 0.011060 0.037480 0.491291 0.364785 0.025613 0.118311 0.305153 0.398160 0.071680 0.225008 0.253497 0.232647 0.213246 0.300610 0.156964 0.297876 0.144683 0.400477 0.179549 0.292514 0.319462 0.208475 Consensus sequence: HVBCCCCCCCCMHHHB Reverse complement motif 0.179549 0.319462 0.292514 0.208475 0.400477 0.297876 0.144683 0.156964 0.300610 0.232647 0.213246 0.253497 0.305153 0.071680 0.398160 0.225008 0.118311 0.364785 0.025613 0.491291 0.195502 0.011060 0.755959 0.037480 0.026401 0.001544 0.956740 0.015314 0.010416 0.000541 0.977424 0.011619 0.009557 0.000642 0.979956 0.009844 0.024633 0.001894 0.963314 0.010159 0.222728 0.007528 0.750532 0.019212 0.138035 0.114016 0.660416 0.087533 0.145641 0.146376 0.590572 0.117412 0.171276 0.172832 0.341901 0.313991 0.185528 0.215409 0.417538 0.181525 0.136946 0.135309 0.396508 0.331236 Consensus sequence: BHHDYGGGGGGGGBVD Alignment: BHHDYGGGGGGGGBVD --SBCGCGGGGSB--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00526 Foxn1_secondary Reverse Complement Original Motif Backward 5 11 0.023211 Species: Mus musculus Original motif 0.477863 0.106306 0.184102 0.231729 0.304951 0.149020 0.361418 0.184612 0.548996 0.056128 0.348902 0.045974 0.385727 0.477782 0.086218 0.050273 0.409556 0.232265 0.173851 0.184328 0.174550 0.312880 0.307123 0.205448 0.850398 0.047204 0.041665 0.060734 0.141234 0.548534 0.142230 0.168002 0.059462 0.026354 0.892948 0.021236 0.053714 0.870297 0.028935 0.047055 0.086273 0.069147 0.805284 0.039296 0.033781 0.573881 0.034115 0.358223 0.035191 0.079663 0.824970 0.060176 0.051830 0.862631 0.019359 0.066180 0.178685 0.015738 0.762485 0.043092 0.058988 0.042615 0.017608 0.880789 0.202382 0.173360 0.284095 0.340163 0.098493 0.234651 0.506524 0.160333 0.109087 0.336204 0.250510 0.304198 0.130945 0.250843 0.177122 0.441090 0.353830 0.138838 0.162784 0.344548 0.114290 0.417163 0.160662 0.307885 Consensus sequence: DDRMHBACGCGYGCGTDGBBDB Reverse complement motif 0.114290 0.160662 0.417163 0.307885 0.344548 0.138838 0.162784 0.353830 0.441090 0.250843 0.177122 0.130945 0.109087 0.250510 0.336204 0.304198 0.098493 0.506524 0.234651 0.160333 0.340163 0.173360 0.284095 0.202382 0.880789 0.042615 0.017608 0.058988 0.178685 0.762485 0.015738 0.043092 0.051830 0.019359 0.862631 0.066180 0.035191 0.824970 0.079663 0.060176 0.033781 0.034115 0.573881 0.358223 0.086273 0.805284 0.069147 0.039296 0.053714 0.028935 0.870297 0.047055 0.059462 0.892948 0.026354 0.021236 0.141234 0.142230 0.548534 0.168002 0.060734 0.047204 0.041665 0.850398 0.174550 0.307123 0.312880 0.205448 0.184328 0.232265 0.173851 0.409556 0.385727 0.086218 0.477782 0.050273 0.045974 0.056128 0.348902 0.548996 0.304951 0.361418 0.149020 0.184612 0.231729 0.106306 0.184102 0.477863 Consensus sequence: BDVBCDACGCKCGCGTBHRKHD Alignment: DDRMHBACGCGYGCGTDGBBDB -------SBCGCGGGGSB---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 4 Motif ID: 69 Motif name: atactttggc Original motif 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 Consensus sequence: ATACTTTGGC Reserve complement motif 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 Consensus sequence: GCCAAAGTAT ************************************************************************ Best Matches for Motif ID 69 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00156 Msx2 Original Motif Reverse Complement Backward 4 10 0.022158 Species: Mus musculus Original motif 0.275513 0.256811 0.311675 0.156002 0.383321 0.282527 0.177970 0.156182 0.442557 0.124681 0.236862 0.195901 0.139318 0.227241 0.544119 0.089322 0.700103 0.083893 0.130336 0.085668 0.022691 0.796940 0.114830 0.065539 0.009654 0.562163 0.000715 0.427467 0.990884 0.001732 0.002330 0.005053 0.985387 0.012176 0.000854 0.001584 0.005044 0.003260 0.000977 0.990719 0.005122 0.009507 0.000372 0.984999 0.957648 0.000380 0.035397 0.006575 0.147183 0.050632 0.560835 0.241350 0.114465 0.415702 0.084791 0.385042 0.157227 0.095566 0.474272 0.272935 0.245081 0.362599 0.108499 0.283820 0.092460 0.210730 0.114248 0.582562 Consensus sequence: VVDGACYAATTAGYDHT Reverse complement motif 0.582562 0.210730 0.114248 0.092460 0.245081 0.108499 0.362599 0.283820 0.157227 0.474272 0.095566 0.272935 0.114465 0.084791 0.415702 0.385042 0.147183 0.560835 0.050632 0.241350 0.006575 0.000380 0.035397 0.957648 0.984999 0.009507 0.000372 0.005122 0.990719 0.003260 0.000977 0.005044 0.001584 0.012176 0.000854 0.985387 0.005053 0.001732 0.002330 0.990884 0.009654 0.000715 0.562163 0.427467 0.022691 0.114830 0.796940 0.065539 0.085668 0.083893 0.130336 0.700103 0.139318 0.544119 0.227241 0.089322 0.195901 0.124681 0.236862 0.442557 0.156182 0.282527 0.177970 0.383321 0.275513 0.311675 0.256811 0.156002 Consensus sequence: ADHKCTAATTKGTCDBV Alignment: ADHKCTAATTKGTCDBV ----ATACTTTGGC--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00101 Sox12_secondary Original Motif Reverse Complement Backward 6 10 0.027519 Species: Mus musculus Original motif 0.378898 0.318901 0.205859 0.096341 0.352524 0.321236 0.224504 0.101736 0.323551 0.182056 0.210897 0.283496 0.135539 0.325230 0.208031 0.331200 0.663106 0.055471 0.154459 0.126963 0.051748 0.292567 0.537307 0.118378 0.886489 0.042361 0.035742 0.035408 0.043647 0.688744 0.094358 0.173252 0.882052 0.039818 0.018899 0.059231 0.864171 0.036011 0.068363 0.031455 0.790158 0.046868 0.041594 0.121379 0.087447 0.143905 0.707798 0.060849 0.295919 0.132479 0.485703 0.085899 0.653156 0.133004 0.110012 0.103828 0.351764 0.131771 0.217730 0.298736 0.203977 0.196773 0.099958 0.499292 Consensus sequence: VVDBASACAAAGRADH Reverse complement motif 0.499292 0.196773 0.099958 0.203977 0.298736 0.131771 0.217730 0.351764 0.103828 0.133004 0.110012 0.653156 0.295919 0.485703 0.132479 0.085899 0.087447 0.707798 0.143905 0.060849 0.121379 0.046868 0.041594 0.790158 0.031455 0.036011 0.068363 0.864171 0.059231 0.039818 0.018899 0.882052 0.043647 0.094358 0.688744 0.173252 0.035408 0.042361 0.035742 0.886489 0.051748 0.537307 0.292567 0.118378 0.126963 0.055471 0.154459 0.663106 0.331200 0.325230 0.208031 0.135539 0.283496 0.182056 0.210897 0.323551 0.101736 0.321236 0.224504 0.352524 0.096341 0.318901 0.205859 0.378898 Consensus sequence: HDTMCTTTGTSTVDBB Alignment: HDTMCTTTGTSTVDBB -ATACTTTGGC----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00066 Hnf4a_secondary Reverse Complement Original Motif Backward 6 10 0.028579 Species: Mus musculus Original motif 0.131680 0.169949 0.346277 0.352094 0.109910 0.144258 0.373681 0.372151 0.196671 0.411335 0.159689 0.232305 0.311086 0.307077 0.122332 0.259505 0.895155 0.013238 0.038874 0.052733 0.779629 0.018399 0.171269 0.030703 0.950546 0.002649 0.041825 0.004980 0.004769 0.002646 0.985847 0.006739 0.004458 0.002117 0.012011 0.981414 0.016789 0.969626 0.003890 0.009695 0.002468 0.982852 0.004754 0.009926 0.891448 0.003193 0.097548 0.007811 0.513330 0.308971 0.070467 0.107232 0.179371 0.115514 0.130898 0.574217 0.285826 0.277536 0.166982 0.269655 0.319407 0.227783 0.129020 0.323790 Consensus sequence: BBHHAAAGTCCAMTHH Reverse complement motif 0.323790 0.227783 0.129020 0.319407 0.269655 0.277536 0.166982 0.285826 0.574217 0.115514 0.130898 0.179371 0.107232 0.308971 0.070467 0.513330 0.007811 0.003193 0.097548 0.891448 0.002468 0.004754 0.982852 0.009926 0.016789 0.003890 0.969626 0.009695 0.981414 0.002117 0.012011 0.004458 0.004769 0.985847 0.002646 0.006739 0.004980 0.002649 0.041825 0.950546 0.030703 0.018399 0.171269 0.779629 0.052733 0.013238 0.038874 0.895155 0.259505 0.307077 0.122332 0.311086 0.196671 0.159689 0.411335 0.232305 0.109910 0.373681 0.144258 0.372151 0.352094 0.169949 0.346277 0.131680 Consensus sequence: HHAYTGGACTTTHDBV Alignment: BBHHAAAGTCCAMTHH -GCCAAAGTAT----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00418 Etv6 Reverse Complement Reverse Complement Forward 5 10 0.030488 Species: Mus musculus Original motif 0.354972 0.069107 0.299350 0.276571 0.209701 0.408003 0.227382 0.154914 0.284336 0.375266 0.162604 0.177794 0.176569 0.181438 0.342172 0.299820 0.106551 0.204378 0.060299 0.628772 0.884088 0.003252 0.103113 0.009546 0.001110 0.704391 0.006294 0.288205 0.014992 0.000892 0.001401 0.982714 0.004842 0.001887 0.002470 0.990801 0.002724 0.992864 0.002206 0.002206 0.001792 0.991200 0.001615 0.005393 0.005151 0.010157 0.940259 0.044433 0.017780 0.199839 0.761921 0.020459 0.230834 0.269936 0.119652 0.379577 0.233019 0.093692 0.034743 0.638546 0.194739 0.181763 0.175340 0.448159 0.145452 0.293709 0.335917 0.224922 Consensus sequence: DVHBTACTTCCGGHTHB Reverse complement motif 0.145452 0.335917 0.293709 0.224922 0.448159 0.181763 0.175340 0.194739 0.638546 0.093692 0.034743 0.233019 0.379577 0.269936 0.119652 0.230834 0.017780 0.761921 0.199839 0.020459 0.005151 0.940259 0.010157 0.044433 0.001792 0.001615 0.991200 0.005393 0.002724 0.002206 0.992864 0.002206 0.990801 0.001887 0.002470 0.004842 0.982714 0.000892 0.001401 0.014992 0.001110 0.006294 0.704391 0.288205 0.009546 0.003252 0.103113 0.884088 0.628772 0.204378 0.060299 0.106551 0.176569 0.342172 0.181438 0.299820 0.284336 0.162604 0.375266 0.177794 0.209701 0.227382 0.408003 0.154914 0.276571 0.069107 0.299350 0.354972 Consensus sequence: BHAHCCGGAAGTABDVD Alignment: BHAHCCGGAAGTABDVD ----GCCAAAGTAT--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00083 Tcf7l2_primary Reverse Complement Reverse Complement Backward 3 10 0.031469 Species: Mus musculus Original motif 0.285725 0.187143 0.254855 0.272277 0.276264 0.157893 0.258178 0.307665 0.238788 0.161120 0.254018 0.346074 0.076041 0.333901 0.150903 0.439156 0.093376 0.526578 0.180529 0.199517 0.010827 0.880320 0.034150 0.074703 0.016546 0.023834 0.000940 0.958680 0.007166 0.008215 0.001941 0.982678 0.029634 0.001363 0.001379 0.967625 0.010872 0.031751 0.926186 0.031190 0.949407 0.000760 0.002581 0.047253 0.109203 0.001362 0.002094 0.887341 0.044198 0.567994 0.353059 0.034749 0.222623 0.142360 0.041281 0.593736 0.358872 0.167597 0.220534 0.252997 0.233072 0.141480 0.230985 0.394463 0.350703 0.243129 0.233961 0.172207 Consensus sequence: DDDYCCTTTGATSTDDV Reverse complement motif 0.172207 0.243129 0.233961 0.350703 0.394463 0.141480 0.230985 0.233072 0.252997 0.167597 0.220534 0.358872 0.593736 0.142360 0.041281 0.222623 0.044198 0.353059 0.567994 0.034749 0.887341 0.001362 0.002094 0.109203 0.047253 0.000760 0.002581 0.949407 0.010872 0.926186 0.031751 0.031190 0.967625 0.001363 0.001379 0.029634 0.982678 0.008215 0.001941 0.007166 0.958680 0.023834 0.000940 0.016546 0.010827 0.034150 0.880320 0.074703 0.093376 0.180529 0.526578 0.199517 0.439156 0.333901 0.150903 0.076041 0.346074 0.161120 0.254018 0.238788 0.307665 0.157893 0.258178 0.276264 0.272277 0.187143 0.254855 0.285725 Consensus sequence: BDDASATCAAAGGMDDD Alignment: BDDASATCAAAGGMDDD -----GCCAAAGTAT-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00030 Sox11_primary Original Motif Reverse Complement Forward 3 10 0.031729 Species: Mus musculus Original motif 0.351812 0.238467 0.143954 0.265768 0.195246 0.235838 0.281473 0.287443 0.349478 0.172616 0.210739 0.267167 0.484061 0.110438 0.173131 0.232370 0.276692 0.070713 0.479604 0.172991 0.859124 0.044167 0.083951 0.012758 0.975608 0.002029 0.002285 0.020079 0.006422 0.978485 0.007124 0.007969 0.987489 0.003025 0.002868 0.006617 0.987739 0.005463 0.002730 0.004067 0.693013 0.004067 0.002445 0.300475 0.189100 0.003677 0.801408 0.005814 0.352090 0.072517 0.567737 0.007656 0.542316 0.176545 0.192768 0.088371 0.196382 0.304176 0.205985 0.293457 0.289415 0.201358 0.182937 0.326290 0.385801 0.216362 0.152363 0.245475 Consensus sequence: HBDDRAACAAAGRABHH Reverse complement motif 0.245475 0.216362 0.152363 0.385801 0.326290 0.201358 0.182937 0.289415 0.196382 0.205985 0.304176 0.293457 0.088371 0.176545 0.192768 0.542316 0.352090 0.567737 0.072517 0.007656 0.189100 0.801408 0.003677 0.005814 0.300475 0.004067 0.002445 0.693013 0.004067 0.005463 0.002730 0.987739 0.006617 0.003025 0.002868 0.987489 0.006422 0.007124 0.978485 0.007969 0.020079 0.002029 0.002285 0.975608 0.012758 0.044167 0.083951 0.859124 0.276692 0.479604 0.070713 0.172991 0.232370 0.110438 0.173131 0.484061 0.267167 0.172616 0.210739 0.349478 0.287443 0.235838 0.281473 0.195246 0.265768 0.238467 0.143954 0.351812 Consensus sequence: HHBTMCTTTGTTMDDVH Alignment: HHBTMCTTTGTTMDDVH --ATACTTTGGC----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00062 Sox4_primary Original Motif Reverse Complement Forward 3 10 0.031914 Species: Mus musculus Original motif 0.427843 0.231210 0.119424 0.221523 0.196506 0.239531 0.304906 0.259057 0.302488 0.156922 0.290190 0.250401 0.433872 0.149126 0.196496 0.220506 0.258426 0.076511 0.475100 0.189963 0.841714 0.046453 0.099915 0.011918 0.983853 0.001612 0.001362 0.013174 0.003460 0.982032 0.005728 0.008780 0.989743 0.002253 0.002020 0.005984 0.990761 0.003397 0.002843 0.003000 0.770864 0.003540 0.001549 0.224048 0.235342 0.002598 0.757383 0.004677 0.371426 0.089574 0.529959 0.009040 0.480804 0.196949 0.240413 0.081833 0.187158 0.355102 0.216599 0.241142 0.248006 0.232182 0.157452 0.362360 0.403367 0.177684 0.164649 0.254300 Consensus sequence: HBDDDAACAAAGRVBHH Reverse complement motif 0.254300 0.177684 0.164649 0.403367 0.362360 0.232182 0.157452 0.248006 0.187158 0.216599 0.355102 0.241142 0.081833 0.196949 0.240413 0.480804 0.371426 0.529959 0.089574 0.009040 0.235342 0.757383 0.002598 0.004677 0.224048 0.003540 0.001549 0.770864 0.003000 0.003397 0.002843 0.990761 0.005984 0.002253 0.002020 0.989743 0.003460 0.005728 0.982032 0.008780 0.013174 0.001612 0.001362 0.983853 0.011918 0.046453 0.099915 0.841714 0.258426 0.475100 0.076511 0.189963 0.220506 0.149126 0.196496 0.433872 0.250401 0.156922 0.290190 0.302488 0.196506 0.304906 0.239531 0.259057 0.221523 0.231210 0.119424 0.427843 Consensus sequence: HHBBMCTTTGTTHDDBH Alignment: HHBBMCTTTGTTHDDBH --ATACTTTGGC----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00035 Hic1_primary Reverse Complement Original Motif Forward 6 10 0.032301 Species: Mus musculus Original motif 0.275207 0.211375 0.250277 0.263141 0.135064 0.327571 0.217556 0.319808 0.145659 0.242586 0.267179 0.344576 0.656519 0.009712 0.315174 0.018595 0.002265 0.004755 0.001656 0.991325 0.041873 0.001128 0.955340 0.001659 0.001306 0.974834 0.022215 0.001645 0.001978 0.992066 0.002638 0.003317 0.921032 0.072388 0.001237 0.005344 0.582027 0.211694 0.115736 0.090542 0.005990 0.927450 0.028306 0.038254 0.027374 0.799879 0.053667 0.119080 0.203510 0.191263 0.168997 0.436229 0.402253 0.154087 0.291346 0.152314 0.201201 0.414412 0.145330 0.239056 0.241094 0.332661 0.143464 0.282781 Consensus sequence: DBBATGCCAACCHVHH Reverse complement motif 0.241094 0.143464 0.332661 0.282781 0.201201 0.145330 0.414412 0.239056 0.152314 0.154087 0.291346 0.402253 0.436229 0.191263 0.168997 0.203510 0.027374 0.053667 0.799879 0.119080 0.005990 0.028306 0.927450 0.038254 0.090542 0.211694 0.115736 0.582027 0.005344 0.072388 0.001237 0.921032 0.001978 0.002638 0.992066 0.003317 0.001306 0.022215 0.974834 0.001645 0.041873 0.955340 0.001128 0.001659 0.991325 0.004755 0.001656 0.002265 0.018595 0.009712 0.315174 0.656519 0.344576 0.242586 0.267179 0.145659 0.135064 0.217556 0.327571 0.319808 0.263141 0.211375 0.250277 0.275207 Consensus sequence: DDBHGGTTGGCATVBD Alignment: DBBATGCCAACCHVHH -----GCCAAAGTAT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00146 Pou6f1_3733.1 Original Motif Original Motif Backward 4 10 0.032571 Species: Mus musculus Original motif 0.380020 0.211224 0.295981 0.112776 0.349734 0.309602 0.075135 0.265530 0.356459 0.226592 0.169646 0.247302 0.229673 0.350174 0.311906 0.108247 0.757838 0.046686 0.016036 0.179440 0.014478 0.002669 0.000464 0.982389 0.984156 0.000563 0.002241 0.013039 0.992195 0.001470 0.001823 0.004511 0.001610 0.002156 0.003120 0.993114 0.008328 0.001327 0.802239 0.188106 0.990155 0.004149 0.002815 0.002881 0.004992 0.004117 0.965215 0.025676 0.091361 0.290495 0.533319 0.084826 0.164763 0.143217 0.028702 0.663317 0.164550 0.118473 0.276288 0.440689 0.152985 0.151847 0.413228 0.281941 0.241185 0.447249 0.135344 0.176222 Consensus sequence: VHHVATAATGAGSTDDH Reverse complement motif 0.241185 0.135344 0.447249 0.176222 0.152985 0.413228 0.151847 0.281941 0.440689 0.118473 0.276288 0.164550 0.663317 0.143217 0.028702 0.164763 0.091361 0.533319 0.290495 0.084826 0.004992 0.965215 0.004117 0.025676 0.002881 0.004149 0.002815 0.990155 0.008328 0.802239 0.001327 0.188106 0.993114 0.002156 0.003120 0.001610 0.004511 0.001470 0.001823 0.992195 0.013039 0.000563 0.002241 0.984156 0.982389 0.002669 0.000464 0.014478 0.179440 0.046686 0.016036 0.757838 0.229673 0.311906 0.350174 0.108247 0.247302 0.226592 0.169646 0.356459 0.265530 0.309602 0.075135 0.349734 0.112776 0.211224 0.295981 0.380020 Consensus sequence: DHDASCTCATTATVHHB Alignment: VHHVATAATGAGSTDDH ----ATACTTTGGC--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00067 Lef1_primary Original Motif Original Motif Backward 6 10 0.033022 Species: Mus musculus Original motif 0.281920 0.214207 0.278077 0.225796 0.325566 0.151435 0.298797 0.224202 0.290253 0.145824 0.243443 0.320480 0.069286 0.404645 0.141614 0.384454 0.070044 0.621448 0.142647 0.165862 0.007295 0.907657 0.038110 0.046938 0.015587 0.018273 0.000658 0.965482 0.005527 0.005886 0.001905 0.986682 0.024512 0.001189 0.001344 0.972955 0.007384 0.025221 0.952270 0.015125 0.966438 0.000630 0.002693 0.030239 0.082252 0.001173 0.001495 0.915080 0.030255 0.677155 0.275323 0.017267 0.199467 0.118815 0.056814 0.624905 0.345445 0.169597 0.216831 0.268127 0.278106 0.150864 0.173693 0.397336 0.251834 0.339733 0.219703 0.188730 Consensus sequence: DDDYCCTTTGATCTDDV Reverse complement motif 0.251834 0.219703 0.339733 0.188730 0.397336 0.150864 0.173693 0.278106 0.268127 0.169597 0.216831 0.345445 0.624905 0.118815 0.056814 0.199467 0.030255 0.275323 0.677155 0.017267 0.915080 0.001173 0.001495 0.082252 0.030239 0.000630 0.002693 0.966438 0.007384 0.952270 0.025221 0.015125 0.972955 0.001189 0.001344 0.024512 0.986682 0.005886 0.001905 0.005527 0.965482 0.018273 0.000658 0.015587 0.007295 0.038110 0.907657 0.046938 0.070044 0.142647 0.621448 0.165862 0.069286 0.141614 0.404645 0.384454 0.320480 0.145824 0.243443 0.290253 0.224202 0.151435 0.298797 0.325566 0.225796 0.214207 0.278077 0.281920 Consensus sequence: VDDAGATCAAAGGKDDD Alignment: DDDYCCTTTGATCTDDV --ATACTTTGGC----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 4 Motif ID: 70 Motif name: CagTGCTCCACTGTGgT Original motif 0.150000 0.700000 0.016667 0.133333 0.650000 0.150000 0.050000 0.150000 0.166667 0.116667 0.633333 0.083333 0.050000 0.033333 0.066667 0.850000 0.050000 0.000000 0.833333 0.116667 0.016667 0.966667 0.000000 0.016667 0.050000 0.016667 0.000000 0.933333 0.066667 0.833333 0.066667 0.033333 0.033333 0.966667 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.050000 0.916667 0.016667 0.016667 0.166667 0.000000 0.000000 0.833333 0.083333 0.016667 0.900000 0.000000 0.000000 0.016667 0.016667 0.966667 0.000000 0.016667 0.966667 0.016667 0.116667 0.166667 0.483333 0.233333 0.066667 0.083333 0.050000 0.800000 Consensus sequence: CAGTGCTCCACTGTGBT Reserve complement motif 0.800000 0.083333 0.050000 0.066667 0.116667 0.483333 0.166667 0.233333 0.000000 0.966667 0.016667 0.016667 0.966667 0.016667 0.016667 0.000000 0.083333 0.900000 0.016667 0.000000 0.833333 0.000000 0.000000 0.166667 0.050000 0.016667 0.916667 0.016667 0.000000 0.000000 0.000000 1.000000 0.033333 0.000000 0.966667 0.000000 0.066667 0.066667 0.833333 0.033333 0.933333 0.016667 0.000000 0.050000 0.016667 0.000000 0.966667 0.016667 0.050000 0.833333 0.000000 0.116667 0.850000 0.033333 0.066667 0.050000 0.166667 0.633333 0.116667 0.083333 0.150000 0.150000 0.050000 0.650000 0.150000 0.016667 0.700000 0.133333 Consensus sequence: ABCACAGTGGAGCACTG ************************************************************************ Best Matches for Motif ID 70 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v015681_primary Reverse Complement Reverse Complement Backward 4 17 0.041931 Species: Mus musculus Original motif 0.472795 0.179227 0.091251 0.256726 0.036521 0.159743 0.204840 0.598896 0.164582 0.312805 0.221324 0.301289 0.237069 0.249050 0.293048 0.220833 0.401949 0.225181 0.229401 0.143469 0.161422 0.494334 0.252207 0.092036 0.252940 0.177721 0.369400 0.199939 0.119630 0.024651 0.849920 0.005798 0.000962 0.002398 0.990616 0.006023 0.937852 0.027016 0.034535 0.000597 0.008963 0.987756 0.000629 0.002652 0.001584 0.992898 0.002349 0.003169 0.956822 0.027342 0.002484 0.013352 0.009873 0.987759 0.000988 0.001381 0.016397 0.980856 0.000369 0.002378 0.081761 0.758555 0.038572 0.121112 0.371713 0.091838 0.448027 0.088423 0.111617 0.121913 0.683885 0.082585 0.334562 0.102916 0.436488 0.126034 0.210362 0.101261 0.238339 0.450037 0.169041 0.271583 0.320799 0.238576 0.140316 0.049885 0.735236 0.074563 Consensus sequence: HTBVVVDGGACCACCCRGRDBG Reverse complement motif 0.140316 0.735236 0.049885 0.074563 0.169041 0.320799 0.271583 0.238576 0.450037 0.101261 0.238339 0.210362 0.334562 0.436488 0.102916 0.126034 0.111617 0.683885 0.121913 0.082585 0.371713 0.448027 0.091838 0.088423 0.081761 0.038572 0.758555 0.121112 0.016397 0.000369 0.980856 0.002378 0.009873 0.000988 0.987759 0.001381 0.013352 0.027342 0.002484 0.956822 0.001584 0.002349 0.992898 0.003169 0.008963 0.000629 0.987756 0.002652 0.000597 0.027016 0.034535 0.937852 0.000962 0.990616 0.002398 0.006023 0.119630 0.849920 0.024651 0.005798 0.252940 0.369400 0.177721 0.199939 0.161422 0.252207 0.494334 0.092036 0.143469 0.225181 0.229401 0.401949 0.237069 0.293048 0.249050 0.220833 0.164582 0.221324 0.312805 0.301289 0.598896 0.159743 0.204840 0.036521 0.256726 0.179227 0.091251 0.472795 Consensus sequence: CBDMCMGGGTGGTCCHVBVBAH Alignment: CBDMCMGGGTGGTCCHVBVBAH --ABCACAGTGGAGCACTG--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00034 Sox7_primary Reverse Complement Original Motif Backward 1 17 0.050190 Species: Mus musculus Original motif 0.360997 0.300272 0.115555 0.223177 0.309749 0.228429 0.166233 0.295589 0.149419 0.176868 0.240155 0.433558 0.379704 0.095791 0.276373 0.248133 0.394549 0.174184 0.130641 0.300626 0.443749 0.070776 0.211081 0.274393 0.364301 0.074356 0.370406 0.190936 0.791976 0.038475 0.093390 0.076159 0.963721 0.001826 0.002456 0.031997 0.004516 0.954596 0.008092 0.032796 0.981080 0.002062 0.002161 0.014697 0.986185 0.001846 0.006976 0.004992 0.059567 0.003649 0.002189 0.934595 0.495328 0.024257 0.240450 0.239965 0.305027 0.094878 0.526069 0.074025 0.418442 0.196237 0.158323 0.226998 0.336713 0.220452 0.191155 0.251680 0.192296 0.300342 0.169047 0.338315 0.240387 0.144634 0.128513 0.486465 0.290763 0.271259 0.116600 0.321377 0.224825 0.296233 0.229255 0.249687 0.493240 0.171285 0.075148 0.260326 Consensus sequence: HHBDHDDAACAATDRHHHHHBW Reverse complement motif 0.260326 0.171285 0.075148 0.493240 0.224825 0.229255 0.296233 0.249687 0.321377 0.271259 0.116600 0.290763 0.486465 0.144634 0.128513 0.240387 0.338315 0.300342 0.169047 0.192296 0.251680 0.220452 0.191155 0.336713 0.226998 0.196237 0.158323 0.418442 0.305027 0.526069 0.094878 0.074025 0.239965 0.024257 0.240450 0.495328 0.934595 0.003649 0.002189 0.059567 0.004992 0.001846 0.006976 0.986185 0.014697 0.002062 0.002161 0.981080 0.004516 0.008092 0.954596 0.032796 0.031997 0.001826 0.002456 0.963721 0.076159 0.038475 0.093390 0.791976 0.364301 0.370406 0.074356 0.190936 0.274393 0.070776 0.211081 0.443749 0.300626 0.174184 0.130641 0.394549 0.248133 0.095791 0.276373 0.379704 0.433558 0.176868 0.240155 0.149419 0.295589 0.228429 0.166233 0.309749 0.223177 0.300272 0.115555 0.360997 Consensus sequence: WBHHHHHMDATTGTTHDHDVHH Alignment: HHBDHDDAACAATDRHHHHHBW -----ABCACAGTGGAGCACTG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v016060_primary Original Motif Reverse Complement Forward 3 17 0.050478 Species: Mus musculus Original motif 0.204923 0.208846 0.365383 0.220848 0.294304 0.300143 0.167287 0.238266 0.109711 0.619514 0.117379 0.153396 0.178979 0.378580 0.230177 0.212264 0.159594 0.542602 0.118178 0.179627 0.125206 0.430074 0.151826 0.292894 0.097692 0.709845 0.116956 0.075506 0.148292 0.565912 0.037632 0.248164 0.077951 0.034190 0.855503 0.032356 0.001657 0.001061 0.971877 0.025405 0.001926 0.001084 0.991712 0.005278 0.033031 0.012001 0.057796 0.897171 0.002723 0.002647 0.993348 0.001281 0.003261 0.000963 0.987199 0.008577 0.000611 0.090925 0.074857 0.833608 0.015299 0.978878 0.004949 0.000874 0.013368 0.600902 0.033485 0.352245 0.231949 0.149575 0.118804 0.499672 0.267580 0.186002 0.371242 0.175176 0.264884 0.223483 0.110082 0.401551 0.221365 0.170121 0.179559 0.428955 0.112997 0.692930 0.139981 0.054092 0.460305 0.207883 0.155111 0.176702 Consensus sequence: BHCBCBCCGGGTGGTCYHVHDCH Reverse complement motif 0.176702 0.207883 0.155111 0.460305 0.112997 0.139981 0.692930 0.054092 0.428955 0.170121 0.179559 0.221365 0.401551 0.223483 0.110082 0.264884 0.267580 0.371242 0.186002 0.175176 0.499672 0.149575 0.118804 0.231949 0.013368 0.033485 0.600902 0.352245 0.015299 0.004949 0.978878 0.000874 0.833608 0.090925 0.074857 0.000611 0.003261 0.987199 0.000963 0.008577 0.002723 0.993348 0.002647 0.001281 0.897171 0.012001 0.057796 0.033031 0.001926 0.991712 0.001084 0.005278 0.001657 0.971877 0.001061 0.025405 0.077951 0.855503 0.034190 0.032356 0.148292 0.037632 0.565912 0.248164 0.097692 0.116956 0.709845 0.075506 0.125206 0.151826 0.430074 0.292894 0.159594 0.118178 0.542602 0.179627 0.178979 0.230177 0.378580 0.212264 0.109711 0.117379 0.619514 0.153396 0.294304 0.167287 0.300143 0.238266 0.204923 0.365383 0.208846 0.220848 Consensus sequence: HGDHVHKGACCACCCGGBGBGDB Alignment: HGDHVHKGACCACCCGGBGBGDB --CAGTGCTCCACTGTGBT---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00022 Zfp740_secondary Original Motif Original Motif Forward 1 17 0.051309 Species: Mus musculus Original motif 0.398967 0.071604 0.323957 0.205472 0.457709 0.058192 0.267218 0.216881 0.393346 0.032365 0.329533 0.244756 0.119528 0.091191 0.190078 0.599202 0.273933 0.123548 0.073075 0.529444 0.068935 0.812883 0.015245 0.102937 0.029664 0.907790 0.024804 0.037742 0.020725 0.933422 0.016796 0.029057 0.015086 0.948448 0.018030 0.018436 0.015628 0.884941 0.061172 0.038259 0.067508 0.744063 0.107305 0.081125 0.108097 0.140614 0.650174 0.101115 0.065696 0.247239 0.506149 0.180916 0.395005 0.077185 0.345914 0.181895 0.527081 0.093650 0.281853 0.097416 0.289378 0.245159 0.348803 0.116660 0.147136 0.260117 0.145993 0.446754 Consensus sequence: DDDTWCCCCCCGGDRVH Reverse complement motif 0.446754 0.260117 0.145993 0.147136 0.289378 0.348803 0.245159 0.116660 0.097416 0.093650 0.281853 0.527081 0.181895 0.077185 0.345914 0.395005 0.065696 0.506149 0.247239 0.180916 0.108097 0.650174 0.140614 0.101115 0.067508 0.107305 0.744063 0.081125 0.015628 0.061172 0.884941 0.038259 0.015086 0.018030 0.948448 0.018436 0.020725 0.016796 0.933422 0.029057 0.029664 0.024804 0.907790 0.037742 0.068935 0.015245 0.812883 0.102937 0.529444 0.123548 0.073075 0.273933 0.599202 0.091191 0.190078 0.119528 0.244756 0.032365 0.329533 0.393346 0.216881 0.058192 0.267218 0.457709 0.205472 0.071604 0.323957 0.398967 Consensus sequence: HVKDCCGGGGGGWADDD Alignment: DDDTWCCCCCCGGDRVH CAGTGCTCCACTGTGBT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v015681_secondary Original Motif Reverse Complement Forward 2 17 0.051651 Species: Mus musculus Original motif 0.214165 0.143436 0.372522 0.269876 0.314445 0.406003 0.160351 0.119201 0.137147 0.092924 0.042921 0.727007 0.044121 0.072843 0.051741 0.831295 0.261292 0.324124 0.298498 0.116086 0.258125 0.323243 0.263362 0.155271 0.204557 0.589399 0.107153 0.098891 0.371021 0.244027 0.291102 0.093849 0.096327 0.572718 0.011797 0.319159 0.027282 0.046183 0.844519 0.082016 0.018921 0.012887 0.915917 0.052275 0.364793 0.166722 0.084229 0.384256 0.028216 0.011233 0.951056 0.009495 0.054974 0.004738 0.890377 0.049911 0.006802 0.312915 0.134247 0.546036 0.241289 0.628210 0.104788 0.025713 0.237863 0.302807 0.213018 0.246311 0.349399 0.203220 0.086635 0.360746 0.386634 0.144693 0.246895 0.221779 0.425101 0.354676 0.093374 0.126849 0.060272 0.391320 0.104905 0.443503 0.162090 0.190233 0.227433 0.420244 Consensus sequence: DVTTVVCVYGGHGGYCHHDMYB Reverse complement motif 0.420244 0.190233 0.227433 0.162090 0.443503 0.391320 0.104905 0.060272 0.126849 0.354676 0.093374 0.425101 0.221779 0.144693 0.246895 0.386634 0.360746 0.203220 0.086635 0.349399 0.237863 0.213018 0.302807 0.246311 0.241289 0.104788 0.628210 0.025713 0.546036 0.312915 0.134247 0.006802 0.054974 0.890377 0.004738 0.049911 0.028216 0.951056 0.011233 0.009495 0.384256 0.166722 0.084229 0.364793 0.018921 0.915917 0.012887 0.052275 0.027282 0.844519 0.046183 0.082016 0.096327 0.011797 0.572718 0.319159 0.093849 0.244027 0.291102 0.371021 0.204557 0.107153 0.589399 0.098891 0.258125 0.263362 0.323243 0.155271 0.261292 0.298498 0.324124 0.116086 0.831295 0.072843 0.051741 0.044121 0.727007 0.092924 0.042921 0.137147 0.314445 0.160351 0.406003 0.119201 0.214165 0.372522 0.143436 0.269876 Consensus sequence: VMYDHDGMCCHCCKBGVVAAVH Alignment: VMYDHDGMCCHCCKBGVVAAVH -CAGTGCTCCACTGTGBT---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00528 Foxm1_primary Reverse Complement Reverse Complement Forward 3 17 0.052352 Species: Mus musculus Original motif 0.402634 0.249702 0.143705 0.203959 0.709619 0.108953 0.130781 0.050647 0.334232 0.077498 0.228818 0.359452 0.131721 0.094794 0.234481 0.539005 0.170102 0.237609 0.252464 0.339824 0.244961 0.347304 0.228129 0.179606 0.612141 0.132244 0.180110 0.075504 0.472236 0.042388 0.234419 0.250957 0.125213 0.007413 0.849788 0.017587 0.702068 0.064216 0.141992 0.091724 0.008657 0.038238 0.002959 0.950145 0.007170 0.002244 0.986824 0.003763 0.002862 0.979956 0.000711 0.016471 0.971196 0.001954 0.011441 0.015409 0.105575 0.031482 0.022836 0.840107 0.031534 0.736742 0.032785 0.198939 0.479153 0.347558 0.031799 0.141490 0.056405 0.123140 0.023989 0.796466 0.111194 0.195344 0.501360 0.192102 0.376359 0.416820 0.072818 0.134004 0.225111 0.249460 0.306563 0.218866 0.405251 0.168478 0.108618 0.317653 0.165386 0.191749 0.268604 0.374261 Consensus sequence: HADTBVADGATGCATCMTGMVHB Reverse complement motif 0.374261 0.191749 0.268604 0.165386 0.317653 0.168478 0.108618 0.405251 0.225111 0.306563 0.249460 0.218866 0.376359 0.072818 0.416820 0.134004 0.111194 0.501360 0.195344 0.192102 0.796466 0.123140 0.023989 0.056405 0.141490 0.347558 0.031799 0.479153 0.031534 0.032785 0.736742 0.198939 0.840107 0.031482 0.022836 0.105575 0.015409 0.001954 0.011441 0.971196 0.002862 0.000711 0.979956 0.016471 0.007170 0.986824 0.002244 0.003763 0.950145 0.038238 0.002959 0.008657 0.091724 0.064216 0.141992 0.702068 0.125213 0.849788 0.007413 0.017587 0.250957 0.042388 0.234419 0.472236 0.075504 0.132244 0.180110 0.612141 0.244961 0.228129 0.347304 0.179606 0.339824 0.237609 0.252464 0.170102 0.539005 0.094794 0.234481 0.131721 0.359452 0.077498 0.228818 0.334232 0.050647 0.108953 0.130781 0.709619 0.203959 0.249702 0.143705 0.402634 Consensus sequence: VHVRCAYGATGCATCDTVVADTH Alignment: VHVRCAYGATGCATCDTVVADTH --ABCACAGTGGAGCACTG---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v016060_primary Reverse Complement Reverse Complement Forward 3 17 0.053668 Species: Mus musculus Original motif 0.180868 0.321661 0.134642 0.362829 0.232215 0.134289 0.315356 0.318141 0.065068 0.093681 0.569842 0.271408 0.370822 0.229680 0.154738 0.244759 0.323039 0.182873 0.173588 0.320500 0.175039 0.266898 0.276080 0.281984 0.412669 0.147730 0.146326 0.293275 0.325953 0.028805 0.629596 0.015646 0.003017 0.001766 0.979711 0.015507 0.888973 0.040666 0.069420 0.000941 0.017309 0.979155 0.000899 0.002637 0.001732 0.988816 0.004856 0.004596 0.889763 0.078125 0.010384 0.021729 0.007566 0.987081 0.001421 0.003932 0.027797 0.966593 0.000878 0.004731 0.025816 0.867003 0.065749 0.041433 0.220658 0.075256 0.582904 0.121182 0.088946 0.283695 0.565345 0.062015 0.328012 0.241332 0.305901 0.124755 0.307302 0.137589 0.375928 0.179181 0.298752 0.231470 0.315255 0.154524 0.094565 0.142901 0.705696 0.056838 Consensus sequence: HDGHHBHRGACCACCCGSVDVG Reverse complement motif 0.094565 0.705696 0.142901 0.056838 0.298752 0.315255 0.231470 0.154524 0.307302 0.375928 0.137589 0.179181 0.124755 0.241332 0.305901 0.328012 0.088946 0.565345 0.283695 0.062015 0.220658 0.582904 0.075256 0.121182 0.025816 0.065749 0.867003 0.041433 0.027797 0.000878 0.966593 0.004731 0.007566 0.001421 0.987081 0.003932 0.021729 0.078125 0.010384 0.889763 0.001732 0.004856 0.988816 0.004596 0.017309 0.000899 0.979155 0.002637 0.000941 0.040666 0.069420 0.888973 0.003017 0.979711 0.001766 0.015507 0.325953 0.629596 0.028805 0.015646 0.293275 0.147730 0.146326 0.412669 0.281984 0.266898 0.276080 0.175039 0.320500 0.182873 0.173588 0.323039 0.244759 0.229680 0.154738 0.370822 0.065068 0.569842 0.093681 0.271408 0.318141 0.134289 0.315356 0.232215 0.362829 0.321661 0.134642 0.180868 Consensus sequence: CVHBSCGGGTGGTCMHVHHCDH Alignment: CVHBSCGGGTGGTCMHVHHCDH --ABCACAGTGGAGCACTG--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00050 Bhlhb2_secondary Reverse Complement Original Motif Forward 6 17 0.053902 Species: Mus musculus Original motif 0.120938 0.344851 0.124072 0.410138 0.220931 0.169844 0.422396 0.186829 0.127752 0.260812 0.103811 0.507625 0.140641 0.405473 0.287668 0.166218 0.296957 0.155579 0.301094 0.246370 0.219647 0.287193 0.154072 0.339087 0.049294 0.026059 0.121789 0.802859 0.520042 0.289284 0.173423 0.017251 0.049190 0.943472 0.004308 0.003030 0.902609 0.006767 0.074770 0.015854 0.003221 0.971329 0.005512 0.019937 0.019937 0.005512 0.971329 0.003221 0.015854 0.074770 0.006767 0.902609 0.003030 0.004308 0.943472 0.049190 0.003497 0.088920 0.685942 0.221641 0.802859 0.121789 0.026059 0.049294 0.334544 0.155170 0.275193 0.235092 0.275957 0.132104 0.454982 0.136957 0.134097 0.254352 0.422940 0.188611 0.396163 0.432784 0.051281 0.119772 0.276474 0.115627 0.419844 0.188056 0.160759 0.088061 0.649863 0.101318 0.203314 0.166595 0.106821 0.523270 Consensus sequence: YDYBDHTMCACGTGGADDBMDGT Reverse complement motif 0.523270 0.166595 0.106821 0.203314 0.160759 0.649863 0.088061 0.101318 0.276474 0.419844 0.115627 0.188056 0.396163 0.051281 0.432784 0.119772 0.134097 0.422940 0.254352 0.188611 0.275957 0.454982 0.132104 0.136957 0.235092 0.155170 0.275193 0.334544 0.049294 0.121789 0.026059 0.802859 0.003497 0.685942 0.088920 0.221641 0.003030 0.943472 0.004308 0.049190 0.902609 0.074770 0.006767 0.015854 0.019937 0.971329 0.005512 0.003221 0.003221 0.005512 0.971329 0.019937 0.015854 0.006767 0.074770 0.902609 0.049190 0.004308 0.943472 0.003030 0.017251 0.289284 0.173423 0.520042 0.802859 0.026059 0.121789 0.049294 0.339087 0.287193 0.154072 0.219647 0.296957 0.301094 0.155579 0.246370 0.140641 0.287668 0.405473 0.166218 0.507625 0.260812 0.103811 0.127752 0.220931 0.422396 0.169844 0.186829 0.410138 0.344851 0.124072 0.120938 Consensus sequence: ACHRBHDTCCACGTGYAHHBMHM Alignment: YDYBDHTMCACGTGGADDBMDGT -----ABCACAGTGGAGCACTG- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00042 Gm397_primary Reverse Complement Reverse Complement Backward 1 17 0.055821 Species: Mus musculus Original motif 0.248614 0.321010 0.201723 0.228654 0.332381 0.190810 0.184854 0.291955 0.253802 0.119338 0.331394 0.295466 0.577827 0.100884 0.130066 0.191223 0.180374 0.011174 0.042942 0.765510 0.009131 0.024996 0.962422 0.003450 0.003308 0.034731 0.002930 0.959032 0.063907 0.001099 0.933714 0.001280 0.001280 0.933714 0.001099 0.063907 0.959032 0.002930 0.034731 0.003308 0.003450 0.962422 0.024996 0.009131 0.765510 0.042942 0.011174 0.180374 0.026456 0.256356 0.130672 0.586516 0.589555 0.285548 0.036864 0.088034 0.265828 0.529813 0.031915 0.172445 0.209015 0.104817 0.374275 0.311892 0.224283 0.292805 0.144270 0.338642 Consensus sequence: HHDATGTGCACATAMDH Reverse complement motif 0.338642 0.292805 0.144270 0.224283 0.209015 0.374275 0.104817 0.311892 0.265828 0.031915 0.529813 0.172445 0.088034 0.285548 0.036864 0.589555 0.586516 0.256356 0.130672 0.026456 0.180374 0.042942 0.011174 0.765510 0.003450 0.024996 0.962422 0.009131 0.003308 0.002930 0.034731 0.959032 0.001280 0.001099 0.933714 0.063907 0.063907 0.933714 0.001099 0.001280 0.959032 0.034731 0.002930 0.003308 0.009131 0.962422 0.024996 0.003450 0.765510 0.011174 0.042942 0.180374 0.191223 0.100884 0.130066 0.577827 0.253802 0.331394 0.119338 0.295466 0.291955 0.190810 0.184854 0.332381 0.248614 0.201723 0.321010 0.228654 Consensus sequence: HHRTATGTGCACATHHD Alignment: HHRTATGTGCACATHHD ABCACAGTGGAGCACTG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00526 Foxn1_secondary Original Motif Reverse Complement Forward 5 17 0.055867 Species: Mus musculus Original motif 0.477863 0.106306 0.184102 0.231729 0.304951 0.149020 0.361418 0.184612 0.548996 0.056128 0.348902 0.045974 0.385727 0.477782 0.086218 0.050273 0.409556 0.232265 0.173851 0.184328 0.174550 0.312880 0.307123 0.205448 0.850398 0.047204 0.041665 0.060734 0.141234 0.548534 0.142230 0.168002 0.059462 0.026354 0.892948 0.021236 0.053714 0.870297 0.028935 0.047055 0.086273 0.069147 0.805284 0.039296 0.033781 0.573881 0.034115 0.358223 0.035191 0.079663 0.824970 0.060176 0.051830 0.862631 0.019359 0.066180 0.178685 0.015738 0.762485 0.043092 0.058988 0.042615 0.017608 0.880789 0.202382 0.173360 0.284095 0.340163 0.098493 0.234651 0.506524 0.160333 0.109087 0.336204 0.250510 0.304198 0.130945 0.250843 0.177122 0.441090 0.353830 0.138838 0.162784 0.344548 0.114290 0.417163 0.160662 0.307885 Consensus sequence: DDRMHBACGCGYGCGTDGBBDB Reverse complement motif 0.114290 0.160662 0.417163 0.307885 0.344548 0.138838 0.162784 0.353830 0.441090 0.250843 0.177122 0.130945 0.109087 0.250510 0.336204 0.304198 0.098493 0.506524 0.234651 0.160333 0.340163 0.173360 0.284095 0.202382 0.880789 0.042615 0.017608 0.058988 0.178685 0.762485 0.015738 0.043092 0.051830 0.019359 0.862631 0.066180 0.035191 0.824970 0.079663 0.060176 0.033781 0.034115 0.573881 0.358223 0.086273 0.805284 0.069147 0.039296 0.053714 0.028935 0.870297 0.047055 0.059462 0.892948 0.026354 0.021236 0.141234 0.142230 0.548534 0.168002 0.060734 0.047204 0.041665 0.850398 0.174550 0.307123 0.312880 0.205448 0.184328 0.232265 0.173851 0.409556 0.385727 0.086218 0.477782 0.050273 0.045974 0.056128 0.348902 0.548996 0.304951 0.361418 0.149020 0.184612 0.231729 0.106306 0.184102 0.477863 Consensus sequence: BDVBCDACGCKCGCGTBHRKHD Alignment: BDVBCDACGCKCGCGTBHRKHD ----CAGTGCTCCACTGTGBT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 4 Motif ID: 71 Motif name: AmTGTGACACCACAGT Original motif 0.703125 0.187500 0.015625 0.093750 0.265625 0.500000 0.125000 0.109375 0.015625 0.046875 0.031250 0.906250 0.078125 0.015625 0.890625 0.015625 0.000000 0.000000 0.000000 1.000000 0.000000 0.031250 0.906250 0.062500 0.953125 0.000000 0.015625 0.031250 0.046875 0.890625 0.000000 0.062500 0.968750 0.000000 0.015625 0.015625 0.109375 0.781250 0.062500 0.046875 0.062500 0.890625 0.000000 0.046875 0.953125 0.000000 0.031250 0.015625 0.031250 0.781250 0.046875 0.140625 0.937500 0.015625 0.031250 0.015625 0.093750 0.078125 0.734375 0.093750 0.031250 0.078125 0.000000 0.890625 Consensus sequence: AMTGTGACACCACAGT Reserve complement motif 0.890625 0.078125 0.000000 0.031250 0.093750 0.734375 0.078125 0.093750 0.015625 0.015625 0.031250 0.937500 0.031250 0.046875 0.781250 0.140625 0.015625 0.000000 0.031250 0.953125 0.062500 0.000000 0.890625 0.046875 0.109375 0.062500 0.781250 0.046875 0.015625 0.000000 0.015625 0.968750 0.046875 0.000000 0.890625 0.062500 0.031250 0.000000 0.015625 0.953125 0.000000 0.906250 0.031250 0.062500 1.000000 0.000000 0.000000 0.000000 0.078125 0.890625 0.015625 0.015625 0.906250 0.046875 0.031250 0.015625 0.265625 0.125000 0.500000 0.109375 0.093750 0.187500 0.015625 0.703125 Consensus sequence: ACTGTGGTGTCACART ************************************************************************ Best Matches for Motif ID 71 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00020 Atf1_primary Original Motif Original Motif Forward 1 16 0.027393 Species: Mus musculus Original motif 0.381335 0.135129 0.244887 0.238648 0.139538 0.419619 0.195665 0.245178 0.158070 0.098493 0.409974 0.333462 0.472756 0.096594 0.388246 0.042403 0.008868 0.028811 0.005332 0.956990 0.014102 0.014269 0.863476 0.108153 0.962594 0.004653 0.011816 0.020937 0.003091 0.949099 0.003165 0.044646 0.044646 0.003165 0.949099 0.003091 0.020937 0.011816 0.004653 0.962594 0.108153 0.863476 0.014269 0.014102 0.956990 0.005332 0.028811 0.008868 0.049761 0.357863 0.144826 0.447550 0.225769 0.448432 0.142340 0.183460 0.264766 0.097627 0.493031 0.144576 0.352319 0.180279 0.236767 0.230635 Consensus sequence: DBDRTGACGTCAYHRD Reverse complement motif 0.230635 0.180279 0.236767 0.352319 0.264766 0.493031 0.097627 0.144576 0.225769 0.142340 0.448432 0.183460 0.447550 0.357863 0.144826 0.049761 0.008868 0.005332 0.028811 0.956990 0.108153 0.014269 0.863476 0.014102 0.962594 0.011816 0.004653 0.020937 0.044646 0.949099 0.003165 0.003091 0.003091 0.003165 0.949099 0.044646 0.020937 0.004653 0.011816 0.962594 0.014102 0.863476 0.014269 0.108153 0.956990 0.028811 0.005332 0.008868 0.042403 0.096594 0.388246 0.472756 0.158070 0.409974 0.098493 0.333462 0.139538 0.195665 0.419619 0.245178 0.238648 0.135129 0.244887 0.381335 Consensus sequence: DMDMTGACGTCAKHBD Alignment: DBDRTGACGTCAYHRD AMTGTGACACCACAGT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00159 Six2 Original Motif Reverse Complement Forward 2 16 0.030325 Species: Mus musculus Original motif 0.452545 0.099192 0.290852 0.157411 0.587199 0.117373 0.086707 0.208721 0.191837 0.044362 0.256539 0.507262 0.299111 0.107464 0.518651 0.074774 0.118226 0.040974 0.797168 0.043631 0.010113 0.030311 0.923661 0.035916 0.126925 0.002828 0.869144 0.001103 0.001338 0.000719 0.046297 0.951646 0.958864 0.001525 0.038365 0.001246 0.003353 0.001741 0.001927 0.992979 0.007665 0.981087 0.001717 0.009531 0.903866 0.022768 0.054074 0.019292 0.165996 0.505327 0.077238 0.251439 0.252666 0.168847 0.288545 0.289942 0.336830 0.080857 0.058862 0.523451 0.234102 0.268721 0.215252 0.281925 0.172036 0.083695 0.223889 0.520379 Consensus sequence: DAKRGGGTATCACDWHT Reverse complement motif 0.520379 0.083695 0.223889 0.172036 0.281925 0.268721 0.215252 0.234102 0.523451 0.080857 0.058862 0.336830 0.289942 0.168847 0.288545 0.252666 0.165996 0.077238 0.505327 0.251439 0.019292 0.022768 0.054074 0.903866 0.007665 0.001717 0.981087 0.009531 0.992979 0.001741 0.001927 0.003353 0.001246 0.001525 0.038365 0.958864 0.951646 0.000719 0.046297 0.001338 0.126925 0.869144 0.002828 0.001103 0.010113 0.923661 0.030311 0.035916 0.118226 0.797168 0.040974 0.043631 0.299111 0.518651 0.107464 0.074774 0.507262 0.044362 0.256539 0.191837 0.208721 0.117373 0.086707 0.587199 0.157411 0.099192 0.290852 0.452545 Consensus sequence: AHWDGTGATACCCMRTD Alignment: AHWDGTGATACCCMRTD -AMTGTGACACCACAGT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00103 Jundm2_primary Original Motif Original Motif Backward 1 16 0.034493 Species: Mus musculus Original motif 0.213023 0.312553 0.241727 0.232696 0.126878 0.453780 0.251405 0.167937 0.127927 0.138541 0.528637 0.204895 0.572671 0.136079 0.242107 0.049142 0.004569 0.015235 0.003215 0.976981 0.004594 0.008024 0.836426 0.150956 0.966548 0.003255 0.009947 0.020250 0.001636 0.899650 0.004880 0.093834 0.093834 0.004880 0.899650 0.001636 0.020250 0.009947 0.003255 0.966548 0.150956 0.836426 0.008024 0.004594 0.976981 0.003215 0.015235 0.004569 0.006508 0.324308 0.040126 0.629058 0.170728 0.554933 0.116757 0.157582 0.255966 0.170983 0.430910 0.142142 0.228601 0.267456 0.166199 0.337744 Consensus sequence: BBGATGACGTCAYCVH Reverse complement motif 0.337744 0.267456 0.166199 0.228601 0.255966 0.430910 0.170983 0.142142 0.170728 0.116757 0.554933 0.157582 0.629058 0.324308 0.040126 0.006508 0.004569 0.003215 0.015235 0.976981 0.150956 0.008024 0.836426 0.004594 0.966548 0.009947 0.003255 0.020250 0.093834 0.899650 0.004880 0.001636 0.001636 0.004880 0.899650 0.093834 0.020250 0.003255 0.009947 0.966548 0.004594 0.836426 0.008024 0.150956 0.976981 0.015235 0.003215 0.004569 0.049142 0.136079 0.242107 0.572671 0.127927 0.528637 0.138541 0.204895 0.126878 0.251405 0.453780 0.167937 0.213023 0.241727 0.312553 0.232696 Consensus sequence: HVGMTGACGTCATCBB Alignment: BBGATGACGTCAYCVH AMTGTGACACCACAGT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00122 Tgif1 Reverse Complement Reverse Complement Forward 1 16 0.034837 Species: Mus musculus Original motif 0.272977 0.158875 0.284742 0.283406 0.550609 0.124110 0.169608 0.155673 0.114568 0.207160 0.282464 0.395807 0.560868 0.052907 0.053508 0.332716 0.336500 0.068048 0.114050 0.481403 0.007736 0.003722 0.000495 0.988048 0.004489 0.000729 0.992211 0.002571 0.956618 0.000414 0.000890 0.042078 0.004381 0.990925 0.000538 0.004156 0.982797 0.000366 0.015539 0.001298 0.016760 0.002980 0.969991 0.010269 0.036013 0.725983 0.200022 0.037982 0.064755 0.104386 0.133891 0.696968 0.199404 0.263520 0.410228 0.126848 0.222648 0.351390 0.272575 0.153387 0.087778 0.206043 0.395671 0.310507 0.319643 0.144216 0.196041 0.340100 Consensus sequence: DABWWTGACAGCTVVBD Reverse complement motif 0.340100 0.144216 0.196041 0.319643 0.087778 0.395671 0.206043 0.310507 0.222648 0.272575 0.351390 0.153387 0.199404 0.410228 0.263520 0.126848 0.696968 0.104386 0.133891 0.064755 0.036013 0.200022 0.725983 0.037982 0.016760 0.969991 0.002980 0.010269 0.001298 0.000366 0.015539 0.982797 0.004381 0.000538 0.990925 0.004156 0.042078 0.000414 0.000890 0.956618 0.004489 0.992211 0.000729 0.002571 0.988048 0.003722 0.000495 0.007736 0.481403 0.068048 0.114050 0.336500 0.332716 0.052907 0.053508 0.560868 0.395807 0.207160 0.282464 0.114568 0.155673 0.124110 0.169608 0.550609 0.272977 0.284742 0.158875 0.283406 Consensus sequence: DBVVAGCTGTCAWWVTH Alignment: DBVVAGCTGTCAWWVTH ACTGTGGTGTCACART- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00195 Six3 Reverse Complement Original Motif Backward 2 16 0.034908 Species: Mus musculus Original motif 0.333695 0.093488 0.364569 0.208248 0.720387 0.079055 0.078819 0.121739 0.228565 0.054353 0.169178 0.547904 0.473776 0.098972 0.322497 0.104754 0.072282 0.069213 0.818062 0.040444 0.015799 0.021866 0.895094 0.067240 0.162037 0.008758 0.827015 0.002191 0.001775 0.000990 0.043426 0.953808 0.965015 0.002030 0.031105 0.001850 0.003203 0.001736 0.003784 0.991277 0.012698 0.972998 0.004011 0.010293 0.917291 0.027214 0.032991 0.022504 0.185849 0.445801 0.093804 0.274545 0.248167 0.232363 0.199701 0.319769 0.402850 0.084312 0.108918 0.403921 0.335914 0.216832 0.177371 0.269883 0.075023 0.107186 0.239759 0.578031 Consensus sequence: DATRGGGTATCAHHWHT Reverse complement motif 0.578031 0.107186 0.239759 0.075023 0.269883 0.216832 0.177371 0.335914 0.403921 0.084312 0.108918 0.402850 0.319769 0.232363 0.199701 0.248167 0.185849 0.093804 0.445801 0.274545 0.022504 0.027214 0.032991 0.917291 0.012698 0.004011 0.972998 0.010293 0.991277 0.001736 0.003784 0.003203 0.001850 0.002030 0.031105 0.965015 0.953808 0.000990 0.043426 0.001775 0.162037 0.827015 0.008758 0.002191 0.015799 0.895094 0.021866 0.067240 0.072282 0.818062 0.069213 0.040444 0.104754 0.098972 0.322497 0.473776 0.547904 0.054353 0.169178 0.228565 0.121739 0.079055 0.078819 0.720387 0.333695 0.364569 0.093488 0.208248 Consensus sequence: AHWHDTGATACCCKATH Alignment: DATRGGGTATCAHHWHT ACTGTGGTGTCACART- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00388 Six6_2267.4 Reverse Complement Original Motif Backward 2 16 0.035409 Species: Mus musculus Original motif 0.330559 0.118371 0.278738 0.272331 0.605486 0.104492 0.066247 0.223775 0.180170 0.051522 0.131669 0.636639 0.431457 0.173748 0.323416 0.071378 0.131729 0.037944 0.812991 0.017337 0.022726 0.033975 0.914981 0.028317 0.138556 0.012597 0.847660 0.001188 0.001916 0.001156 0.046653 0.950276 0.965626 0.001518 0.031319 0.001536 0.003782 0.001412 0.002175 0.992631 0.006601 0.979412 0.002328 0.011660 0.947233 0.007670 0.017734 0.027363 0.374066 0.305253 0.063914 0.256767 0.267070 0.210201 0.216997 0.305732 0.294988 0.127424 0.094154 0.483434 0.354130 0.195592 0.176636 0.273642 0.094874 0.110275 0.192261 0.602591 Consensus sequence: DATRGGGTATCAHDWHT Reverse complement motif 0.602591 0.110275 0.192261 0.094874 0.273642 0.195592 0.176636 0.354130 0.483434 0.127424 0.094154 0.294988 0.305732 0.210201 0.216997 0.267070 0.256767 0.305253 0.063914 0.374066 0.027363 0.007670 0.017734 0.947233 0.006601 0.002328 0.979412 0.011660 0.992631 0.001412 0.002175 0.003782 0.001536 0.001518 0.031319 0.965626 0.950276 0.001156 0.046653 0.001916 0.138556 0.847660 0.012597 0.001188 0.022726 0.914981 0.033975 0.028317 0.131729 0.812991 0.037944 0.017337 0.071378 0.173748 0.323416 0.431457 0.636639 0.051522 0.131669 0.180170 0.223775 0.104492 0.066247 0.605486 0.272331 0.118371 0.278738 0.330559 Consensus sequence: AHWDHTGATACCCKATD Alignment: DATRGGGTATCAHDWHT ACTGTGGTGTCACART- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00192 Six1 Reverse Complement Original Motif Forward 1 16 0.035431 Species: Mus musculus Original motif 0.319306 0.130147 0.399309 0.151238 0.482636 0.211172 0.085871 0.220321 0.214292 0.085504 0.207353 0.492851 0.392819 0.136859 0.403883 0.066438 0.215886 0.049341 0.685932 0.048842 0.039793 0.053756 0.870240 0.036211 0.202525 0.005026 0.791396 0.001053 0.001092 0.001021 0.052968 0.944919 0.963185 0.001738 0.033596 0.001480 0.002017 0.001886 0.002847 0.993250 0.009914 0.974962 0.001987 0.013137 0.909252 0.021586 0.037899 0.031263 0.177851 0.274190 0.117998 0.429961 0.228906 0.159459 0.303955 0.307681 0.330938 0.158106 0.118706 0.392251 0.160453 0.267920 0.280244 0.291383 0.176707 0.068175 0.229538 0.525580 Consensus sequence: DHDRGGGTATCAHDHBT Reverse complement motif 0.525580 0.068175 0.229538 0.176707 0.291383 0.267920 0.280244 0.160453 0.392251 0.158106 0.118706 0.330938 0.307681 0.159459 0.303955 0.228906 0.429961 0.274190 0.117998 0.177851 0.031263 0.021586 0.037899 0.909252 0.009914 0.001987 0.974962 0.013137 0.993250 0.001886 0.002847 0.002017 0.001480 0.001738 0.033596 0.963185 0.944919 0.001021 0.052968 0.001092 0.202525 0.791396 0.005026 0.001053 0.039793 0.870240 0.053756 0.036211 0.215886 0.685932 0.049341 0.048842 0.392819 0.403883 0.136859 0.066438 0.492851 0.085504 0.207353 0.214292 0.220321 0.211172 0.085871 0.482636 0.319306 0.399309 0.130147 0.151238 Consensus sequence: AVHDHTGATACCCMDHH Alignment: AVHDHTGATACCCMDHH ACTGTGGTGTCACART- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00199 Six4 Original Motif Original Motif Forward 2 16 0.035515 Species: Mus musculus Original motif 0.523054 0.168817 0.140331 0.167798 0.187385 0.177009 0.246164 0.389442 0.414492 0.118547 0.308876 0.158085 0.345234 0.289795 0.130249 0.234723 0.611522 0.116948 0.098944 0.172586 0.016342 0.029436 0.015062 0.939161 0.014351 0.004796 0.962435 0.018418 0.987454 0.005228 0.002590 0.004727 0.007431 0.812214 0.005849 0.174506 0.969354 0.025386 0.002362 0.002898 0.005123 0.989068 0.003362 0.002447 0.001424 0.969981 0.012011 0.016585 0.209729 0.227411 0.210523 0.352337 0.341679 0.297940 0.104590 0.255792 0.126190 0.288862 0.245018 0.339930 0.173008 0.295896 0.252422 0.278674 0.409639 0.210750 0.296197 0.083415 Consensus sequence: ADDHATGACACCBHBBV Reverse complement motif 0.083415 0.210750 0.296197 0.409639 0.173008 0.252422 0.295896 0.278674 0.339930 0.288862 0.245018 0.126190 0.255792 0.297940 0.104590 0.341679 0.352337 0.227411 0.210523 0.209729 0.001424 0.012011 0.969981 0.016585 0.005123 0.003362 0.989068 0.002447 0.002898 0.025386 0.002362 0.969354 0.007431 0.005849 0.812214 0.174506 0.004727 0.005228 0.002590 0.987454 0.014351 0.962435 0.004796 0.018418 0.939161 0.029436 0.015062 0.016342 0.172586 0.116948 0.098944 0.611522 0.234723 0.289795 0.130249 0.345234 0.158085 0.118547 0.308876 0.414492 0.389442 0.177009 0.246164 0.187385 0.167798 0.168817 0.140331 0.523054 Consensus sequence: BBVHVGGTGTCATHDDT Alignment: ADDHATGACACCBHBBV -AMTGTGACACCACAGT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00053 Rxra_primary Original Motif Original Motif Forward 2 16 0.036249 Species: Mus musculus Original motif 0.235299 0.222264 0.237416 0.305021 0.144778 0.278902 0.341673 0.234648 0.261127 0.261904 0.191591 0.285378 0.119943 0.410774 0.218940 0.250343 0.222672 0.075554 0.365253 0.336521 0.001838 0.046904 0.002828 0.948430 0.030410 0.006359 0.960821 0.002410 0.987391 0.007562 0.002810 0.002237 0.105188 0.888650 0.001163 0.004998 0.006475 0.987074 0.001793 0.004659 0.001816 0.765138 0.003092 0.229953 0.010354 0.846496 0.029899 0.113251 0.328732 0.039382 0.265510 0.366377 0.209638 0.262628 0.145613 0.382121 0.385390 0.177695 0.299828 0.137087 0.403452 0.268924 0.096028 0.231595 0.203082 0.231812 0.213520 0.351585 Consensus sequence: DBHBDTGACCCCDHVHB Reverse complement motif 0.351585 0.231812 0.213520 0.203082 0.231595 0.268924 0.096028 0.403452 0.137087 0.177695 0.299828 0.385390 0.382121 0.262628 0.145613 0.209638 0.366377 0.039382 0.265510 0.328732 0.010354 0.029899 0.846496 0.113251 0.001816 0.003092 0.765138 0.229953 0.006475 0.001793 0.987074 0.004659 0.105188 0.001163 0.888650 0.004998 0.002237 0.007562 0.002810 0.987391 0.030410 0.960821 0.006359 0.002410 0.948430 0.046904 0.002828 0.001838 0.222672 0.365253 0.075554 0.336521 0.119943 0.218940 0.410774 0.250343 0.285378 0.261904 0.191591 0.261127 0.144778 0.341673 0.278902 0.234648 0.305021 0.222264 0.237416 0.235299 Consensus sequence: VHBHDGGGGTCAHBHBD Alignment: DBHBDTGACCCCDHVHB -AMTGTGACACCACAGT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00388 Six6_2267.5 Original Motif Reverse Complement Backward 1 16 0.037488 Species: Mus musculus Original motif 0.357565 0.095438 0.345110 0.201887 0.415206 0.108701 0.160030 0.316063 0.276710 0.105226 0.183597 0.434468 0.461481 0.135300 0.303126 0.100093 0.190186 0.035578 0.728290 0.045946 0.040893 0.024794 0.889495 0.044817 0.197092 0.018297 0.781124 0.003487 0.005212 0.002190 0.027421 0.965178 0.970183 0.002451 0.021340 0.006025 0.004645 0.002381 0.003788 0.989186 0.017413 0.955357 0.007268 0.019962 0.927889 0.018513 0.013421 0.040177 0.411060 0.139133 0.096462 0.353345 0.215585 0.237932 0.205422 0.341060 0.409189 0.134754 0.084179 0.371879 0.210772 0.273586 0.108006 0.407635 0.091781 0.159161 0.216288 0.532770 Consensus sequence: DDDRGGGTATCAWHWHT Reverse complement motif 0.532770 0.159161 0.216288 0.091781 0.407635 0.273586 0.108006 0.210772 0.371879 0.134754 0.084179 0.409189 0.341060 0.237932 0.205422 0.215585 0.353345 0.139133 0.096462 0.411060 0.040177 0.018513 0.013421 0.927889 0.017413 0.007268 0.955357 0.019962 0.989186 0.002381 0.003788 0.004645 0.006025 0.002451 0.021340 0.970183 0.965178 0.002190 0.027421 0.005212 0.197092 0.781124 0.018297 0.003487 0.040893 0.889495 0.024794 0.044817 0.190186 0.728290 0.035578 0.045946 0.100093 0.135300 0.303126 0.461481 0.434468 0.105226 0.183597 0.276710 0.316063 0.108701 0.160030 0.415206 0.201887 0.095438 0.345110 0.357565 Consensus sequence: AHWHWTGATACCCKDDD Alignment: DDDRGGGTATCAWHWHT -AMTGTGACACCACAGT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 4 Motif ID: 72 Motif name: CACTGTGrYrtCACAGTGswsCAcT Original motif 0.111111 0.746032 0.063492 0.079365 0.857143 0.047619 0.047619 0.047619 0.047619 0.857143 0.079365 0.015873 0.031746 0.000000 0.000000 0.968254 0.031746 0.015873 0.904762 0.047619 0.000000 0.000000 0.000000 1.000000 0.031746 0.000000 0.857143 0.111111 0.396825 0.111111 0.412698 0.079365 0.031746 0.253968 0.015873 0.698413 0.365079 0.000000 0.634921 0.000000 0.079365 0.206349 0.047619 0.666667 0.047619 0.936508 0.015873 0.000000 0.952381 0.000000 0.015873 0.031746 0.015873 0.920635 0.000000 0.063492 0.920635 0.000000 0.000000 0.079365 0.063492 0.047619 0.841270 0.047619 0.000000 0.000000 0.015873 0.984127 0.047619 0.015873 0.904762 0.031746 0.015873 0.603175 0.317460 0.063492 0.396825 0.000000 0.015873 0.587302 0.015873 0.476190 0.428571 0.079365 0.063492 0.920635 0.000000 0.015873 0.920635 0.015873 0.047619 0.015873 0.095238 0.682540 0.095238 0.126984 0.047619 0.015873 0.095238 0.841270 Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reserve complement motif 0.841270 0.015873 0.095238 0.047619 0.095238 0.095238 0.682540 0.126984 0.015873 0.015873 0.047619 0.920635 0.063492 0.000000 0.920635 0.015873 0.015873 0.428571 0.476190 0.079365 0.587302 0.000000 0.015873 0.396825 0.015873 0.317460 0.603175 0.063492 0.047619 0.904762 0.015873 0.031746 0.984127 0.000000 0.015873 0.000000 0.063492 0.841270 0.047619 0.047619 0.079365 0.000000 0.000000 0.920635 0.015873 0.000000 0.920635 0.063492 0.031746 0.000000 0.015873 0.952381 0.047619 0.015873 0.936508 0.000000 0.666667 0.206349 0.047619 0.079365 0.365079 0.634921 0.000000 0.000000 0.698413 0.253968 0.015873 0.031746 0.396825 0.412698 0.111111 0.079365 0.031746 0.857143 0.000000 0.111111 1.000000 0.000000 0.000000 0.000000 0.031746 0.904762 0.015873 0.047619 0.968254 0.000000 0.000000 0.031746 0.047619 0.079365 0.857143 0.015873 0.047619 0.047619 0.047619 0.857143 0.111111 0.063492 0.746032 0.079365 Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG ************************************************************************ Best Matches for Motif ID 72 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00034 Sox7_primary Original Motif Original Motif Forward 5 21 0.055837 Species: Mus musculus Original motif 0.360997 0.300272 0.115555 0.223177 0.309749 0.228429 0.166233 0.295589 0.149419 0.176868 0.240155 0.433558 0.379704 0.095791 0.276373 0.248133 0.394549 0.174184 0.130641 0.300626 0.443749 0.070776 0.211081 0.274393 0.364301 0.074356 0.370406 0.190936 0.791976 0.038475 0.093390 0.076159 0.963721 0.001826 0.002456 0.031997 0.004516 0.954596 0.008092 0.032796 0.981080 0.002062 0.002161 0.014697 0.986185 0.001846 0.006976 0.004992 0.059567 0.003649 0.002189 0.934595 0.495328 0.024257 0.240450 0.239965 0.305027 0.094878 0.526069 0.074025 0.418442 0.196237 0.158323 0.226998 0.336713 0.220452 0.191155 0.251680 0.192296 0.300342 0.169047 0.338315 0.240387 0.144634 0.128513 0.486465 0.290763 0.271259 0.116600 0.321377 0.224825 0.296233 0.229255 0.249687 0.493240 0.171285 0.075148 0.260326 Consensus sequence: HHBDHDDAACAATDRHHHHHBW Reverse complement motif 0.260326 0.171285 0.075148 0.493240 0.224825 0.229255 0.296233 0.249687 0.321377 0.271259 0.116600 0.290763 0.486465 0.144634 0.128513 0.240387 0.338315 0.300342 0.169047 0.192296 0.251680 0.220452 0.191155 0.336713 0.226998 0.196237 0.158323 0.418442 0.305027 0.526069 0.094878 0.074025 0.239965 0.024257 0.240450 0.495328 0.934595 0.003649 0.002189 0.059567 0.004992 0.001846 0.006976 0.986185 0.014697 0.002062 0.002161 0.981080 0.004516 0.008092 0.954596 0.032796 0.031997 0.001826 0.002456 0.963721 0.076159 0.038475 0.093390 0.791976 0.364301 0.370406 0.074356 0.190936 0.274393 0.070776 0.211081 0.443749 0.300626 0.174184 0.130641 0.394549 0.248133 0.095791 0.276373 0.379704 0.433558 0.176868 0.240155 0.149419 0.295589 0.228429 0.166233 0.309749 0.223177 0.300272 0.115555 0.360997 Consensus sequence: WBHHHHHMDATTGTTHDHDVHH Alignment: HHBDHDDAACAATDRHHHHHBW---- ----CACTGTGRTRTCACAGTGSWSCACT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v015681_secondary Reverse Complement Reverse Complement Backward 6 20 0.554770 Species: Mus musculus Original motif 0.214165 0.143436 0.372522 0.269876 0.314445 0.406003 0.160351 0.119201 0.137147 0.092924 0.042921 0.727007 0.044121 0.072843 0.051741 0.831295 0.261292 0.324124 0.298498 0.116086 0.258125 0.323243 0.263362 0.155271 0.204557 0.589399 0.107153 0.098891 0.371021 0.244027 0.291102 0.093849 0.096327 0.572718 0.011797 0.319159 0.027282 0.046183 0.844519 0.082016 0.018921 0.012887 0.915917 0.052275 0.364793 0.166722 0.084229 0.384256 0.028216 0.011233 0.951056 0.009495 0.054974 0.004738 0.890377 0.049911 0.006802 0.312915 0.134247 0.546036 0.241289 0.628210 0.104788 0.025713 0.237863 0.302807 0.213018 0.246311 0.349399 0.203220 0.086635 0.360746 0.386634 0.144693 0.246895 0.221779 0.425101 0.354676 0.093374 0.126849 0.060272 0.391320 0.104905 0.443503 0.162090 0.190233 0.227433 0.420244 Consensus sequence: DVTTVVCVYGGHGGYCHHDMYB Reverse complement motif 0.420244 0.190233 0.227433 0.162090 0.443503 0.391320 0.104905 0.060272 0.126849 0.354676 0.093374 0.425101 0.221779 0.144693 0.246895 0.386634 0.360746 0.203220 0.086635 0.349399 0.237863 0.213018 0.302807 0.246311 0.241289 0.104788 0.628210 0.025713 0.546036 0.312915 0.134247 0.006802 0.054974 0.890377 0.004738 0.049911 0.028216 0.951056 0.011233 0.009495 0.384256 0.166722 0.084229 0.364793 0.018921 0.915917 0.012887 0.052275 0.027282 0.844519 0.046183 0.082016 0.096327 0.011797 0.572718 0.319159 0.093849 0.244027 0.291102 0.371021 0.204557 0.107153 0.589399 0.098891 0.258125 0.263362 0.323243 0.155271 0.261292 0.298498 0.324124 0.116086 0.831295 0.072843 0.051741 0.044121 0.727007 0.092924 0.042921 0.137147 0.314445 0.160351 0.406003 0.119201 0.214165 0.372522 0.143436 0.269876 Consensus sequence: VMYDHDGMCCHCCKBGVVAAVH Alignment: -----VMYDHDGMCCHCCKBGVVAAVH AGTGSWSCACTGTGAMAMCACAGTG----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v016060_primary Reverse Complement Original Motif Backward 5 19 1.057225 Species: Mus musculus Original motif 0.137831 0.118922 0.394177 0.349070 0.190108 0.163633 0.138507 0.507753 0.346002 0.332315 0.228621 0.093063 0.113254 0.287554 0.373285 0.225908 0.272578 0.125402 0.328963 0.273057 0.333973 0.115165 0.194267 0.356595 0.381054 0.086215 0.501679 0.031052 0.002232 0.007405 0.966087 0.024276 0.834741 0.112115 0.052053 0.001091 0.009034 0.983239 0.000766 0.006960 0.002054 0.988103 0.003138 0.006705 0.805772 0.171299 0.008415 0.014515 0.020076 0.976846 0.000894 0.002183 0.079914 0.917273 0.001179 0.001634 0.013983 0.950545 0.004205 0.031267 0.789407 0.039441 0.108645 0.062507 0.055453 0.161271 0.595249 0.188028 0.333424 0.128169 0.373270 0.165136 0.536103 0.109520 0.062980 0.291397 0.346477 0.090909 0.279533 0.283081 0.045892 0.190183 0.584314 0.179611 0.088294 0.406148 0.251647 0.253912 0.202467 0.447159 0.162802 0.187571 Consensus sequence: DTVBDDRGACCACCCAGDWDGBH Reverse complement motif 0.202467 0.162802 0.447159 0.187571 0.088294 0.251647 0.406148 0.253912 0.045892 0.584314 0.190183 0.179611 0.283081 0.090909 0.279533 0.346477 0.291397 0.109520 0.062980 0.536103 0.333424 0.373270 0.128169 0.165136 0.055453 0.595249 0.161271 0.188028 0.062507 0.039441 0.108645 0.789407 0.013983 0.004205 0.950545 0.031267 0.079914 0.001179 0.917273 0.001634 0.020076 0.000894 0.976846 0.002183 0.014515 0.171299 0.008415 0.805772 0.002054 0.003138 0.988103 0.006705 0.009034 0.000766 0.983239 0.006960 0.001091 0.112115 0.052053 0.834741 0.002232 0.966087 0.007405 0.024276 0.381054 0.501679 0.086215 0.031052 0.356595 0.115165 0.194267 0.333973 0.272578 0.328963 0.125402 0.273057 0.113254 0.373285 0.287554 0.225908 0.093063 0.332315 0.228621 0.346002 0.507753 0.163633 0.138507 0.190108 0.137831 0.394177 0.118922 0.349070 Consensus sequence: DBCDWHCTGGGTGGTCMDHBBAH Alignment: ------DTVBDDRGACCACCCAGDWDGBH AGTGSWSCACTGTGAMAMCACAGTG---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v016060_primary Reverse Complement Reverse Complement Forward 7 19 1.059462 Species: Mus musculus Original motif 0.204923 0.208846 0.365383 0.220848 0.294304 0.300143 0.167287 0.238266 0.109711 0.619514 0.117379 0.153396 0.178979 0.378580 0.230177 0.212264 0.159594 0.542602 0.118178 0.179627 0.125206 0.430074 0.151826 0.292894 0.097692 0.709845 0.116956 0.075506 0.148292 0.565912 0.037632 0.248164 0.077951 0.034190 0.855503 0.032356 0.001657 0.001061 0.971877 0.025405 0.001926 0.001084 0.991712 0.005278 0.033031 0.012001 0.057796 0.897171 0.002723 0.002647 0.993348 0.001281 0.003261 0.000963 0.987199 0.008577 0.000611 0.090925 0.074857 0.833608 0.015299 0.978878 0.004949 0.000874 0.013368 0.600902 0.033485 0.352245 0.231949 0.149575 0.118804 0.499672 0.267580 0.186002 0.371242 0.175176 0.264884 0.223483 0.110082 0.401551 0.221365 0.170121 0.179559 0.428955 0.112997 0.692930 0.139981 0.054092 0.460305 0.207883 0.155111 0.176702 Consensus sequence: BHCBCBCCGGGTGGTCYHVHDCH Reverse complement motif 0.176702 0.207883 0.155111 0.460305 0.112997 0.139981 0.692930 0.054092 0.428955 0.170121 0.179559 0.221365 0.401551 0.223483 0.110082 0.264884 0.267580 0.371242 0.186002 0.175176 0.499672 0.149575 0.118804 0.231949 0.013368 0.033485 0.600902 0.352245 0.015299 0.004949 0.978878 0.000874 0.833608 0.090925 0.074857 0.000611 0.003261 0.987199 0.000963 0.008577 0.002723 0.993348 0.002647 0.001281 0.897171 0.012001 0.057796 0.033031 0.001926 0.991712 0.001084 0.005278 0.001657 0.971877 0.001061 0.025405 0.077951 0.855503 0.034190 0.032356 0.148292 0.037632 0.565912 0.248164 0.097692 0.116956 0.709845 0.075506 0.125206 0.151826 0.430074 0.292894 0.159594 0.118178 0.542602 0.179627 0.178979 0.230177 0.378580 0.212264 0.109711 0.117379 0.619514 0.153396 0.294304 0.167287 0.300143 0.238266 0.204923 0.365383 0.208846 0.220848 Consensus sequence: HGDHVHKGACCACCCGGBGBGDB Alignment: HGDHVHKGACCACCCGGBGBGDB------ ------AGTGSWSCACTGTGAMAMCACAGTG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v015681_primary Original Motif Reverse Complement Forward 8 18 1.549601 Species: Mus musculus Original motif 0.472795 0.179227 0.091251 0.256726 0.036521 0.159743 0.204840 0.598896 0.164582 0.312805 0.221324 0.301289 0.237069 0.249050 0.293048 0.220833 0.401949 0.225181 0.229401 0.143469 0.161422 0.494334 0.252207 0.092036 0.252940 0.177721 0.369400 0.199939 0.119630 0.024651 0.849920 0.005798 0.000962 0.002398 0.990616 0.006023 0.937852 0.027016 0.034535 0.000597 0.008963 0.987756 0.000629 0.002652 0.001584 0.992898 0.002349 0.003169 0.956822 0.027342 0.002484 0.013352 0.009873 0.987759 0.000988 0.001381 0.016397 0.980856 0.000369 0.002378 0.081761 0.758555 0.038572 0.121112 0.371713 0.091838 0.448027 0.088423 0.111617 0.121913 0.683885 0.082585 0.334562 0.102916 0.436488 0.126034 0.210362 0.101261 0.238339 0.450037 0.169041 0.271583 0.320799 0.238576 0.140316 0.049885 0.735236 0.074563 Consensus sequence: HTBVVVDGGACCACCCRGRDBG Reverse complement motif 0.140316 0.735236 0.049885 0.074563 0.169041 0.320799 0.271583 0.238576 0.450037 0.101261 0.238339 0.210362 0.334562 0.436488 0.102916 0.126034 0.111617 0.683885 0.121913 0.082585 0.371713 0.448027 0.091838 0.088423 0.081761 0.038572 0.758555 0.121112 0.016397 0.000369 0.980856 0.002378 0.009873 0.000988 0.987759 0.001381 0.013352 0.027342 0.002484 0.956822 0.001584 0.002349 0.992898 0.003169 0.008963 0.000629 0.987756 0.002652 0.000597 0.027016 0.034535 0.937852 0.000962 0.990616 0.002398 0.006023 0.119630 0.849920 0.024651 0.005798 0.252940 0.369400 0.177721 0.199939 0.161422 0.252207 0.494334 0.092036 0.143469 0.225181 0.229401 0.401949 0.237069 0.293048 0.249050 0.220833 0.164582 0.221324 0.312805 0.301289 0.598896 0.159743 0.204840 0.036521 0.256726 0.179227 0.091251 0.472795 Consensus sequence: CBDMCMGGGTGGTCCHVBVBAH Alignment: HTBVVVDGGACCACCCRGRDBG------- -------CACTGTGRTRTCACAGTGSWSCACT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00528 Foxm1_primary Original Motif Reverse Complement Backward 6 18 1.551493 Species: Mus musculus Original motif 0.402634 0.249702 0.143705 0.203959 0.709619 0.108953 0.130781 0.050647 0.334232 0.077498 0.228818 0.359452 0.131721 0.094794 0.234481 0.539005 0.170102 0.237609 0.252464 0.339824 0.244961 0.347304 0.228129 0.179606 0.612141 0.132244 0.180110 0.075504 0.472236 0.042388 0.234419 0.250957 0.125213 0.007413 0.849788 0.017587 0.702068 0.064216 0.141992 0.091724 0.008657 0.038238 0.002959 0.950145 0.007170 0.002244 0.986824 0.003763 0.002862 0.979956 0.000711 0.016471 0.971196 0.001954 0.011441 0.015409 0.105575 0.031482 0.022836 0.840107 0.031534 0.736742 0.032785 0.198939 0.479153 0.347558 0.031799 0.141490 0.056405 0.123140 0.023989 0.796466 0.111194 0.195344 0.501360 0.192102 0.376359 0.416820 0.072818 0.134004 0.225111 0.249460 0.306563 0.218866 0.405251 0.168478 0.108618 0.317653 0.165386 0.191749 0.268604 0.374261 Consensus sequence: HADTBVADGATGCATCMTGMVHB Reverse complement motif 0.374261 0.191749 0.268604 0.165386 0.317653 0.168478 0.108618 0.405251 0.225111 0.306563 0.249460 0.218866 0.376359 0.072818 0.416820 0.134004 0.111194 0.501360 0.195344 0.192102 0.796466 0.123140 0.023989 0.056405 0.141490 0.347558 0.031799 0.479153 0.031534 0.032785 0.736742 0.198939 0.840107 0.031482 0.022836 0.105575 0.015409 0.001954 0.011441 0.971196 0.002862 0.000711 0.979956 0.016471 0.007170 0.986824 0.002244 0.003763 0.950145 0.038238 0.002959 0.008657 0.091724 0.064216 0.141992 0.702068 0.125213 0.849788 0.007413 0.017587 0.250957 0.042388 0.234419 0.472236 0.075504 0.132244 0.180110 0.612141 0.244961 0.228129 0.347304 0.179606 0.339824 0.237609 0.252464 0.170102 0.539005 0.094794 0.234481 0.131721 0.359452 0.077498 0.228818 0.334232 0.050647 0.108953 0.130781 0.709619 0.203959 0.249702 0.143705 0.402634 Consensus sequence: VHVRCAYGATGCATCDTVVADTH Alignment: -------VHVRCAYGATGCATCDTVVADTH CACTGTGRTRTCACAGTGSWSCACT----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v016060_primary Reverse Complement Original Motif Forward 5 18 1.556070 Species: Mus musculus Original motif 0.180868 0.321661 0.134642 0.362829 0.232215 0.134289 0.315356 0.318141 0.065068 0.093681 0.569842 0.271408 0.370822 0.229680 0.154738 0.244759 0.323039 0.182873 0.173588 0.320500 0.175039 0.266898 0.276080 0.281984 0.412669 0.147730 0.146326 0.293275 0.325953 0.028805 0.629596 0.015646 0.003017 0.001766 0.979711 0.015507 0.888973 0.040666 0.069420 0.000941 0.017309 0.979155 0.000899 0.002637 0.001732 0.988816 0.004856 0.004596 0.889763 0.078125 0.010384 0.021729 0.007566 0.987081 0.001421 0.003932 0.027797 0.966593 0.000878 0.004731 0.025816 0.867003 0.065749 0.041433 0.220658 0.075256 0.582904 0.121182 0.088946 0.283695 0.565345 0.062015 0.328012 0.241332 0.305901 0.124755 0.307302 0.137589 0.375928 0.179181 0.298752 0.231470 0.315255 0.154524 0.094565 0.142901 0.705696 0.056838 Consensus sequence: HDGHHBHRGACCACCCGSVDVG Reverse complement motif 0.094565 0.705696 0.142901 0.056838 0.298752 0.315255 0.231470 0.154524 0.307302 0.375928 0.137589 0.179181 0.124755 0.241332 0.305901 0.328012 0.088946 0.565345 0.283695 0.062015 0.220658 0.582904 0.075256 0.121182 0.025816 0.065749 0.867003 0.041433 0.027797 0.000878 0.966593 0.004731 0.007566 0.001421 0.987081 0.003932 0.021729 0.078125 0.010384 0.889763 0.001732 0.004856 0.988816 0.004596 0.017309 0.000899 0.979155 0.002637 0.000941 0.040666 0.069420 0.888973 0.003017 0.979711 0.001766 0.015507 0.325953 0.629596 0.028805 0.015646 0.293275 0.147730 0.146326 0.412669 0.281984 0.266898 0.276080 0.175039 0.320500 0.182873 0.173588 0.323039 0.244759 0.229680 0.154738 0.370822 0.065068 0.569842 0.093681 0.271408 0.318141 0.134289 0.315356 0.232215 0.362829 0.321661 0.134642 0.180868 Consensus sequence: CVHBSCGGGTGGTCMHVHHCDH Alignment: HDGHHBHRGACCACCCGSVDVG------- ----AGTGSWSCACTGTGAMAMCACAGTG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00228 Bapx1 Reverse Complement Original Motif Forward 2 17 2.042465 Species: Mus musculus Original motif 0.301697 0.347856 0.239075 0.111372 0.364458 0.225587 0.074842 0.335112 0.228472 0.141747 0.139010 0.490770 0.559532 0.164793 0.197557 0.078118 0.506611 0.130882 0.113226 0.249281 0.054222 0.680706 0.257913 0.007160 0.001978 0.899030 0.000622 0.098369 0.950561 0.002121 0.000888 0.046429 0.037529 0.960534 0.000660 0.001278 0.001571 0.005538 0.001403 0.991487 0.001274 0.052527 0.000520 0.945679 0.926306 0.006886 0.003823 0.062985 0.638246 0.038639 0.145042 0.178072 0.266452 0.337698 0.283972 0.111878 0.307019 0.250170 0.243307 0.199504 0.550380 0.190997 0.122920 0.135703 0.187982 0.330356 0.168897 0.312765 Consensus sequence: VHHAACCACTTAAVVAH Reverse complement motif 0.187982 0.168897 0.330356 0.312765 0.135703 0.190997 0.122920 0.550380 0.199504 0.250170 0.243307 0.307019 0.266452 0.283972 0.337698 0.111878 0.178072 0.038639 0.145042 0.638246 0.062985 0.006886 0.003823 0.926306 0.945679 0.052527 0.000520 0.001274 0.991487 0.005538 0.001403 0.001571 0.037529 0.000660 0.960534 0.001278 0.046429 0.002121 0.000888 0.950561 0.001978 0.000622 0.899030 0.098369 0.054222 0.257913 0.680706 0.007160 0.249281 0.130882 0.113226 0.506611 0.078118 0.164793 0.197557 0.559532 0.490770 0.141747 0.139010 0.228472 0.335112 0.225587 0.074842 0.364458 0.301697 0.239075 0.347856 0.111372 Consensus sequence: DTBVTTAAGTGGTTHHV Alignment: DTBVTTAAGTGGTTHHV-------- -AGTGSWSCACTGTGAMAMCACAGTG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00031 Zbtb3_primary Original Motif Reverse Complement Forward 7 17 2.043161 Species: Mus musculus Original motif 0.401190 0.144405 0.268531 0.185874 0.430224 0.168519 0.221247 0.180011 0.172575 0.268499 0.274136 0.284789 0.150971 0.297110 0.290868 0.261051 0.133421 0.282842 0.434718 0.149019 0.042798 0.941105 0.001785 0.014312 0.890788 0.002551 0.103316 0.003345 0.001887 0.951368 0.043722 0.003023 0.011633 0.002218 0.002269 0.983880 0.003597 0.003728 0.984819 0.007856 0.002946 0.903520 0.072457 0.021077 0.908487 0.057072 0.018256 0.016185 0.076237 0.329864 0.228896 0.365003 0.144926 0.162981 0.177370 0.514722 0.124970 0.327876 0.295814 0.251341 0.144592 0.313887 0.301912 0.239609 0.108463 0.241747 0.350296 0.299494 Consensus sequence: DDBBBCACTGCABTBBB Reverse complement motif 0.108463 0.350296 0.241747 0.299494 0.144592 0.301912 0.313887 0.239609 0.124970 0.295814 0.327876 0.251341 0.514722 0.162981 0.177370 0.144926 0.365003 0.329864 0.228896 0.076237 0.016185 0.057072 0.018256 0.908487 0.002946 0.072457 0.903520 0.021077 0.003597 0.984819 0.003728 0.007856 0.983880 0.002218 0.002269 0.011633 0.001887 0.043722 0.951368 0.003023 0.003345 0.002551 0.103316 0.890788 0.042798 0.001785 0.941105 0.014312 0.133421 0.434718 0.282842 0.149019 0.150971 0.290868 0.297110 0.261051 0.284789 0.268499 0.274136 0.172575 0.180011 0.168519 0.221247 0.430224 0.185874 0.144405 0.268531 0.401190 Consensus sequence: BBBAVTGCAGTGBBVDD Alignment: DDBBBCACTGCABTBBB-------- ------CACTGTGRTRTCACAGTGSWSCACT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00193 Rhox11_1765.2 Reverse Complement Original Motif Forward 4 17 2.043462 Species: Mus musculus Original motif 0.538735 0.129821 0.147336 0.184107 0.331267 0.275123 0.227609 0.166001 0.174654 0.113319 0.383610 0.328417 0.296734 0.281670 0.230068 0.191527 0.128222 0.561296 0.062928 0.247554 0.027028 0.014676 0.949335 0.008962 0.087209 0.761581 0.147964 0.003246 0.006796 0.000741 0.006037 0.986427 0.039496 0.000533 0.943453 0.016517 0.005541 0.005164 0.002805 0.986489 0.561957 0.002761 0.004207 0.431075 0.780197 0.037155 0.031222 0.151425 0.518642 0.104220 0.012670 0.364468 0.314451 0.111366 0.333508 0.240676 0.236936 0.357992 0.280813 0.124259 0.314846 0.163774 0.426195 0.095185 0.408340 0.134111 0.102987 0.354562 Consensus sequence: AVDVCGCTGTWAWDVVW Reverse complement motif 0.354562 0.134111 0.102987 0.408340 0.314846 0.426195 0.163774 0.095185 0.236936 0.280813 0.357992 0.124259 0.314451 0.333508 0.111366 0.240676 0.364468 0.104220 0.012670 0.518642 0.151425 0.037155 0.031222 0.780197 0.431075 0.002761 0.004207 0.561957 0.986489 0.005164 0.002805 0.005541 0.039496 0.943453 0.000533 0.016517 0.986427 0.000741 0.006037 0.006796 0.087209 0.147964 0.761581 0.003246 0.027028 0.949335 0.014676 0.008962 0.128222 0.062928 0.561296 0.247554 0.191527 0.281670 0.230068 0.296734 0.174654 0.383610 0.113319 0.328417 0.166001 0.275123 0.227609 0.331267 0.184107 0.129821 0.147336 0.538735 Consensus sequence: WVVHWTWACAGCGBHBT Alignment: WVVHWTWACAGCGBHBT-------- ---AGTGSWSCACTGTGAMAMCACAGTG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 4 Motif ID: 73 Motif name: TGGAGCACTGTGACAcCACAGTGg Original motif 0.054054 0.040541 0.054054 0.851351 0.040541 0.013514 0.824324 0.121622 0.094595 0.135135 0.756757 0.013514 0.891892 0.000000 0.000000 0.108108 0.040541 0.094595 0.810811 0.054054 0.081081 0.797297 0.054054 0.067568 0.932432 0.027027 0.000000 0.040541 0.054054 0.756757 0.135135 0.054054 0.108108 0.027027 0.013514 0.851351 0.108108 0.000000 0.851351 0.040541 0.013514 0.000000 0.027027 0.959459 0.000000 0.013514 0.945946 0.040541 0.905405 0.000000 0.067568 0.027027 0.054054 0.837838 0.000000 0.108108 0.945946 0.013514 0.040541 0.000000 0.162162 0.500000 0.189189 0.148649 0.108108 0.824324 0.000000 0.067568 0.945946 0.000000 0.040541 0.013514 0.081081 0.837838 0.027027 0.054054 0.945946 0.000000 0.013514 0.040541 0.054054 0.067568 0.783784 0.094595 0.054054 0.027027 0.000000 0.918919 0.040541 0.013514 0.864865 0.081081 0.148649 0.121622 0.675676 0.054054 Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reserve complement motif 0.148649 0.675676 0.121622 0.054054 0.040541 0.864865 0.013514 0.081081 0.918919 0.027027 0.000000 0.054054 0.054054 0.783784 0.067568 0.094595 0.040541 0.000000 0.013514 0.945946 0.081081 0.027027 0.837838 0.054054 0.013514 0.000000 0.040541 0.945946 0.108108 0.000000 0.824324 0.067568 0.162162 0.189189 0.500000 0.148649 0.000000 0.013514 0.040541 0.945946 0.054054 0.000000 0.837838 0.108108 0.027027 0.000000 0.067568 0.905405 0.000000 0.945946 0.013514 0.040541 0.959459 0.000000 0.027027 0.013514 0.108108 0.851351 0.000000 0.040541 0.851351 0.027027 0.013514 0.108108 0.054054 0.135135 0.756757 0.054054 0.040541 0.027027 0.000000 0.932432 0.081081 0.054054 0.797297 0.067568 0.040541 0.810811 0.094595 0.054054 0.108108 0.000000 0.000000 0.891892 0.094595 0.756757 0.135135 0.013514 0.040541 0.824324 0.013514 0.121622 0.851351 0.040541 0.054054 0.054054 Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA ************************************************************************ Best Matches for Motif ID 73 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00098 Rfx3_secondary Reverse Complement Reverse Complement Forward 4 21 0.039195 Species: Mus musculus Original motif 0.314514 0.275352 0.257617 0.152518 0.126939 0.598294 0.130576 0.144192 0.102265 0.155334 0.177957 0.564445 0.129288 0.282678 0.326990 0.261044 0.318166 0.227823 0.175681 0.278330 0.109019 0.380838 0.278328 0.231815 0.226145 0.289206 0.291300 0.193348 0.035863 0.844339 0.072582 0.047216 0.223793 0.187244 0.088092 0.500871 0.039800 0.029681 0.026201 0.904317 0.298298 0.032147 0.654746 0.014809 0.014729 0.022023 0.944826 0.018422 0.485114 0.004925 0.013785 0.496176 0.035708 0.020381 0.240804 0.703108 0.951152 0.012738 0.017886 0.018224 0.023713 0.944394 0.009538 0.022355 0.291067 0.385205 0.232388 0.091339 0.340334 0.199588 0.311526 0.148552 0.198713 0.472138 0.178319 0.150830 0.321155 0.269932 0.311301 0.097612 0.412646 0.195252 0.231950 0.160152 0.297134 0.180928 0.250400 0.271538 0.151169 0.305386 0.358574 0.184871 Consensus sequence: VCTBHBVCTTGGWTACVVVVVDB Reverse complement motif 0.151169 0.358574 0.305386 0.184871 0.271538 0.180928 0.250400 0.297134 0.160152 0.195252 0.231950 0.412646 0.097612 0.269932 0.311301 0.321155 0.198713 0.178319 0.472138 0.150830 0.148552 0.199588 0.311526 0.340334 0.291067 0.232388 0.385205 0.091339 0.023713 0.009538 0.944394 0.022355 0.018224 0.012738 0.017886 0.951152 0.703108 0.020381 0.240804 0.035708 0.496176 0.004925 0.013785 0.485114 0.014729 0.944826 0.022023 0.018422 0.298298 0.654746 0.032147 0.014809 0.904317 0.029681 0.026201 0.039800 0.500871 0.187244 0.088092 0.223793 0.035863 0.072582 0.844339 0.047216 0.226145 0.291300 0.289206 0.193348 0.109019 0.278328 0.380838 0.231815 0.278330 0.227823 0.175681 0.318166 0.129288 0.326990 0.282678 0.261044 0.564445 0.155334 0.177957 0.102265 0.126939 0.130576 0.598294 0.144192 0.152518 0.275352 0.257617 0.314514 Consensus sequence: BDBBVBVGTAWCCAAGVBHBAGB Alignment: BDBBVBVGTAWCCAAGVBHBAGB--- ---CCACTGTGVTGTCACAGTGCTCCA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v015681_primary Reverse Complement Reverse Complement Forward 3 21 0.040027 Species: Mus musculus Original motif 0.641428 0.180211 0.044767 0.133594 0.171696 0.262981 0.334148 0.231174 0.129726 0.322735 0.243462 0.304077 0.165713 0.175735 0.256108 0.402445 0.146090 0.171890 0.412753 0.269266 0.212837 0.439192 0.280990 0.066980 0.251088 0.275516 0.374380 0.099015 0.575438 0.079656 0.338201 0.006704 0.005634 0.003422 0.972597 0.018348 0.890447 0.077034 0.031851 0.000668 0.007128 0.986862 0.000496 0.005515 0.001445 0.991564 0.001925 0.005066 0.738761 0.190157 0.026399 0.044684 0.013384 0.983783 0.000896 0.001937 0.068077 0.929549 0.000773 0.001602 0.040830 0.933742 0.005283 0.020145 0.730274 0.029225 0.145689 0.094812 0.165032 0.572838 0.162001 0.100129 0.383584 0.129942 0.429497 0.056977 0.455959 0.071959 0.208204 0.263878 0.134271 0.262985 0.222626 0.380117 0.071193 0.346594 0.346081 0.236132 0.445661 0.405278 0.053901 0.095160 Consensus sequence: ABBBBVVRGACCACCCACRDBBM Reverse complement motif 0.095160 0.405278 0.053901 0.445661 0.071193 0.346081 0.346594 0.236132 0.380117 0.262985 0.222626 0.134271 0.263878 0.071959 0.208204 0.455959 0.383584 0.429497 0.129942 0.056977 0.165032 0.162001 0.572838 0.100129 0.094812 0.029225 0.145689 0.730274 0.040830 0.005283 0.933742 0.020145 0.068077 0.000773 0.929549 0.001602 0.013384 0.000896 0.983783 0.001937 0.044684 0.190157 0.026399 0.738761 0.001445 0.001925 0.991564 0.005066 0.007128 0.000496 0.986862 0.005515 0.000668 0.077034 0.031851 0.890447 0.005634 0.972597 0.003422 0.018348 0.006704 0.079656 0.338201 0.575438 0.251088 0.374380 0.275516 0.099015 0.212837 0.280990 0.439192 0.066980 0.146090 0.412753 0.171890 0.269266 0.402445 0.175735 0.256108 0.165713 0.129726 0.243462 0.322735 0.304077 0.171696 0.334148 0.262981 0.231174 0.133594 0.180211 0.044767 0.641428 Consensus sequence: YBVDMGTGGGTGGTCKVVBVBBT Alignment: YBVDMGTGGGTGGTCKVVBVBBT--- --CCACTGTGVTGTCACAGTGCTCCA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v016060_primary Reverse Complement Reverse Complement Backward 5 20 0.535486 Species: Mus musculus Original motif 0.137831 0.118922 0.394177 0.349070 0.190108 0.163633 0.138507 0.507753 0.346002 0.332315 0.228621 0.093063 0.113254 0.287554 0.373285 0.225908 0.272578 0.125402 0.328963 0.273057 0.333973 0.115165 0.194267 0.356595 0.381054 0.086215 0.501679 0.031052 0.002232 0.007405 0.966087 0.024276 0.834741 0.112115 0.052053 0.001091 0.009034 0.983239 0.000766 0.006960 0.002054 0.988103 0.003138 0.006705 0.805772 0.171299 0.008415 0.014515 0.020076 0.976846 0.000894 0.002183 0.079914 0.917273 0.001179 0.001634 0.013983 0.950545 0.004205 0.031267 0.789407 0.039441 0.108645 0.062507 0.055453 0.161271 0.595249 0.188028 0.333424 0.128169 0.373270 0.165136 0.536103 0.109520 0.062980 0.291397 0.346477 0.090909 0.279533 0.283081 0.045892 0.190183 0.584314 0.179611 0.088294 0.406148 0.251647 0.253912 0.202467 0.447159 0.162802 0.187571 Consensus sequence: DTVBDDRGACCACCCAGDWDGBH Reverse complement motif 0.202467 0.162802 0.447159 0.187571 0.088294 0.251647 0.406148 0.253912 0.045892 0.584314 0.190183 0.179611 0.283081 0.090909 0.279533 0.346477 0.291397 0.109520 0.062980 0.536103 0.333424 0.373270 0.128169 0.165136 0.055453 0.595249 0.161271 0.188028 0.062507 0.039441 0.108645 0.789407 0.013983 0.004205 0.950545 0.031267 0.079914 0.001179 0.917273 0.001634 0.020076 0.000894 0.976846 0.002183 0.014515 0.171299 0.008415 0.805772 0.002054 0.003138 0.988103 0.006705 0.009034 0.000766 0.983239 0.006960 0.001091 0.112115 0.052053 0.834741 0.002232 0.966087 0.007405 0.024276 0.381054 0.501679 0.086215 0.031052 0.356595 0.115165 0.194267 0.333973 0.272578 0.328963 0.125402 0.273057 0.113254 0.373285 0.287554 0.225908 0.093063 0.332315 0.228621 0.346002 0.507753 0.163633 0.138507 0.190108 0.137831 0.394177 0.118922 0.349070 Consensus sequence: DBCDWHCTGGGTGGTCMDHBBAH Alignment: ----DBCDWHCTGGGTGGTCMDHBBAH CCACTGTGVTGTCACAGTGCTCCA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v015681_primary Reverse Complement Reverse Complement Backward 5 20 0.536069 Species: Mus musculus Original motif 0.183797 0.268049 0.330111 0.218043 0.127599 0.330310 0.243614 0.298477 0.143199 0.188046 0.268593 0.400162 0.214690 0.205230 0.247090 0.332990 0.294688 0.299104 0.327152 0.079056 0.221909 0.193223 0.480155 0.104712 0.444072 0.068239 0.481838 0.005852 0.006182 0.015429 0.901278 0.077111 0.766535 0.111138 0.121632 0.000696 0.014848 0.973961 0.000298 0.010893 0.001807 0.992200 0.002669 0.003324 0.795344 0.140510 0.018576 0.045571 0.006990 0.988200 0.002510 0.002299 0.154898 0.842296 0.000998 0.001808 0.029577 0.919262 0.006935 0.044226 0.677987 0.032075 0.185065 0.104874 0.195132 0.364580 0.319321 0.120967 0.225412 0.115034 0.612849 0.046705 0.548628 0.058900 0.162857 0.229616 0.112531 0.340331 0.165910 0.381227 0.073029 0.303078 0.363896 0.259997 0.561485 0.260567 0.092979 0.084969 0.132283 0.457691 0.140159 0.269867 Consensus sequence: BBBDVVRGACCACCCAVGABBAB Reverse complement motif 0.132283 0.140159 0.457691 0.269867 0.084969 0.260567 0.092979 0.561485 0.073029 0.363896 0.303078 0.259997 0.381227 0.340331 0.165910 0.112531 0.229616 0.058900 0.162857 0.548628 0.225412 0.612849 0.115034 0.046705 0.195132 0.319321 0.364580 0.120967 0.104874 0.032075 0.185065 0.677987 0.029577 0.006935 0.919262 0.044226 0.154898 0.000998 0.842296 0.001808 0.006990 0.002510 0.988200 0.002299 0.045571 0.140510 0.018576 0.795344 0.001807 0.002669 0.992200 0.003324 0.014848 0.000298 0.973961 0.010893 0.000696 0.111138 0.121632 0.766535 0.006182 0.901278 0.015429 0.077111 0.444072 0.481838 0.068239 0.005852 0.221909 0.480155 0.193223 0.104712 0.294688 0.327152 0.299104 0.079056 0.332990 0.205230 0.247090 0.214690 0.400162 0.188046 0.268593 0.143199 0.127599 0.243614 0.330310 0.298477 0.183797 0.330111 0.268049 0.218043 Consensus sequence: BTBVTCVTGGGTGGTCMVVDVBB Alignment: ----BTBVTCVTGGGTGGTCMVVDVBB CCACTGTGVTGTCACAGTGCTCCA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v016060_primary Original Motif Reverse Complement Backward 4 20 0.539704 Species: Mus musculus Original motif 0.204923 0.208846 0.365383 0.220848 0.294304 0.300143 0.167287 0.238266 0.109711 0.619514 0.117379 0.153396 0.178979 0.378580 0.230177 0.212264 0.159594 0.542602 0.118178 0.179627 0.125206 0.430074 0.151826 0.292894 0.097692 0.709845 0.116956 0.075506 0.148292 0.565912 0.037632 0.248164 0.077951 0.034190 0.855503 0.032356 0.001657 0.001061 0.971877 0.025405 0.001926 0.001084 0.991712 0.005278 0.033031 0.012001 0.057796 0.897171 0.002723 0.002647 0.993348 0.001281 0.003261 0.000963 0.987199 0.008577 0.000611 0.090925 0.074857 0.833608 0.015299 0.978878 0.004949 0.000874 0.013368 0.600902 0.033485 0.352245 0.231949 0.149575 0.118804 0.499672 0.267580 0.186002 0.371242 0.175176 0.264884 0.223483 0.110082 0.401551 0.221365 0.170121 0.179559 0.428955 0.112997 0.692930 0.139981 0.054092 0.460305 0.207883 0.155111 0.176702 Consensus sequence: BHCBCBCCGGGTGGTCYHVHDCH Reverse complement motif 0.176702 0.207883 0.155111 0.460305 0.112997 0.139981 0.692930 0.054092 0.428955 0.170121 0.179559 0.221365 0.401551 0.223483 0.110082 0.264884 0.267580 0.371242 0.186002 0.175176 0.499672 0.149575 0.118804 0.231949 0.013368 0.033485 0.600902 0.352245 0.015299 0.004949 0.978878 0.000874 0.833608 0.090925 0.074857 0.000611 0.003261 0.987199 0.000963 0.008577 0.002723 0.993348 0.002647 0.001281 0.897171 0.012001 0.057796 0.033031 0.001926 0.991712 0.001084 0.005278 0.001657 0.971877 0.001061 0.025405 0.077951 0.855503 0.034190 0.032356 0.148292 0.037632 0.565912 0.248164 0.097692 0.116956 0.709845 0.075506 0.125206 0.151826 0.430074 0.292894 0.159594 0.118178 0.542602 0.179627 0.178979 0.230177 0.378580 0.212264 0.109711 0.117379 0.619514 0.153396 0.294304 0.167287 0.300143 0.238266 0.204923 0.365383 0.208846 0.220848 Consensus sequence: HGDHVHKGACCACCCGGBGBGDB Alignment: ----HGDHVHKGACCACCCGGBGBGDB TGGAGCACTGTGACAVCACAGTGG--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v015681_secondary Original Motif Reverse Complement Backward 7 18 1.538189 Species: Mus musculus Original motif 0.214165 0.143436 0.372522 0.269876 0.314445 0.406003 0.160351 0.119201 0.137147 0.092924 0.042921 0.727007 0.044121 0.072843 0.051741 0.831295 0.261292 0.324124 0.298498 0.116086 0.258125 0.323243 0.263362 0.155271 0.204557 0.589399 0.107153 0.098891 0.371021 0.244027 0.291102 0.093849 0.096327 0.572718 0.011797 0.319159 0.027282 0.046183 0.844519 0.082016 0.018921 0.012887 0.915917 0.052275 0.364793 0.166722 0.084229 0.384256 0.028216 0.011233 0.951056 0.009495 0.054974 0.004738 0.890377 0.049911 0.006802 0.312915 0.134247 0.546036 0.241289 0.628210 0.104788 0.025713 0.237863 0.302807 0.213018 0.246311 0.349399 0.203220 0.086635 0.360746 0.386634 0.144693 0.246895 0.221779 0.425101 0.354676 0.093374 0.126849 0.060272 0.391320 0.104905 0.443503 0.162090 0.190233 0.227433 0.420244 Consensus sequence: DVTTVVCVYGGHGGYCHHDMYB Reverse complement motif 0.420244 0.190233 0.227433 0.162090 0.443503 0.391320 0.104905 0.060272 0.126849 0.354676 0.093374 0.425101 0.221779 0.144693 0.246895 0.386634 0.360746 0.203220 0.086635 0.349399 0.237863 0.213018 0.302807 0.246311 0.241289 0.104788 0.628210 0.025713 0.546036 0.312915 0.134247 0.006802 0.054974 0.890377 0.004738 0.049911 0.028216 0.951056 0.011233 0.009495 0.384256 0.166722 0.084229 0.364793 0.018921 0.915917 0.012887 0.052275 0.027282 0.844519 0.046183 0.082016 0.096327 0.011797 0.572718 0.319159 0.093849 0.244027 0.291102 0.371021 0.204557 0.107153 0.589399 0.098891 0.258125 0.263362 0.323243 0.155271 0.261292 0.298498 0.324124 0.116086 0.831295 0.072843 0.051741 0.044121 0.727007 0.092924 0.042921 0.137147 0.314445 0.160351 0.406003 0.119201 0.214165 0.372522 0.143436 0.269876 Consensus sequence: VMYDHDGMCCHCCKBGVVAAVH Alignment: ------DVTTVVCVYGGHGGYCHHDMYB TGGAGCACTGTGACAVCACAGTGG------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00122 Tgif1 Original Motif Original Motif Backward 3 17 2.025337 Species: Mus musculus Original motif 0.272977 0.158875 0.284742 0.283406 0.550609 0.124110 0.169608 0.155673 0.114568 0.207160 0.282464 0.395807 0.560868 0.052907 0.053508 0.332716 0.336500 0.068048 0.114050 0.481403 0.007736 0.003722 0.000495 0.988048 0.004489 0.000729 0.992211 0.002571 0.956618 0.000414 0.000890 0.042078 0.004381 0.990925 0.000538 0.004156 0.982797 0.000366 0.015539 0.001298 0.016760 0.002980 0.969991 0.010269 0.036013 0.725983 0.200022 0.037982 0.064755 0.104386 0.133891 0.696968 0.199404 0.263520 0.410228 0.126848 0.222648 0.351390 0.272575 0.153387 0.087778 0.206043 0.395671 0.310507 0.319643 0.144216 0.196041 0.340100 Consensus sequence: DABWWTGACAGCTVVBD Reverse complement motif 0.340100 0.144216 0.196041 0.319643 0.087778 0.395671 0.206043 0.310507 0.222648 0.272575 0.351390 0.153387 0.199404 0.410228 0.263520 0.126848 0.696968 0.104386 0.133891 0.064755 0.036013 0.200022 0.725983 0.037982 0.016760 0.969991 0.002980 0.010269 0.001298 0.000366 0.015539 0.982797 0.004381 0.000538 0.990925 0.004156 0.042078 0.000414 0.000890 0.956618 0.004489 0.992211 0.000729 0.002571 0.988048 0.003722 0.000495 0.007736 0.481403 0.068048 0.114050 0.336500 0.332716 0.052907 0.053508 0.560868 0.395807 0.207160 0.282464 0.114568 0.155673 0.124110 0.169608 0.550609 0.272977 0.284742 0.158875 0.283406 Consensus sequence: DBVVAGCTGTCAWWVTH Alignment: -------DABWWTGACAGCTVVBD TGGAGCACTGTGACAVCACAGTGG-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00159 Six2 Reverse Complement Original Motif Backward 6 17 2.025713 Species: Mus musculus Original motif 0.452545 0.099192 0.290852 0.157411 0.587199 0.117373 0.086707 0.208721 0.191837 0.044362 0.256539 0.507262 0.299111 0.107464 0.518651 0.074774 0.118226 0.040974 0.797168 0.043631 0.010113 0.030311 0.923661 0.035916 0.126925 0.002828 0.869144 0.001103 0.001338 0.000719 0.046297 0.951646 0.958864 0.001525 0.038365 0.001246 0.003353 0.001741 0.001927 0.992979 0.007665 0.981087 0.001717 0.009531 0.903866 0.022768 0.054074 0.019292 0.165996 0.505327 0.077238 0.251439 0.252666 0.168847 0.288545 0.289942 0.336830 0.080857 0.058862 0.523451 0.234102 0.268721 0.215252 0.281925 0.172036 0.083695 0.223889 0.520379 Consensus sequence: DAKRGGGTATCACDWHT Reverse complement motif 0.520379 0.083695 0.223889 0.172036 0.281925 0.268721 0.215252 0.234102 0.523451 0.080857 0.058862 0.336830 0.289942 0.168847 0.288545 0.252666 0.165996 0.077238 0.505327 0.251439 0.019292 0.022768 0.054074 0.903866 0.007665 0.001717 0.981087 0.009531 0.992979 0.001741 0.001927 0.003353 0.001246 0.001525 0.038365 0.958864 0.951646 0.000719 0.046297 0.001338 0.126925 0.869144 0.002828 0.001103 0.010113 0.923661 0.030311 0.035916 0.118226 0.797168 0.040974 0.043631 0.299111 0.518651 0.107464 0.074774 0.507262 0.044362 0.256539 0.191837 0.208721 0.117373 0.086707 0.587199 0.157411 0.099192 0.290852 0.452545 Consensus sequence: AHWDGTGATACCCMRTD Alignment: -------AHWDGTGATACCCMRTD CCACTGTGVTGTCACAGTGCTCCA----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00192 Six1 Reverse Complement Original Motif Backward 6 17 2.028921 Species: Mus musculus Original motif 0.319306 0.130147 0.399309 0.151238 0.482636 0.211172 0.085871 0.220321 0.214292 0.085504 0.207353 0.492851 0.392819 0.136859 0.403883 0.066438 0.215886 0.049341 0.685932 0.048842 0.039793 0.053756 0.870240 0.036211 0.202525 0.005026 0.791396 0.001053 0.001092 0.001021 0.052968 0.944919 0.963185 0.001738 0.033596 0.001480 0.002017 0.001886 0.002847 0.993250 0.009914 0.974962 0.001987 0.013137 0.909252 0.021586 0.037899 0.031263 0.177851 0.274190 0.117998 0.429961 0.228906 0.159459 0.303955 0.307681 0.330938 0.158106 0.118706 0.392251 0.160453 0.267920 0.280244 0.291383 0.176707 0.068175 0.229538 0.525580 Consensus sequence: DHDRGGGTATCAHDHBT Reverse complement motif 0.525580 0.068175 0.229538 0.176707 0.291383 0.267920 0.280244 0.160453 0.392251 0.158106 0.118706 0.330938 0.307681 0.159459 0.303955 0.228906 0.429961 0.274190 0.117998 0.177851 0.031263 0.021586 0.037899 0.909252 0.009914 0.001987 0.974962 0.013137 0.993250 0.001886 0.002847 0.002017 0.001480 0.001738 0.033596 0.963185 0.944919 0.001021 0.052968 0.001092 0.202525 0.791396 0.005026 0.001053 0.039793 0.870240 0.053756 0.036211 0.215886 0.685932 0.049341 0.048842 0.392819 0.403883 0.136859 0.066438 0.492851 0.085504 0.207353 0.214292 0.220321 0.211172 0.085871 0.482636 0.319306 0.399309 0.130147 0.151238 Consensus sequence: AVHDHTGATACCCMDHH Alignment: -------AVHDHTGATACCCMDHH CCACTGTGVTGTCACAGTGCTCCA----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00076 Rfxdc2_secondary Reverse Complement Reverse Complement Forward 4 17 2.029199 Species: Mus musculus Original motif 0.120124 0.369052 0.280026 0.230798 0.153013 0.175278 0.321983 0.349726 0.426573 0.206846 0.272112 0.094469 0.067213 0.665712 0.165815 0.101259 0.213424 0.152912 0.229260 0.404404 0.042427 0.193675 0.034144 0.729754 0.359927 0.038767 0.588911 0.012395 0.015079 0.017884 0.948607 0.018430 0.699438 0.007004 0.014579 0.278979 0.017282 0.022228 0.369181 0.591308 0.948823 0.011471 0.018805 0.020901 0.016175 0.947649 0.007710 0.028466 0.114584 0.334989 0.511562 0.038865 0.219114 0.247229 0.396478 0.137179 0.308087 0.178171 0.248356 0.265386 0.479300 0.125168 0.134837 0.260696 0.323493 0.230502 0.108189 0.337815 Consensus sequence: BBVCDTRGAKACSVDDH Reverse complement motif 0.337815 0.230502 0.108189 0.323493 0.260696 0.125168 0.134837 0.479300 0.265386 0.178171 0.248356 0.308087 0.219114 0.396478 0.247229 0.137179 0.114584 0.511562 0.334989 0.038865 0.016175 0.007710 0.947649 0.028466 0.020901 0.011471 0.018805 0.948823 0.591308 0.022228 0.369181 0.017282 0.278979 0.007004 0.014579 0.699438 0.015079 0.948607 0.017884 0.018430 0.359927 0.588911 0.038767 0.012395 0.729754 0.193675 0.034144 0.042427 0.404404 0.152912 0.229260 0.213424 0.067213 0.165815 0.665712 0.101259 0.094469 0.206846 0.272112 0.426573 0.349726 0.175278 0.321983 0.153013 0.120124 0.280026 0.369052 0.230798 Consensus sequence: HDDVSGTRTCMADGBVB Alignment: HDDVSGTRTCMADGBVB------- ---CCACTGTGVTGTCACAGTGCTCCA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 4 Motif ID: 74 Motif name: ssCCCCGCSssk Original motif 0.000000 0.444444 0.370370 0.185185 0.111111 0.407407 0.333333 0.148148 0.000000 0.888889 0.037037 0.074074 0.000000 0.888889 0.074074 0.037037 0.000000 0.777778 0.222222 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.037037 0.888889 0.000000 0.074074 0.000000 0.703704 0.296296 0.000000 0.000000 0.518519 0.370370 0.111111 0.111111 0.407407 0.259259 0.222222 0.074074 0.222222 0.407407 0.296296 Consensus sequence: SBCCCCGCCSBB Reserve complement motif 0.074074 0.407407 0.222222 0.296296 0.111111 0.259259 0.407407 0.222222 0.000000 0.370370 0.518519 0.111111 0.000000 0.296296 0.703704 0.000000 0.037037 0.000000 0.888889 0.074074 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.222222 0.777778 0.000000 0.000000 0.074074 0.888889 0.037037 0.000000 0.037037 0.888889 0.074074 0.111111 0.333333 0.407407 0.148148 0.000000 0.370370 0.444444 0.185185 Consensus sequence: BBSGGCGGGGBS ************************************************************************ Best Matches for Motif ID 74 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00000 Smad3_secondary Original Motif Original Motif Forward 3 12 0.011485 Species: Mus musculus Original motif 0.150668 0.131779 0.245665 0.471887 0.316817 0.287314 0.150829 0.245040 0.256473 0.409066 0.109700 0.224761 0.210646 0.220222 0.345010 0.224122 0.166679 0.508939 0.081676 0.242705 0.049351 0.759380 0.088489 0.102780 0.047598 0.785546 0.121957 0.044898 0.004606 0.944933 0.034696 0.015764 0.040252 0.050652 0.890382 0.018713 0.003038 0.913699 0.022449 0.060814 0.028672 0.941477 0.012276 0.017575 0.635243 0.139731 0.110495 0.114531 0.240016 0.385948 0.182848 0.191188 0.210430 0.274127 0.085171 0.430272 0.088118 0.454598 0.208989 0.248295 0.181269 0.265028 0.149023 0.404680 0.101070 0.252682 0.368542 0.277706 Consensus sequence: DHHBCCCCGCCAHHBHB Reverse complement motif 0.101070 0.368542 0.252682 0.277706 0.404680 0.265028 0.149023 0.181269 0.088118 0.208989 0.454598 0.248295 0.430272 0.274127 0.085171 0.210430 0.240016 0.182848 0.385948 0.191188 0.114531 0.139731 0.110495 0.635243 0.028672 0.012276 0.941477 0.017575 0.003038 0.022449 0.913699 0.060814 0.040252 0.890382 0.050652 0.018713 0.004606 0.034696 0.944933 0.015764 0.047598 0.121957 0.785546 0.044898 0.049351 0.088489 0.759380 0.102780 0.166679 0.081676 0.508939 0.242705 0.210646 0.345010 0.220222 0.224122 0.256473 0.109700 0.409066 0.224761 0.245040 0.287314 0.150829 0.316817 0.471887 0.131779 0.245665 0.150668 Consensus sequence: BHBHDTGGCGGGGBDHD Alignment: DHHBCCCCGCCAHHBHB --SBCCCCGCCSBB--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00093 Klf7_primary Original Motif Original Motif Forward 3 12 0.016526 Species: Mus musculus Original motif 0.204514 0.198353 0.171218 0.425915 0.167188 0.296785 0.246082 0.289946 0.267330 0.148001 0.398674 0.185994 0.549386 0.060167 0.337100 0.053347 0.050746 0.900013 0.022169 0.027073 0.037905 0.920332 0.008360 0.033403 0.410356 0.566702 0.016267 0.006675 0.009526 0.982354 0.001060 0.007060 0.204292 0.001084 0.748567 0.046056 0.003955 0.988490 0.002821 0.004735 0.004264 0.988826 0.004311 0.002598 0.002758 0.929549 0.001244 0.066448 0.260332 0.421683 0.024720 0.293265 0.184798 0.247697 0.085237 0.482268 0.347537 0.197344 0.139961 0.315159 0.255281 0.166620 0.242297 0.335802 Consensus sequence: HBDRCCMCGCCCHHHD Reverse complement motif 0.335802 0.166620 0.242297 0.255281 0.315159 0.197344 0.139961 0.347537 0.482268 0.247697 0.085237 0.184798 0.260332 0.024720 0.421683 0.293265 0.002758 0.001244 0.929549 0.066448 0.004264 0.004311 0.988826 0.002598 0.003955 0.002821 0.988490 0.004735 0.204292 0.748567 0.001084 0.046056 0.009526 0.001060 0.982354 0.007060 0.410356 0.016267 0.566702 0.006675 0.037905 0.008360 0.920332 0.033403 0.050746 0.022169 0.900013 0.027073 0.053347 0.060167 0.337100 0.549386 0.267330 0.398674 0.148001 0.185994 0.167188 0.246082 0.296785 0.289946 0.425915 0.198353 0.171218 0.204514 Consensus sequence: DHHDGGGCGRGGKHBH Alignment: HBDRCCMCGCCCHHHD --SBCCCCGCCSBB-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00022 Zfp740_primary Original Motif Original Motif Backward 3 12 0.027614 Species: Mus musculus Original motif 0.136946 0.396508 0.135309 0.331236 0.185528 0.417538 0.215409 0.181525 0.171276 0.341901 0.172832 0.313991 0.145641 0.590572 0.146376 0.117412 0.138035 0.660416 0.114016 0.087533 0.222728 0.750532 0.007528 0.019212 0.024633 0.963314 0.001894 0.010159 0.009557 0.979956 0.000642 0.009844 0.010416 0.977424 0.000541 0.011619 0.026401 0.956740 0.001544 0.015314 0.195502 0.755959 0.011060 0.037480 0.491291 0.364785 0.025613 0.118311 0.305153 0.398160 0.071680 0.225008 0.253497 0.232647 0.213246 0.300610 0.156964 0.297876 0.144683 0.400477 0.179549 0.292514 0.319462 0.208475 Consensus sequence: HVBCCCCCCCCMHHHB Reverse complement motif 0.179549 0.319462 0.292514 0.208475 0.400477 0.297876 0.144683 0.156964 0.300610 0.232647 0.213246 0.253497 0.305153 0.071680 0.398160 0.225008 0.118311 0.364785 0.025613 0.491291 0.195502 0.011060 0.755959 0.037480 0.026401 0.001544 0.956740 0.015314 0.010416 0.000541 0.977424 0.011619 0.009557 0.000642 0.979956 0.009844 0.024633 0.001894 0.963314 0.010159 0.222728 0.007528 0.750532 0.019212 0.138035 0.114016 0.660416 0.087533 0.145641 0.146376 0.590572 0.117412 0.171276 0.172832 0.341901 0.313991 0.185528 0.215409 0.417538 0.181525 0.136946 0.135309 0.396508 0.331236 Consensus sequence: BHHDYGGGGGGGGBVD Alignment: HVBCCCCCCCCMHHHB --SBCCCCGCCSBB-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00003 E2F3_primary Original Motif Reverse Complement Forward 2 12 0.032858 Species: Mus musculus Original motif 0.358868 0.212371 0.263565 0.165196 0.303014 0.253580 0.111217 0.332189 0.420933 0.110957 0.210958 0.257152 0.769724 0.062662 0.032155 0.135459 0.311973 0.051319 0.408669 0.228039 0.097916 0.141153 0.719697 0.041234 0.009980 0.014044 0.971955 0.004021 0.014425 0.974798 0.008373 0.002404 0.000891 0.013228 0.983966 0.001915 0.000827 0.938560 0.059548 0.001065 0.007071 0.102005 0.872378 0.018546 0.020099 0.897653 0.014151 0.068097 0.114080 0.346724 0.409037 0.130159 0.331439 0.279041 0.085030 0.304491 0.319846 0.136792 0.043641 0.499722 Consensus sequence: VHDADGGCGCGCSHW Reverse complement motif 0.499722 0.136792 0.043641 0.319846 0.304491 0.279041 0.085030 0.331439 0.114080 0.409037 0.346724 0.130159 0.020099 0.014151 0.897653 0.068097 0.007071 0.872378 0.102005 0.018546 0.000827 0.059548 0.938560 0.001065 0.000891 0.983966 0.013228 0.001915 0.014425 0.008373 0.974798 0.002404 0.009980 0.971955 0.014044 0.004021 0.097916 0.719697 0.141153 0.041234 0.311973 0.408669 0.051319 0.228039 0.135459 0.062662 0.032155 0.769724 0.257152 0.110957 0.210958 0.420933 0.332189 0.253580 0.111217 0.303014 0.165196 0.212371 0.263565 0.358868 Consensus sequence: WHSGCGCGCCHTDHB Alignment: WHSGCGCGCCHTDHB -SBCCCCGCCSBB-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00033 Zfp410_secondary Original Motif Original Motif Forward 2 12 0.033673 Species: Mus musculus Original motif 0.162979 0.284781 0.237433 0.314807 0.182449 0.447584 0.069464 0.300502 0.298973 0.261014 0.213211 0.226802 0.136039 0.433062 0.144274 0.286625 0.180084 0.395933 0.158565 0.265418 0.069354 0.748510 0.068898 0.113238 0.060485 0.717828 0.075333 0.146354 0.023280 0.071762 0.645500 0.259457 0.166896 0.749762 0.062730 0.020612 0.050401 0.775248 0.089072 0.085279 0.103847 0.767557 0.068804 0.059791 0.064815 0.748318 0.114588 0.072280 0.340921 0.071942 0.242981 0.344157 0.301967 0.263512 0.165927 0.268594 0.479800 0.222955 0.118441 0.178803 0.229469 0.283621 0.143099 0.343811 0.261733 0.180191 0.169905 0.388170 Consensus sequence: BHHBHCCGCCCCDHHHH Reverse complement motif 0.388170 0.180191 0.169905 0.261733 0.343811 0.283621 0.143099 0.229469 0.178803 0.222955 0.118441 0.479800 0.268594 0.263512 0.165927 0.301967 0.344157 0.071942 0.242981 0.340921 0.064815 0.114588 0.748318 0.072280 0.103847 0.068804 0.767557 0.059791 0.050401 0.089072 0.775248 0.085279 0.166896 0.062730 0.749762 0.020612 0.023280 0.645500 0.071762 0.259457 0.060485 0.075333 0.717828 0.146354 0.069354 0.068898 0.748510 0.113238 0.180084 0.158565 0.395933 0.265418 0.136039 0.144274 0.433062 0.286625 0.226802 0.261014 0.213211 0.298973 0.182449 0.069464 0.447584 0.300502 0.314807 0.284781 0.237433 0.162979 Consensus sequence: HHHHDGGGGCGGDBHDV Alignment: BHHBHCCGCCCCDHHHH -SBCCCCGCCSBB---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00001 E2F2_primary Original Motif Reverse Complement Forward 2 12 0.034574 Species: Mus musculus Original motif 0.305970 0.214348 0.269312 0.210370 0.279551 0.218276 0.140576 0.361597 0.391304 0.162239 0.193916 0.252541 0.701667 0.102206 0.041580 0.154547 0.427655 0.068368 0.324706 0.179271 0.144368 0.191048 0.609772 0.054812 0.014295 0.020613 0.958397 0.006695 0.019783 0.962982 0.013403 0.003831 0.001189 0.023882 0.973231 0.001697 0.001343 0.919840 0.077728 0.001089 0.011293 0.097945 0.865194 0.025568 0.039106 0.864604 0.025189 0.071100 0.147663 0.328105 0.407118 0.117115 0.462769 0.203531 0.107986 0.225714 0.293396 0.229650 0.082819 0.394135 Consensus sequence: VHDARGGCGCGCVHH Reverse complement motif 0.394135 0.229650 0.082819 0.293396 0.225714 0.203531 0.107986 0.462769 0.147663 0.407118 0.328105 0.117115 0.039106 0.025189 0.864604 0.071100 0.011293 0.865194 0.097945 0.025568 0.001343 0.077728 0.919840 0.001089 0.001189 0.973231 0.023882 0.001697 0.019783 0.013403 0.962982 0.003831 0.014295 0.958397 0.020613 0.006695 0.144368 0.609772 0.191048 0.054812 0.179271 0.068368 0.324706 0.427655 0.154547 0.102206 0.041580 0.701667 0.252541 0.162239 0.193916 0.391304 0.361597 0.218276 0.140576 0.279551 0.210370 0.214348 0.269312 0.305970 Consensus sequence: HHVGCGCGCCKTDHB Alignment: HHVGCGCGCCKTDHB -SBCCCCGCCSBB-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00099 Ascl2_secondary Reverse Complement Reverse Complement Backward 3 12 0.034747 Species: Mus musculus Original motif 0.114462 0.345602 0.289353 0.250583 0.192593 0.250844 0.116250 0.440313 0.338838 0.304929 0.195843 0.160390 0.312051 0.115094 0.162465 0.410390 0.143975 0.600492 0.123348 0.132185 0.078751 0.715072 0.135182 0.070995 0.146191 0.685571 0.069799 0.098439 0.137287 0.646078 0.126428 0.090207 0.335099 0.092260 0.371510 0.201131 0.033090 0.631176 0.074278 0.261456 0.117516 0.619336 0.100946 0.162202 0.114769 0.627362 0.089839 0.168031 0.195787 0.252057 0.220803 0.331353 0.415355 0.120731 0.281372 0.182542 0.111178 0.217079 0.245769 0.425974 0.191517 0.296952 0.153370 0.358162 Consensus sequence: BHVDCCCCDCCCBDBH Reverse complement motif 0.358162 0.296952 0.153370 0.191517 0.425974 0.217079 0.245769 0.111178 0.182542 0.120731 0.281372 0.415355 0.331353 0.252057 0.220803 0.195787 0.114769 0.089839 0.627362 0.168031 0.117516 0.100946 0.619336 0.162202 0.033090 0.074278 0.631176 0.261456 0.335099 0.371510 0.092260 0.201131 0.137287 0.126428 0.646078 0.090207 0.146191 0.069799 0.685571 0.098439 0.078751 0.135182 0.715072 0.070995 0.143975 0.123348 0.600492 0.132185 0.410390 0.115094 0.162465 0.312051 0.160390 0.304929 0.195843 0.338838 0.440313 0.250844 0.116250 0.192593 0.114462 0.289353 0.345602 0.250583 Consensus sequence: HVDVGGGHGGGGDBHB Alignment: HVDVGGGHGGGGDBHB --BBSGGCGGGGBS-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00043 Bcl6b_secondary Reverse Complement Reverse Complement Forward 3 12 0.035812 Species: Mus musculus Original motif 0.316572 0.278382 0.152556 0.252490 0.167141 0.257034 0.259894 0.315931 0.175523 0.325956 0.259996 0.238525 0.165052 0.385677 0.239449 0.209822 0.069489 0.782718 0.072454 0.075339 0.049943 0.800636 0.031988 0.117433 0.223382 0.060306 0.552691 0.163621 0.072944 0.818252 0.034406 0.074398 0.070535 0.845127 0.062712 0.021626 0.031035 0.859354 0.055424 0.054187 0.063668 0.798503 0.067274 0.070554 0.348488 0.030697 0.197179 0.423636 0.307220 0.256470 0.181009 0.255301 0.460933 0.285057 0.090258 0.163752 0.315798 0.228431 0.171135 0.284637 0.374527 0.268328 0.198810 0.158335 Consensus sequence: HBBBCCGCCCCWHHHV Reverse complement motif 0.158335 0.268328 0.198810 0.374527 0.284637 0.228431 0.171135 0.315798 0.163752 0.285057 0.090258 0.460933 0.255301 0.256470 0.181009 0.307220 0.423636 0.030697 0.197179 0.348488 0.063668 0.067274 0.798503 0.070554 0.031035 0.055424 0.859354 0.054187 0.070535 0.062712 0.845127 0.021626 0.072944 0.034406 0.818252 0.074398 0.223382 0.552691 0.060306 0.163621 0.049943 0.031988 0.800636 0.117433 0.069489 0.072454 0.782718 0.075339 0.165052 0.239449 0.385677 0.209822 0.175523 0.259996 0.325956 0.238525 0.315931 0.257034 0.259894 0.167141 0.252490 0.278382 0.152556 0.316572 Consensus sequence: BHHHWGGGGCGGBBVH Alignment: BHHHWGGGGCGGBBVH --BBSGGCGGGGBS-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00400 Zif268 Original Motif Original Motif Forward 9 12 0.036535 Species: Mus musculus Original motif 0.104824 0.412716 0.254506 0.227955 0.644922 0.065476 0.140479 0.149122 0.201205 0.166164 0.347131 0.285501 0.360606 0.256316 0.150766 0.232313 0.199831 0.240681 0.279350 0.280137 0.234308 0.204076 0.321306 0.240310 0.274112 0.462435 0.111425 0.152028 0.067070 0.717501 0.073934 0.141496 0.106745 0.084442 0.658566 0.150247 0.025128 0.967053 0.003585 0.004234 0.006412 0.982989 0.003227 0.007371 0.009588 0.877620 0.002571 0.110221 0.621521 0.355443 0.015669 0.007366 0.002600 0.980275 0.004191 0.012934 0.118773 0.026658 0.783843 0.070725 0.022358 0.822101 0.024684 0.130857 0.713212 0.080912 0.128793 0.077084 0.166568 0.250955 0.107934 0.474544 0.225040 0.222494 0.163301 0.389166 0.268976 0.223206 0.265314 0.242504 0.137052 0.229058 0.148439 0.485451 0.135819 0.304550 0.141994 0.417637 0.272440 0.319501 0.230580 0.177478 Consensus sequence: BADHBDHCGCCCMCGCAHHDBBV Reverse complement motif 0.272440 0.230580 0.319501 0.177478 0.417637 0.304550 0.141994 0.135819 0.485451 0.229058 0.148439 0.137052 0.242504 0.223206 0.265314 0.268976 0.389166 0.222494 0.163301 0.225040 0.474544 0.250955 0.107934 0.166568 0.077084 0.080912 0.128793 0.713212 0.022358 0.024684 0.822101 0.130857 0.118773 0.783843 0.026658 0.070725 0.002600 0.004191 0.980275 0.012934 0.007366 0.355443 0.015669 0.621521 0.009588 0.002571 0.877620 0.110221 0.006412 0.003227 0.982989 0.007371 0.025128 0.003585 0.967053 0.004234 0.106745 0.658566 0.084442 0.150247 0.067070 0.073934 0.717501 0.141496 0.274112 0.111425 0.462435 0.152028 0.234308 0.321306 0.204076 0.240310 0.280137 0.240681 0.279350 0.199831 0.232313 0.256316 0.150766 0.360606 0.201205 0.347131 0.166164 0.285501 0.149122 0.065476 0.140479 0.644922 0.104824 0.254506 0.412716 0.227955 Consensus sequence: VVVDHHTGCGYGGGCGDHVHHTB Alignment: BADHBDHCGCCCMCGCAHHDBBV --------SBCCCCGCCSBB--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00526 Foxn1_primary Reverse Complement Reverse Complement Backward 6 12 0.038973 Species: Mus musculus Original motif 0.456612 0.057181 0.078281 0.407926 0.460529 0.185506 0.083106 0.270859 0.445717 0.179510 0.239355 0.135417 0.116339 0.145186 0.275331 0.463144 0.239398 0.142078 0.480004 0.138520 0.355157 0.217877 0.284296 0.142670 0.318602 0.444835 0.153321 0.083243 0.609569 0.055866 0.280349 0.054216 0.062297 0.769824 0.027844 0.140035 0.151868 0.019245 0.803188 0.025699 0.011842 0.952534 0.017959 0.017665 0.017665 0.017959 0.952534 0.011842 0.025699 0.803188 0.019245 0.151868 0.140035 0.027844 0.769824 0.062297 0.054216 0.280349 0.055866 0.609569 0.013084 0.624655 0.177956 0.184305 0.287647 0.183527 0.295753 0.233074 0.042309 0.345931 0.198458 0.413301 0.338138 0.266033 0.045367 0.350462 0.302850 0.155320 0.074662 0.467168 0.240926 0.068901 0.283055 0.407118 0.409954 0.183157 0.154186 0.252704 Consensus sequence: WHVBVVMACGCGCGTCDYHWDH Reverse complement motif 0.252704 0.183157 0.154186 0.409954 0.407118 0.068901 0.283055 0.240926 0.467168 0.155320 0.074662 0.302850 0.350462 0.266033 0.045367 0.338138 0.413301 0.345931 0.198458 0.042309 0.287647 0.295753 0.183527 0.233074 0.013084 0.177956 0.624655 0.184305 0.609569 0.280349 0.055866 0.054216 0.140035 0.769824 0.027844 0.062297 0.025699 0.019245 0.803188 0.151868 0.017665 0.952534 0.017959 0.011842 0.011842 0.017959 0.952534 0.017665 0.151868 0.803188 0.019245 0.025699 0.062297 0.027844 0.769824 0.140035 0.054216 0.055866 0.280349 0.609569 0.318602 0.153321 0.444835 0.083243 0.142670 0.217877 0.284296 0.355157 0.239398 0.480004 0.142078 0.138520 0.463144 0.145186 0.275331 0.116339 0.135417 0.179510 0.239355 0.445717 0.270859 0.185506 0.083106 0.460529 0.407926 0.057181 0.078281 0.456612 Consensus sequence: HDWHMHGACGCGCGTRBVVBHW Alignment: HDWHMHGACGCGCGTRBVVBHW -----BBSGGCGGGGBS----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 4 Motif ID: 75 Motif name: wwCCAmAGTCmt Original motif 0.454545 0.045455 0.227273 0.272727 0.363636 0.136364 0.136364 0.363636 0.000000 1.000000 0.000000 0.000000 0.000000 0.954545 0.045455 0.000000 1.000000 0.000000 0.000000 0.000000 0.409091 0.590909 0.000000 0.000000 0.909091 0.045455 0.045455 0.000000 0.000000 0.000000 1.000000 0.000000 0.045455 0.000000 0.000000 0.954545 0.045455 0.909091 0.000000 0.045455 0.272727 0.318182 0.181818 0.227273 0.181818 0.227273 0.227273 0.363636 Consensus sequence: DDCCAMAGTCHB Reserve complement motif 0.363636 0.227273 0.227273 0.181818 0.272727 0.181818 0.318182 0.227273 0.045455 0.000000 0.909091 0.045455 0.954545 0.000000 0.000000 0.045455 0.000000 1.000000 0.000000 0.000000 0.000000 0.045455 0.045455 0.909091 0.409091 0.000000 0.590909 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.045455 0.954545 0.000000 0.000000 0.000000 1.000000 0.000000 0.363636 0.136364 0.136364 0.363636 0.272727 0.045455 0.227273 0.454545 Consensus sequence: VDGACTRTGGDD ************************************************************************ Best Matches for Motif ID 75 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00079 Esrra_primary Original Motif Original Motif Backward 5 12 0.009273 Species: Mus musculus Original motif 0.212524 0.177958 0.293723 0.315796 0.420838 0.283140 0.144938 0.151084 0.198119 0.196347 0.260353 0.345181 0.117752 0.282184 0.137207 0.462857 0.070125 0.781439 0.138093 0.010344 0.965989 0.000956 0.023828 0.009227 0.977263 0.003066 0.019255 0.000416 0.007404 0.000267 0.938934 0.053395 0.007147 0.000287 0.983377 0.009190 0.039608 0.000730 0.040682 0.918981 0.000685 0.905345 0.021930 0.072040 0.800961 0.001126 0.195791 0.002121 0.245039 0.241263 0.038084 0.475614 0.265397 0.238316 0.304963 0.191325 0.203742 0.286208 0.231002 0.279048 0.194132 0.188854 0.346693 0.270322 0.310711 0.263840 0.184317 0.241132 Consensus sequence: DHDBCAAGGTCAHVBDH Reverse complement motif 0.241132 0.263840 0.184317 0.310711 0.194132 0.346693 0.188854 0.270322 0.203742 0.231002 0.286208 0.279048 0.265397 0.304963 0.238316 0.191325 0.475614 0.241263 0.038084 0.245039 0.002121 0.001126 0.195791 0.800961 0.000685 0.021930 0.905345 0.072040 0.918981 0.000730 0.040682 0.039608 0.007147 0.983377 0.000287 0.009190 0.007404 0.938934 0.000267 0.053395 0.000416 0.003066 0.019255 0.977263 0.009227 0.000956 0.023828 0.965989 0.070125 0.138093 0.781439 0.010344 0.462857 0.282184 0.137207 0.117752 0.345181 0.196347 0.260353 0.198119 0.151084 0.283140 0.144938 0.420838 0.315796 0.177958 0.293723 0.212524 Consensus sequence: HHBVHTGACCTTGVDHD Alignment: DHDBCAAGGTCAHVBDH -DDCCAMAGTCHB---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00066 Hnf4a_secondary Original Motif Original Motif Forward 1 12 0.015755 Species: Mus musculus Original motif 0.131680 0.169949 0.346277 0.352094 0.109910 0.144258 0.373681 0.372151 0.196671 0.411335 0.159689 0.232305 0.311086 0.307077 0.122332 0.259505 0.895155 0.013238 0.038874 0.052733 0.779629 0.018399 0.171269 0.030703 0.950546 0.002649 0.041825 0.004980 0.004769 0.002646 0.985847 0.006739 0.004458 0.002117 0.012011 0.981414 0.016789 0.969626 0.003890 0.009695 0.002468 0.982852 0.004754 0.009926 0.891448 0.003193 0.097548 0.007811 0.513330 0.308971 0.070467 0.107232 0.179371 0.115514 0.130898 0.574217 0.285826 0.277536 0.166982 0.269655 0.319407 0.227783 0.129020 0.323790 Consensus sequence: BBHHAAAGTCCAMTHH Reverse complement motif 0.323790 0.227783 0.129020 0.319407 0.269655 0.277536 0.166982 0.285826 0.574217 0.115514 0.130898 0.179371 0.107232 0.308971 0.070467 0.513330 0.007811 0.003193 0.097548 0.891448 0.002468 0.004754 0.982852 0.009926 0.016789 0.003890 0.969626 0.009695 0.981414 0.002117 0.012011 0.004458 0.004769 0.985847 0.002646 0.006739 0.004980 0.002649 0.041825 0.950546 0.030703 0.018399 0.171269 0.779629 0.052733 0.013238 0.038874 0.895155 0.259505 0.307077 0.122332 0.311086 0.196671 0.159689 0.411335 0.232305 0.109910 0.373681 0.144258 0.372151 0.352094 0.169949 0.346277 0.131680 Consensus sequence: HHAYTGGACTTTHDBV Alignment: BBHHAAAGTCCAMTHH DDCCAMAGTCHB---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00023 Sox30_primary Reverse Complement Original Motif Forward 3 12 0.021894 Species: Mus musculus Original motif 0.372432 0.102933 0.322145 0.202491 0.328072 0.182071 0.157347 0.332510 0.289417 0.084511 0.292873 0.333198 0.157571 0.227851 0.441662 0.172917 0.716832 0.049010 0.201411 0.032747 0.957368 0.003162 0.004402 0.035068 0.003907 0.862678 0.009407 0.124008 0.977231 0.007658 0.004263 0.010847 0.976481 0.004510 0.015225 0.003784 0.067568 0.004353 0.005071 0.923008 0.158205 0.108442 0.467023 0.266330 0.334549 0.091557 0.510241 0.063654 0.456431 0.182602 0.150234 0.210732 0.387485 0.241062 0.151504 0.219950 0.188387 0.269857 0.176514 0.365242 0.175680 0.243984 0.165833 0.414502 Consensus sequence: DHDBAACAATDRHHHH Reverse complement motif 0.414502 0.243984 0.165833 0.175680 0.365242 0.269857 0.176514 0.188387 0.219950 0.241062 0.151504 0.387485 0.210732 0.182602 0.150234 0.456431 0.334549 0.510241 0.091557 0.063654 0.158205 0.467023 0.108442 0.266330 0.923008 0.004353 0.005071 0.067568 0.003784 0.004510 0.015225 0.976481 0.010847 0.007658 0.004263 0.977231 0.003907 0.009407 0.862678 0.124008 0.035068 0.003162 0.004402 0.957368 0.032747 0.049010 0.201411 0.716832 0.157571 0.441662 0.227851 0.172917 0.333198 0.084511 0.292873 0.289417 0.332510 0.182071 0.157347 0.328072 0.202491 0.102933 0.322145 0.372432 Consensus sequence: HHHHMHATTGTTBDHD Alignment: DHDBAACAATDRHHHH --VDGACTRTGGDD-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00028 Tcfap2e_primary Original Motif Reverse Complement Backward 2 12 0.023236 Species: Mus musculus Original motif 0.369517 0.172742 0.163174 0.294567 0.260541 0.211816 0.194359 0.333284 0.292862 0.281323 0.073013 0.352801 0.011777 0.272676 0.697188 0.018359 0.005160 0.983588 0.005917 0.005335 0.002256 0.960488 0.005733 0.031524 0.003735 0.283214 0.123762 0.589290 0.024383 0.379981 0.542999 0.052638 0.589290 0.123762 0.283214 0.003735 0.031524 0.005733 0.960488 0.002256 0.005335 0.005917 0.983588 0.005160 0.018359 0.697188 0.272676 0.011777 0.328286 0.093173 0.334133 0.244408 0.563777 0.145250 0.140240 0.150733 0.263206 0.222321 0.242153 0.272320 Consensus sequence: HHHGCCTSAGGCDAD Reverse complement motif 0.272320 0.222321 0.242153 0.263206 0.150733 0.145250 0.140240 0.563777 0.328286 0.334133 0.093173 0.244408 0.018359 0.272676 0.697188 0.011777 0.005335 0.983588 0.005917 0.005160 0.031524 0.960488 0.005733 0.002256 0.003735 0.123762 0.283214 0.589290 0.024383 0.542999 0.379981 0.052638 0.589290 0.283214 0.123762 0.003735 0.002256 0.005733 0.960488 0.031524 0.005160 0.005917 0.983588 0.005335 0.011777 0.697188 0.272676 0.018359 0.352801 0.281323 0.073013 0.292862 0.333284 0.211816 0.194359 0.260541 0.294567 0.172742 0.163174 0.369517 Consensus sequence: DTHGCCTSAGGCHHH Alignment: DTHGCCTSAGGCHHH --DDCCAMAGTCHB- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00034 Sox7_primary Reverse Complement Original Motif Backward 6 12 0.023587 Species: Mus musculus Original motif 0.360997 0.300272 0.115555 0.223177 0.309749 0.228429 0.166233 0.295589 0.149419 0.176868 0.240155 0.433558 0.379704 0.095791 0.276373 0.248133 0.394549 0.174184 0.130641 0.300626 0.443749 0.070776 0.211081 0.274393 0.364301 0.074356 0.370406 0.190936 0.791976 0.038475 0.093390 0.076159 0.963721 0.001826 0.002456 0.031997 0.004516 0.954596 0.008092 0.032796 0.981080 0.002062 0.002161 0.014697 0.986185 0.001846 0.006976 0.004992 0.059567 0.003649 0.002189 0.934595 0.495328 0.024257 0.240450 0.239965 0.305027 0.094878 0.526069 0.074025 0.418442 0.196237 0.158323 0.226998 0.336713 0.220452 0.191155 0.251680 0.192296 0.300342 0.169047 0.338315 0.240387 0.144634 0.128513 0.486465 0.290763 0.271259 0.116600 0.321377 0.224825 0.296233 0.229255 0.249687 0.493240 0.171285 0.075148 0.260326 Consensus sequence: HHBDHDDAACAATDRHHHHHBW Reverse complement motif 0.260326 0.171285 0.075148 0.493240 0.224825 0.229255 0.296233 0.249687 0.321377 0.271259 0.116600 0.290763 0.486465 0.144634 0.128513 0.240387 0.338315 0.300342 0.169047 0.192296 0.251680 0.220452 0.191155 0.336713 0.226998 0.196237 0.158323 0.418442 0.305027 0.526069 0.094878 0.074025 0.239965 0.024257 0.240450 0.495328 0.934595 0.003649 0.002189 0.059567 0.004992 0.001846 0.006976 0.986185 0.014697 0.002062 0.002161 0.981080 0.004516 0.008092 0.954596 0.032796 0.031997 0.001826 0.002456 0.963721 0.076159 0.038475 0.093390 0.791976 0.364301 0.370406 0.074356 0.190936 0.274393 0.070776 0.211081 0.443749 0.300626 0.174184 0.130641 0.394549 0.248133 0.095791 0.276373 0.379704 0.433558 0.176868 0.240155 0.149419 0.295589 0.228429 0.166233 0.309749 0.223177 0.300272 0.115555 0.360997 Consensus sequence: WBHHHHHMDATTGTTHDHDVHH Alignment: HHBDHDDAACAATDRHHHHHBW -----VDGACTRTGGDD----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00095 Zfp691_secondary Original Motif Reverse Complement Backward 4 12 0.024090 Species: Mus musculus Original motif 0.236868 0.155338 0.295091 0.312703 0.522782 0.133021 0.177386 0.166812 0.192915 0.374870 0.221406 0.210809 0.146546 0.199196 0.418035 0.236223 0.454326 0.095049 0.151770 0.298855 0.027956 0.023096 0.878335 0.070614 0.916030 0.020358 0.039894 0.023717 0.010595 0.938036 0.039415 0.011954 0.007271 0.014948 0.007990 0.969792 0.014291 0.964878 0.011126 0.009705 0.154586 0.759294 0.050151 0.035969 0.051021 0.268239 0.053410 0.627330 0.158293 0.386843 0.113152 0.341713 0.281766 0.184139 0.187916 0.346179 0.292444 0.267259 0.241323 0.198974 0.425732 0.262331 0.149076 0.162861 0.205385 0.384164 0.267912 0.142538 Consensus sequence: DABBWGACTCCTHDVHV Reverse complement motif 0.205385 0.267912 0.384164 0.142538 0.162861 0.262331 0.149076 0.425732 0.198974 0.267259 0.241323 0.292444 0.346179 0.184139 0.187916 0.281766 0.158293 0.113152 0.386843 0.341713 0.627330 0.268239 0.053410 0.051021 0.154586 0.050151 0.759294 0.035969 0.014291 0.011126 0.964878 0.009705 0.969792 0.014948 0.007990 0.007271 0.010595 0.039415 0.938036 0.011954 0.023717 0.020358 0.039894 0.916030 0.027956 0.878335 0.023096 0.070614 0.298855 0.095049 0.151770 0.454326 0.146546 0.418035 0.199196 0.236223 0.192915 0.221406 0.374870 0.210809 0.166812 0.133021 0.177386 0.522782 0.312703 0.155338 0.295091 0.236868 Consensus sequence: VHBDDAGGAGTCWBBTD Alignment: VHBDDAGGAGTCWBBTD --DDCCAMAGTCHB--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00004 Sox14_secondary Reverse Complement Original Motif Backward 2 12 0.025783 Species: Mus musculus Original motif 0.191264 0.345487 0.212142 0.251106 0.105033 0.130838 0.338939 0.425191 0.126539 0.333031 0.233364 0.307066 0.641901 0.114039 0.195933 0.048127 0.153349 0.532437 0.272427 0.041786 0.934680 0.009395 0.019668 0.036257 0.013611 0.927298 0.037729 0.021361 0.964293 0.018416 0.006724 0.010568 0.962181 0.018004 0.014592 0.005223 0.229593 0.016301 0.007632 0.746474 0.268456 0.030092 0.519349 0.182102 0.201484 0.107350 0.588833 0.102334 0.253726 0.259057 0.242924 0.244293 0.168663 0.203061 0.347898 0.280378 0.175853 0.339716 0.301724 0.182707 Consensus sequence: BKBASACAATRGHBB Reverse complement motif 0.175853 0.301724 0.339716 0.182707 0.168663 0.347898 0.203061 0.280378 0.253726 0.242924 0.259057 0.244293 0.201484 0.588833 0.107350 0.102334 0.268456 0.519349 0.030092 0.182102 0.746474 0.016301 0.007632 0.229593 0.005223 0.018004 0.014592 0.962181 0.010568 0.018416 0.006724 0.964293 0.013611 0.037729 0.927298 0.021361 0.036257 0.009395 0.019668 0.934680 0.153349 0.272427 0.532437 0.041786 0.048127 0.114039 0.195933 0.641901 0.126539 0.233364 0.333031 0.307066 0.425191 0.130838 0.338939 0.105033 0.191264 0.212142 0.345487 0.251106 Consensus sequence: BBDCMATTGTSTBRB Alignment: BKBASACAATRGHBB --VDGACTRTGGDD- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00081 Mybl1_primary Reverse Complement Original Motif Backward 3 12 0.026472 Species: Mus musculus Original motif 0.219490 0.243488 0.196239 0.340783 0.242096 0.094435 0.234242 0.429226 0.242319 0.155536 0.366023 0.236122 0.369837 0.185801 0.219486 0.224876 0.390568 0.211210 0.098244 0.299978 0.782192 0.011783 0.158354 0.047671 0.837985 0.006254 0.084522 0.071239 0.027255 0.965067 0.001360 0.006318 0.006706 0.831051 0.151462 0.010782 0.003491 0.002829 0.991758 0.001921 0.004195 0.009136 0.009776 0.976893 0.009860 0.166761 0.002159 0.821220 0.709623 0.006957 0.204415 0.079005 0.316262 0.239384 0.140024 0.304330 0.254660 0.237146 0.090326 0.417868 0.289939 0.309708 0.068038 0.332316 0.262670 0.214791 0.217375 0.305164 Consensus sequence: HDDDHAACCGTTAHHHD Reverse complement motif 0.305164 0.214791 0.217375 0.262670 0.332316 0.309708 0.068038 0.289939 0.417868 0.237146 0.090326 0.254660 0.304330 0.239384 0.140024 0.316262 0.079005 0.006957 0.204415 0.709623 0.821220 0.166761 0.002159 0.009860 0.976893 0.009136 0.009776 0.004195 0.003491 0.991758 0.002829 0.001921 0.006706 0.151462 0.831051 0.010782 0.027255 0.001360 0.965067 0.006318 0.071239 0.006254 0.084522 0.837985 0.047671 0.011783 0.158354 0.782192 0.299978 0.211210 0.098244 0.390568 0.224876 0.185801 0.219486 0.369837 0.242319 0.366023 0.155536 0.236122 0.429226 0.094435 0.234242 0.242096 0.340783 0.243488 0.196239 0.219490 Consensus sequence: DHHHTAACGGTTHDHDH Alignment: HDDDHAACCGTTAHHHD ---VDGACTRTGGDD-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00052 Osr2_primary Original Motif Reverse Complement Backward 2 12 0.027027 Species: Mus musculus Original motif 0.295210 0.230759 0.178832 0.295199 0.286163 0.186772 0.186150 0.340915 0.287577 0.235045 0.329453 0.147924 0.263264 0.191325 0.081978 0.463433 0.839420 0.118123 0.018788 0.023669 0.005488 0.984397 0.000830 0.009284 0.660134 0.001532 0.336574 0.001760 0.003020 0.001773 0.993144 0.002063 0.039664 0.001060 0.005054 0.954222 0.980339 0.000636 0.016776 0.002249 0.003849 0.001418 0.992166 0.002568 0.000858 0.950172 0.007228 0.041743 0.342840 0.230712 0.133570 0.292878 0.342486 0.316980 0.167294 0.173240 0.362426 0.178913 0.146709 0.311952 0.266586 0.140406 0.435643 0.157365 Consensus sequence: HHVHACRGTAGCHHHD Reverse complement motif 0.266586 0.435643 0.140406 0.157365 0.311952 0.178913 0.146709 0.362426 0.173240 0.316980 0.167294 0.342486 0.292878 0.230712 0.133570 0.342840 0.000858 0.007228 0.950172 0.041743 0.003849 0.992166 0.001418 0.002568 0.002249 0.000636 0.016776 0.980339 0.954222 0.001060 0.005054 0.039664 0.003020 0.993144 0.001773 0.002063 0.001760 0.001532 0.336574 0.660134 0.005488 0.000830 0.984397 0.009284 0.023669 0.118123 0.018788 0.839420 0.463433 0.191325 0.081978 0.263264 0.287577 0.329453 0.235045 0.147924 0.340915 0.186772 0.186150 0.286163 0.295199 0.230759 0.178832 0.295210 Consensus sequence: HHHHGCTACKGTHVHH Alignment: HHHHGCTACKGTHVHH ---DDCCAMAGTCHB- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00000 Smad3_primary Reverse Complement Reverse Complement Forward 3 12 0.027066 Species: Mus musculus Original motif 0.282316 0.413385 0.114930 0.189369 0.341654 0.135011 0.267943 0.255392 0.399523 0.173081 0.168845 0.258551 0.365086 0.196360 0.211856 0.226699 0.243321 0.177839 0.224206 0.354635 0.029873 0.808479 0.036309 0.125339 0.004945 0.815465 0.040635 0.138955 0.934557 0.058944 0.005027 0.001471 0.005099 0.003998 0.986148 0.004755 0.969304 0.020594 0.001929 0.008173 0.008189 0.984816 0.004199 0.002795 0.669579 0.012182 0.282153 0.036085 0.130511 0.171241 0.334041 0.364207 0.198982 0.289660 0.252392 0.258966 0.423172 0.190978 0.164411 0.221440 0.213519 0.287388 0.294414 0.204679 0.371956 0.285061 0.150191 0.192792 Consensus sequence: HDHDDCCAGACABBHVH Reverse complement motif 0.192792 0.285061 0.150191 0.371956 0.213519 0.294414 0.287388 0.204679 0.221440 0.190978 0.164411 0.423172 0.198982 0.252392 0.289660 0.258966 0.364207 0.171241 0.334041 0.130511 0.036085 0.012182 0.282153 0.669579 0.008189 0.004199 0.984816 0.002795 0.008173 0.020594 0.001929 0.969304 0.005099 0.986148 0.003998 0.004755 0.001471 0.058944 0.005027 0.934557 0.004945 0.040635 0.815465 0.138955 0.029873 0.036309 0.808479 0.125339 0.354635 0.177839 0.224206 0.243321 0.226699 0.196360 0.211856 0.365086 0.258551 0.173081 0.168845 0.399523 0.255392 0.135011 0.267943 0.341654 0.282316 0.114930 0.413385 0.189369 Consensus sequence: HVHBVTGTCTGGDDHDD Alignment: HVHBVTGTCTGGDDHDD --VDGACTRTGGDD--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 4 Motif ID: 76 Motif name: CAcCACAGTGGAGCAct Original motif 0.078125 0.734375 0.046875 0.140625 0.828125 0.046875 0.078125 0.046875 0.203125 0.484375 0.156250 0.156250 0.015625 0.984375 0.000000 0.000000 0.968750 0.015625 0.015625 0.000000 0.000000 0.906250 0.015625 0.078125 0.859375 0.000000 0.000000 0.140625 0.031250 0.000000 0.906250 0.062500 0.000000 0.015625 0.000000 0.984375 0.000000 0.000000 0.968750 0.031250 0.046875 0.062500 0.812500 0.078125 0.937500 0.015625 0.015625 0.031250 0.015625 0.031250 0.921875 0.031250 0.125000 0.796875 0.000000 0.078125 0.875000 0.046875 0.046875 0.031250 0.093750 0.656250 0.093750 0.156250 0.156250 0.078125 0.109375 0.656250 Consensus sequence: CAHCACAGTGGAGCACT Reserve complement motif 0.656250 0.078125 0.109375 0.156250 0.093750 0.093750 0.656250 0.156250 0.031250 0.046875 0.046875 0.875000 0.125000 0.000000 0.796875 0.078125 0.015625 0.921875 0.031250 0.031250 0.031250 0.015625 0.015625 0.937500 0.046875 0.812500 0.062500 0.078125 0.000000 0.968750 0.000000 0.031250 0.984375 0.015625 0.000000 0.000000 0.031250 0.906250 0.000000 0.062500 0.140625 0.000000 0.000000 0.859375 0.000000 0.015625 0.906250 0.078125 0.000000 0.015625 0.015625 0.968750 0.015625 0.000000 0.984375 0.000000 0.203125 0.156250 0.484375 0.156250 0.046875 0.046875 0.078125 0.828125 0.078125 0.046875 0.734375 0.140625 Consensus sequence: AGTGCTCCACTGTGDTG ************************************************************************ Best Matches for Motif ID 76 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v015681_primary Original Motif Reverse Complement Forward 2 17 0.038134 Species: Mus musculus Original motif 0.472795 0.179227 0.091251 0.256726 0.036521 0.159743 0.204840 0.598896 0.164582 0.312805 0.221324 0.301289 0.237069 0.249050 0.293048 0.220833 0.401949 0.225181 0.229401 0.143469 0.161422 0.494334 0.252207 0.092036 0.252940 0.177721 0.369400 0.199939 0.119630 0.024651 0.849920 0.005798 0.000962 0.002398 0.990616 0.006023 0.937852 0.027016 0.034535 0.000597 0.008963 0.987756 0.000629 0.002652 0.001584 0.992898 0.002349 0.003169 0.956822 0.027342 0.002484 0.013352 0.009873 0.987759 0.000988 0.001381 0.016397 0.980856 0.000369 0.002378 0.081761 0.758555 0.038572 0.121112 0.371713 0.091838 0.448027 0.088423 0.111617 0.121913 0.683885 0.082585 0.334562 0.102916 0.436488 0.126034 0.210362 0.101261 0.238339 0.450037 0.169041 0.271583 0.320799 0.238576 0.140316 0.049885 0.735236 0.074563 Consensus sequence: HTBVVVDGGACCACCCRGRDBG Reverse complement motif 0.140316 0.735236 0.049885 0.074563 0.169041 0.320799 0.271583 0.238576 0.450037 0.101261 0.238339 0.210362 0.334562 0.436488 0.102916 0.126034 0.111617 0.683885 0.121913 0.082585 0.371713 0.448027 0.091838 0.088423 0.081761 0.038572 0.758555 0.121112 0.016397 0.000369 0.980856 0.002378 0.009873 0.000988 0.987759 0.001381 0.013352 0.027342 0.002484 0.956822 0.001584 0.002349 0.992898 0.003169 0.008963 0.000629 0.987756 0.002652 0.000597 0.027016 0.034535 0.937852 0.000962 0.990616 0.002398 0.006023 0.119630 0.849920 0.024651 0.005798 0.252940 0.369400 0.177721 0.199939 0.161422 0.252207 0.494334 0.092036 0.143469 0.225181 0.229401 0.401949 0.237069 0.293048 0.249050 0.220833 0.164582 0.221324 0.312805 0.301289 0.598896 0.159743 0.204840 0.036521 0.256726 0.179227 0.091251 0.472795 Consensus sequence: CBDMCMGGGTGGTCCHVBVBAH Alignment: CBDMCMGGGTGGTCCHVBVBAH -CAHCACAGTGGAGCACT---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00031 Zbtb3_primary Reverse Complement Reverse Complement Backward 1 17 0.039321 Species: Mus musculus Original motif 0.401190 0.144405 0.268531 0.185874 0.430224 0.168519 0.221247 0.180011 0.172575 0.268499 0.274136 0.284789 0.150971 0.297110 0.290868 0.261051 0.133421 0.282842 0.434718 0.149019 0.042798 0.941105 0.001785 0.014312 0.890788 0.002551 0.103316 0.003345 0.001887 0.951368 0.043722 0.003023 0.011633 0.002218 0.002269 0.983880 0.003597 0.003728 0.984819 0.007856 0.002946 0.903520 0.072457 0.021077 0.908487 0.057072 0.018256 0.016185 0.076237 0.329864 0.228896 0.365003 0.144926 0.162981 0.177370 0.514722 0.124970 0.327876 0.295814 0.251341 0.144592 0.313887 0.301912 0.239609 0.108463 0.241747 0.350296 0.299494 Consensus sequence: DDBBBCACTGCABTBBB Reverse complement motif 0.108463 0.350296 0.241747 0.299494 0.144592 0.301912 0.313887 0.239609 0.124970 0.295814 0.327876 0.251341 0.514722 0.162981 0.177370 0.144926 0.365003 0.329864 0.228896 0.076237 0.016185 0.057072 0.018256 0.908487 0.002946 0.072457 0.903520 0.021077 0.003597 0.984819 0.003728 0.007856 0.983880 0.002218 0.002269 0.011633 0.001887 0.043722 0.951368 0.003023 0.003345 0.002551 0.103316 0.890788 0.042798 0.001785 0.941105 0.014312 0.133421 0.434718 0.282842 0.149019 0.150971 0.290868 0.297110 0.261051 0.284789 0.268499 0.274136 0.172575 0.180011 0.168519 0.221247 0.430224 0.185874 0.144405 0.268531 0.401190 Consensus sequence: BBBAVTGCAGTGBBVDD Alignment: BBBAVTGCAGTGBBVDD AGTGCTCCACTGTGDTG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00034 Sox7_primary Original Motif Original Motif Backward 2 17 0.044117 Species: Mus musculus Original motif 0.360997 0.300272 0.115555 0.223177 0.309749 0.228429 0.166233 0.295589 0.149419 0.176868 0.240155 0.433558 0.379704 0.095791 0.276373 0.248133 0.394549 0.174184 0.130641 0.300626 0.443749 0.070776 0.211081 0.274393 0.364301 0.074356 0.370406 0.190936 0.791976 0.038475 0.093390 0.076159 0.963721 0.001826 0.002456 0.031997 0.004516 0.954596 0.008092 0.032796 0.981080 0.002062 0.002161 0.014697 0.986185 0.001846 0.006976 0.004992 0.059567 0.003649 0.002189 0.934595 0.495328 0.024257 0.240450 0.239965 0.305027 0.094878 0.526069 0.074025 0.418442 0.196237 0.158323 0.226998 0.336713 0.220452 0.191155 0.251680 0.192296 0.300342 0.169047 0.338315 0.240387 0.144634 0.128513 0.486465 0.290763 0.271259 0.116600 0.321377 0.224825 0.296233 0.229255 0.249687 0.493240 0.171285 0.075148 0.260326 Consensus sequence: HHBDHDDAACAATDRHHHHHBW Reverse complement motif 0.260326 0.171285 0.075148 0.493240 0.224825 0.229255 0.296233 0.249687 0.321377 0.271259 0.116600 0.290763 0.486465 0.144634 0.128513 0.240387 0.338315 0.300342 0.169047 0.192296 0.251680 0.220452 0.191155 0.336713 0.226998 0.196237 0.158323 0.418442 0.305027 0.526069 0.094878 0.074025 0.239965 0.024257 0.240450 0.495328 0.934595 0.003649 0.002189 0.059567 0.004992 0.001846 0.006976 0.986185 0.014697 0.002062 0.002161 0.981080 0.004516 0.008092 0.954596 0.032796 0.031997 0.001826 0.002456 0.963721 0.076159 0.038475 0.093390 0.791976 0.364301 0.370406 0.074356 0.190936 0.274393 0.070776 0.211081 0.443749 0.300626 0.174184 0.130641 0.394549 0.248133 0.095791 0.276373 0.379704 0.433558 0.176868 0.240155 0.149419 0.295589 0.228429 0.166233 0.309749 0.223177 0.300272 0.115555 0.360997 Consensus sequence: WBHHHHHMDATTGTTHDHDVHH Alignment: HHBDHDDAACAATDRHHHHHBW ----CAHCACAGTGGAGCACT- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v016060_primary Reverse Complement Reverse Complement Forward 4 17 0.047762 Species: Mus musculus Original motif 0.204923 0.208846 0.365383 0.220848 0.294304 0.300143 0.167287 0.238266 0.109711 0.619514 0.117379 0.153396 0.178979 0.378580 0.230177 0.212264 0.159594 0.542602 0.118178 0.179627 0.125206 0.430074 0.151826 0.292894 0.097692 0.709845 0.116956 0.075506 0.148292 0.565912 0.037632 0.248164 0.077951 0.034190 0.855503 0.032356 0.001657 0.001061 0.971877 0.025405 0.001926 0.001084 0.991712 0.005278 0.033031 0.012001 0.057796 0.897171 0.002723 0.002647 0.993348 0.001281 0.003261 0.000963 0.987199 0.008577 0.000611 0.090925 0.074857 0.833608 0.015299 0.978878 0.004949 0.000874 0.013368 0.600902 0.033485 0.352245 0.231949 0.149575 0.118804 0.499672 0.267580 0.186002 0.371242 0.175176 0.264884 0.223483 0.110082 0.401551 0.221365 0.170121 0.179559 0.428955 0.112997 0.692930 0.139981 0.054092 0.460305 0.207883 0.155111 0.176702 Consensus sequence: BHCBCBCCGGGTGGTCYHVHDCH Reverse complement motif 0.176702 0.207883 0.155111 0.460305 0.112997 0.139981 0.692930 0.054092 0.428955 0.170121 0.179559 0.221365 0.401551 0.223483 0.110082 0.264884 0.267580 0.371242 0.186002 0.175176 0.499672 0.149575 0.118804 0.231949 0.013368 0.033485 0.600902 0.352245 0.015299 0.004949 0.978878 0.000874 0.833608 0.090925 0.074857 0.000611 0.003261 0.987199 0.000963 0.008577 0.002723 0.993348 0.002647 0.001281 0.897171 0.012001 0.057796 0.033031 0.001926 0.991712 0.001084 0.005278 0.001657 0.971877 0.001061 0.025405 0.077951 0.855503 0.034190 0.032356 0.148292 0.037632 0.565912 0.248164 0.097692 0.116956 0.709845 0.075506 0.125206 0.151826 0.430074 0.292894 0.159594 0.118178 0.542602 0.179627 0.178979 0.230177 0.378580 0.212264 0.109711 0.117379 0.619514 0.153396 0.294304 0.167287 0.300143 0.238266 0.204923 0.365383 0.208846 0.220848 Consensus sequence: HGDHVHKGACCACCCGGBGBGDB Alignment: HGDHVHKGACCACCCGGBGBGDB ---AGTGCTCCACTGTGDTG--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00231 Nkx2-2 Original Motif Original Motif Backward 1 17 0.047942 Species: Mus musculus Original motif 0.299323 0.258429 0.141957 0.300291 0.267631 0.143882 0.146933 0.441554 0.482614 0.212022 0.233631 0.071733 0.430836 0.073912 0.334439 0.160813 0.124944 0.704331 0.166815 0.003910 0.001941 0.876479 0.000828 0.120752 0.920202 0.005985 0.000456 0.073357 0.023544 0.974093 0.000859 0.001505 0.005010 0.003098 0.001328 0.990564 0.003250 0.198149 0.000490 0.798110 0.134659 0.104976 0.753464 0.006901 0.932490 0.000724 0.006140 0.060646 0.504530 0.106203 0.360995 0.028271 0.673257 0.074893 0.106536 0.145314 0.356324 0.097610 0.230142 0.315924 0.129483 0.188353 0.203623 0.478542 0.289071 0.157675 0.231909 0.321345 Consensus sequence: HDVRCCACTTGARADBD Reverse complement motif 0.321345 0.157675 0.231909 0.289071 0.478542 0.188353 0.203623 0.129483 0.315924 0.097610 0.230142 0.356324 0.145314 0.074893 0.106536 0.673257 0.028271 0.106203 0.360995 0.504530 0.060646 0.000724 0.006140 0.932490 0.134659 0.753464 0.104976 0.006901 0.798110 0.198149 0.000490 0.003250 0.990564 0.003098 0.001328 0.005010 0.023544 0.000859 0.974093 0.001505 0.073357 0.005985 0.000456 0.920202 0.001941 0.000828 0.876479 0.120752 0.124944 0.166815 0.704331 0.003910 0.160813 0.073912 0.334439 0.430836 0.071733 0.212022 0.233631 0.482614 0.441554 0.143882 0.146933 0.267631 0.300291 0.258429 0.141957 0.299323 Consensus sequence: DVDTKTCAAGTGGKBDH Alignment: HDVRCCACTTGARADBD CAHCACAGTGGAGCACT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00528 Foxm1_primary Original Motif Reverse Complement Backward 6 17 0.048468 Species: Mus musculus Original motif 0.402634 0.249702 0.143705 0.203959 0.709619 0.108953 0.130781 0.050647 0.334232 0.077498 0.228818 0.359452 0.131721 0.094794 0.234481 0.539005 0.170102 0.237609 0.252464 0.339824 0.244961 0.347304 0.228129 0.179606 0.612141 0.132244 0.180110 0.075504 0.472236 0.042388 0.234419 0.250957 0.125213 0.007413 0.849788 0.017587 0.702068 0.064216 0.141992 0.091724 0.008657 0.038238 0.002959 0.950145 0.007170 0.002244 0.986824 0.003763 0.002862 0.979956 0.000711 0.016471 0.971196 0.001954 0.011441 0.015409 0.105575 0.031482 0.022836 0.840107 0.031534 0.736742 0.032785 0.198939 0.479153 0.347558 0.031799 0.141490 0.056405 0.123140 0.023989 0.796466 0.111194 0.195344 0.501360 0.192102 0.376359 0.416820 0.072818 0.134004 0.225111 0.249460 0.306563 0.218866 0.405251 0.168478 0.108618 0.317653 0.165386 0.191749 0.268604 0.374261 Consensus sequence: HADTBVADGATGCATCMTGMVHB Reverse complement motif 0.374261 0.191749 0.268604 0.165386 0.317653 0.168478 0.108618 0.405251 0.225111 0.306563 0.249460 0.218866 0.376359 0.072818 0.416820 0.134004 0.111194 0.501360 0.195344 0.192102 0.796466 0.123140 0.023989 0.056405 0.141490 0.347558 0.031799 0.479153 0.031534 0.032785 0.736742 0.198939 0.840107 0.031482 0.022836 0.105575 0.015409 0.001954 0.011441 0.971196 0.002862 0.000711 0.979956 0.016471 0.007170 0.986824 0.002244 0.003763 0.950145 0.038238 0.002959 0.008657 0.091724 0.064216 0.141992 0.702068 0.125213 0.849788 0.007413 0.017587 0.250957 0.042388 0.234419 0.472236 0.075504 0.132244 0.180110 0.612141 0.244961 0.228129 0.347304 0.179606 0.339824 0.237609 0.252464 0.170102 0.539005 0.094794 0.234481 0.131721 0.359452 0.077498 0.228818 0.334232 0.050647 0.108953 0.130781 0.709619 0.203959 0.249702 0.143705 0.402634 Consensus sequence: VHVRCAYGATGCATCDTVVADTH Alignment: VHVRCAYGATGCATCDTVVADTH -CAHCACAGTGGAGCACT----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v016060_secondary Reverse Complement Reverse Complement Forward 1 17 0.048744 Species: Mus musculus Original motif 0.168550 0.345968 0.396524 0.088958 0.038113 0.360882 0.114042 0.486963 0.349356 0.180599 0.051416 0.418629 0.258773 0.332518 0.244932 0.163778 0.371663 0.208591 0.263136 0.156609 0.225440 0.321741 0.175932 0.276887 0.100827 0.656850 0.018644 0.223679 0.494140 0.155427 0.327424 0.023009 0.105642 0.805846 0.027712 0.060800 0.065110 0.845072 0.058046 0.031772 0.649343 0.110180 0.180680 0.059797 0.064269 0.853604 0.066860 0.015268 0.437421 0.533797 0.016833 0.011948 0.121694 0.787708 0.016177 0.074421 0.625382 0.066925 0.266070 0.041623 0.117819 0.608153 0.165139 0.108889 0.145639 0.102001 0.604926 0.147434 0.521188 0.184986 0.064607 0.229219 0.180371 0.274237 0.096591 0.448801 0.071055 0.455813 0.332817 0.140315 0.084503 0.199982 0.448293 0.267222 0.389451 0.169545 0.155507 0.285497 0.424314 0.227621 0.101210 0.246855 Consensus sequence: VYWVVHCRCCACMCACGAHSBHH Reverse complement motif 0.246855 0.227621 0.101210 0.424314 0.285497 0.169545 0.155507 0.389451 0.084503 0.448293 0.199982 0.267222 0.071055 0.332817 0.455813 0.140315 0.448801 0.274237 0.096591 0.180371 0.229219 0.184986 0.064607 0.521188 0.145639 0.604926 0.102001 0.147434 0.117819 0.165139 0.608153 0.108889 0.041623 0.066925 0.266070 0.625382 0.121694 0.016177 0.787708 0.074421 0.437421 0.016833 0.533797 0.011948 0.064269 0.066860 0.853604 0.015268 0.059797 0.110180 0.180680 0.649343 0.065110 0.058046 0.845072 0.031772 0.105642 0.027712 0.805846 0.060800 0.023009 0.155427 0.327424 0.494140 0.100827 0.018644 0.656850 0.223679 0.225440 0.175932 0.321741 0.276887 0.156609 0.208591 0.263136 0.371663 0.258773 0.244932 0.332518 0.163778 0.418629 0.180599 0.051416 0.349356 0.486963 0.360882 0.114042 0.038113 0.168550 0.396524 0.345968 0.088958 Consensus sequence: HHBSHTCGTGRGTGGKGDBVWMV Alignment: HHBSHTCGTGRGTGGKGDBVWMV AGTGCTCCACTGTGDTG------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00046 Tcfe2a_primary Reverse Complement Reverse Complement Backward 1 17 0.048891 Species: Mus musculus Original motif 0.306209 0.232705 0.244475 0.216611 0.165668 0.171480 0.222584 0.440269 0.213008 0.429038 0.156385 0.201569 0.283226 0.329518 0.160795 0.226461 0.439156 0.283517 0.251270 0.026056 0.014994 0.980987 0.000714 0.003304 0.975741 0.020182 0.002909 0.001168 0.000926 0.191353 0.801648 0.006073 0.015382 0.090853 0.893043 0.000721 0.001549 0.005912 0.001713 0.990826 0.004000 0.000857 0.989667 0.005475 0.016957 0.663726 0.148127 0.171190 0.299047 0.091156 0.448649 0.161148 0.354701 0.214677 0.236757 0.193865 0.399446 0.174508 0.200036 0.226009 0.303545 0.277435 0.200094 0.218926 0.380242 0.148876 0.163367 0.307514 Consensus sequence: VBHHVCAGGTGCDVDHD Reverse complement motif 0.307514 0.148876 0.163367 0.380242 0.218926 0.277435 0.200094 0.303545 0.226009 0.174508 0.200036 0.399446 0.193865 0.214677 0.236757 0.354701 0.299047 0.448649 0.091156 0.161148 0.016957 0.148127 0.663726 0.171190 0.004000 0.989667 0.000857 0.005475 0.990826 0.005912 0.001713 0.001549 0.015382 0.893043 0.090853 0.000721 0.000926 0.801648 0.191353 0.006073 0.001168 0.020182 0.002909 0.975741 0.014994 0.000714 0.980987 0.003304 0.026056 0.283517 0.251270 0.439156 0.283226 0.160795 0.329518 0.226461 0.213008 0.156385 0.429038 0.201569 0.440269 0.171480 0.222584 0.165668 0.216611 0.232705 0.244475 0.306209 Consensus sequence: DHDBHGCACCTGBDDVB Alignment: DHDBHGCACCTGBDDVB AGTGCTCCACTGTGDTG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v016060_primary Original Motif Reverse Complement Backward 5 17 0.049135 Species: Mus musculus Original motif 0.180868 0.321661 0.134642 0.362829 0.232215 0.134289 0.315356 0.318141 0.065068 0.093681 0.569842 0.271408 0.370822 0.229680 0.154738 0.244759 0.323039 0.182873 0.173588 0.320500 0.175039 0.266898 0.276080 0.281984 0.412669 0.147730 0.146326 0.293275 0.325953 0.028805 0.629596 0.015646 0.003017 0.001766 0.979711 0.015507 0.888973 0.040666 0.069420 0.000941 0.017309 0.979155 0.000899 0.002637 0.001732 0.988816 0.004856 0.004596 0.889763 0.078125 0.010384 0.021729 0.007566 0.987081 0.001421 0.003932 0.027797 0.966593 0.000878 0.004731 0.025816 0.867003 0.065749 0.041433 0.220658 0.075256 0.582904 0.121182 0.088946 0.283695 0.565345 0.062015 0.328012 0.241332 0.305901 0.124755 0.307302 0.137589 0.375928 0.179181 0.298752 0.231470 0.315255 0.154524 0.094565 0.142901 0.705696 0.056838 Consensus sequence: HDGHHBHRGACCACCCGSVDVG Reverse complement motif 0.094565 0.705696 0.142901 0.056838 0.298752 0.315255 0.231470 0.154524 0.307302 0.375928 0.137589 0.179181 0.124755 0.241332 0.305901 0.328012 0.088946 0.565345 0.283695 0.062015 0.220658 0.582904 0.075256 0.121182 0.025816 0.065749 0.867003 0.041433 0.027797 0.000878 0.966593 0.004731 0.007566 0.001421 0.987081 0.003932 0.021729 0.078125 0.010384 0.889763 0.001732 0.004856 0.988816 0.004596 0.017309 0.000899 0.979155 0.002637 0.000941 0.040666 0.069420 0.888973 0.003017 0.979711 0.001766 0.015507 0.325953 0.629596 0.028805 0.015646 0.293275 0.147730 0.146326 0.412669 0.281984 0.266898 0.276080 0.175039 0.320500 0.182873 0.173588 0.323039 0.244759 0.229680 0.154738 0.370822 0.065068 0.569842 0.093681 0.271408 0.318141 0.134289 0.315356 0.232215 0.362829 0.321661 0.134642 0.180868 Consensus sequence: CVHBSCGGGTGGTCMHVHHCDH Alignment: CVHBSCGGGTGGTCMHVHHCDH -CAHCACAGTGGAGCACT---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v015681_secondary Original Motif Original Motif Forward 4 17 0.051502 Species: Mus musculus Original motif 0.214165 0.143436 0.372522 0.269876 0.314445 0.406003 0.160351 0.119201 0.137147 0.092924 0.042921 0.727007 0.044121 0.072843 0.051741 0.831295 0.261292 0.324124 0.298498 0.116086 0.258125 0.323243 0.263362 0.155271 0.204557 0.589399 0.107153 0.098891 0.371021 0.244027 0.291102 0.093849 0.096327 0.572718 0.011797 0.319159 0.027282 0.046183 0.844519 0.082016 0.018921 0.012887 0.915917 0.052275 0.364793 0.166722 0.084229 0.384256 0.028216 0.011233 0.951056 0.009495 0.054974 0.004738 0.890377 0.049911 0.006802 0.312915 0.134247 0.546036 0.241289 0.628210 0.104788 0.025713 0.237863 0.302807 0.213018 0.246311 0.349399 0.203220 0.086635 0.360746 0.386634 0.144693 0.246895 0.221779 0.425101 0.354676 0.093374 0.126849 0.060272 0.391320 0.104905 0.443503 0.162090 0.190233 0.227433 0.420244 Consensus sequence: DVTTVVCVYGGHGGYCHHDMYB Reverse complement motif 0.420244 0.190233 0.227433 0.162090 0.443503 0.391320 0.104905 0.060272 0.126849 0.354676 0.093374 0.425101 0.221779 0.144693 0.246895 0.386634 0.360746 0.203220 0.086635 0.349399 0.237863 0.213018 0.302807 0.246311 0.241289 0.104788 0.628210 0.025713 0.546036 0.312915 0.134247 0.006802 0.054974 0.890377 0.004738 0.049911 0.028216 0.951056 0.011233 0.009495 0.384256 0.166722 0.084229 0.364793 0.018921 0.915917 0.012887 0.052275 0.027282 0.844519 0.046183 0.082016 0.096327 0.011797 0.572718 0.319159 0.093849 0.244027 0.291102 0.371021 0.204557 0.107153 0.589399 0.098891 0.258125 0.263362 0.323243 0.155271 0.261292 0.298498 0.324124 0.116086 0.831295 0.072843 0.051741 0.044121 0.727007 0.092924 0.042921 0.137147 0.314445 0.160351 0.406003 0.119201 0.214165 0.372522 0.143436 0.269876 Consensus sequence: VMYDHDGMCCHCCKBGVVAAVH Alignment: DVTTVVCVYGGHGGYCHHDMYB ---CAHCACAGTGGAGCACT-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 4 Motif ID: 77 Motif name: AgTGCTCCACTGTGgTGTCACAgT Original motif 0.690141 0.126761 0.042254 0.140845 0.169014 0.098592 0.676056 0.056338 0.042254 0.028169 0.028169 0.901408 0.056338 0.000000 0.774648 0.169014 0.042254 0.887324 0.042254 0.028169 0.000000 0.014085 0.000000 0.985915 0.056338 0.830986 0.042254 0.070423 0.028169 0.957746 0.014085 0.000000 0.957746 0.000000 0.014085 0.028169 0.084507 0.845070 0.014085 0.056338 0.028169 0.014085 0.000000 0.957746 0.140845 0.028169 0.802817 0.028169 0.014085 0.014085 0.014085 0.957746 0.014085 0.000000 0.929577 0.056338 0.056338 0.154930 0.619718 0.169014 0.014085 0.028169 0.000000 0.957746 0.056338 0.014085 0.873239 0.056338 0.014085 0.000000 0.000000 0.985915 0.042254 0.929577 0.000000 0.028169 0.957746 0.028169 0.000000 0.014085 0.028169 0.845070 0.028169 0.098592 0.873239 0.014085 0.042254 0.070423 0.098592 0.154930 0.563380 0.183099 0.070423 0.014085 0.112676 0.802817 Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reserve complement motif 0.802817 0.014085 0.112676 0.070423 0.098592 0.563380 0.154930 0.183099 0.070423 0.014085 0.042254 0.873239 0.028169 0.028169 0.845070 0.098592 0.014085 0.028169 0.000000 0.957746 0.042254 0.000000 0.929577 0.028169 0.985915 0.000000 0.000000 0.014085 0.056338 0.873239 0.014085 0.056338 0.957746 0.028169 0.000000 0.014085 0.056338 0.619718 0.154930 0.169014 0.014085 0.929577 0.000000 0.056338 0.957746 0.014085 0.014085 0.014085 0.140845 0.802817 0.028169 0.028169 0.957746 0.014085 0.000000 0.028169 0.084507 0.014085 0.845070 0.056338 0.028169 0.000000 0.014085 0.957746 0.028169 0.014085 0.957746 0.000000 0.056338 0.042254 0.830986 0.070423 0.985915 0.014085 0.000000 0.000000 0.042254 0.042254 0.887324 0.028169 0.056338 0.774648 0.000000 0.169014 0.901408 0.028169 0.028169 0.042254 0.169014 0.676056 0.098592 0.056338 0.140845 0.126761 0.042254 0.690141 Consensus sequence: ACTGTGACACCACAGTGGAGCACT ************************************************************************ Best Matches for Motif ID 77 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v015681_primary Reverse Complement Original Motif Forward 1 23 0.050973 Species: Mus musculus Original motif 0.183797 0.268049 0.330111 0.218043 0.127599 0.330310 0.243614 0.298477 0.143199 0.188046 0.268593 0.400162 0.214690 0.205230 0.247090 0.332990 0.294688 0.299104 0.327152 0.079056 0.221909 0.193223 0.480155 0.104712 0.444072 0.068239 0.481838 0.005852 0.006182 0.015429 0.901278 0.077111 0.766535 0.111138 0.121632 0.000696 0.014848 0.973961 0.000298 0.010893 0.001807 0.992200 0.002669 0.003324 0.795344 0.140510 0.018576 0.045571 0.006990 0.988200 0.002510 0.002299 0.154898 0.842296 0.000998 0.001808 0.029577 0.919262 0.006935 0.044226 0.677987 0.032075 0.185065 0.104874 0.195132 0.364580 0.319321 0.120967 0.225412 0.115034 0.612849 0.046705 0.548628 0.058900 0.162857 0.229616 0.112531 0.340331 0.165910 0.381227 0.073029 0.303078 0.363896 0.259997 0.561485 0.260567 0.092979 0.084969 0.132283 0.457691 0.140159 0.269867 Consensus sequence: BBBDVVRGACCACCCAVGABBAB Reverse complement motif 0.132283 0.140159 0.457691 0.269867 0.084969 0.260567 0.092979 0.561485 0.073029 0.363896 0.303078 0.259997 0.381227 0.340331 0.165910 0.112531 0.229616 0.058900 0.162857 0.548628 0.225412 0.612849 0.115034 0.046705 0.195132 0.319321 0.364580 0.120967 0.104874 0.032075 0.185065 0.677987 0.029577 0.006935 0.919262 0.044226 0.154898 0.000998 0.842296 0.001808 0.006990 0.002510 0.988200 0.002299 0.045571 0.140510 0.018576 0.795344 0.001807 0.002669 0.992200 0.003324 0.014848 0.000298 0.973961 0.010893 0.000696 0.111138 0.121632 0.766535 0.006182 0.901278 0.015429 0.077111 0.444072 0.481838 0.068239 0.005852 0.221909 0.480155 0.193223 0.104712 0.294688 0.327152 0.299104 0.079056 0.332990 0.205230 0.247090 0.214690 0.400162 0.188046 0.268593 0.143199 0.127599 0.243614 0.330310 0.298477 0.183797 0.330111 0.268049 0.218043 Consensus sequence: BTBVTCVTGGGTGGTCMVVDVBB Alignment: BTBVTCVTGGGTGGTCMVVDVBB- ACTGTGACACCACAGTGGAGCACT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v016060_primary Original Motif Reverse Complement Backward 3 21 1.048801 Species: Mus musculus Original motif 0.137831 0.118922 0.394177 0.349070 0.190108 0.163633 0.138507 0.507753 0.346002 0.332315 0.228621 0.093063 0.113254 0.287554 0.373285 0.225908 0.272578 0.125402 0.328963 0.273057 0.333973 0.115165 0.194267 0.356595 0.381054 0.086215 0.501679 0.031052 0.002232 0.007405 0.966087 0.024276 0.834741 0.112115 0.052053 0.001091 0.009034 0.983239 0.000766 0.006960 0.002054 0.988103 0.003138 0.006705 0.805772 0.171299 0.008415 0.014515 0.020076 0.976846 0.000894 0.002183 0.079914 0.917273 0.001179 0.001634 0.013983 0.950545 0.004205 0.031267 0.789407 0.039441 0.108645 0.062507 0.055453 0.161271 0.595249 0.188028 0.333424 0.128169 0.373270 0.165136 0.536103 0.109520 0.062980 0.291397 0.346477 0.090909 0.279533 0.283081 0.045892 0.190183 0.584314 0.179611 0.088294 0.406148 0.251647 0.253912 0.202467 0.447159 0.162802 0.187571 Consensus sequence: DTVBDDRGACCACCCAGDWDGBH Reverse complement motif 0.202467 0.162802 0.447159 0.187571 0.088294 0.251647 0.406148 0.253912 0.045892 0.584314 0.190183 0.179611 0.283081 0.090909 0.279533 0.346477 0.291397 0.109520 0.062980 0.536103 0.333424 0.373270 0.128169 0.165136 0.055453 0.595249 0.161271 0.188028 0.062507 0.039441 0.108645 0.789407 0.013983 0.004205 0.950545 0.031267 0.079914 0.001179 0.917273 0.001634 0.020076 0.000894 0.976846 0.002183 0.014515 0.171299 0.008415 0.805772 0.002054 0.003138 0.988103 0.006705 0.009034 0.000766 0.983239 0.006960 0.001091 0.112115 0.052053 0.834741 0.002232 0.966087 0.007405 0.024276 0.381054 0.501679 0.086215 0.031052 0.356595 0.115165 0.194267 0.333973 0.272578 0.328963 0.125402 0.273057 0.113254 0.373285 0.287554 0.225908 0.093063 0.332315 0.228621 0.346002 0.507753 0.163633 0.138507 0.190108 0.137831 0.394177 0.118922 0.349070 Consensus sequence: DBCDWHCTGGGTGGTCMDHBBAH Alignment: ---DBCDWHCTGGGTGGTCMDHBBAH AGTGCTCCACTGTGGTGTCACAGT-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v016060_primary Reverse Complement Reverse Complement Backward 4 21 1.050875 Species: Mus musculus Original motif 0.204923 0.208846 0.365383 0.220848 0.294304 0.300143 0.167287 0.238266 0.109711 0.619514 0.117379 0.153396 0.178979 0.378580 0.230177 0.212264 0.159594 0.542602 0.118178 0.179627 0.125206 0.430074 0.151826 0.292894 0.097692 0.709845 0.116956 0.075506 0.148292 0.565912 0.037632 0.248164 0.077951 0.034190 0.855503 0.032356 0.001657 0.001061 0.971877 0.025405 0.001926 0.001084 0.991712 0.005278 0.033031 0.012001 0.057796 0.897171 0.002723 0.002647 0.993348 0.001281 0.003261 0.000963 0.987199 0.008577 0.000611 0.090925 0.074857 0.833608 0.015299 0.978878 0.004949 0.000874 0.013368 0.600902 0.033485 0.352245 0.231949 0.149575 0.118804 0.499672 0.267580 0.186002 0.371242 0.175176 0.264884 0.223483 0.110082 0.401551 0.221365 0.170121 0.179559 0.428955 0.112997 0.692930 0.139981 0.054092 0.460305 0.207883 0.155111 0.176702 Consensus sequence: BHCBCBCCGGGTGGTCYHVHDCH Reverse complement motif 0.176702 0.207883 0.155111 0.460305 0.112997 0.139981 0.692930 0.054092 0.428955 0.170121 0.179559 0.221365 0.401551 0.223483 0.110082 0.264884 0.267580 0.371242 0.186002 0.175176 0.499672 0.149575 0.118804 0.231949 0.013368 0.033485 0.600902 0.352245 0.015299 0.004949 0.978878 0.000874 0.833608 0.090925 0.074857 0.000611 0.003261 0.987199 0.000963 0.008577 0.002723 0.993348 0.002647 0.001281 0.897171 0.012001 0.057796 0.033031 0.001926 0.991712 0.001084 0.005278 0.001657 0.971877 0.001061 0.025405 0.077951 0.855503 0.034190 0.032356 0.148292 0.037632 0.565912 0.248164 0.097692 0.116956 0.709845 0.075506 0.125206 0.151826 0.430074 0.292894 0.159594 0.118178 0.542602 0.179627 0.178979 0.230177 0.378580 0.212264 0.109711 0.117379 0.619514 0.153396 0.294304 0.167287 0.300143 0.238266 0.204923 0.365383 0.208846 0.220848 Consensus sequence: HGDHVHKGACCACCCGGBGBGDB Alignment: ---HGDHVHKGACCACCCGGBGBGDB ACTGTGACACCACAGTGGAGCACT--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v015681_primary Reverse Complement Reverse Complement Forward 7 18 2.547481 Species: Mus musculus Original motif 0.472795 0.179227 0.091251 0.256726 0.036521 0.159743 0.204840 0.598896 0.164582 0.312805 0.221324 0.301289 0.237069 0.249050 0.293048 0.220833 0.401949 0.225181 0.229401 0.143469 0.161422 0.494334 0.252207 0.092036 0.252940 0.177721 0.369400 0.199939 0.119630 0.024651 0.849920 0.005798 0.000962 0.002398 0.990616 0.006023 0.937852 0.027016 0.034535 0.000597 0.008963 0.987756 0.000629 0.002652 0.001584 0.992898 0.002349 0.003169 0.956822 0.027342 0.002484 0.013352 0.009873 0.987759 0.000988 0.001381 0.016397 0.980856 0.000369 0.002378 0.081761 0.758555 0.038572 0.121112 0.371713 0.091838 0.448027 0.088423 0.111617 0.121913 0.683885 0.082585 0.334562 0.102916 0.436488 0.126034 0.210362 0.101261 0.238339 0.450037 0.169041 0.271583 0.320799 0.238576 0.140316 0.049885 0.735236 0.074563 Consensus sequence: HTBVVVDGGACCACCCRGRDBG Reverse complement motif 0.140316 0.735236 0.049885 0.074563 0.169041 0.320799 0.271583 0.238576 0.450037 0.101261 0.238339 0.210362 0.334562 0.436488 0.102916 0.126034 0.111617 0.683885 0.121913 0.082585 0.371713 0.448027 0.091838 0.088423 0.081761 0.038572 0.758555 0.121112 0.016397 0.000369 0.980856 0.002378 0.009873 0.000988 0.987759 0.001381 0.013352 0.027342 0.002484 0.956822 0.001584 0.002349 0.992898 0.003169 0.008963 0.000629 0.987756 0.002652 0.000597 0.027016 0.034535 0.937852 0.000962 0.990616 0.002398 0.006023 0.119630 0.849920 0.024651 0.005798 0.252940 0.369400 0.177721 0.199939 0.161422 0.252207 0.494334 0.092036 0.143469 0.225181 0.229401 0.401949 0.237069 0.293048 0.249050 0.220833 0.164582 0.221324 0.312805 0.301289 0.598896 0.159743 0.204840 0.036521 0.256726 0.179227 0.091251 0.472795 Consensus sequence: CBDMCMGGGTGGTCCHVBVBAH Alignment: CBDMCMGGGTGGTCCHVBVBAH------ ------ACTGTGACACCACAGTGGAGCACT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00045 Mafb_primary Original Motif Original Motif Backward 1 17 3.036695 Species: Mus musculus Original motif 0.420301 0.182299 0.161481 0.235919 0.593201 0.055751 0.202477 0.148571 0.653364 0.017008 0.054630 0.274998 0.339176 0.102943 0.050258 0.507622 0.171557 0.078698 0.267471 0.482273 0.044703 0.033212 0.003920 0.918165 0.010333 0.004451 0.972441 0.012775 0.034026 0.949298 0.004788 0.011889 0.016078 0.008878 0.004007 0.971037 0.020331 0.004077 0.929676 0.045916 0.975739 0.007450 0.005991 0.010819 0.012733 0.887375 0.018700 0.081192 0.259981 0.111885 0.243051 0.385083 0.327677 0.149969 0.094895 0.427459 0.541721 0.105923 0.242224 0.110132 0.258689 0.068305 0.493226 0.179779 0.306041 0.306854 0.168308 0.218798 Consensus sequence: HAAWDTGCTGACDWARH Reverse complement motif 0.306041 0.168308 0.306854 0.218798 0.258689 0.493226 0.068305 0.179779 0.110132 0.105923 0.242224 0.541721 0.427459 0.149969 0.094895 0.327677 0.385083 0.111885 0.243051 0.259981 0.012733 0.018700 0.887375 0.081192 0.010819 0.007450 0.005991 0.975739 0.020331 0.929676 0.004077 0.045916 0.971037 0.008878 0.004007 0.016078 0.034026 0.004788 0.949298 0.011889 0.010333 0.972441 0.004451 0.012775 0.918165 0.033212 0.003920 0.044703 0.482273 0.078698 0.267471 0.171557 0.507622 0.102943 0.050258 0.339176 0.274998 0.017008 0.054630 0.653364 0.148571 0.055751 0.202477 0.593201 0.235919 0.182299 0.161481 0.420301 Consensus sequence: DMTWDGTCAGCADWTTH Alignment: -------HAAWDTGCTGACDWARH AGTGCTCCACTGTGGTGTCACAGT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00055 Hbp1_secondary Original Motif Original Motif Backward 7 17 3.040280 Species: Mus musculus Original motif 0.313621 0.149049 0.200899 0.336432 0.262644 0.147616 0.334882 0.254859 0.175848 0.137857 0.292272 0.394023 0.045910 0.364107 0.180535 0.409448 0.093235 0.718630 0.093516 0.094619 0.095552 0.724866 0.044589 0.134993 0.058227 0.785149 0.029814 0.126810 0.897368 0.023735 0.019064 0.059832 0.043826 0.041750 0.020731 0.893692 0.044268 0.013557 0.014689 0.927487 0.102208 0.026005 0.709573 0.162214 0.058404 0.046118 0.135257 0.760221 0.303689 0.280676 0.320259 0.095375 0.258633 0.262177 0.197029 0.282161 0.564761 0.122466 0.194691 0.118082 0.104738 0.358061 0.310533 0.226668 0.267450 0.230099 0.197859 0.304593 Consensus sequence: DDDYCCCATTGTVHABH Reverse complement motif 0.304593 0.230099 0.197859 0.267450 0.104738 0.310533 0.358061 0.226668 0.118082 0.122466 0.194691 0.564761 0.282161 0.262177 0.197029 0.258633 0.303689 0.320259 0.280676 0.095375 0.760221 0.046118 0.135257 0.058404 0.102208 0.709573 0.026005 0.162214 0.927487 0.013557 0.014689 0.044268 0.893692 0.041750 0.020731 0.043826 0.059832 0.023735 0.019064 0.897368 0.058227 0.029814 0.785149 0.126810 0.095552 0.044589 0.724866 0.134993 0.093235 0.093516 0.718630 0.094619 0.409448 0.364107 0.180535 0.045910 0.394023 0.137857 0.292272 0.175848 0.262644 0.334882 0.147616 0.254859 0.336432 0.149049 0.200899 0.313621 Consensus sequence: HBTHVACAATGGGMDHD Alignment: -------DDDYCCCATTGTVHABH AGTGCTCCACTGTGGTGTCACAGT------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00031 Zbtb3_primary Original Motif Reverse Complement Forward 1 17 3.043475 Species: Mus musculus Original motif 0.401190 0.144405 0.268531 0.185874 0.430224 0.168519 0.221247 0.180011 0.172575 0.268499 0.274136 0.284789 0.150971 0.297110 0.290868 0.261051 0.133421 0.282842 0.434718 0.149019 0.042798 0.941105 0.001785 0.014312 0.890788 0.002551 0.103316 0.003345 0.001887 0.951368 0.043722 0.003023 0.011633 0.002218 0.002269 0.983880 0.003597 0.003728 0.984819 0.007856 0.002946 0.903520 0.072457 0.021077 0.908487 0.057072 0.018256 0.016185 0.076237 0.329864 0.228896 0.365003 0.144926 0.162981 0.177370 0.514722 0.124970 0.327876 0.295814 0.251341 0.144592 0.313887 0.301912 0.239609 0.108463 0.241747 0.350296 0.299494 Consensus sequence: DDBBBCACTGCABTBBB Reverse complement motif 0.108463 0.350296 0.241747 0.299494 0.144592 0.301912 0.313887 0.239609 0.124970 0.295814 0.327876 0.251341 0.514722 0.162981 0.177370 0.144926 0.365003 0.329864 0.228896 0.076237 0.016185 0.057072 0.018256 0.908487 0.002946 0.072457 0.903520 0.021077 0.003597 0.984819 0.003728 0.007856 0.983880 0.002218 0.002269 0.011633 0.001887 0.043722 0.951368 0.003023 0.003345 0.002551 0.103316 0.890788 0.042798 0.001785 0.941105 0.014312 0.133421 0.434718 0.282842 0.149019 0.150971 0.290868 0.297110 0.261051 0.284789 0.268499 0.274136 0.172575 0.180011 0.168519 0.221247 0.430224 0.185874 0.144405 0.268531 0.401190 Consensus sequence: BBBAVTGCAGTGBBVDD Alignment: BBBAVTGCAGTGBBVDD------- AGTGCTCCACTGTGGTGTCACAGT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00067 Lef1_primary Reverse Complement Reverse Complement Forward 4 17 3.046621 Species: Mus musculus Original motif 0.281920 0.214207 0.278077 0.225796 0.325566 0.151435 0.298797 0.224202 0.290253 0.145824 0.243443 0.320480 0.069286 0.404645 0.141614 0.384454 0.070044 0.621448 0.142647 0.165862 0.007295 0.907657 0.038110 0.046938 0.015587 0.018273 0.000658 0.965482 0.005527 0.005886 0.001905 0.986682 0.024512 0.001189 0.001344 0.972955 0.007384 0.025221 0.952270 0.015125 0.966438 0.000630 0.002693 0.030239 0.082252 0.001173 0.001495 0.915080 0.030255 0.677155 0.275323 0.017267 0.199467 0.118815 0.056814 0.624905 0.345445 0.169597 0.216831 0.268127 0.278106 0.150864 0.173693 0.397336 0.251834 0.339733 0.219703 0.188730 Consensus sequence: DDDYCCTTTGATCTDDV Reverse complement motif 0.251834 0.219703 0.339733 0.188730 0.397336 0.150864 0.173693 0.278106 0.268127 0.169597 0.216831 0.345445 0.624905 0.118815 0.056814 0.199467 0.030255 0.275323 0.677155 0.017267 0.915080 0.001173 0.001495 0.082252 0.030239 0.000630 0.002693 0.966438 0.007384 0.952270 0.025221 0.015125 0.972955 0.001189 0.001344 0.024512 0.986682 0.005886 0.001905 0.005527 0.965482 0.018273 0.000658 0.015587 0.007295 0.038110 0.907657 0.046938 0.070044 0.142647 0.621448 0.165862 0.069286 0.141614 0.404645 0.384454 0.320480 0.145824 0.243443 0.290253 0.224202 0.151435 0.298797 0.325566 0.225796 0.214207 0.278077 0.281920 Consensus sequence: VDDAGATCAAAGGKDDD Alignment: VDDAGATCAAAGGKDDD------- ---ACTGTGACACCACAGTGGAGCACT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00070 Gcm1_secondary Original Motif Reverse Complement Backward 7 17 3.046628 Species: Mus musculus Original motif 0.298360 0.124865 0.240783 0.335992 0.184300 0.174617 0.373392 0.267691 0.150632 0.435099 0.254062 0.160207 0.212569 0.220347 0.370971 0.196113 0.258171 0.316689 0.186896 0.238243 0.872371 0.051703 0.070791 0.005135 0.011560 0.017672 0.009746 0.961022 0.888546 0.042964 0.061758 0.006732 0.071365 0.009982 0.801505 0.117148 0.010657 0.014961 0.949286 0.025096 0.004496 0.009941 0.978381 0.007182 0.005645 0.010294 0.972682 0.011378 0.499895 0.152322 0.335875 0.011908 0.109410 0.346384 0.380529 0.163677 0.371764 0.096182 0.457999 0.074056 0.450207 0.392208 0.065686 0.091898 0.104224 0.228467 0.391473 0.275836 Consensus sequence: DDBVHATAGGGGRBRMB Reverse complement motif 0.104224 0.391473 0.228467 0.275836 0.091898 0.392208 0.065686 0.450207 0.371764 0.457999 0.096182 0.074056 0.109410 0.380529 0.346384 0.163677 0.011908 0.152322 0.335875 0.499895 0.005645 0.972682 0.010294 0.011378 0.004496 0.978381 0.009941 0.007182 0.010657 0.949286 0.014961 0.025096 0.071365 0.801505 0.009982 0.117148 0.006732 0.042964 0.061758 0.888546 0.961022 0.017672 0.009746 0.011560 0.005135 0.051703 0.070791 0.872371 0.258171 0.186896 0.316689 0.238243 0.212569 0.370971 0.220347 0.196113 0.150632 0.254062 0.435099 0.160207 0.184300 0.373392 0.174617 0.267691 0.335992 0.124865 0.240783 0.298360 Consensus sequence: BYMBKCCCCTATDVBHD Alignment: -------DDBVHATAGGGGRBRMB AGTGCTCCACTGTGGTGTCACAGT------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00148 Hdx Reverse Complement Original Motif Forward 1 17 3.049068 Species: Mus musculus Original motif 0.311640 0.203273 0.213311 0.271776 0.341055 0.177799 0.257310 0.223836 0.047573 0.089551 0.516163 0.346713 0.195776 0.119326 0.352322 0.332576 0.295379 0.306027 0.157574 0.241020 0.213770 0.018770 0.724927 0.042533 0.702123 0.228608 0.050137 0.019133 0.826735 0.011735 0.061646 0.099884 0.920071 0.005458 0.026253 0.048218 0.018655 0.024240 0.028915 0.928190 0.029929 0.896758 0.043300 0.030013 0.864548 0.044943 0.013744 0.076766 0.177175 0.216931 0.155519 0.450375 0.228403 0.325164 0.203649 0.242785 0.140135 0.298665 0.306153 0.255047 0.338324 0.345500 0.057864 0.258313 0.402538 0.228867 0.191777 0.176818 Consensus sequence: DDKDHGAAATCAHHBHV Reverse complement motif 0.176818 0.228867 0.191777 0.402538 0.338324 0.057864 0.345500 0.258313 0.140135 0.306153 0.298665 0.255047 0.228403 0.203649 0.325164 0.242785 0.450375 0.216931 0.155519 0.177175 0.076766 0.044943 0.013744 0.864548 0.029929 0.043300 0.896758 0.030013 0.928190 0.024240 0.028915 0.018655 0.048218 0.005458 0.026253 0.920071 0.099884 0.011735 0.061646 0.826735 0.019133 0.228608 0.050137 0.702123 0.213770 0.724927 0.018770 0.042533 0.295379 0.157574 0.306027 0.241020 0.195776 0.352322 0.119326 0.332576 0.047573 0.516163 0.089551 0.346713 0.223836 0.177799 0.257310 0.341055 0.271776 0.203273 0.213311 0.311640 Consensus sequence: BDBDHTGATTTCDHYDD Alignment: DDKDHGAAATCAHHBHV------- ACTGTGACACCACAGTGGAGCACT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 4 Motif ID: 78 Motif name: ssGCkTGCssk Original motif 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 0.500000 0.500000 Consensus sequence: SSGCKTGCSSK Reserve complement motif 0.000000 0.500000 0.000000 0.500000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.000000 0.500000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 Consensus sequence: YSSGCAYGCSS ************************************************************************ Best Matches for Motif ID 78 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00003 E2F3_primary Original Motif Original Motif Forward 5 11 0.004633 Species: Mus musculus Original motif 0.358868 0.212371 0.263565 0.165196 0.303014 0.253580 0.111217 0.332189 0.420933 0.110957 0.210958 0.257152 0.769724 0.062662 0.032155 0.135459 0.311973 0.051319 0.408669 0.228039 0.097916 0.141153 0.719697 0.041234 0.009980 0.014044 0.971955 0.004021 0.014425 0.974798 0.008373 0.002404 0.000891 0.013228 0.983966 0.001915 0.000827 0.938560 0.059548 0.001065 0.007071 0.102005 0.872378 0.018546 0.020099 0.897653 0.014151 0.068097 0.114080 0.346724 0.409037 0.130159 0.331439 0.279041 0.085030 0.304491 0.319846 0.136792 0.043641 0.499722 Consensus sequence: VHDADGGCGCGCSHW Reverse complement motif 0.499722 0.136792 0.043641 0.319846 0.304491 0.279041 0.085030 0.331439 0.114080 0.409037 0.346724 0.130159 0.020099 0.014151 0.897653 0.068097 0.007071 0.872378 0.102005 0.018546 0.000827 0.059548 0.938560 0.001065 0.000891 0.983966 0.013228 0.001915 0.014425 0.008373 0.974798 0.002404 0.009980 0.971955 0.014044 0.004021 0.097916 0.719697 0.141153 0.041234 0.311973 0.408669 0.051319 0.228039 0.135459 0.062662 0.032155 0.769724 0.257152 0.110957 0.210958 0.420933 0.332189 0.253580 0.111217 0.303014 0.165196 0.212371 0.263565 0.358868 Consensus sequence: WHSGCGCGCCHTDHB Alignment: VHDADGGCGCGCSHW ----SSGCKTGCSSK ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00094 Zfp128_primary Original Motif Original Motif Backward 3 11 0.004821 Species: Mus musculus Original motif 0.194238 0.221898 0.264007 0.319857 0.288200 0.308426 0.101010 0.302365 0.285270 0.161574 0.132609 0.420548 0.252760 0.126943 0.276148 0.344149 0.220972 0.026248 0.366825 0.385955 0.016419 0.006845 0.879910 0.096825 0.185479 0.004691 0.730552 0.079278 0.003651 0.988022 0.001666 0.006661 0.067428 0.001276 0.928472 0.002824 0.004284 0.002407 0.001922 0.991387 0.990094 0.001414 0.004941 0.003550 0.005452 0.989161 0.001844 0.003543 0.149564 0.620887 0.192873 0.036677 0.100768 0.559974 0.113427 0.225831 0.177258 0.260019 0.181462 0.381261 0.425243 0.223937 0.143942 0.206878 0.451743 0.122626 0.218322 0.207309 Consensus sequence: BHHDKGGCGTACCCBHD Reverse complement motif 0.207309 0.122626 0.218322 0.451743 0.206878 0.223937 0.143942 0.425243 0.381261 0.260019 0.181462 0.177258 0.100768 0.113427 0.559974 0.225831 0.149564 0.192873 0.620887 0.036677 0.005452 0.001844 0.989161 0.003543 0.003550 0.001414 0.004941 0.990094 0.991387 0.002407 0.001922 0.004284 0.067428 0.928472 0.001276 0.002824 0.003651 0.001666 0.988022 0.006661 0.185479 0.730552 0.004691 0.079278 0.016419 0.879910 0.006845 0.096825 0.385955 0.026248 0.366825 0.220972 0.344149 0.126943 0.276148 0.252760 0.420548 0.161574 0.132609 0.285270 0.288200 0.101010 0.308426 0.302365 0.319857 0.221898 0.264007 0.194238 Consensus sequence: DHVGGGTACGCCRDHDV Alignment: BHHDKGGCGTACCCBHD ----SSGCKTGCSSK-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00035 Hic1_secondary Reverse Complement Reverse Complement Forward 6 11 0.005628 Species: Mus musculus Original motif 0.204898 0.149951 0.363373 0.281778 0.112946 0.243700 0.437938 0.205417 0.205232 0.182319 0.383143 0.229305 0.242063 0.152491 0.296426 0.309020 0.312922 0.028523 0.585026 0.073529 0.006754 0.011178 0.005346 0.976723 0.127589 0.005562 0.859436 0.007414 0.010046 0.974694 0.007001 0.008259 0.010262 0.974769 0.006069 0.008899 0.015122 0.966101 0.007970 0.010807 0.556511 0.167389 0.114635 0.161465 0.586459 0.044786 0.073450 0.295305 0.297710 0.194666 0.223655 0.283969 0.303202 0.250809 0.206475 0.239514 0.279338 0.160655 0.314457 0.245550 0.266477 0.266890 0.299970 0.166662 Consensus sequence: DBDDRTGCCCAWDHDV Reverse complement motif 0.266477 0.299970 0.266890 0.166662 0.279338 0.314457 0.160655 0.245550 0.239514 0.250809 0.206475 0.303202 0.283969 0.194666 0.223655 0.297710 0.295305 0.044786 0.073450 0.586459 0.161465 0.167389 0.114635 0.556511 0.015122 0.007970 0.966101 0.010807 0.010262 0.006069 0.974769 0.008899 0.010046 0.007001 0.974694 0.008259 0.127589 0.859436 0.005562 0.007414 0.976723 0.011178 0.005346 0.006754 0.312922 0.585026 0.028523 0.073529 0.309020 0.152491 0.296426 0.242063 0.205232 0.383143 0.182319 0.229305 0.112946 0.437938 0.243700 0.205417 0.204898 0.363373 0.149951 0.281778 Consensus sequence: VHHDWTGGGCAMDHBH Alignment: VHHDWTGGGCAMDHBH -----YSSGCAYGCSS ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00065 Zfp161_primary Original Motif Original Motif Forward 3 11 0.005960 Species: Mus musculus Original motif 0.142624 0.111294 0.283688 0.462394 0.221170 0.081404 0.499138 0.198288 0.290070 0.042114 0.604904 0.062912 0.109755 0.559510 0.215454 0.115281 0.111745 0.022727 0.850580 0.014948 0.015907 0.942291 0.005561 0.036241 0.088509 0.003729 0.902805 0.004957 0.004957 0.902805 0.003729 0.088509 0.036241 0.005561 0.942291 0.015907 0.014948 0.850580 0.022727 0.111745 0.325358 0.049424 0.519652 0.105566 0.062912 0.604904 0.042114 0.290070 0.214335 0.388248 0.125912 0.271505 0.128984 0.372787 0.092390 0.405839 0.269058 0.098422 0.484016 0.148504 0.362176 0.156050 0.188642 0.293132 Consensus sequence: DDGCGCGCGCRCHYRD Reverse complement motif 0.293132 0.156050 0.188642 0.362176 0.269058 0.484016 0.098422 0.148504 0.405839 0.372787 0.092390 0.128984 0.214335 0.125912 0.388248 0.271505 0.062912 0.042114 0.604904 0.290070 0.325358 0.519652 0.049424 0.105566 0.014948 0.022727 0.850580 0.111745 0.036241 0.942291 0.005561 0.015907 0.004957 0.003729 0.902805 0.088509 0.088509 0.902805 0.003729 0.004957 0.015907 0.005561 0.942291 0.036241 0.111745 0.850580 0.022727 0.014948 0.109755 0.215454 0.559510 0.115281 0.290070 0.604904 0.042114 0.062912 0.221170 0.499138 0.081404 0.198288 0.462394 0.111294 0.283688 0.142624 Consensus sequence: DMMDGMGCGCGCGCHD Alignment: DDGCGCGCGCRCHYRD --SSGCKTGCSSK--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00001 E2F2_primary Original Motif Reverse Complement Forward 2 11 0.008217 Species: Mus musculus Original motif 0.305970 0.214348 0.269312 0.210370 0.279551 0.218276 0.140576 0.361597 0.391304 0.162239 0.193916 0.252541 0.701667 0.102206 0.041580 0.154547 0.427655 0.068368 0.324706 0.179271 0.144368 0.191048 0.609772 0.054812 0.014295 0.020613 0.958397 0.006695 0.019783 0.962982 0.013403 0.003831 0.001189 0.023882 0.973231 0.001697 0.001343 0.919840 0.077728 0.001089 0.011293 0.097945 0.865194 0.025568 0.039106 0.864604 0.025189 0.071100 0.147663 0.328105 0.407118 0.117115 0.462769 0.203531 0.107986 0.225714 0.293396 0.229650 0.082819 0.394135 Consensus sequence: VHDARGGCGCGCVHH Reverse complement motif 0.394135 0.229650 0.082819 0.293396 0.225714 0.203531 0.107986 0.462769 0.147663 0.407118 0.328105 0.117115 0.039106 0.025189 0.864604 0.071100 0.011293 0.865194 0.097945 0.025568 0.001343 0.077728 0.919840 0.001089 0.001189 0.973231 0.023882 0.001697 0.019783 0.013403 0.962982 0.003831 0.014295 0.958397 0.020613 0.006695 0.144368 0.609772 0.191048 0.054812 0.179271 0.068368 0.324706 0.427655 0.154547 0.102206 0.041580 0.701667 0.252541 0.162239 0.193916 0.391304 0.361597 0.218276 0.140576 0.279551 0.210370 0.214348 0.269312 0.305970 Consensus sequence: HHVGCGCGCCKTDHB Alignment: HHVGCGCGCCKTDHB -SSGCKTGCSSK--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00060 Max_secondary Original Motif Reverse Complement Backward 1 11 0.010926 Species: Mus musculus Original motif 0.127991 0.202889 0.399822 0.269298 0.156940 0.244015 0.182364 0.416681 0.046494 0.050598 0.744311 0.158596 0.196142 0.365183 0.183389 0.255286 0.019306 0.946805 0.015210 0.018680 0.924839 0.022113 0.027620 0.025428 0.007478 0.672138 0.027789 0.292595 0.046702 0.026044 0.906146 0.021107 0.117335 0.610863 0.025132 0.246670 0.044431 0.053581 0.722748 0.179240 0.543713 0.149809 0.190030 0.116447 0.241148 0.722386 0.022547 0.013919 0.265412 0.113032 0.270602 0.350954 0.226186 0.143504 0.332746 0.297564 Consensus sequence: BBGHCACGCGACDD Reverse complement motif 0.226186 0.332746 0.143504 0.297564 0.350954 0.113032 0.270602 0.265412 0.241148 0.022547 0.722386 0.013919 0.116447 0.149809 0.190030 0.543713 0.044431 0.722748 0.053581 0.179240 0.117335 0.025132 0.610863 0.246670 0.046702 0.906146 0.026044 0.021107 0.007478 0.027789 0.672138 0.292595 0.025428 0.022113 0.027620 0.924839 0.019306 0.015210 0.946805 0.018680 0.196142 0.183389 0.365183 0.255286 0.046494 0.744311 0.050598 0.158596 0.416681 0.244015 0.182364 0.156940 0.127991 0.399822 0.202889 0.269298 Consensus sequence: HDGTCGCGTGDCVB Alignment: BBGHCACGCGACDD ---SSGCKTGCSSK ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00527 Foxn4_secondary Original Motif Reverse Complement Forward 9 11 0.015020 Species: Mus musculus Original motif 0.298336 0.418632 0.208054 0.074978 0.289907 0.015608 0.457100 0.237385 0.273583 0.077889 0.107860 0.540668 0.184954 0.161611 0.384390 0.269045 0.521826 0.156340 0.089019 0.232815 0.356716 0.131104 0.394857 0.117323 0.266669 0.108765 0.505273 0.119293 0.020778 0.047199 0.919524 0.012500 0.948536 0.018775 0.008113 0.024576 0.010822 0.964042 0.014701 0.010434 0.007428 0.019505 0.966351 0.006717 0.010025 0.975678 0.008648 0.005649 0.043796 0.120935 0.742979 0.092289 0.008252 0.250704 0.541132 0.199913 0.474428 0.044681 0.134430 0.346461 0.146597 0.421317 0.143166 0.288920 0.020540 0.181479 0.553811 0.244170 0.129612 0.173360 0.535219 0.161808 0.506084 0.158156 0.130983 0.204776 0.054872 0.103043 0.545792 0.296293 0.389882 0.171037 0.164162 0.274918 0.225861 0.314031 0.288872 0.171237 Consensus sequence: VDWDARRGACGCGGWHGGAKHV Reverse complement motif 0.225861 0.288872 0.314031 0.171237 0.274918 0.171037 0.164162 0.389882 0.054872 0.545792 0.103043 0.296293 0.204776 0.158156 0.130983 0.506084 0.129612 0.535219 0.173360 0.161808 0.020540 0.553811 0.181479 0.244170 0.146597 0.143166 0.421317 0.288920 0.346461 0.044681 0.134430 0.474428 0.008252 0.541132 0.250704 0.199913 0.043796 0.742979 0.120935 0.092289 0.010025 0.008648 0.975678 0.005649 0.007428 0.966351 0.019505 0.006717 0.010822 0.014701 0.964042 0.010434 0.024576 0.018775 0.008113 0.948536 0.020778 0.919524 0.047199 0.012500 0.266669 0.505273 0.108765 0.119293 0.356716 0.394857 0.131104 0.117323 0.232815 0.156340 0.089019 0.521826 0.184954 0.384390 0.161611 0.269045 0.540668 0.077889 0.107860 0.273583 0.289907 0.457100 0.015608 0.237385 0.298336 0.208054 0.418632 0.074978 Consensus sequence: VHYTCCDWCCGCGTCMMTHWHV Alignment: VHYTCCDWCCGCGTCMMTHWHV --------SSGCKTGCSSK--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00002 Sp4_secondary Reverse Complement Reverse Complement Forward 2 11 0.016078 Species: Mus musculus Original motif 0.146334 0.312326 0.244281 0.297060 0.493155 0.092609 0.162506 0.251729 0.503593 0.059863 0.077561 0.358984 0.763321 0.015264 0.213114 0.008301 0.012415 0.025932 0.945502 0.016151 0.006713 0.015221 0.950098 0.027968 0.062415 0.834303 0.054500 0.048782 0.011010 0.020677 0.928821 0.039493 0.012785 0.024162 0.145822 0.817231 0.133595 0.033962 0.787876 0.044567 0.140697 0.180481 0.428253 0.250570 0.036281 0.806412 0.033510 0.123797 0.157910 0.408607 0.122427 0.311055 0.292185 0.260017 0.197515 0.250283 0.251107 0.124480 0.359447 0.264967 Consensus sequence: BDWAGGCGTGBCHHD Reverse complement motif 0.251107 0.359447 0.124480 0.264967 0.250283 0.260017 0.197515 0.292185 0.157910 0.122427 0.408607 0.311055 0.036281 0.033510 0.806412 0.123797 0.140697 0.428253 0.180481 0.250570 0.133595 0.787876 0.033962 0.044567 0.817231 0.024162 0.145822 0.012785 0.011010 0.928821 0.020677 0.039493 0.062415 0.054500 0.834303 0.048782 0.006713 0.950098 0.015221 0.027968 0.012415 0.945502 0.025932 0.016151 0.008301 0.015264 0.213114 0.763321 0.358984 0.059863 0.077561 0.503593 0.251729 0.092609 0.162506 0.493155 0.146334 0.244281 0.312326 0.297060 Consensus sequence: HHDGBCACGCCTWDB Alignment: HHDGBCACGCCTWDB -YSSGCAYGCSS--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00526 Foxn1_primary Original Motif Reverse Complement Backward 3 11 0.017160 Species: Mus musculus Original motif 0.456612 0.057181 0.078281 0.407926 0.460529 0.185506 0.083106 0.270859 0.445717 0.179510 0.239355 0.135417 0.116339 0.145186 0.275331 0.463144 0.239398 0.142078 0.480004 0.138520 0.355157 0.217877 0.284296 0.142670 0.318602 0.444835 0.153321 0.083243 0.609569 0.055866 0.280349 0.054216 0.062297 0.769824 0.027844 0.140035 0.151868 0.019245 0.803188 0.025699 0.011842 0.952534 0.017959 0.017665 0.017665 0.017959 0.952534 0.011842 0.025699 0.803188 0.019245 0.151868 0.140035 0.027844 0.769824 0.062297 0.054216 0.280349 0.055866 0.609569 0.013084 0.624655 0.177956 0.184305 0.287647 0.183527 0.295753 0.233074 0.042309 0.345931 0.198458 0.413301 0.338138 0.266033 0.045367 0.350462 0.302850 0.155320 0.074662 0.467168 0.240926 0.068901 0.283055 0.407118 0.409954 0.183157 0.154186 0.252704 Consensus sequence: WHVBVVMACGCGCGTCDYHWDH Reverse complement motif 0.252704 0.183157 0.154186 0.409954 0.407118 0.068901 0.283055 0.240926 0.467168 0.155320 0.074662 0.302850 0.350462 0.266033 0.045367 0.338138 0.413301 0.345931 0.198458 0.042309 0.287647 0.295753 0.183527 0.233074 0.013084 0.177956 0.624655 0.184305 0.609569 0.280349 0.055866 0.054216 0.140035 0.769824 0.027844 0.062297 0.025699 0.019245 0.803188 0.151868 0.017665 0.952534 0.017959 0.011842 0.011842 0.017959 0.952534 0.017665 0.151868 0.803188 0.019245 0.025699 0.062297 0.027844 0.769824 0.140035 0.054216 0.055866 0.280349 0.609569 0.318602 0.153321 0.444835 0.083243 0.142670 0.217877 0.284296 0.355157 0.239398 0.480004 0.142078 0.138520 0.463144 0.145186 0.275331 0.116339 0.135417 0.179510 0.239355 0.445717 0.270859 0.185506 0.083106 0.460529 0.407926 0.057181 0.078281 0.456612 Consensus sequence: HDWHMHGACGCGCGTRBVVBHW Alignment: HDWHMHGACGCGCGTRBVVBHW ---------SSGCKTGCSSK-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00528 Foxm1_secondary Reverse Complement Reverse Complement Forward 7 11 0.017271 Species: Mus musculus Original motif 0.399785 0.446658 0.111435 0.042122 0.535175 0.103991 0.089706 0.271128 0.078171 0.387987 0.375083 0.158759 0.309001 0.519142 0.070618 0.101239 0.201844 0.255818 0.323149 0.219190 0.534101 0.109845 0.235026 0.121028 0.656038 0.037473 0.261484 0.045006 0.315713 0.164290 0.471815 0.048182 0.651960 0.009412 0.328237 0.010391 0.937365 0.017313 0.007516 0.037807 0.019983 0.044238 0.012387 0.923392 0.061195 0.021485 0.881645 0.035675 0.017521 0.952998 0.013139 0.016342 0.254160 0.029735 0.493023 0.223082 0.239200 0.593324 0.114503 0.052973 0.610822 0.071539 0.099169 0.218470 0.166610 0.389712 0.204400 0.239278 0.227752 0.361626 0.178497 0.232125 0.537030 0.182466 0.026035 0.254470 0.235902 0.151006 0.043788 0.569304 0.081851 0.250397 0.590059 0.077693 0.340417 0.189613 0.272075 0.197895 Consensus sequence: MWSMBAARRATGCDCABHATGD Reverse complement motif 0.197895 0.189613 0.272075 0.340417 0.081851 0.590059 0.250397 0.077693 0.569304 0.151006 0.043788 0.235902 0.254470 0.182466 0.026035 0.537030 0.227752 0.178497 0.361626 0.232125 0.166610 0.204400 0.389712 0.239278 0.218470 0.071539 0.099169 0.610822 0.239200 0.114503 0.593324 0.052973 0.254160 0.493023 0.029735 0.223082 0.017521 0.013139 0.952998 0.016342 0.061195 0.881645 0.021485 0.035675 0.923392 0.044238 0.012387 0.019983 0.037807 0.017313 0.007516 0.937365 0.010391 0.009412 0.328237 0.651960 0.315713 0.471815 0.164290 0.048182 0.045006 0.037473 0.261484 0.656038 0.121028 0.109845 0.235026 0.534101 0.201844 0.323149 0.255818 0.219190 0.309001 0.070618 0.519142 0.101239 0.078171 0.375083 0.387987 0.158759 0.271128 0.103991 0.089706 0.535175 0.399785 0.111435 0.446658 0.042122 Consensus sequence: DCATDBTGHGCATKMTTBRSWR Alignment: DCATDBTGHGCATKMTTBRSWR ------YSSGCAYGCSS----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 4 Motif ID: 79 Motif name: cCGCGGrCACG Original motif 0.000000 0.600000 0.200000 0.200000 0.000000 0.800000 0.000000 0.200000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.600000 0.000000 0.400000 0.000000 0.000000 0.800000 0.200000 0.000000 0.800000 0.000000 0.200000 0.000000 0.000000 0.800000 0.200000 0.000000 0.200000 0.000000 0.800000 0.000000 Consensus sequence: CCGCGGRCACG Reserve complement motif 0.200000 0.800000 0.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.200000 0.800000 0.000000 0.000000 0.000000 0.400000 0.600000 0.000000 0.800000 0.200000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.800000 0.200000 0.000000 0.200000 0.600000 0.200000 Consensus sequence: CGTGKCCGCGG ************************************************************************ Best Matches for Motif ID 79 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00065 Zfp161_primary Original Motif Original Motif Backward 2 11 0.022021 Species: Mus musculus Original motif 0.142624 0.111294 0.283688 0.462394 0.221170 0.081404 0.499138 0.198288 0.290070 0.042114 0.604904 0.062912 0.109755 0.559510 0.215454 0.115281 0.111745 0.022727 0.850580 0.014948 0.015907 0.942291 0.005561 0.036241 0.088509 0.003729 0.902805 0.004957 0.004957 0.902805 0.003729 0.088509 0.036241 0.005561 0.942291 0.015907 0.014948 0.850580 0.022727 0.111745 0.325358 0.049424 0.519652 0.105566 0.062912 0.604904 0.042114 0.290070 0.214335 0.388248 0.125912 0.271505 0.128984 0.372787 0.092390 0.405839 0.269058 0.098422 0.484016 0.148504 0.362176 0.156050 0.188642 0.293132 Consensus sequence: DDGCGCGCGCRCHYRD Reverse complement motif 0.293132 0.156050 0.188642 0.362176 0.269058 0.484016 0.098422 0.148504 0.405839 0.372787 0.092390 0.128984 0.214335 0.125912 0.388248 0.271505 0.062912 0.042114 0.604904 0.290070 0.325358 0.519652 0.049424 0.105566 0.014948 0.022727 0.850580 0.111745 0.036241 0.942291 0.005561 0.015907 0.004957 0.003729 0.902805 0.088509 0.088509 0.902805 0.003729 0.004957 0.015907 0.005561 0.942291 0.036241 0.111745 0.850580 0.022727 0.014948 0.109755 0.215454 0.559510 0.115281 0.290070 0.604904 0.042114 0.062912 0.221170 0.499138 0.081404 0.198288 0.462394 0.111294 0.283688 0.142624 Consensus sequence: DMMDGMGCGCGCGCHD Alignment: DDGCGCGCGCRCHYRD ----CCGCGGRCACG- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00527 Foxn4_secondary Reverse Complement Reverse Complement Backward 9 11 0.024575 Species: Mus musculus Original motif 0.298336 0.418632 0.208054 0.074978 0.289907 0.015608 0.457100 0.237385 0.273583 0.077889 0.107860 0.540668 0.184954 0.161611 0.384390 0.269045 0.521826 0.156340 0.089019 0.232815 0.356716 0.131104 0.394857 0.117323 0.266669 0.108765 0.505273 0.119293 0.020778 0.047199 0.919524 0.012500 0.948536 0.018775 0.008113 0.024576 0.010822 0.964042 0.014701 0.010434 0.007428 0.019505 0.966351 0.006717 0.010025 0.975678 0.008648 0.005649 0.043796 0.120935 0.742979 0.092289 0.008252 0.250704 0.541132 0.199913 0.474428 0.044681 0.134430 0.346461 0.146597 0.421317 0.143166 0.288920 0.020540 0.181479 0.553811 0.244170 0.129612 0.173360 0.535219 0.161808 0.506084 0.158156 0.130983 0.204776 0.054872 0.103043 0.545792 0.296293 0.389882 0.171037 0.164162 0.274918 0.225861 0.314031 0.288872 0.171237 Consensus sequence: VDWDARRGACGCGGWHGGAKHV Reverse complement motif 0.225861 0.288872 0.314031 0.171237 0.274918 0.171037 0.164162 0.389882 0.054872 0.545792 0.103043 0.296293 0.204776 0.158156 0.130983 0.506084 0.129612 0.535219 0.173360 0.161808 0.020540 0.553811 0.181479 0.244170 0.146597 0.143166 0.421317 0.288920 0.346461 0.044681 0.134430 0.474428 0.008252 0.541132 0.250704 0.199913 0.043796 0.742979 0.120935 0.092289 0.010025 0.008648 0.975678 0.005649 0.007428 0.966351 0.019505 0.006717 0.010822 0.014701 0.964042 0.010434 0.024576 0.018775 0.008113 0.948536 0.020778 0.919524 0.047199 0.012500 0.266669 0.505273 0.108765 0.119293 0.356716 0.394857 0.131104 0.117323 0.232815 0.156340 0.089019 0.521826 0.184954 0.384390 0.161611 0.269045 0.540668 0.077889 0.107860 0.273583 0.289907 0.457100 0.015608 0.237385 0.298336 0.208054 0.418632 0.074978 Consensus sequence: VHYTCCDWCCGCGTCMMTHWHV Alignment: VHYTCCDWCCGCGTCMMTHWHV ---CGTGKCCGCGG-------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00042 Gm397_second Original Motif Original Motif Backward 4 11 0.027937 Species: Mus musculus Original motif 0.360404 0.193218 0.248888 0.197490 0.286498 0.224597 0.426555 0.062349 0.347032 0.440548 0.033161 0.179259 0.337062 0.193658 0.385751 0.083529 0.108793 0.005723 0.878300 0.007184 0.015151 0.973406 0.009324 0.002118 0.972117 0.003915 0.019783 0.004185 0.010144 0.980912 0.003106 0.005839 0.974864 0.007532 0.015914 0.001691 0.012441 0.939195 0.029256 0.019108 0.759620 0.106164 0.073819 0.060397 0.157234 0.818234 0.007449 0.017083 0.050076 0.063608 0.505171 0.381144 0.131903 0.538163 0.124608 0.205325 0.367623 0.286526 0.240931 0.104919 0.357798 0.317606 0.097711 0.226885 Consensus sequence: DVMVGCACACACKCVH Reverse complement motif 0.226885 0.317606 0.097711 0.357798 0.104919 0.286526 0.240931 0.367623 0.131903 0.124608 0.538163 0.205325 0.050076 0.505171 0.063608 0.381144 0.157234 0.007449 0.818234 0.017083 0.060397 0.106164 0.073819 0.759620 0.012441 0.029256 0.939195 0.019108 0.001691 0.007532 0.015914 0.974864 0.010144 0.003106 0.980912 0.005839 0.004185 0.003915 0.019783 0.972117 0.015151 0.009324 0.973406 0.002118 0.108793 0.878300 0.005723 0.007184 0.337062 0.385751 0.193658 0.083529 0.347032 0.033161 0.440548 0.179259 0.286498 0.426555 0.224597 0.062349 0.197490 0.193218 0.248888 0.360404 Consensus sequence: HBGYGTGTGTGCVRVD Alignment: DVMVGCACACACKCVH --CCGCGGRCACG--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00007 Egr1_primary Original Motif Reverse Complement Forward 2 11 0.028538 Species: Mus musculus Original motif 0.211547 0.282708 0.203472 0.302273 0.141988 0.722437 0.054854 0.080721 0.032605 0.877172 0.012432 0.077792 0.115126 0.070606 0.781290 0.032979 0.003516 0.990021 0.002265 0.004198 0.004715 0.982482 0.009897 0.002906 0.001627 0.975937 0.001662 0.020774 0.262352 0.731732 0.002730 0.003187 0.005890 0.985756 0.002081 0.006273 0.022893 0.090460 0.649322 0.237324 0.023038 0.859949 0.037913 0.079101 0.567633 0.057394 0.166792 0.208181 0.176597 0.331265 0.125308 0.366830 0.183049 0.183774 0.226793 0.406384 Consensus sequence: HCCGCCCCCGCAHB Reverse complement motif 0.406384 0.183774 0.226793 0.183049 0.366830 0.331265 0.125308 0.176597 0.208181 0.057394 0.166792 0.567633 0.023038 0.037913 0.859949 0.079101 0.022893 0.649322 0.090460 0.237324 0.005890 0.002081 0.985756 0.006273 0.262352 0.002730 0.731732 0.003187 0.001627 0.001662 0.975937 0.020774 0.004715 0.009897 0.982482 0.002906 0.003516 0.002265 0.990021 0.004198 0.115126 0.781290 0.070606 0.032979 0.032605 0.012432 0.877172 0.077792 0.141988 0.054854 0.722437 0.080721 0.302273 0.282708 0.203472 0.211547 Consensus sequence: VHTGCGGGGGCGGH Alignment: VHTGCGGGGGCGGH -CCGCGGRCACG-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00050 Bhlhb2_secondary Original Motif Reverse Complement Backward 5 11 0.033538 Species: Mus musculus Original motif 0.120938 0.344851 0.124072 0.410138 0.220931 0.169844 0.422396 0.186829 0.127752 0.260812 0.103811 0.507625 0.140641 0.405473 0.287668 0.166218 0.296957 0.155579 0.301094 0.246370 0.219647 0.287193 0.154072 0.339087 0.049294 0.026059 0.121789 0.802859 0.520042 0.289284 0.173423 0.017251 0.049190 0.943472 0.004308 0.003030 0.902609 0.006767 0.074770 0.015854 0.003221 0.971329 0.005512 0.019937 0.019937 0.005512 0.971329 0.003221 0.015854 0.074770 0.006767 0.902609 0.003030 0.004308 0.943472 0.049190 0.003497 0.088920 0.685942 0.221641 0.802859 0.121789 0.026059 0.049294 0.334544 0.155170 0.275193 0.235092 0.275957 0.132104 0.454982 0.136957 0.134097 0.254352 0.422940 0.188611 0.396163 0.432784 0.051281 0.119772 0.276474 0.115627 0.419844 0.188056 0.160759 0.088061 0.649863 0.101318 0.203314 0.166595 0.106821 0.523270 Consensus sequence: YDYBDHTMCACGTGGADDBMDGT Reverse complement motif 0.523270 0.166595 0.106821 0.203314 0.160759 0.649863 0.088061 0.101318 0.276474 0.419844 0.115627 0.188056 0.396163 0.051281 0.432784 0.119772 0.134097 0.422940 0.254352 0.188611 0.275957 0.454982 0.132104 0.136957 0.235092 0.155170 0.275193 0.334544 0.049294 0.121789 0.026059 0.802859 0.003497 0.685942 0.088920 0.221641 0.003030 0.943472 0.004308 0.049190 0.902609 0.074770 0.006767 0.015854 0.019937 0.971329 0.005512 0.003221 0.003221 0.005512 0.971329 0.019937 0.015854 0.006767 0.074770 0.902609 0.049190 0.004308 0.943472 0.003030 0.017251 0.289284 0.173423 0.520042 0.802859 0.026059 0.121789 0.049294 0.339087 0.287193 0.154072 0.219647 0.296957 0.301094 0.155579 0.246370 0.140641 0.287668 0.405473 0.166218 0.507625 0.260812 0.103811 0.127752 0.220931 0.422396 0.169844 0.186829 0.410138 0.344851 0.124072 0.120938 Consensus sequence: ACHRBHDTCCACGTGYAHHBMHM Alignment: ACHRBHDTCCACGTGYAHHBMHM --------CCGCGGRCACG---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00400 Zif268 Original Motif Reverse Complement Backward 6 11 0.034043 Species: Mus musculus Original motif 0.104824 0.412716 0.254506 0.227955 0.644922 0.065476 0.140479 0.149122 0.201205 0.166164 0.347131 0.285501 0.360606 0.256316 0.150766 0.232313 0.199831 0.240681 0.279350 0.280137 0.234308 0.204076 0.321306 0.240310 0.274112 0.462435 0.111425 0.152028 0.067070 0.717501 0.073934 0.141496 0.106745 0.084442 0.658566 0.150247 0.025128 0.967053 0.003585 0.004234 0.006412 0.982989 0.003227 0.007371 0.009588 0.877620 0.002571 0.110221 0.621521 0.355443 0.015669 0.007366 0.002600 0.980275 0.004191 0.012934 0.118773 0.026658 0.783843 0.070725 0.022358 0.822101 0.024684 0.130857 0.713212 0.080912 0.128793 0.077084 0.166568 0.250955 0.107934 0.474544 0.225040 0.222494 0.163301 0.389166 0.268976 0.223206 0.265314 0.242504 0.137052 0.229058 0.148439 0.485451 0.135819 0.304550 0.141994 0.417637 0.272440 0.319501 0.230580 0.177478 Consensus sequence: BADHBDHCGCCCMCGCAHHDBBV Reverse complement motif 0.272440 0.230580 0.319501 0.177478 0.417637 0.304550 0.141994 0.135819 0.485451 0.229058 0.148439 0.137052 0.242504 0.223206 0.265314 0.268976 0.389166 0.222494 0.163301 0.225040 0.474544 0.250955 0.107934 0.166568 0.077084 0.080912 0.128793 0.713212 0.022358 0.024684 0.822101 0.130857 0.118773 0.783843 0.026658 0.070725 0.002600 0.004191 0.980275 0.012934 0.007366 0.355443 0.015669 0.621521 0.009588 0.002571 0.877620 0.110221 0.006412 0.003227 0.982989 0.007371 0.025128 0.003585 0.967053 0.004234 0.106745 0.658566 0.084442 0.150247 0.067070 0.073934 0.717501 0.141496 0.274112 0.111425 0.462435 0.152028 0.234308 0.321306 0.204076 0.240310 0.280137 0.240681 0.279350 0.199831 0.232313 0.256316 0.150766 0.360606 0.201205 0.347131 0.166164 0.285501 0.149122 0.065476 0.140479 0.644922 0.104824 0.254506 0.412716 0.227955 Consensus sequence: VVVDHHTGCGYGGGCGDHVHHTB Alignment: VVVDHHTGCGYGGGCGDHVHHTB -------CCGCGGRCACG----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00065 Zfp161_secondary Original Motif Original Motif Forward 2 11 0.034586 Species: Mus musculus Original motif 0.142646 0.070072 0.573757 0.213525 0.142215 0.493588 0.067040 0.297157 0.024280 0.923170 0.017567 0.034984 0.015569 0.033118 0.937202 0.014111 0.039447 0.888724 0.020074 0.051755 0.016404 0.008157 0.963367 0.012073 0.063620 0.860169 0.044753 0.031458 0.787911 0.122939 0.024389 0.064761 0.260517 0.103413 0.509585 0.126484 0.203752 0.216621 0.251506 0.328121 0.081075 0.040917 0.820854 0.057154 0.096434 0.760303 0.054942 0.088321 0.266016 0.190184 0.384583 0.159217 0.223960 0.243225 0.228688 0.304127 Consensus sequence: GYCGCGCARBGCVB Reverse complement motif 0.304127 0.243225 0.228688 0.223960 0.266016 0.384583 0.190184 0.159217 0.096434 0.054942 0.760303 0.088321 0.081075 0.820854 0.040917 0.057154 0.328121 0.216621 0.251506 0.203752 0.260517 0.509585 0.103413 0.126484 0.064761 0.122939 0.024389 0.787911 0.063620 0.044753 0.860169 0.031458 0.016404 0.963367 0.008157 0.012073 0.039447 0.020074 0.888724 0.051755 0.015569 0.937202 0.033118 0.014111 0.024280 0.017567 0.923170 0.034984 0.142215 0.067040 0.493588 0.297157 0.142646 0.573757 0.070072 0.213525 Consensus sequence: VVGCVMTGCGCGKC Alignment: GYCGCGCARBGCVB -CCGCGGRCACG-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00097 Mtf1_primary Original Motif Original Motif Backward 3 11 0.035043 Species: Mus musculus Original motif 0.220880 0.102939 0.418146 0.258035 0.154303 0.210788 0.420671 0.214238 0.229141 0.160788 0.412818 0.197253 0.167193 0.404248 0.092489 0.336070 0.025978 0.931335 0.023830 0.018857 0.009150 0.002023 0.977342 0.011485 0.044768 0.024113 0.039091 0.892028 0.007577 0.008370 0.973767 0.010286 0.005251 0.264996 0.004018 0.725735 0.009165 0.002428 0.980566 0.007841 0.021296 0.956027 0.008893 0.013784 0.982532 0.003341 0.005773 0.008353 0.500983 0.226027 0.143944 0.129045 0.544466 0.285936 0.044719 0.124879 0.321158 0.168428 0.261827 0.248587 0.271460 0.263221 0.199083 0.266236 Consensus sequence: DBDHCGTGTGCAAMDH Reverse complement motif 0.266236 0.263221 0.199083 0.271460 0.248587 0.168428 0.261827 0.321158 0.124879 0.285936 0.044719 0.544466 0.129045 0.226027 0.143944 0.500983 0.008353 0.003341 0.005773 0.982532 0.021296 0.008893 0.956027 0.013784 0.009165 0.980566 0.002428 0.007841 0.725735 0.264996 0.004018 0.005251 0.007577 0.973767 0.008370 0.010286 0.892028 0.024113 0.039091 0.044768 0.009150 0.977342 0.002023 0.011485 0.025978 0.023830 0.931335 0.018857 0.167193 0.092489 0.404248 0.336070 0.229141 0.412818 0.160788 0.197253 0.154303 0.420671 0.210788 0.214238 0.220880 0.418146 0.102939 0.258035 Consensus sequence: HDYTTGCACACGDHBH Alignment: DBDHCGTGTGCAAMDH ---CCGCGGRCACG-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00076 Rfxdc2_secondary Reverse Complement Reverse Complement Backward 3 11 0.035993 Species: Mus musculus Original motif 0.120124 0.369052 0.280026 0.230798 0.153013 0.175278 0.321983 0.349726 0.426573 0.206846 0.272112 0.094469 0.067213 0.665712 0.165815 0.101259 0.213424 0.152912 0.229260 0.404404 0.042427 0.193675 0.034144 0.729754 0.359927 0.038767 0.588911 0.012395 0.015079 0.017884 0.948607 0.018430 0.699438 0.007004 0.014579 0.278979 0.017282 0.022228 0.369181 0.591308 0.948823 0.011471 0.018805 0.020901 0.016175 0.947649 0.007710 0.028466 0.114584 0.334989 0.511562 0.038865 0.219114 0.247229 0.396478 0.137179 0.308087 0.178171 0.248356 0.265386 0.479300 0.125168 0.134837 0.260696 0.323493 0.230502 0.108189 0.337815 Consensus sequence: BBVCDTRGAKACSVDDH Reverse complement motif 0.337815 0.230502 0.108189 0.323493 0.260696 0.125168 0.134837 0.479300 0.265386 0.178171 0.248356 0.308087 0.219114 0.396478 0.247229 0.137179 0.114584 0.511562 0.334989 0.038865 0.016175 0.007710 0.947649 0.028466 0.020901 0.011471 0.018805 0.948823 0.591308 0.022228 0.369181 0.017282 0.278979 0.007004 0.014579 0.699438 0.015079 0.948607 0.017884 0.018430 0.359927 0.588911 0.038767 0.012395 0.729754 0.193675 0.034144 0.042427 0.404404 0.152912 0.229260 0.213424 0.067213 0.165815 0.665712 0.101259 0.094469 0.206846 0.272112 0.426573 0.349726 0.175278 0.321983 0.153013 0.120124 0.280026 0.369052 0.230798 Consensus sequence: HDDVSGTRTCMADGBVB Alignment: HDDVSGTRTCMADGBVB ----CGTGKCCGCGG-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00526 Foxn1_primary Original Motif Reverse Complement Backward 3 11 0.036196 Species: Mus musculus Original motif 0.456612 0.057181 0.078281 0.407926 0.460529 0.185506 0.083106 0.270859 0.445717 0.179510 0.239355 0.135417 0.116339 0.145186 0.275331 0.463144 0.239398 0.142078 0.480004 0.138520 0.355157 0.217877 0.284296 0.142670 0.318602 0.444835 0.153321 0.083243 0.609569 0.055866 0.280349 0.054216 0.062297 0.769824 0.027844 0.140035 0.151868 0.019245 0.803188 0.025699 0.011842 0.952534 0.017959 0.017665 0.017665 0.017959 0.952534 0.011842 0.025699 0.803188 0.019245 0.151868 0.140035 0.027844 0.769824 0.062297 0.054216 0.280349 0.055866 0.609569 0.013084 0.624655 0.177956 0.184305 0.287647 0.183527 0.295753 0.233074 0.042309 0.345931 0.198458 0.413301 0.338138 0.266033 0.045367 0.350462 0.302850 0.155320 0.074662 0.467168 0.240926 0.068901 0.283055 0.407118 0.409954 0.183157 0.154186 0.252704 Consensus sequence: WHVBVVMACGCGCGTCDYHWDH Reverse complement motif 0.252704 0.183157 0.154186 0.409954 0.407118 0.068901 0.283055 0.240926 0.467168 0.155320 0.074662 0.302850 0.350462 0.266033 0.045367 0.338138 0.413301 0.345931 0.198458 0.042309 0.287647 0.295753 0.183527 0.233074 0.013084 0.177956 0.624655 0.184305 0.609569 0.280349 0.055866 0.054216 0.140035 0.769824 0.027844 0.062297 0.025699 0.019245 0.803188 0.151868 0.017665 0.952534 0.017959 0.011842 0.011842 0.017959 0.952534 0.017665 0.151868 0.803188 0.019245 0.025699 0.062297 0.027844 0.769824 0.140035 0.054216 0.055866 0.280349 0.609569 0.318602 0.153321 0.444835 0.083243 0.142670 0.217877 0.284296 0.355157 0.239398 0.480004 0.142078 0.138520 0.463144 0.145186 0.275331 0.116339 0.135417 0.179510 0.239355 0.445717 0.270859 0.185506 0.083106 0.460529 0.407926 0.057181 0.078281 0.456612 Consensus sequence: HDWHMHGACGCGCGTRBVVBHW Alignment: HDWHMHGACGCGCGTRBVVBHW ---------CCGCGGRCACG-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 4 Motif ID: 80 Motif name: taaacgatgcc Original motif 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 Consensus sequence: TAAACGATGCC Reserve complement motif 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 Consensus sequence: GGCATCGTTTA ************************************************************************ Best Matches for Motif ID 80 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00114 Homez Original Motif Reverse Complement Backward 3 11 0.020764 Species: Mus musculus Original motif 0.585235 0.056880 0.174898 0.182987 0.344783 0.171238 0.144379 0.339600 0.496888 0.112442 0.086669 0.304001 0.457408 0.134777 0.032789 0.375026 0.342717 0.420568 0.171418 0.065297 0.872988 0.030946 0.004203 0.091862 0.006581 0.013120 0.006495 0.973804 0.036193 0.946961 0.004377 0.012469 0.014767 0.005226 0.966106 0.013901 0.208700 0.008264 0.021875 0.761161 0.037957 0.018882 0.028895 0.914266 0.157997 0.026546 0.021365 0.794092 0.139814 0.136272 0.117987 0.605927 0.125467 0.233302 0.183071 0.458161 0.523941 0.191122 0.050126 0.234811 0.374984 0.049392 0.291831 0.283793 0.268235 0.165772 0.308515 0.257477 Consensus sequence: AHWWMATCGTTTTBADD Reverse complement motif 0.268235 0.308515 0.165772 0.257477 0.283793 0.049392 0.291831 0.374984 0.234811 0.191122 0.050126 0.523941 0.458161 0.233302 0.183071 0.125467 0.605927 0.136272 0.117987 0.139814 0.794092 0.026546 0.021365 0.157997 0.914266 0.018882 0.028895 0.037957 0.761161 0.008264 0.021875 0.208700 0.014767 0.966106 0.005226 0.013901 0.036193 0.004377 0.946961 0.012469 0.973804 0.013120 0.006495 0.006581 0.091862 0.030946 0.004203 0.872988 0.342717 0.171418 0.420568 0.065297 0.375026 0.134777 0.032789 0.457408 0.304001 0.112442 0.086669 0.496888 0.339600 0.171238 0.144379 0.344783 0.182987 0.056880 0.174898 0.585235 Consensus sequence: HDTVAAAACGATRWWHT Alignment: HDTVAAAACGATRWWHT ----TAAACGATGCC-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00061 Foxl1_primary Reverse Complement Reverse Complement Forward 1 11 0.029432 Species: Mus musculus Original motif 0.323208 0.152915 0.185111 0.338766 0.428132 0.056109 0.099487 0.416272 0.659386 0.039965 0.035805 0.264843 0.647143 0.049206 0.078984 0.224667 0.208834 0.076592 0.071631 0.642943 0.341077 0.003865 0.649511 0.005547 0.016627 0.001866 0.001715 0.979792 0.952319 0.045294 0.000870 0.001516 0.988834 0.004620 0.000720 0.005826 0.989346 0.001005 0.006467 0.003182 0.001093 0.784230 0.001235 0.213442 0.991209 0.002017 0.001737 0.005037 0.801581 0.037084 0.023060 0.138274 0.528554 0.089350 0.107501 0.274595 0.208802 0.268646 0.368022 0.154530 0.280218 0.221367 0.340497 0.157918 0.146611 0.250725 0.293524 0.309140 Consensus sequence: DWAATRTAAACAAWVVB Reverse complement motif 0.309140 0.250725 0.293524 0.146611 0.280218 0.340497 0.221367 0.157918 0.208802 0.368022 0.268646 0.154530 0.274595 0.089350 0.107501 0.528554 0.138274 0.037084 0.023060 0.801581 0.005037 0.002017 0.001737 0.991209 0.001093 0.001235 0.784230 0.213442 0.003182 0.001005 0.006467 0.989346 0.005826 0.004620 0.000720 0.988834 0.001516 0.045294 0.000870 0.952319 0.979792 0.001866 0.001715 0.016627 0.341077 0.649511 0.003865 0.005547 0.642943 0.076592 0.071631 0.208834 0.224667 0.049206 0.078984 0.647143 0.264843 0.039965 0.035805 0.659386 0.416272 0.056109 0.099487 0.428132 0.338766 0.152915 0.185111 0.323208 Consensus sequence: VVVWTTGTTTAMATTWD Alignment: VVVWTTGTTTAMATTWD GGCATCGTTTA------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00039 Foxj3_primary Original Motif Original Motif Backward 1 11 0.030091 Species: Mus musculus Original motif 0.273456 0.257473 0.208488 0.260583 0.338566 0.133379 0.306363 0.221693 0.475488 0.192852 0.156858 0.174803 0.506619 0.132646 0.170373 0.190362 0.349042 0.127275 0.325924 0.197759 0.303850 0.013619 0.678034 0.004497 0.014136 0.015691 0.003073 0.967100 0.913373 0.082928 0.001910 0.001789 0.956294 0.017745 0.000584 0.025378 0.987796 0.001685 0.004159 0.006360 0.002288 0.814764 0.001427 0.181521 0.986707 0.002688 0.003346 0.007259 0.787378 0.065481 0.057961 0.089180 0.572982 0.089910 0.066184 0.270924 0.224167 0.339979 0.258886 0.176968 0.268414 0.272007 0.239541 0.220038 0.241771 0.394748 0.174273 0.189208 Consensus sequence: HDHADGTAAACAAAVVH Reverse complement motif 0.241771 0.174273 0.394748 0.189208 0.268414 0.239541 0.272007 0.220038 0.224167 0.258886 0.339979 0.176968 0.270924 0.089910 0.066184 0.572982 0.089180 0.065481 0.057961 0.787378 0.007259 0.002688 0.003346 0.986707 0.002288 0.001427 0.814764 0.181521 0.006360 0.001685 0.004159 0.987796 0.025378 0.017745 0.000584 0.956294 0.001789 0.082928 0.001910 0.913373 0.967100 0.015691 0.003073 0.014136 0.303850 0.678034 0.013619 0.004497 0.197759 0.127275 0.325924 0.349042 0.190362 0.132646 0.170373 0.506619 0.174803 0.192852 0.156858 0.475488 0.221693 0.133379 0.306363 0.338566 0.260583 0.257473 0.208488 0.273456 Consensus sequence: DVVTTTGTTTACDTHDH Alignment: HDHADGTAAACAAAVVH ------TAAACGATGCC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00025 Foxk1_primary Reverse Complement Reverse Complement Backward 7 11 0.030661 Species: Mus musculus Original motif 0.338172 0.192194 0.207817 0.261817 0.407924 0.117261 0.278236 0.196580 0.595570 0.070480 0.119221 0.214729 0.710845 0.038748 0.052600 0.197807 0.124647 0.116138 0.178053 0.581162 0.201602 0.005514 0.792110 0.000774 0.024590 0.004193 0.001331 0.969886 0.919465 0.077871 0.000760 0.001904 0.972342 0.010395 0.000580 0.016683 0.991045 0.001495 0.003585 0.003875 0.001358 0.885197 0.000980 0.112465 0.990318 0.001846 0.002968 0.004867 0.804563 0.063147 0.023496 0.108795 0.564824 0.087976 0.102865 0.244336 0.269947 0.300278 0.285008 0.144767 0.337905 0.220102 0.253694 0.188299 0.153781 0.274135 0.318343 0.253741 Consensus sequence: DDAATGTAAACAAAVVB Reverse complement motif 0.153781 0.318343 0.274135 0.253741 0.188299 0.220102 0.253694 0.337905 0.269947 0.285008 0.300278 0.144767 0.244336 0.087976 0.102865 0.564824 0.108795 0.063147 0.023496 0.804563 0.004867 0.001846 0.002968 0.990318 0.001358 0.000980 0.885197 0.112465 0.003875 0.001495 0.003585 0.991045 0.016683 0.010395 0.000580 0.972342 0.001904 0.077871 0.000760 0.919465 0.969886 0.004193 0.001331 0.024590 0.201602 0.792110 0.005514 0.000774 0.581162 0.116138 0.178053 0.124647 0.197807 0.038748 0.052600 0.710845 0.214729 0.070480 0.119221 0.595570 0.196580 0.117261 0.278236 0.407924 0.261817 0.192194 0.207817 0.338172 Consensus sequence: BBVTTTGTTTACATTDD Alignment: BBVTTTGTTTACATTDD GGCATCGTTTA------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00527 Foxn4_primary Reverse Complement Original Motif Forward 10 11 0.034248 Species: Mus musculus Original motif 0.397468 0.109792 0.196359 0.296381 0.102928 0.480888 0.250249 0.165936 0.141925 0.173586 0.377365 0.307124 0.337385 0.368225 0.188518 0.105872 0.354789 0.067393 0.345343 0.232475 0.299392 0.109745 0.215552 0.375311 0.242937 0.170264 0.189245 0.397554 0.461680 0.013180 0.358677 0.166463 0.067089 0.063048 0.008045 0.861819 0.431756 0.128671 0.436022 0.003551 0.006559 0.001814 0.988272 0.003355 0.012929 0.983600 0.001468 0.002003 0.018768 0.000766 0.976433 0.004033 0.003776 0.005554 0.002991 0.987679 0.002737 0.981589 0.009028 0.006646 0.126509 0.273800 0.413161 0.186530 0.100613 0.337225 0.212034 0.350128 0.123741 0.284683 0.060914 0.530661 0.204454 0.143533 0.100462 0.551551 0.202290 0.482197 0.148368 0.167145 0.191625 0.101330 0.607860 0.099185 0.507546 0.086532 0.219554 0.186368 Consensus sequence: DBBVDDDRTRGCGTCBBYTHGA Reverse complement motif 0.186368 0.086532 0.219554 0.507546 0.191625 0.607860 0.101330 0.099185 0.202290 0.148368 0.482197 0.167145 0.551551 0.143533 0.100462 0.204454 0.530661 0.284683 0.060914 0.123741 0.350128 0.337225 0.212034 0.100613 0.126509 0.413161 0.273800 0.186530 0.002737 0.009028 0.981589 0.006646 0.987679 0.005554 0.002991 0.003776 0.018768 0.976433 0.000766 0.004033 0.012929 0.001468 0.983600 0.002003 0.006559 0.988272 0.001814 0.003355 0.431756 0.436022 0.128671 0.003551 0.861819 0.063048 0.008045 0.067089 0.166463 0.013180 0.358677 0.461680 0.397554 0.170264 0.189245 0.242937 0.375311 0.109745 0.215552 0.299392 0.232475 0.067393 0.345343 0.354789 0.337385 0.188518 0.368225 0.105872 0.141925 0.377365 0.173586 0.307124 0.102928 0.250249 0.480888 0.165936 0.296381 0.109792 0.196359 0.397468 Consensus sequence: TCDAMVBGACGCMAKDDDVBBD Alignment: DBBVDDDRTRGCGTCBBYTHGA ---------GGCATCGTTTA-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00040 Irf5_primary Reverse Complement Reverse Complement Forward 3 11 0.034502 Species: Mus musculus Original motif 0.337548 0.193688 0.194039 0.274725 0.279950 0.185928 0.199501 0.334621 0.357304 0.160203 0.278768 0.203725 0.499782 0.069569 0.166858 0.263790 0.832538 0.022992 0.085287 0.059183 0.144788 0.434769 0.040595 0.379848 0.016035 0.943520 0.003379 0.037067 0.014208 0.001713 0.982579 0.001500 0.985572 0.004274 0.008722 0.001432 0.894404 0.001440 0.007585 0.096571 0.991307 0.002706 0.001993 0.003994 0.011143 0.973529 0.013241 0.002087 0.016468 0.532173 0.009621 0.441739 0.462373 0.120288 0.237126 0.180213 0.392685 0.223865 0.229697 0.153753 Consensus sequence: DDDWAYCGAAACYDV Reverse complement motif 0.153753 0.223865 0.229697 0.392685 0.180213 0.120288 0.237126 0.462373 0.016468 0.009621 0.532173 0.441739 0.011143 0.013241 0.973529 0.002087 0.003994 0.002706 0.001993 0.991307 0.096571 0.001440 0.007585 0.894404 0.001432 0.004274 0.008722 0.985572 0.014208 0.982579 0.001713 0.001500 0.016035 0.003379 0.943520 0.037067 0.144788 0.040595 0.434769 0.379848 0.059183 0.022992 0.085287 0.832538 0.263790 0.069569 0.166858 0.499782 0.203725 0.160203 0.278768 0.357304 0.334621 0.185928 0.199501 0.279950 0.274725 0.193688 0.194039 0.337548 Consensus sequence: BDKGTTTCGKTWDDD Alignment: BDKGTTTCGKTWDDD --GGCATCGTTTA-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00528 Foxm1_primary Original Motif Reverse Complement Forward 3 11 0.035162 Species: Mus musculus Original motif 0.402634 0.249702 0.143705 0.203959 0.709619 0.108953 0.130781 0.050647 0.334232 0.077498 0.228818 0.359452 0.131721 0.094794 0.234481 0.539005 0.170102 0.237609 0.252464 0.339824 0.244961 0.347304 0.228129 0.179606 0.612141 0.132244 0.180110 0.075504 0.472236 0.042388 0.234419 0.250957 0.125213 0.007413 0.849788 0.017587 0.702068 0.064216 0.141992 0.091724 0.008657 0.038238 0.002959 0.950145 0.007170 0.002244 0.986824 0.003763 0.002862 0.979956 0.000711 0.016471 0.971196 0.001954 0.011441 0.015409 0.105575 0.031482 0.022836 0.840107 0.031534 0.736742 0.032785 0.198939 0.479153 0.347558 0.031799 0.141490 0.056405 0.123140 0.023989 0.796466 0.111194 0.195344 0.501360 0.192102 0.376359 0.416820 0.072818 0.134004 0.225111 0.249460 0.306563 0.218866 0.405251 0.168478 0.108618 0.317653 0.165386 0.191749 0.268604 0.374261 Consensus sequence: HADTBVADGATGCATCMTGMVHB Reverse complement motif 0.374261 0.191749 0.268604 0.165386 0.317653 0.168478 0.108618 0.405251 0.225111 0.306563 0.249460 0.218866 0.376359 0.072818 0.416820 0.134004 0.111194 0.501360 0.195344 0.192102 0.796466 0.123140 0.023989 0.056405 0.141490 0.347558 0.031799 0.479153 0.031534 0.032785 0.736742 0.198939 0.840107 0.031482 0.022836 0.105575 0.015409 0.001954 0.011441 0.971196 0.002862 0.000711 0.979956 0.016471 0.007170 0.986824 0.002244 0.003763 0.950145 0.038238 0.002959 0.008657 0.091724 0.064216 0.141992 0.702068 0.125213 0.849788 0.007413 0.017587 0.250957 0.042388 0.234419 0.472236 0.075504 0.132244 0.180110 0.612141 0.244961 0.228129 0.347304 0.179606 0.339824 0.237609 0.252464 0.170102 0.539005 0.094794 0.234481 0.131721 0.359452 0.077498 0.228818 0.334232 0.050647 0.108953 0.130781 0.709619 0.203959 0.249702 0.143705 0.402634 Consensus sequence: VHVRCAYGATGCATCDTVVADTH Alignment: VHVRCAYGATGCATCDTVVADTH --TAAACGATGCC---------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00232 Dobox4 Reverse Complement Reverse Complement Backward 2 11 0.037149 Species: Mus musculus Original motif 0.264302 0.211442 0.173361 0.350895 0.413224 0.116602 0.116602 0.353572 0.486656 0.190855 0.148590 0.173900 0.503388 0.062728 0.128222 0.305661 0.084825 0.015745 0.170672 0.728758 0.856596 0.001753 0.045684 0.095967 0.052745 0.001652 0.828687 0.116917 0.985176 0.012392 0.001483 0.000949 0.011350 0.100275 0.009362 0.879013 0.764353 0.230179 0.001125 0.004343 0.001443 0.952663 0.005512 0.040382 0.008496 0.966240 0.002248 0.023017 0.076925 0.757970 0.008043 0.157062 0.097162 0.473715 0.088219 0.340904 0.392557 0.078339 0.147795 0.381309 0.055342 0.079606 0.149083 0.715969 0.369817 0.112894 0.219338 0.297952 Consensus sequence: HWHWTAGATACCCYWTD Reverse complement motif 0.297952 0.112894 0.219338 0.369817 0.715969 0.079606 0.149083 0.055342 0.381309 0.078339 0.147795 0.392557 0.097162 0.088219 0.473715 0.340904 0.076925 0.008043 0.757970 0.157062 0.008496 0.002248 0.966240 0.023017 0.001443 0.005512 0.952663 0.040382 0.004343 0.230179 0.001125 0.764353 0.879013 0.100275 0.009362 0.011350 0.000949 0.012392 0.001483 0.985176 0.052745 0.828687 0.001652 0.116917 0.095967 0.001753 0.045684 0.856596 0.728758 0.015745 0.170672 0.084825 0.305661 0.062728 0.128222 0.503388 0.173900 0.190855 0.148590 0.486656 0.353572 0.116602 0.116602 0.413224 0.350895 0.211442 0.173361 0.264302 Consensus sequence: DAWKGGGTATCTAWHWH Alignment: DAWKGGGTATCTAWHWH -----GGCATCGTTTA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00073 Foxa2_primary Reverse Complement Reverse Complement Backward 7 11 0.038480 Species: Mus musculus Original motif 0.335487 0.205062 0.128957 0.330494 0.411635 0.179625 0.175701 0.233038 0.412976 0.128602 0.091890 0.366532 0.608396 0.079002 0.107142 0.205460 0.433474 0.035203 0.153143 0.378180 0.087552 0.005003 0.894586 0.012858 0.004459 0.038951 0.001109 0.955481 0.924470 0.068560 0.001165 0.005805 0.920483 0.070039 0.001674 0.007805 0.988335 0.001902 0.003155 0.006608 0.001527 0.656726 0.002699 0.339047 0.987505 0.001810 0.004336 0.006349 0.719584 0.065184 0.050384 0.164848 0.535389 0.099997 0.102849 0.261764 0.245215 0.272017 0.301499 0.181269 0.306107 0.209040 0.248687 0.236166 0.223744 0.278668 0.251931 0.245657 Consensus sequence: HHWAWGTAAAYAAAVDB Reverse complement motif 0.223744 0.251931 0.278668 0.245657 0.236166 0.209040 0.248687 0.306107 0.245215 0.301499 0.272017 0.181269 0.261764 0.099997 0.102849 0.535389 0.164848 0.065184 0.050384 0.719584 0.006349 0.001810 0.004336 0.987505 0.001527 0.002699 0.656726 0.339047 0.006608 0.001902 0.003155 0.988335 0.007805 0.070039 0.001674 0.920483 0.005805 0.068560 0.001165 0.924470 0.955481 0.038951 0.001109 0.004459 0.087552 0.894586 0.005003 0.012858 0.378180 0.035203 0.153143 0.433474 0.205460 0.079002 0.107142 0.608396 0.366532 0.128602 0.091890 0.412976 0.233038 0.179625 0.175701 0.411635 0.330494 0.205062 0.128957 0.335487 Consensus sequence: BDVTTTKTTTACWTWHH Alignment: BDVTTTKTTTACWTWHH GGCATCGTTTA------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00011 Irf6_primary Reverse Complement Reverse Complement Forward 6 11 0.038853 Species: Mus musculus Original motif 0.256714 0.363080 0.149403 0.230804 0.312941 0.135162 0.190389 0.361507 0.255033 0.128823 0.354898 0.261246 0.667588 0.053933 0.205778 0.072701 0.199950 0.339707 0.114445 0.345899 0.029853 0.908514 0.006383 0.055250 0.019621 0.002231 0.976266 0.001882 0.983875 0.005320 0.008639 0.002166 0.698671 0.002741 0.006725 0.291864 0.990097 0.003609 0.003047 0.003247 0.008905 0.975208 0.011495 0.004392 0.022092 0.611448 0.018828 0.347632 0.538109 0.125313 0.241515 0.095063 0.456841 0.205124 0.177213 0.160822 0.372926 0.189134 0.195747 0.242193 0.217155 0.198027 0.300393 0.284425 0.277630 0.187849 0.237049 0.297472 Consensus sequence: HDDAHCGAAACYAVDDD Reverse complement motif 0.297472 0.187849 0.237049 0.277630 0.217155 0.300393 0.198027 0.284425 0.242193 0.189134 0.195747 0.372926 0.160822 0.205124 0.177213 0.456841 0.095063 0.125313 0.241515 0.538109 0.022092 0.018828 0.611448 0.347632 0.008905 0.011495 0.975208 0.004392 0.003247 0.003609 0.003047 0.990097 0.291864 0.002741 0.006725 0.698671 0.002166 0.005320 0.008639 0.983875 0.019621 0.976266 0.002231 0.001882 0.029853 0.006383 0.908514 0.055250 0.345899 0.339707 0.114445 0.199950 0.072701 0.053933 0.205778 0.667588 0.255033 0.354898 0.128823 0.261246 0.361507 0.135162 0.190389 0.312941 0.256714 0.149403 0.363080 0.230804 Consensus sequence: DHDBTKGTTTCGHTHDD Alignment: DHDBTKGTTTCGHTHDD -----GGCATCGTTTA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 4 Motif ID: 81 Motif name: ctatacggacg Original motif 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 Consensus sequence: CTATACGGACG Reserve complement motif 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 Consensus sequence: CGTCCGTATAG ************************************************************************ Best Matches for Motif ID 81 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00038 Spdef_primary Original Motif Reverse Complement Forward 3 11 0.027939 Species: Mus musculus Original motif 0.278139 0.269446 0.332078 0.120337 0.191853 0.289569 0.165370 0.353209 0.490437 0.027482 0.446684 0.035396 0.092110 0.612324 0.134576 0.160990 0.714688 0.007177 0.042951 0.235183 0.017038 0.014836 0.006165 0.961960 0.005411 0.986820 0.005716 0.002053 0.005945 0.989961 0.001629 0.002464 0.001282 0.006131 0.872195 0.120392 0.002518 0.087009 0.857395 0.053078 0.567474 0.070909 0.194015 0.167602 0.178375 0.058626 0.041325 0.721673 0.255647 0.250555 0.158035 0.335763 0.184054 0.303968 0.126491 0.385487 0.145245 0.233810 0.150000 0.470945 0.093249 0.313763 0.190482 0.402505 Consensus sequence: VHRCATCCGGATHHBB Reverse complement motif 0.402505 0.313763 0.190482 0.093249 0.470945 0.233810 0.150000 0.145245 0.385487 0.303968 0.126491 0.184054 0.335763 0.250555 0.158035 0.255647 0.721673 0.058626 0.041325 0.178375 0.167602 0.070909 0.194015 0.567474 0.002518 0.857395 0.087009 0.053078 0.001282 0.872195 0.006131 0.120392 0.005945 0.001629 0.989961 0.002464 0.005411 0.005716 0.986820 0.002053 0.961960 0.014836 0.006165 0.017038 0.235183 0.007177 0.042951 0.714688 0.092110 0.134576 0.612324 0.160990 0.035396 0.027482 0.446684 0.490437 0.353209 0.289569 0.165370 0.191853 0.278139 0.332078 0.269446 0.120337 Consensus sequence: VVHHATCCGGATGKHV Alignment: VVHHATCCGGATGKHV --CTATACGGACG--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00527 Foxn4_secondary Original Motif Original Motif Forward 1 11 0.030812 Species: Mus musculus Original motif 0.298336 0.418632 0.208054 0.074978 0.289907 0.015608 0.457100 0.237385 0.273583 0.077889 0.107860 0.540668 0.184954 0.161611 0.384390 0.269045 0.521826 0.156340 0.089019 0.232815 0.356716 0.131104 0.394857 0.117323 0.266669 0.108765 0.505273 0.119293 0.020778 0.047199 0.919524 0.012500 0.948536 0.018775 0.008113 0.024576 0.010822 0.964042 0.014701 0.010434 0.007428 0.019505 0.966351 0.006717 0.010025 0.975678 0.008648 0.005649 0.043796 0.120935 0.742979 0.092289 0.008252 0.250704 0.541132 0.199913 0.474428 0.044681 0.134430 0.346461 0.146597 0.421317 0.143166 0.288920 0.020540 0.181479 0.553811 0.244170 0.129612 0.173360 0.535219 0.161808 0.506084 0.158156 0.130983 0.204776 0.054872 0.103043 0.545792 0.296293 0.389882 0.171037 0.164162 0.274918 0.225861 0.314031 0.288872 0.171237 Consensus sequence: VDWDARRGACGCGGWHGGAKHV Reverse complement motif 0.225861 0.288872 0.314031 0.171237 0.274918 0.171037 0.164162 0.389882 0.054872 0.545792 0.103043 0.296293 0.204776 0.158156 0.130983 0.506084 0.129612 0.535219 0.173360 0.161808 0.020540 0.553811 0.181479 0.244170 0.146597 0.143166 0.421317 0.288920 0.346461 0.044681 0.134430 0.474428 0.008252 0.541132 0.250704 0.199913 0.043796 0.742979 0.120935 0.092289 0.010025 0.008648 0.975678 0.005649 0.007428 0.966351 0.019505 0.006717 0.010822 0.014701 0.964042 0.010434 0.024576 0.018775 0.008113 0.948536 0.020778 0.919524 0.047199 0.012500 0.266669 0.505273 0.108765 0.119293 0.356716 0.394857 0.131104 0.117323 0.232815 0.156340 0.089019 0.521826 0.184954 0.384390 0.161611 0.269045 0.540668 0.077889 0.107860 0.273583 0.289907 0.457100 0.015608 0.237385 0.298336 0.208054 0.418632 0.074978 Consensus sequence: VHYTCCDWCCGCGTCMMTHWHV Alignment: VDWDARRGACGCGGWHGGAKHV CTATACGGACG----------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00413 Elf4 Original Motif Reverse Complement Forward 1 11 0.032867 Species: Mus musculus Original motif 0.349744 0.139466 0.209326 0.301464 0.080478 0.359482 0.307083 0.252956 0.145756 0.213763 0.350557 0.289924 0.317307 0.199359 0.096089 0.387245 0.868576 0.009724 0.088821 0.032878 0.001975 0.827004 0.014159 0.156862 0.045494 0.000985 0.001907 0.951615 0.011012 0.001203 0.002186 0.985599 0.002743 0.992908 0.002226 0.002123 0.001498 0.990840 0.001556 0.006106 0.000951 0.005138 0.880591 0.113319 0.003127 0.107962 0.867980 0.020930 0.156602 0.055355 0.396563 0.391480 0.421246 0.049379 0.084495 0.444880 0.223879 0.068063 0.203809 0.504249 0.144100 0.323579 0.131544 0.400777 Consensus sequence: DBBHACTTCCGGKWTH Reverse complement motif 0.400777 0.323579 0.131544 0.144100 0.504249 0.068063 0.203809 0.223879 0.444880 0.049379 0.084495 0.421246 0.156602 0.396563 0.055355 0.391480 0.003127 0.867980 0.107962 0.020930 0.000951 0.880591 0.005138 0.113319 0.001498 0.001556 0.990840 0.006106 0.002743 0.002226 0.992908 0.002123 0.985599 0.001203 0.002186 0.011012 0.951615 0.000985 0.001907 0.045494 0.001975 0.014159 0.827004 0.156862 0.032878 0.009724 0.088821 0.868576 0.387245 0.199359 0.096089 0.317307 0.145756 0.350557 0.213763 0.289924 0.080478 0.307083 0.359482 0.252956 0.301464 0.139466 0.209326 0.349744 Consensus sequence: HAWYCCGGAAGTHBBD Alignment: HAWYCCGGAAGTHBBD CTATACGGACG----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00418 Etv6 Reverse Complement Original Motif Forward 7 11 0.033401 Species: Mus musculus Original motif 0.354972 0.069107 0.299350 0.276571 0.209701 0.408003 0.227382 0.154914 0.284336 0.375266 0.162604 0.177794 0.176569 0.181438 0.342172 0.299820 0.106551 0.204378 0.060299 0.628772 0.884088 0.003252 0.103113 0.009546 0.001110 0.704391 0.006294 0.288205 0.014992 0.000892 0.001401 0.982714 0.004842 0.001887 0.002470 0.990801 0.002724 0.992864 0.002206 0.002206 0.001792 0.991200 0.001615 0.005393 0.005151 0.010157 0.940259 0.044433 0.017780 0.199839 0.761921 0.020459 0.230834 0.269936 0.119652 0.379577 0.233019 0.093692 0.034743 0.638546 0.194739 0.181763 0.175340 0.448159 0.145452 0.293709 0.335917 0.224922 Consensus sequence: DVHBTACTTCCGGHTHB Reverse complement motif 0.145452 0.335917 0.293709 0.224922 0.448159 0.181763 0.175340 0.194739 0.638546 0.093692 0.034743 0.233019 0.379577 0.269936 0.119652 0.230834 0.017780 0.761921 0.199839 0.020459 0.005151 0.940259 0.010157 0.044433 0.001792 0.001615 0.991200 0.005393 0.002724 0.002206 0.992864 0.002206 0.990801 0.001887 0.002470 0.004842 0.982714 0.000892 0.001401 0.014992 0.001110 0.006294 0.704391 0.288205 0.009546 0.003252 0.103113 0.884088 0.628772 0.204378 0.060299 0.106551 0.176569 0.342172 0.181438 0.299820 0.284336 0.162604 0.375266 0.177794 0.209701 0.227382 0.408003 0.154914 0.276571 0.069107 0.299350 0.354972 Consensus sequence: BHAHCCGGAAGTABDVD Alignment: DVHBTACTTCCGGHTHB ------CGTCCGTATAG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00409 Elf5 Original Motif Original Motif Forward 1 11 0.033639 Species: Mus musculus Original motif 0.179167 0.229135 0.279326 0.312372 0.421239 0.102900 0.145609 0.330252 0.791978 0.009721 0.028951 0.169350 0.237609 0.375543 0.161526 0.225321 0.145845 0.325411 0.516045 0.012699 0.431007 0.516333 0.051679 0.000982 0.005750 0.001408 0.990928 0.001915 0.002025 0.001886 0.992021 0.004068 0.986405 0.001705 0.001039 0.010851 0.950652 0.003619 0.000482 0.045248 0.165221 0.013897 0.819076 0.001805 0.032042 0.049374 0.014632 0.903953 0.285325 0.108010 0.127373 0.479292 0.366131 0.141246 0.290661 0.201963 Consensus sequence: BWAHSMGGAAGTWD Reverse complement motif 0.201963 0.141246 0.290661 0.366131 0.479292 0.108010 0.127373 0.285325 0.903953 0.049374 0.014632 0.032042 0.165221 0.819076 0.013897 0.001805 0.045248 0.003619 0.000482 0.950652 0.010851 0.001705 0.001039 0.986405 0.002025 0.992021 0.001886 0.004068 0.005750 0.990928 0.001408 0.001915 0.431007 0.051679 0.516333 0.000982 0.145845 0.516045 0.325411 0.012699 0.237609 0.161526 0.375543 0.225321 0.169350 0.009721 0.028951 0.791978 0.330252 0.102900 0.145609 0.421239 0.312372 0.229135 0.279326 0.179167 Consensus sequence: DWACTTCCRSDTWV Alignment: BWAHSMGGAAGTWD CTATACGGACG--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00097 Mtf1_primary Reverse Complement Original Motif Backward 2 11 0.034653 Species: Mus musculus Original motif 0.220880 0.102939 0.418146 0.258035 0.154303 0.210788 0.420671 0.214238 0.229141 0.160788 0.412818 0.197253 0.167193 0.404248 0.092489 0.336070 0.025978 0.931335 0.023830 0.018857 0.009150 0.002023 0.977342 0.011485 0.044768 0.024113 0.039091 0.892028 0.007577 0.008370 0.973767 0.010286 0.005251 0.264996 0.004018 0.725735 0.009165 0.002428 0.980566 0.007841 0.021296 0.956027 0.008893 0.013784 0.982532 0.003341 0.005773 0.008353 0.500983 0.226027 0.143944 0.129045 0.544466 0.285936 0.044719 0.124879 0.321158 0.168428 0.261827 0.248587 0.271460 0.263221 0.199083 0.266236 Consensus sequence: DBDHCGTGTGCAAMDH Reverse complement motif 0.266236 0.263221 0.199083 0.271460 0.248587 0.168428 0.261827 0.321158 0.124879 0.285936 0.044719 0.544466 0.129045 0.226027 0.143944 0.500983 0.008353 0.003341 0.005773 0.982532 0.021296 0.008893 0.956027 0.013784 0.009165 0.980566 0.002428 0.007841 0.725735 0.264996 0.004018 0.005251 0.007577 0.973767 0.008370 0.010286 0.892028 0.024113 0.039091 0.044768 0.009150 0.977342 0.002023 0.011485 0.025978 0.023830 0.931335 0.018857 0.167193 0.092489 0.404248 0.336070 0.229141 0.412818 0.160788 0.197253 0.154303 0.420671 0.210788 0.214238 0.220880 0.418146 0.102939 0.258035 Consensus sequence: HDYTTGCACACGDHBH Alignment: DBDHCGTGTGCAAMDH ----CGTCCGTATAG- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00135 Hoxc12 Original Motif Reverse Complement Backward 3 11 0.036100 Species: Mus musculus Original motif 0.183093 0.256705 0.106645 0.453557 0.293699 0.196292 0.123477 0.386533 0.412013 0.124988 0.381422 0.081576 0.195091 0.186106 0.527371 0.091431 0.152495 0.041951 0.802926 0.002628 0.001867 0.030137 0.001608 0.966389 0.042259 0.939178 0.001204 0.017359 0.130196 0.001627 0.865068 0.003109 0.003366 0.001436 0.003067 0.992131 0.922191 0.005824 0.000528 0.071457 0.973219 0.001857 0.001299 0.023624 0.979071 0.008898 0.002615 0.009416 0.503130 0.138484 0.031998 0.326389 0.337928 0.242816 0.070564 0.348692 0.182884 0.251308 0.190482 0.375326 0.307728 0.135074 0.240871 0.316326 0.189821 0.425134 0.167065 0.217980 Consensus sequence: HHRGGTCGTAAAWHBDH Reverse complement motif 0.189821 0.167065 0.425134 0.217980 0.316326 0.135074 0.240871 0.307728 0.375326 0.251308 0.190482 0.182884 0.348692 0.242816 0.070564 0.337928 0.326389 0.138484 0.031998 0.503130 0.009416 0.008898 0.002615 0.979071 0.023624 0.001857 0.001299 0.973219 0.071457 0.005824 0.000528 0.922191 0.992131 0.001436 0.003067 0.003366 0.130196 0.865068 0.001627 0.003109 0.042259 0.001204 0.939178 0.017359 0.966389 0.030137 0.001608 0.001867 0.152495 0.802926 0.041951 0.002628 0.195091 0.527371 0.186106 0.091431 0.081576 0.124988 0.381422 0.412013 0.386533 0.196292 0.123477 0.293699 0.453557 0.256705 0.106645 0.183093 Consensus sequence: DDVHWTTTACGACCKHH Alignment: DDVHWTTTACGACCKHH ----CTATACGGACG-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00084 Gmeb1_primary Reverse Complement Reverse Complement Backward 3 11 0.036547 Species: Mus musculus Original motif 0.166569 0.264627 0.345569 0.223235 0.335599 0.314451 0.153336 0.196615 0.105350 0.231839 0.348018 0.314793 0.131274 0.215623 0.291288 0.361815 0.125570 0.072341 0.404848 0.397242 0.049879 0.039110 0.325167 0.585844 0.705098 0.009202 0.284757 0.000943 0.003535 0.986983 0.004275 0.005207 0.005207 0.004275 0.986983 0.003535 0.000943 0.284757 0.009202 0.705098 0.585844 0.325167 0.039110 0.049879 0.397242 0.404848 0.072341 0.125570 0.206857 0.234555 0.371731 0.186857 0.435957 0.145115 0.181033 0.237896 0.176104 0.260127 0.230770 0.333000 0.272102 0.213365 0.312032 0.202501 0.237402 0.250982 0.266977 0.244639 Consensus sequence: BHBBKKACGTMMVDBVB Reverse complement motif 0.237402 0.266977 0.250982 0.244639 0.272102 0.312032 0.213365 0.202501 0.333000 0.260127 0.230770 0.176104 0.237896 0.145115 0.181033 0.435957 0.206857 0.371731 0.234555 0.186857 0.397242 0.072341 0.404848 0.125570 0.049879 0.325167 0.039110 0.585844 0.705098 0.284757 0.009202 0.000943 0.005207 0.986983 0.004275 0.003535 0.003535 0.004275 0.986983 0.005207 0.000943 0.009202 0.284757 0.705098 0.585844 0.039110 0.325167 0.049879 0.125570 0.404848 0.072341 0.397242 0.361815 0.215623 0.291288 0.131274 0.105350 0.348018 0.231839 0.314793 0.196615 0.314451 0.153336 0.335599 0.166569 0.345569 0.264627 0.223235 Consensus sequence: BVVDVRYACGTRYVBHB Alignment: BVVDVRYACGTRYVBHB ----CGTCCGTATAG-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00015 Ehf_primary Original Motif Original Motif Forward 2 11 0.036713 Species: Mus musculus Original motif 0.327238 0.304037 0.232174 0.136551 0.198306 0.222758 0.316421 0.262515 0.252373 0.217079 0.267210 0.263337 0.633781 0.039800 0.036914 0.289504 0.160405 0.384709 0.220671 0.234215 0.134205 0.590541 0.266074 0.009179 0.210933 0.755978 0.030378 0.002710 0.011856 0.001472 0.984138 0.002533 0.003235 0.001605 0.989465 0.005695 0.984189 0.002418 0.002842 0.010551 0.884492 0.002651 0.002095 0.110762 0.249047 0.054607 0.690939 0.005407 0.124602 0.154669 0.047597 0.673132 0.375217 0.110561 0.230374 0.283848 0.402951 0.186789 0.219551 0.190710 Consensus sequence: VBDABCCGGAAGTDD Reverse complement motif 0.190710 0.186789 0.219551 0.402951 0.283848 0.110561 0.230374 0.375217 0.673132 0.154669 0.047597 0.124602 0.249047 0.690939 0.054607 0.005407 0.110762 0.002651 0.002095 0.884492 0.010551 0.002418 0.002842 0.984189 0.003235 0.989465 0.001605 0.005695 0.011856 0.984138 0.001472 0.002533 0.210933 0.030378 0.755978 0.002710 0.134205 0.266074 0.590541 0.009179 0.160405 0.220671 0.384709 0.234215 0.289504 0.039800 0.036914 0.633781 0.252373 0.267210 0.217079 0.263337 0.198306 0.316421 0.222758 0.262515 0.136551 0.304037 0.232174 0.327238 Consensus sequence: DDACTTCCGGBTHBB Alignment: VBDABCCGGAAGTDD -CTATACGGACG--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00421 Etv1 Reverse Complement Reverse Complement Backward 2 11 0.037300 Species: Mus musculus Original motif 0.481848 0.274378 0.165047 0.078727 0.153123 0.322109 0.385794 0.138974 0.257711 0.198309 0.118559 0.425422 0.102329 0.255032 0.373097 0.269542 0.655995 0.027594 0.168796 0.147615 0.012836 0.906067 0.077134 0.003962 0.079806 0.917232 0.002438 0.000524 0.005217 0.001765 0.991859 0.001159 0.001691 0.002097 0.993588 0.002624 0.991087 0.001016 0.001937 0.005961 0.751484 0.005147 0.002324 0.241044 0.112494 0.076460 0.805095 0.005951 0.012019 0.198497 0.022413 0.767071 0.482843 0.140306 0.249898 0.126953 0.298792 0.191769 0.286874 0.222565 0.395216 0.302575 0.172247 0.129961 0.364642 0.219734 0.190320 0.225304 Consensus sequence: MVHBACCGGAAGTVDVH Reverse complement motif 0.225304 0.219734 0.190320 0.364642 0.129961 0.302575 0.172247 0.395216 0.222565 0.191769 0.286874 0.298792 0.126953 0.140306 0.249898 0.482843 0.767071 0.198497 0.022413 0.012019 0.112494 0.805095 0.076460 0.005951 0.241044 0.005147 0.002324 0.751484 0.005961 0.001016 0.001937 0.991087 0.001691 0.993588 0.002097 0.002624 0.005217 0.991859 0.001765 0.001159 0.079806 0.002438 0.917232 0.000524 0.012836 0.077134 0.906067 0.003962 0.147615 0.027594 0.168796 0.655995 0.102329 0.373097 0.255032 0.269542 0.425422 0.198309 0.118559 0.257711 0.153123 0.385794 0.322109 0.138974 0.078727 0.274378 0.165047 0.481848 Consensus sequence: HBDBACTTCCGGTBHVY Alignment: HBDBACTTCCGGTBHVY -----CGTCCGTATAG- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 4 Motif ID: 82 Motif name: gCGCGCsCgsG Original motif 0.105263 0.210526 0.526316 0.157895 0.000000 0.736842 0.105263 0.157895 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.368421 0.631579 0.000000 0.000000 0.894737 0.105263 0.000000 0.157895 0.157895 0.631579 0.052632 0.052632 0.631579 0.263158 0.052632 0.105263 0.052632 0.789474 0.052632 Consensus sequence: GCGCGCSCGCG Reserve complement motif 0.105263 0.789474 0.052632 0.052632 0.052632 0.263158 0.631579 0.052632 0.157895 0.631579 0.157895 0.052632 0.000000 0.105263 0.894737 0.000000 0.000000 0.631579 0.368421 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.105263 0.736842 0.157895 0.105263 0.526316 0.210526 0.157895 Consensus sequence: CGCGSGCGCGC ************************************************************************ Best Matches for Motif ID 82 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00065 Zfp161_primary Reverse Complement Original Motif Forward 2 11 0.000000 Species: Mus musculus Original motif 0.142624 0.111294 0.283688 0.462394 0.221170 0.081404 0.499138 0.198288 0.290070 0.042114 0.604904 0.062912 0.109755 0.559510 0.215454 0.115281 0.111745 0.022727 0.850580 0.014948 0.015907 0.942291 0.005561 0.036241 0.088509 0.003729 0.902805 0.004957 0.004957 0.902805 0.003729 0.088509 0.036241 0.005561 0.942291 0.015907 0.014948 0.850580 0.022727 0.111745 0.325358 0.049424 0.519652 0.105566 0.062912 0.604904 0.042114 0.290070 0.214335 0.388248 0.125912 0.271505 0.128984 0.372787 0.092390 0.405839 0.269058 0.098422 0.484016 0.148504 0.362176 0.156050 0.188642 0.293132 Consensus sequence: DDGCGCGCGCRCHYRD Reverse complement motif 0.293132 0.156050 0.188642 0.362176 0.269058 0.484016 0.098422 0.148504 0.405839 0.372787 0.092390 0.128984 0.214335 0.125912 0.388248 0.271505 0.062912 0.042114 0.604904 0.290070 0.325358 0.519652 0.049424 0.105566 0.014948 0.022727 0.850580 0.111745 0.036241 0.942291 0.005561 0.015907 0.004957 0.003729 0.902805 0.088509 0.088509 0.902805 0.003729 0.004957 0.015907 0.005561 0.942291 0.036241 0.111745 0.850580 0.022727 0.014948 0.109755 0.215454 0.559510 0.115281 0.290070 0.604904 0.042114 0.062912 0.221170 0.499138 0.081404 0.198288 0.462394 0.111294 0.283688 0.142624 Consensus sequence: DMMDGMGCGCGCGCHD Alignment: DDGCGCGCGCRCHYRD -CGCGSGCGCGC---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00003 E2F3_primary Reverse Complement Reverse Complement Backward 5 11 0.010201 Species: Mus musculus Original motif 0.358868 0.212371 0.263565 0.165196 0.303014 0.253580 0.111217 0.332189 0.420933 0.110957 0.210958 0.257152 0.769724 0.062662 0.032155 0.135459 0.311973 0.051319 0.408669 0.228039 0.097916 0.141153 0.719697 0.041234 0.009980 0.014044 0.971955 0.004021 0.014425 0.974798 0.008373 0.002404 0.000891 0.013228 0.983966 0.001915 0.000827 0.938560 0.059548 0.001065 0.007071 0.102005 0.872378 0.018546 0.020099 0.897653 0.014151 0.068097 0.114080 0.346724 0.409037 0.130159 0.331439 0.279041 0.085030 0.304491 0.319846 0.136792 0.043641 0.499722 Consensus sequence: VHDADGGCGCGCSHW Reverse complement motif 0.499722 0.136792 0.043641 0.319846 0.304491 0.279041 0.085030 0.331439 0.114080 0.409037 0.346724 0.130159 0.020099 0.014151 0.897653 0.068097 0.007071 0.872378 0.102005 0.018546 0.000827 0.059548 0.938560 0.001065 0.000891 0.983966 0.013228 0.001915 0.014425 0.008373 0.974798 0.002404 0.009980 0.971955 0.014044 0.004021 0.097916 0.719697 0.141153 0.041234 0.311973 0.408669 0.051319 0.228039 0.135459 0.062662 0.032155 0.769724 0.257152 0.110957 0.210958 0.420933 0.332189 0.253580 0.111217 0.303014 0.165196 0.212371 0.263565 0.358868 Consensus sequence: WHSGCGCGCCHTDHB Alignment: WHSGCGCGCCHTDHB CGCGSGCGCGC---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00001 E2F2_primary Reverse Complement Reverse Complement Forward 1 11 0.012446 Species: Mus musculus Original motif 0.305970 0.214348 0.269312 0.210370 0.279551 0.218276 0.140576 0.361597 0.391304 0.162239 0.193916 0.252541 0.701667 0.102206 0.041580 0.154547 0.427655 0.068368 0.324706 0.179271 0.144368 0.191048 0.609772 0.054812 0.014295 0.020613 0.958397 0.006695 0.019783 0.962982 0.013403 0.003831 0.001189 0.023882 0.973231 0.001697 0.001343 0.919840 0.077728 0.001089 0.011293 0.097945 0.865194 0.025568 0.039106 0.864604 0.025189 0.071100 0.147663 0.328105 0.407118 0.117115 0.462769 0.203531 0.107986 0.225714 0.293396 0.229650 0.082819 0.394135 Consensus sequence: VHDARGGCGCGCVHH Reverse complement motif 0.394135 0.229650 0.082819 0.293396 0.225714 0.203531 0.107986 0.462769 0.147663 0.407118 0.328105 0.117115 0.039106 0.025189 0.864604 0.071100 0.011293 0.865194 0.097945 0.025568 0.001343 0.077728 0.919840 0.001089 0.001189 0.973231 0.023882 0.001697 0.019783 0.013403 0.962982 0.003831 0.014295 0.958397 0.020613 0.006695 0.144368 0.609772 0.191048 0.054812 0.179271 0.068368 0.324706 0.427655 0.154547 0.102206 0.041580 0.701667 0.252541 0.162239 0.193916 0.391304 0.361597 0.218276 0.140576 0.279551 0.210370 0.214348 0.269312 0.305970 Consensus sequence: HHVGCGCGCCKTDHB Alignment: HHVGCGCGCCKTDHB CGCGSGCGCGC---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00526 Foxn1_primary Reverse Complement Original Motif Backward 8 11 0.019220 Species: Mus musculus Original motif 0.456612 0.057181 0.078281 0.407926 0.460529 0.185506 0.083106 0.270859 0.445717 0.179510 0.239355 0.135417 0.116339 0.145186 0.275331 0.463144 0.239398 0.142078 0.480004 0.138520 0.355157 0.217877 0.284296 0.142670 0.318602 0.444835 0.153321 0.083243 0.609569 0.055866 0.280349 0.054216 0.062297 0.769824 0.027844 0.140035 0.151868 0.019245 0.803188 0.025699 0.011842 0.952534 0.017959 0.017665 0.017665 0.017959 0.952534 0.011842 0.025699 0.803188 0.019245 0.151868 0.140035 0.027844 0.769824 0.062297 0.054216 0.280349 0.055866 0.609569 0.013084 0.624655 0.177956 0.184305 0.287647 0.183527 0.295753 0.233074 0.042309 0.345931 0.198458 0.413301 0.338138 0.266033 0.045367 0.350462 0.302850 0.155320 0.074662 0.467168 0.240926 0.068901 0.283055 0.407118 0.409954 0.183157 0.154186 0.252704 Consensus sequence: WHVBVVMACGCGCGTCDYHWDH Reverse complement motif 0.252704 0.183157 0.154186 0.409954 0.407118 0.068901 0.283055 0.240926 0.467168 0.155320 0.074662 0.302850 0.350462 0.266033 0.045367 0.338138 0.413301 0.345931 0.198458 0.042309 0.287647 0.295753 0.183527 0.233074 0.013084 0.177956 0.624655 0.184305 0.609569 0.280349 0.055866 0.054216 0.140035 0.769824 0.027844 0.062297 0.025699 0.019245 0.803188 0.151868 0.017665 0.952534 0.017959 0.011842 0.011842 0.017959 0.952534 0.017665 0.151868 0.803188 0.019245 0.025699 0.062297 0.027844 0.769824 0.140035 0.054216 0.055866 0.280349 0.609569 0.318602 0.153321 0.444835 0.083243 0.142670 0.217877 0.284296 0.355157 0.239398 0.480004 0.142078 0.138520 0.463144 0.145186 0.275331 0.116339 0.135417 0.179510 0.239355 0.445717 0.270859 0.185506 0.083106 0.460529 0.407926 0.057181 0.078281 0.456612 Consensus sequence: HDWHMHGACGCGCGTRBVVBHW Alignment: WHVBVVMACGCGCGTCDYHWDH ----CGCGSGCGCGC------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00526 Foxn1_secondary Reverse Complement Original Motif Forward 8 11 0.023198 Species: Mus musculus Original motif 0.477863 0.106306 0.184102 0.231729 0.304951 0.149020 0.361418 0.184612 0.548996 0.056128 0.348902 0.045974 0.385727 0.477782 0.086218 0.050273 0.409556 0.232265 0.173851 0.184328 0.174550 0.312880 0.307123 0.205448 0.850398 0.047204 0.041665 0.060734 0.141234 0.548534 0.142230 0.168002 0.059462 0.026354 0.892948 0.021236 0.053714 0.870297 0.028935 0.047055 0.086273 0.069147 0.805284 0.039296 0.033781 0.573881 0.034115 0.358223 0.035191 0.079663 0.824970 0.060176 0.051830 0.862631 0.019359 0.066180 0.178685 0.015738 0.762485 0.043092 0.058988 0.042615 0.017608 0.880789 0.202382 0.173360 0.284095 0.340163 0.098493 0.234651 0.506524 0.160333 0.109087 0.336204 0.250510 0.304198 0.130945 0.250843 0.177122 0.441090 0.353830 0.138838 0.162784 0.344548 0.114290 0.417163 0.160662 0.307885 Consensus sequence: DDRMHBACGCGYGCGTDGBBDB Reverse complement motif 0.114290 0.160662 0.417163 0.307885 0.344548 0.138838 0.162784 0.353830 0.441090 0.250843 0.177122 0.130945 0.109087 0.250510 0.336204 0.304198 0.098493 0.506524 0.234651 0.160333 0.340163 0.173360 0.284095 0.202382 0.880789 0.042615 0.017608 0.058988 0.178685 0.762485 0.015738 0.043092 0.051830 0.019359 0.862631 0.066180 0.035191 0.824970 0.079663 0.060176 0.033781 0.034115 0.573881 0.358223 0.086273 0.805284 0.069147 0.039296 0.053714 0.028935 0.870297 0.047055 0.059462 0.892948 0.026354 0.021236 0.141234 0.142230 0.548534 0.168002 0.060734 0.047204 0.041665 0.850398 0.174550 0.307123 0.312880 0.205448 0.184328 0.232265 0.173851 0.409556 0.385727 0.086218 0.477782 0.050273 0.045974 0.056128 0.348902 0.548996 0.304951 0.361418 0.149020 0.184612 0.231729 0.106306 0.184102 0.477863 Consensus sequence: BDVBCDACGCKCGCGTBHRKHD Alignment: DDRMHBACGCGYGCGTDGBBDB -------CGCGSGCGCGC---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00007 Egr1_primary Original Motif Original Motif Backward 3 11 0.028937 Species: Mus musculus Original motif 0.211547 0.282708 0.203472 0.302273 0.141988 0.722437 0.054854 0.080721 0.032605 0.877172 0.012432 0.077792 0.115126 0.070606 0.781290 0.032979 0.003516 0.990021 0.002265 0.004198 0.004715 0.982482 0.009897 0.002906 0.001627 0.975937 0.001662 0.020774 0.262352 0.731732 0.002730 0.003187 0.005890 0.985756 0.002081 0.006273 0.022893 0.090460 0.649322 0.237324 0.023038 0.859949 0.037913 0.079101 0.567633 0.057394 0.166792 0.208181 0.176597 0.331265 0.125308 0.366830 0.183049 0.183774 0.226793 0.406384 Consensus sequence: HCCGCCCCCGCAHB Reverse complement motif 0.406384 0.183774 0.226793 0.183049 0.366830 0.331265 0.125308 0.176597 0.208181 0.057394 0.166792 0.567633 0.023038 0.037913 0.859949 0.079101 0.022893 0.649322 0.090460 0.237324 0.005890 0.002081 0.985756 0.006273 0.262352 0.002730 0.731732 0.003187 0.001627 0.001662 0.975937 0.020774 0.004715 0.009897 0.982482 0.002906 0.003516 0.002265 0.990021 0.004198 0.115126 0.781290 0.070606 0.032979 0.032605 0.012432 0.877172 0.077792 0.141988 0.054854 0.722437 0.080721 0.302273 0.282708 0.203472 0.211547 Consensus sequence: VHTGCGGGGGCGGH Alignment: HCCGCCCCCGCAHB -GCGCGCSCGCG-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00400 Zif268 Original Motif Original Motif Forward 7 11 0.029725 Species: Mus musculus Original motif 0.104824 0.412716 0.254506 0.227955 0.644922 0.065476 0.140479 0.149122 0.201205 0.166164 0.347131 0.285501 0.360606 0.256316 0.150766 0.232313 0.199831 0.240681 0.279350 0.280137 0.234308 0.204076 0.321306 0.240310 0.274112 0.462435 0.111425 0.152028 0.067070 0.717501 0.073934 0.141496 0.106745 0.084442 0.658566 0.150247 0.025128 0.967053 0.003585 0.004234 0.006412 0.982989 0.003227 0.007371 0.009588 0.877620 0.002571 0.110221 0.621521 0.355443 0.015669 0.007366 0.002600 0.980275 0.004191 0.012934 0.118773 0.026658 0.783843 0.070725 0.022358 0.822101 0.024684 0.130857 0.713212 0.080912 0.128793 0.077084 0.166568 0.250955 0.107934 0.474544 0.225040 0.222494 0.163301 0.389166 0.268976 0.223206 0.265314 0.242504 0.137052 0.229058 0.148439 0.485451 0.135819 0.304550 0.141994 0.417637 0.272440 0.319501 0.230580 0.177478 Consensus sequence: BADHBDHCGCCCMCGCAHHDBBV Reverse complement motif 0.272440 0.230580 0.319501 0.177478 0.417637 0.304550 0.141994 0.135819 0.485451 0.229058 0.148439 0.137052 0.242504 0.223206 0.265314 0.268976 0.389166 0.222494 0.163301 0.225040 0.474544 0.250955 0.107934 0.166568 0.077084 0.080912 0.128793 0.713212 0.022358 0.024684 0.822101 0.130857 0.118773 0.783843 0.026658 0.070725 0.002600 0.004191 0.980275 0.012934 0.007366 0.355443 0.015669 0.621521 0.009588 0.002571 0.877620 0.110221 0.006412 0.003227 0.982989 0.007371 0.025128 0.003585 0.967053 0.004234 0.106745 0.658566 0.084442 0.150247 0.067070 0.073934 0.717501 0.141496 0.274112 0.111425 0.462435 0.152028 0.234308 0.321306 0.204076 0.240310 0.280137 0.240681 0.279350 0.199831 0.232313 0.256316 0.150766 0.360606 0.201205 0.347131 0.166164 0.285501 0.149122 0.065476 0.140479 0.644922 0.104824 0.254506 0.412716 0.227955 Consensus sequence: VVVDHHTGCGYGGGCGDHVHHTB Alignment: BADHBDHCGCCCMCGCAHHDBBV ------GCGCGCSCGCG------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00088 Plagl1_primary Reverse Complement Original Motif Backward 5 11 0.031691 Species: Mus musculus Original motif 0.119709 0.241933 0.299696 0.338662 0.236295 0.277376 0.191945 0.294383 0.203722 0.152043 0.467305 0.176931 0.187661 0.114330 0.513662 0.184347 0.047306 0.041411 0.838415 0.072868 0.131945 0.003749 0.848921 0.015385 0.003800 0.006713 0.960656 0.028832 0.002515 0.652482 0.343047 0.001955 0.001955 0.343047 0.652482 0.002515 0.028832 0.960656 0.006713 0.003800 0.015385 0.848921 0.003749 0.131945 0.072868 0.838415 0.041411 0.047306 0.193804 0.543600 0.063385 0.199211 0.210649 0.233823 0.258755 0.296773 0.376439 0.191612 0.261004 0.170945 0.230078 0.256519 0.299785 0.213618 Consensus sequence: BHDGGGGSSCCCCBVV Reverse complement motif 0.230078 0.299785 0.256519 0.213618 0.170945 0.191612 0.261004 0.376439 0.296773 0.233823 0.258755 0.210649 0.193804 0.063385 0.543600 0.199211 0.072868 0.041411 0.838415 0.047306 0.015385 0.003749 0.848921 0.131945 0.028832 0.006713 0.960656 0.003800 0.001955 0.652482 0.343047 0.002515 0.002515 0.343047 0.652482 0.001955 0.003800 0.960656 0.006713 0.028832 0.131945 0.848921 0.003749 0.015385 0.047306 0.838415 0.041411 0.072868 0.187661 0.513662 0.114330 0.184347 0.203722 0.467305 0.152043 0.176931 0.294383 0.277376 0.191945 0.236295 0.338662 0.241933 0.299696 0.119709 Consensus sequence: VBVGGGGSSCCCCHHV Alignment: BHDGGGGSSCCCCBVV -CGCGSGCGCGC---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00002 Sp4_primary Reverse Complement Reverse Complement Backward 3 11 0.032363 Species: Mus musculus Original motif 0.155386 0.223380 0.374454 0.246780 0.247106 0.159582 0.345111 0.248201 0.238889 0.258354 0.165304 0.337454 0.255612 0.489586 0.051621 0.203182 0.450100 0.545383 0.001071 0.003447 0.003704 0.991007 0.002456 0.002833 0.035504 0.001814 0.928129 0.034553 0.001494 0.991406 0.003414 0.003686 0.003045 0.990628 0.005182 0.001145 0.000990 0.963237 0.001215 0.034557 0.148016 0.838396 0.000666 0.012922 0.014261 0.905847 0.007200 0.072692 0.083394 0.270068 0.058368 0.588170 0.149141 0.286783 0.142802 0.421274 0.204851 0.347195 0.253356 0.194597 0.184442 0.299908 0.194408 0.321242 0.125793 0.380109 0.245318 0.248780 Consensus sequence: BDHHMCGCCCCCTHVBB Reverse complement motif 0.125793 0.245318 0.380109 0.248780 0.321242 0.299908 0.194408 0.184442 0.204851 0.253356 0.347195 0.194597 0.421274 0.286783 0.142802 0.149141 0.588170 0.270068 0.058368 0.083394 0.014261 0.007200 0.905847 0.072692 0.148016 0.000666 0.838396 0.012922 0.000990 0.001215 0.963237 0.034557 0.003045 0.005182 0.990628 0.001145 0.001494 0.003414 0.991406 0.003686 0.035504 0.928129 0.001814 0.034553 0.003704 0.002456 0.991007 0.002833 0.450100 0.001071 0.545383 0.003447 0.255612 0.051621 0.489586 0.203182 0.337454 0.258354 0.165304 0.238889 0.247106 0.345111 0.159582 0.248201 0.155386 0.374454 0.223380 0.246780 Consensus sequence: BVVHAGGGGGCGRDHHB Alignment: BVVHAGGGGGCGRDHHB ----CGCGSGCGCGC-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00527 Foxn4_secondary Reverse Complement Reverse Complement Backward 7 11 0.039112 Species: Mus musculus Original motif 0.298336 0.418632 0.208054 0.074978 0.289907 0.015608 0.457100 0.237385 0.273583 0.077889 0.107860 0.540668 0.184954 0.161611 0.384390 0.269045 0.521826 0.156340 0.089019 0.232815 0.356716 0.131104 0.394857 0.117323 0.266669 0.108765 0.505273 0.119293 0.020778 0.047199 0.919524 0.012500 0.948536 0.018775 0.008113 0.024576 0.010822 0.964042 0.014701 0.010434 0.007428 0.019505 0.966351 0.006717 0.010025 0.975678 0.008648 0.005649 0.043796 0.120935 0.742979 0.092289 0.008252 0.250704 0.541132 0.199913 0.474428 0.044681 0.134430 0.346461 0.146597 0.421317 0.143166 0.288920 0.020540 0.181479 0.553811 0.244170 0.129612 0.173360 0.535219 0.161808 0.506084 0.158156 0.130983 0.204776 0.054872 0.103043 0.545792 0.296293 0.389882 0.171037 0.164162 0.274918 0.225861 0.314031 0.288872 0.171237 Consensus sequence: VDWDARRGACGCGGWHGGAKHV Reverse complement motif 0.225861 0.288872 0.314031 0.171237 0.274918 0.171037 0.164162 0.389882 0.054872 0.545792 0.103043 0.296293 0.204776 0.158156 0.130983 0.506084 0.129612 0.535219 0.173360 0.161808 0.020540 0.553811 0.181479 0.244170 0.146597 0.143166 0.421317 0.288920 0.346461 0.044681 0.134430 0.474428 0.008252 0.541132 0.250704 0.199913 0.043796 0.742979 0.120935 0.092289 0.010025 0.008648 0.975678 0.005649 0.007428 0.966351 0.019505 0.006717 0.010822 0.014701 0.964042 0.010434 0.024576 0.018775 0.008113 0.948536 0.020778 0.919524 0.047199 0.012500 0.266669 0.505273 0.108765 0.119293 0.356716 0.394857 0.131104 0.117323 0.232815 0.156340 0.089019 0.521826 0.184954 0.384390 0.161611 0.269045 0.540668 0.077889 0.107860 0.273583 0.289907 0.457100 0.015608 0.237385 0.298336 0.208054 0.418632 0.074978 Consensus sequence: VHYTCCDWCCGCGTCMMTHWHV Alignment: VHYTCCDWCCGCGTCMMTHWHV -----CGCGSGCGCGC------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 4 Motif ID: 83 Motif name: srACyCCGAyr Original motif 0.000000 0.500000 0.500000 0.000000 0.500000 0.000000 0.500000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.000000 0.500000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.000000 0.500000 0.500000 0.000000 0.500000 0.000000 Consensus sequence: SRACYCCGAYR Reserve complement motif 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.500000 0.500000 0.000000 Consensus sequence: KKTCGGKGTKS ************************************************************************ Best Matches for Motif ID 83 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00024 Glis2_primary Reverse Complement Reverse Complement Forward 3 11 0.012991 Species: Mus musculus Original motif 0.135895 0.314811 0.129804 0.419490 0.379294 0.148356 0.125349 0.347001 0.331058 0.171563 0.156431 0.340948 0.238325 0.268940 0.259195 0.233540 0.014812 0.072844 0.774496 0.137848 0.826050 0.107559 0.058965 0.007426 0.013657 0.965452 0.008273 0.012618 0.011951 0.975704 0.007210 0.005135 0.015560 0.961676 0.004028 0.018736 0.010295 0.971668 0.003618 0.014418 0.087168 0.805495 0.002118 0.105220 0.098937 0.760880 0.010017 0.130166 0.492579 0.177017 0.171719 0.158685 0.160142 0.327745 0.192170 0.319943 0.484858 0.086830 0.273852 0.154461 0.266100 0.086868 0.363661 0.283371 Consensus sequence: HHHVGACCCCCCVBRD Reverse complement motif 0.266100 0.363661 0.086868 0.283371 0.154461 0.086830 0.273852 0.484858 0.160142 0.192170 0.327745 0.319943 0.158685 0.177017 0.171719 0.492579 0.098937 0.010017 0.760880 0.130166 0.087168 0.002118 0.805495 0.105220 0.010295 0.003618 0.971668 0.014418 0.015560 0.004028 0.961676 0.018736 0.011951 0.007210 0.975704 0.005135 0.013657 0.008273 0.965452 0.012618 0.007426 0.107559 0.058965 0.826050 0.014812 0.774496 0.072844 0.137848 0.238325 0.259195 0.268940 0.233540 0.340948 0.171563 0.156431 0.331058 0.347001 0.148356 0.125349 0.379294 0.419490 0.314811 0.129804 0.135895 Consensus sequence: HKBBGGGGGGTCVHHH Alignment: HKBBGGGGGGTCVHHH --KKTCGGKGTKS--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00527 Foxn4_secondary Original Motif Original Motif Forward 7 11 0.013032 Species: Mus musculus Original motif 0.298336 0.418632 0.208054 0.074978 0.289907 0.015608 0.457100 0.237385 0.273583 0.077889 0.107860 0.540668 0.184954 0.161611 0.384390 0.269045 0.521826 0.156340 0.089019 0.232815 0.356716 0.131104 0.394857 0.117323 0.266669 0.108765 0.505273 0.119293 0.020778 0.047199 0.919524 0.012500 0.948536 0.018775 0.008113 0.024576 0.010822 0.964042 0.014701 0.010434 0.007428 0.019505 0.966351 0.006717 0.010025 0.975678 0.008648 0.005649 0.043796 0.120935 0.742979 0.092289 0.008252 0.250704 0.541132 0.199913 0.474428 0.044681 0.134430 0.346461 0.146597 0.421317 0.143166 0.288920 0.020540 0.181479 0.553811 0.244170 0.129612 0.173360 0.535219 0.161808 0.506084 0.158156 0.130983 0.204776 0.054872 0.103043 0.545792 0.296293 0.389882 0.171037 0.164162 0.274918 0.225861 0.314031 0.288872 0.171237 Consensus sequence: VDWDARRGACGCGGWHGGAKHV Reverse complement motif 0.225861 0.288872 0.314031 0.171237 0.274918 0.171037 0.164162 0.389882 0.054872 0.545792 0.103043 0.296293 0.204776 0.158156 0.130983 0.506084 0.129612 0.535219 0.173360 0.161808 0.020540 0.553811 0.181479 0.244170 0.146597 0.143166 0.421317 0.288920 0.346461 0.044681 0.134430 0.474428 0.008252 0.541132 0.250704 0.199913 0.043796 0.742979 0.120935 0.092289 0.010025 0.008648 0.975678 0.005649 0.007428 0.966351 0.019505 0.006717 0.010822 0.014701 0.964042 0.010434 0.024576 0.018775 0.008113 0.948536 0.020778 0.919524 0.047199 0.012500 0.266669 0.505273 0.108765 0.119293 0.356716 0.394857 0.131104 0.117323 0.232815 0.156340 0.089019 0.521826 0.184954 0.384390 0.161611 0.269045 0.540668 0.077889 0.107860 0.273583 0.289907 0.457100 0.015608 0.237385 0.298336 0.208054 0.418632 0.074978 Consensus sequence: VHYTCCDWCCGCGTCMMTHWHV Alignment: VDWDARRGACGCGGWHGGAKHV ------SRACYCCGAYR----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00070 Gcm1_secondary Original Motif Reverse Complement Backward 5 11 0.013246 Species: Mus musculus Original motif 0.298360 0.124865 0.240783 0.335992 0.184300 0.174617 0.373392 0.267691 0.150632 0.435099 0.254062 0.160207 0.212569 0.220347 0.370971 0.196113 0.258171 0.316689 0.186896 0.238243 0.872371 0.051703 0.070791 0.005135 0.011560 0.017672 0.009746 0.961022 0.888546 0.042964 0.061758 0.006732 0.071365 0.009982 0.801505 0.117148 0.010657 0.014961 0.949286 0.025096 0.004496 0.009941 0.978381 0.007182 0.005645 0.010294 0.972682 0.011378 0.499895 0.152322 0.335875 0.011908 0.109410 0.346384 0.380529 0.163677 0.371764 0.096182 0.457999 0.074056 0.450207 0.392208 0.065686 0.091898 0.104224 0.228467 0.391473 0.275836 Consensus sequence: DDBVHATAGGGGRBRMB Reverse complement motif 0.104224 0.391473 0.228467 0.275836 0.091898 0.392208 0.065686 0.450207 0.371764 0.457999 0.096182 0.074056 0.109410 0.380529 0.346384 0.163677 0.011908 0.152322 0.335875 0.499895 0.005645 0.972682 0.010294 0.011378 0.004496 0.978381 0.009941 0.007182 0.010657 0.949286 0.014961 0.025096 0.071365 0.801505 0.009982 0.117148 0.006732 0.042964 0.061758 0.888546 0.961022 0.017672 0.009746 0.011560 0.005135 0.051703 0.070791 0.872371 0.258171 0.186896 0.316689 0.238243 0.212569 0.370971 0.220347 0.196113 0.150632 0.254062 0.435099 0.160207 0.184300 0.373392 0.174617 0.267691 0.335992 0.124865 0.240783 0.298360 Consensus sequence: BYMBKCCCCTATDVBHD Alignment: BYMBKCCCCTATDVBHD --SRACYCCGAYR---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00070 Gcm1_primary Original Motif Original Motif Forward 3 11 0.013537 Species: Mus musculus Original motif 0.251681 0.208273 0.178525 0.361520 0.323865 0.334303 0.205542 0.136289 0.308084 0.277004 0.326203 0.088709 0.280609 0.171416 0.168918 0.379057 0.734441 0.031257 0.211473 0.022829 0.006187 0.990281 0.001052 0.002480 0.005819 0.990856 0.001498 0.001826 0.043838 0.936502 0.001550 0.018110 0.022607 0.058037 0.901005 0.018350 0.000424 0.787011 0.026547 0.186017 0.980774 0.002884 0.011288 0.005054 0.009100 0.110310 0.067399 0.813192 0.247510 0.310539 0.250093 0.191858 0.279511 0.211998 0.250717 0.257774 0.264451 0.270002 0.142606 0.322941 0.227607 0.212076 0.267214 0.293102 Consensus sequence: HVVHACCCGCATVDHD Reverse complement motif 0.293102 0.212076 0.267214 0.227607 0.322941 0.270002 0.142606 0.264451 0.257774 0.211998 0.250717 0.279511 0.247510 0.250093 0.310539 0.191858 0.813192 0.110310 0.067399 0.009100 0.005054 0.002884 0.011288 0.980774 0.000424 0.026547 0.787011 0.186017 0.022607 0.901005 0.058037 0.018350 0.043838 0.001550 0.936502 0.018110 0.005819 0.001498 0.990856 0.001826 0.006187 0.001052 0.990281 0.002480 0.022829 0.031257 0.211473 0.734441 0.379057 0.171416 0.168918 0.280609 0.308084 0.326203 0.277004 0.088709 0.323865 0.205542 0.334303 0.136289 0.361520 0.208273 0.178525 0.251681 Consensus sequence: DHDVATGCGGGTHVVH Alignment: HVVHACCCGCATVDHD --SRACYCCGAYR--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00021 Zfp281_secondary Original Motif Original Motif Forward 4 11 0.013691 Species: Mus musculus Original motif 0.463582 0.061604 0.232850 0.241964 0.128956 0.062321 0.481130 0.327593 0.217730 0.020690 0.453776 0.307803 0.535427 0.042857 0.149994 0.271722 0.222391 0.125415 0.375419 0.276775 0.640877 0.065373 0.223489 0.070261 0.021896 0.962922 0.010999 0.004183 0.033993 0.953699 0.002967 0.009341 0.009096 0.979346 0.006614 0.004944 0.010148 0.971252 0.010228 0.008373 0.019605 0.958973 0.012496 0.008926 0.752208 0.080178 0.046020 0.121594 0.466313 0.149124 0.107403 0.277160 0.177748 0.055516 0.159170 0.607566 0.314879 0.170636 0.187525 0.326960 0.322202 0.105206 0.230803 0.341789 0.284925 0.228846 0.320951 0.165278 Consensus sequence: DKKWDACCCCCAHTDDV Reverse complement motif 0.284925 0.320951 0.228846 0.165278 0.341789 0.105206 0.230803 0.322202 0.326960 0.170636 0.187525 0.314879 0.607566 0.055516 0.159170 0.177748 0.277160 0.149124 0.107403 0.466313 0.121594 0.080178 0.046020 0.752208 0.019605 0.012496 0.958973 0.008926 0.010148 0.010228 0.971252 0.008373 0.009096 0.006614 0.979346 0.004944 0.033993 0.002967 0.953699 0.009341 0.021896 0.010999 0.962922 0.004183 0.070261 0.065373 0.223489 0.640877 0.222391 0.375419 0.125415 0.276775 0.271722 0.042857 0.149994 0.535427 0.217730 0.453776 0.020690 0.307803 0.128956 0.481130 0.062321 0.327593 0.241964 0.061604 0.232850 0.463582 Consensus sequence: VDDAHTGGGGGTHWYYD Alignment: DKKWDACCCCCAHTDDV ---SRACYCCGAYR--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00047 Zbtb7b_primary Reverse Complement Reverse Complement Forward 3 11 0.014609 Species: Mus musculus Original motif 0.346946 0.168959 0.284689 0.199406 0.368623 0.144282 0.255122 0.231973 0.231438 0.167540 0.443911 0.157110 0.048139 0.713513 0.224736 0.013612 0.005943 0.982494 0.009265 0.002298 0.005729 0.990328 0.002017 0.001925 0.012634 0.982154 0.001044 0.004167 0.003906 0.974044 0.002213 0.019837 0.092161 0.786818 0.026401 0.094621 0.372382 0.157921 0.109317 0.360380 0.615307 0.152879 0.040223 0.191591 0.669723 0.112856 0.072817 0.144604 0.433088 0.064050 0.180057 0.322805 0.487027 0.216787 0.092562 0.203624 0.140487 0.242560 0.157093 0.459860 Consensus sequence: DDVCCCCCCHAAWHB Reverse complement motif 0.459860 0.242560 0.157093 0.140487 0.203624 0.216787 0.092562 0.487027 0.322805 0.064050 0.180057 0.433088 0.144604 0.112856 0.072817 0.669723 0.191591 0.152879 0.040223 0.615307 0.360380 0.157921 0.109317 0.372382 0.092161 0.026401 0.786818 0.094621 0.003906 0.002213 0.974044 0.019837 0.012634 0.001044 0.982154 0.004167 0.005729 0.002017 0.990328 0.001925 0.005943 0.009265 0.982494 0.002298 0.048139 0.224736 0.713513 0.013612 0.231438 0.443911 0.167540 0.157110 0.231973 0.144282 0.255122 0.368623 0.199406 0.168959 0.284689 0.346946 Consensus sequence: VHWTTHGGGGGGVDD Alignment: VHWTTHGGGGGGVDD --KKTCGGKGTKS-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00040 Irf5_primary Reverse Complement Reverse Complement Forward 5 11 0.014819 Species: Mus musculus Original motif 0.337548 0.193688 0.194039 0.274725 0.279950 0.185928 0.199501 0.334621 0.357304 0.160203 0.278768 0.203725 0.499782 0.069569 0.166858 0.263790 0.832538 0.022992 0.085287 0.059183 0.144788 0.434769 0.040595 0.379848 0.016035 0.943520 0.003379 0.037067 0.014208 0.001713 0.982579 0.001500 0.985572 0.004274 0.008722 0.001432 0.894404 0.001440 0.007585 0.096571 0.991307 0.002706 0.001993 0.003994 0.011143 0.973529 0.013241 0.002087 0.016468 0.532173 0.009621 0.441739 0.462373 0.120288 0.237126 0.180213 0.392685 0.223865 0.229697 0.153753 Consensus sequence: DDDWAYCGAAACYDV Reverse complement motif 0.153753 0.223865 0.229697 0.392685 0.180213 0.120288 0.237126 0.462373 0.016468 0.009621 0.532173 0.441739 0.011143 0.013241 0.973529 0.002087 0.003994 0.002706 0.001993 0.991307 0.096571 0.001440 0.007585 0.894404 0.001432 0.004274 0.008722 0.985572 0.014208 0.982579 0.001713 0.001500 0.016035 0.003379 0.943520 0.037067 0.144788 0.040595 0.434769 0.379848 0.059183 0.022992 0.085287 0.832538 0.263790 0.069569 0.166858 0.499782 0.203725 0.160203 0.278768 0.357304 0.334621 0.185928 0.199501 0.279950 0.274725 0.193688 0.194039 0.337548 Consensus sequence: BDKGTTTCGKTWDDD Alignment: BDKGTTTCGKTWDDD ----KKTCGGKGTKS ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v015681_primary Original Motif Original Motif Forward 9 11 0.014859 Species: Mus musculus Original motif 0.641428 0.180211 0.044767 0.133594 0.171696 0.262981 0.334148 0.231174 0.129726 0.322735 0.243462 0.304077 0.165713 0.175735 0.256108 0.402445 0.146090 0.171890 0.412753 0.269266 0.212837 0.439192 0.280990 0.066980 0.251088 0.275516 0.374380 0.099015 0.575438 0.079656 0.338201 0.006704 0.005634 0.003422 0.972597 0.018348 0.890447 0.077034 0.031851 0.000668 0.007128 0.986862 0.000496 0.005515 0.001445 0.991564 0.001925 0.005066 0.738761 0.190157 0.026399 0.044684 0.013384 0.983783 0.000896 0.001937 0.068077 0.929549 0.000773 0.001602 0.040830 0.933742 0.005283 0.020145 0.730274 0.029225 0.145689 0.094812 0.165032 0.572838 0.162001 0.100129 0.383584 0.129942 0.429497 0.056977 0.455959 0.071959 0.208204 0.263878 0.134271 0.262985 0.222626 0.380117 0.071193 0.346594 0.346081 0.236132 0.445661 0.405278 0.053901 0.095160 Consensus sequence: ABBBBVVRGACCACCCACRDBBM Reverse complement motif 0.095160 0.405278 0.053901 0.445661 0.071193 0.346081 0.346594 0.236132 0.380117 0.262985 0.222626 0.134271 0.263878 0.071959 0.208204 0.455959 0.383584 0.429497 0.129942 0.056977 0.165032 0.162001 0.572838 0.100129 0.094812 0.029225 0.145689 0.730274 0.040830 0.005283 0.933742 0.020145 0.068077 0.000773 0.929549 0.001602 0.013384 0.000896 0.983783 0.001937 0.044684 0.190157 0.026399 0.738761 0.001445 0.001925 0.991564 0.005066 0.007128 0.000496 0.986862 0.005515 0.000668 0.077034 0.031851 0.890447 0.005634 0.972597 0.003422 0.018348 0.006704 0.079656 0.338201 0.575438 0.251088 0.374380 0.275516 0.099015 0.212837 0.280990 0.439192 0.066980 0.146090 0.412753 0.171890 0.269266 0.402445 0.175735 0.256108 0.165713 0.129726 0.243462 0.322735 0.304077 0.171696 0.334148 0.262981 0.231174 0.133594 0.180211 0.044767 0.641428 Consensus sequence: YBVDMGTGGGTGGTCKVVBVBBT Alignment: ABBBBVVRGACCACCCACRDBBM --------SRACYCCGAYR---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00021 Zfp281_primary Reverse Complement Reverse Complement Backward 5 11 0.015330 Species: Mus musculus Original motif 0.201535 0.165213 0.201324 0.431929 0.136153 0.443451 0.179132 0.241264 0.263149 0.555137 0.067983 0.113731 0.142183 0.737634 0.045722 0.074461 0.044982 0.884112 0.045356 0.025549 0.246434 0.590578 0.022655 0.140333 0.123049 0.591257 0.033072 0.252622 0.018153 0.944742 0.010254 0.026851 0.035459 0.953844 0.003988 0.006709 0.020000 0.954344 0.005966 0.019690 0.015299 0.964390 0.006755 0.013557 0.028565 0.936152 0.011660 0.023623 0.300127 0.517309 0.029700 0.152863 0.159063 0.513443 0.051834 0.275660 0.158172 0.647055 0.133256 0.061516 Consensus sequence: DBCCCCCCCCCCMYC Reverse complement motif 0.158172 0.133256 0.647055 0.061516 0.159063 0.051834 0.513443 0.275660 0.300127 0.029700 0.517309 0.152863 0.028565 0.011660 0.936152 0.023623 0.015299 0.006755 0.964390 0.013557 0.020000 0.005966 0.954344 0.019690 0.035459 0.003988 0.953844 0.006709 0.018153 0.010254 0.944742 0.026851 0.123049 0.033072 0.591257 0.252622 0.246434 0.022655 0.590578 0.140333 0.044982 0.045356 0.884112 0.025549 0.142183 0.045722 0.737634 0.074461 0.263149 0.067983 0.555137 0.113731 0.136153 0.179132 0.443451 0.241264 0.431929 0.165213 0.201324 0.201535 Consensus sequence: GKRGGGGGGGGGGBD Alignment: GKRGGGGGGGGGGBD KKTCGGKGTKS---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v016060_primary Reverse Complement Reverse Complement Backward 10 11 0.015555 Species: Mus musculus Original motif 0.137831 0.118922 0.394177 0.349070 0.190108 0.163633 0.138507 0.507753 0.346002 0.332315 0.228621 0.093063 0.113254 0.287554 0.373285 0.225908 0.272578 0.125402 0.328963 0.273057 0.333973 0.115165 0.194267 0.356595 0.381054 0.086215 0.501679 0.031052 0.002232 0.007405 0.966087 0.024276 0.834741 0.112115 0.052053 0.001091 0.009034 0.983239 0.000766 0.006960 0.002054 0.988103 0.003138 0.006705 0.805772 0.171299 0.008415 0.014515 0.020076 0.976846 0.000894 0.002183 0.079914 0.917273 0.001179 0.001634 0.013983 0.950545 0.004205 0.031267 0.789407 0.039441 0.108645 0.062507 0.055453 0.161271 0.595249 0.188028 0.333424 0.128169 0.373270 0.165136 0.536103 0.109520 0.062980 0.291397 0.346477 0.090909 0.279533 0.283081 0.045892 0.190183 0.584314 0.179611 0.088294 0.406148 0.251647 0.253912 0.202467 0.447159 0.162802 0.187571 Consensus sequence: DTVBDDRGACCACCCAGDWDGBH Reverse complement motif 0.202467 0.162802 0.447159 0.187571 0.088294 0.251647 0.406148 0.253912 0.045892 0.584314 0.190183 0.179611 0.283081 0.090909 0.279533 0.346477 0.291397 0.109520 0.062980 0.536103 0.333424 0.373270 0.128169 0.165136 0.055453 0.595249 0.161271 0.188028 0.062507 0.039441 0.108645 0.789407 0.013983 0.004205 0.950545 0.031267 0.079914 0.001179 0.917273 0.001634 0.020076 0.000894 0.976846 0.002183 0.014515 0.171299 0.008415 0.805772 0.002054 0.003138 0.988103 0.006705 0.009034 0.000766 0.983239 0.006960 0.001091 0.112115 0.052053 0.834741 0.002232 0.966087 0.007405 0.024276 0.381054 0.501679 0.086215 0.031052 0.356595 0.115165 0.194267 0.333973 0.272578 0.328963 0.125402 0.273057 0.113254 0.373285 0.287554 0.225908 0.093063 0.332315 0.228621 0.346002 0.507753 0.163633 0.138507 0.190108 0.137831 0.394177 0.118922 0.349070 Consensus sequence: DBCDWHCTGGGTGGTCMDHBBAH Alignment: DBCDWHCTGGGTGGTCMDHBBAH ---KKTCGGKGTKS--------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 5 Motif ID: 84 Motif name: TFW3 Original motif 0.117363 0.130225 0.654341 0.098071 0.070740 0.929260 0.000000 0.000000 0.779743 0.104502 0.000000 0.115756 0.000000 0.916399 0.083601 0.000000 0.127010 0.000000 0.000000 0.872990 0.000000 0.000000 1.000000 0.000000 Consensus sequence: GCACTG Reserve complement motif 0.000000 1.000000 0.000000 0.000000 0.872990 0.000000 0.000000 0.127010 0.000000 0.083601 0.916399 0.000000 0.115756 0.104502 0.000000 0.779743 0.070740 0.000000 0.929260 0.000000 0.117363 0.654341 0.130225 0.098071 Consensus sequence: CAGTGC ************************************************************************ Best Matches for Motif ID 84 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00031 Zbtb3_primary Reverse Complement Reverse Complement Forward 8 6 0.000000 Species: Mus musculus Original motif 0.401190 0.144405 0.268531 0.185874 0.430224 0.168519 0.221247 0.180011 0.172575 0.268499 0.274136 0.284789 0.150971 0.297110 0.290868 0.261051 0.133421 0.282842 0.434718 0.149019 0.042798 0.941105 0.001785 0.014312 0.890788 0.002551 0.103316 0.003345 0.001887 0.951368 0.043722 0.003023 0.011633 0.002218 0.002269 0.983880 0.003597 0.003728 0.984819 0.007856 0.002946 0.903520 0.072457 0.021077 0.908487 0.057072 0.018256 0.016185 0.076237 0.329864 0.228896 0.365003 0.144926 0.162981 0.177370 0.514722 0.124970 0.327876 0.295814 0.251341 0.144592 0.313887 0.301912 0.239609 0.108463 0.241747 0.350296 0.299494 Consensus sequence: DDBBBCACTGCABTBBB Reverse complement motif 0.108463 0.350296 0.241747 0.299494 0.144592 0.301912 0.313887 0.239609 0.124970 0.295814 0.327876 0.251341 0.514722 0.162981 0.177370 0.144926 0.365003 0.329864 0.228896 0.076237 0.016185 0.057072 0.018256 0.908487 0.002946 0.072457 0.903520 0.021077 0.003597 0.984819 0.003728 0.007856 0.983880 0.002218 0.002269 0.011633 0.001887 0.043722 0.951368 0.003023 0.003345 0.002551 0.103316 0.890788 0.042798 0.001785 0.941105 0.014312 0.133421 0.434718 0.282842 0.149019 0.150971 0.290868 0.297110 0.261051 0.284789 0.268499 0.274136 0.172575 0.180011 0.168519 0.221247 0.430224 0.185874 0.144405 0.268531 0.401190 Consensus sequence: BBBAVTGCAGTGBBVDD Alignment: BBBAVTGCAGTGBBVDD -------CAGTGC---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00095 Zfp691_primary Reverse Complement Original Motif Backward 8 6 0.020963 Species: Mus musculus Original motif 0.099567 0.441928 0.195388 0.263117 0.246130 0.144776 0.333677 0.275418 0.313398 0.260626 0.161738 0.264239 0.441985 0.199975 0.211839 0.146201 0.122299 0.673789 0.078912 0.125000 0.938960 0.009295 0.048527 0.003217 0.003807 0.001797 0.985916 0.008480 0.006543 0.001803 0.001788 0.989866 0.014213 0.000681 0.981108 0.003998 0.005018 0.989568 0.000804 0.004610 0.001371 0.007539 0.002430 0.988659 0.001686 0.992039 0.002898 0.003378 0.516097 0.399155 0.057953 0.026795 0.118858 0.390408 0.146017 0.344717 0.306387 0.166100 0.132122 0.395391 0.388407 0.129054 0.288224 0.194315 0.308085 0.152185 0.160807 0.378924 Consensus sequence: BDHVCAGTGCTCMBHDD Reverse complement motif 0.378924 0.152185 0.160807 0.308085 0.194315 0.129054 0.288224 0.388407 0.395391 0.166100 0.132122 0.306387 0.118858 0.146017 0.390408 0.344717 0.026795 0.399155 0.057953 0.516097 0.001686 0.002898 0.992039 0.003378 0.988659 0.007539 0.002430 0.001371 0.005018 0.000804 0.989568 0.004610 0.014213 0.981108 0.000681 0.003998 0.989866 0.001803 0.001788 0.006543 0.003807 0.985916 0.001797 0.008480 0.003217 0.009295 0.048527 0.938960 0.122299 0.078912 0.673789 0.125000 0.146201 0.199975 0.211839 0.441985 0.264239 0.260626 0.161738 0.313398 0.246130 0.333677 0.144776 0.275418 0.099567 0.195388 0.441928 0.263117 Consensus sequence: DDHBYGAGCACTGBHHB Alignment: BDHVCAGTGCTCMBHDD ----CAGTGC------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00031 Zbtb3_secondary Reverse Complement Reverse Complement Backward 4 6 0.024887 Species: Mus musculus Original motif 0.110412 0.519910 0.162398 0.207280 0.470593 0.172893 0.115202 0.241311 0.467126 0.160175 0.227365 0.145334 0.196112 0.169855 0.079068 0.554965 0.198275 0.671393 0.026094 0.104237 0.793465 0.046739 0.110258 0.049538 0.058204 0.867549 0.045603 0.028645 0.079471 0.027484 0.025248 0.867797 0.032277 0.065893 0.827417 0.074413 0.080553 0.119144 0.585050 0.215253 0.105106 0.470208 0.170921 0.253765 0.690158 0.033925 0.171121 0.104796 0.299543 0.155890 0.362586 0.181981 0.343375 0.213360 0.180067 0.263198 0.364819 0.149053 0.181128 0.305000 0.247818 0.143948 0.217882 0.390352 Consensus sequence: CHVTCACTGGBADHDD Reverse complement motif 0.390352 0.143948 0.217882 0.247818 0.305000 0.149053 0.181128 0.364819 0.263198 0.213360 0.180067 0.343375 0.299543 0.362586 0.155890 0.181981 0.104796 0.033925 0.171121 0.690158 0.105106 0.170921 0.470208 0.253765 0.080553 0.585050 0.119144 0.215253 0.032277 0.827417 0.065893 0.074413 0.867797 0.027484 0.025248 0.079471 0.058204 0.045603 0.867549 0.028645 0.049538 0.046739 0.110258 0.793465 0.198275 0.026094 0.671393 0.104237 0.554965 0.169855 0.079068 0.196112 0.145334 0.160175 0.227365 0.467126 0.241311 0.172893 0.115202 0.470593 0.110412 0.162398 0.519910 0.207280 Consensus sequence: DDHHTBCCAGTGABHG Alignment: DDHHTBCCAGTGABHG -------CAGTGC--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00065 Zfp161_secondary Original Motif Reverse Complement Forward 3 6 0.030317 Species: Mus musculus Original motif 0.142646 0.070072 0.573757 0.213525 0.142215 0.493588 0.067040 0.297157 0.024280 0.923170 0.017567 0.034984 0.015569 0.033118 0.937202 0.014111 0.039447 0.888724 0.020074 0.051755 0.016404 0.008157 0.963367 0.012073 0.063620 0.860169 0.044753 0.031458 0.787911 0.122939 0.024389 0.064761 0.260517 0.103413 0.509585 0.126484 0.203752 0.216621 0.251506 0.328121 0.081075 0.040917 0.820854 0.057154 0.096434 0.760303 0.054942 0.088321 0.266016 0.190184 0.384583 0.159217 0.223960 0.243225 0.228688 0.304127 Consensus sequence: GYCGCGCARBGCVB Reverse complement motif 0.304127 0.243225 0.228688 0.223960 0.266016 0.384583 0.190184 0.159217 0.096434 0.054942 0.760303 0.088321 0.081075 0.820854 0.040917 0.057154 0.328121 0.216621 0.251506 0.203752 0.260517 0.509585 0.103413 0.126484 0.064761 0.122939 0.024389 0.787911 0.063620 0.044753 0.860169 0.031458 0.016404 0.963367 0.008157 0.012073 0.039447 0.020074 0.888724 0.051755 0.015569 0.937202 0.033118 0.014111 0.024280 0.017567 0.923170 0.034984 0.142215 0.067040 0.493588 0.297157 0.142646 0.573757 0.070072 0.213525 Consensus sequence: VVGCVMTGCGCGKC Alignment: VVGCVMTGCGCGKC --GCACTG------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00006 Zic3_secondary Reverse Complement Reverse Complement Backward 3 6 0.042059 Species: Mus musculus Original motif 0.225537 0.223459 0.280507 0.270498 0.332396 0.181810 0.207290 0.278505 0.309873 0.017922 0.386135 0.286070 0.101947 0.871607 0.020267 0.006179 0.541366 0.089100 0.242170 0.127364 0.003307 0.969997 0.002414 0.024283 0.903286 0.021590 0.015872 0.059253 0.039887 0.009732 0.945083 0.005298 0.001704 0.827209 0.006276 0.164810 0.723052 0.003102 0.221051 0.052795 0.011758 0.024398 0.560633 0.403211 0.003656 0.012952 0.939586 0.043807 0.477846 0.270399 0.113113 0.138642 0.225706 0.298505 0.258523 0.217266 0.365251 0.191780 0.197411 0.245557 Consensus sequence: DDDCACAGCAKGHVD Reverse complement motif 0.245557 0.191780 0.197411 0.365251 0.225706 0.258523 0.298505 0.217266 0.138642 0.270399 0.113113 0.477846 0.003656 0.939586 0.012952 0.043807 0.011758 0.560633 0.024398 0.403211 0.052795 0.003102 0.221051 0.723052 0.001704 0.006276 0.827209 0.164810 0.039887 0.945083 0.009732 0.005298 0.059253 0.021590 0.015872 0.903286 0.003307 0.002414 0.969997 0.024283 0.127364 0.089100 0.242170 0.541366 0.101947 0.020267 0.871607 0.006179 0.309873 0.386135 0.017922 0.286070 0.278505 0.181810 0.207290 0.332396 0.225537 0.280507 0.223459 0.270498 Consensus sequence: DVHCYTGCTGTGHDH Alignment: DVHCYTGCTGTGHDH -------CAGTGC-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00102 Zic1_secondary Original Motif Original Motif Forward 3 6 0.049908 Species: Mus musculus Original motif 0.161683 0.405114 0.171743 0.261460 0.259478 0.357988 0.146793 0.235741 0.371334 0.026439 0.283598 0.318630 0.092229 0.883389 0.018758 0.005623 0.419591 0.169874 0.253266 0.157270 0.002985 0.976375 0.002722 0.017918 0.909381 0.021357 0.013299 0.055963 0.039418 0.007014 0.948302 0.005266 0.001711 0.845894 0.005756 0.146640 0.803792 0.003049 0.148687 0.044472 0.015314 0.017153 0.680239 0.287294 0.003793 0.011414 0.937403 0.047390 0.431916 0.266291 0.144154 0.157638 0.269331 0.239338 0.366817 0.124513 0.395873 0.103980 0.214796 0.285351 Consensus sequence: BHDCVCAGCAGGHVD Reverse complement motif 0.285351 0.103980 0.214796 0.395873 0.269331 0.366817 0.239338 0.124513 0.157638 0.266291 0.144154 0.431916 0.003793 0.937403 0.011414 0.047390 0.015314 0.680239 0.017153 0.287294 0.044472 0.003049 0.148687 0.803792 0.001711 0.005756 0.845894 0.146640 0.039418 0.948302 0.007014 0.005266 0.055963 0.021357 0.013299 0.909381 0.002985 0.002722 0.976375 0.017918 0.157270 0.169874 0.253266 0.419591 0.092229 0.018758 0.883389 0.005623 0.318630 0.026439 0.283598 0.371334 0.259478 0.146793 0.357988 0.235741 0.161683 0.171743 0.405114 0.261460 Consensus sequence: DVHCCTGCTGBGDDB Alignment: BHDCVCAGCAGGHVD --GCACTG------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00231 Nkx2-2 Reverse Complement Reverse Complement Forward 8 6 0.050767 Species: Mus musculus Original motif 0.299323 0.258429 0.141957 0.300291 0.267631 0.143882 0.146933 0.441554 0.482614 0.212022 0.233631 0.071733 0.430836 0.073912 0.334439 0.160813 0.124944 0.704331 0.166815 0.003910 0.001941 0.876479 0.000828 0.120752 0.920202 0.005985 0.000456 0.073357 0.023544 0.974093 0.000859 0.001505 0.005010 0.003098 0.001328 0.990564 0.003250 0.198149 0.000490 0.798110 0.134659 0.104976 0.753464 0.006901 0.932490 0.000724 0.006140 0.060646 0.504530 0.106203 0.360995 0.028271 0.673257 0.074893 0.106536 0.145314 0.356324 0.097610 0.230142 0.315924 0.129483 0.188353 0.203623 0.478542 0.289071 0.157675 0.231909 0.321345 Consensus sequence: HDVRCCACTTGARADBD Reverse complement motif 0.321345 0.157675 0.231909 0.289071 0.478542 0.188353 0.203623 0.129483 0.315924 0.097610 0.230142 0.356324 0.145314 0.074893 0.106536 0.673257 0.028271 0.106203 0.360995 0.504530 0.060646 0.000724 0.006140 0.932490 0.134659 0.753464 0.104976 0.006901 0.798110 0.198149 0.000490 0.003250 0.990564 0.003098 0.001328 0.005010 0.023544 0.000859 0.974093 0.001505 0.073357 0.005985 0.000456 0.920202 0.001941 0.000828 0.876479 0.120752 0.124944 0.166815 0.704331 0.003910 0.160813 0.073912 0.334439 0.430836 0.071733 0.212022 0.233631 0.482614 0.441554 0.143882 0.146933 0.267631 0.300291 0.258429 0.141957 0.299323 Consensus sequence: DVDTKTCAAGTGGKBDH Alignment: DVDTKTCAAGTGGKBDH -------CAGTGC---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00107 Nkx2-4 Reverse Complement Reverse Complement Backward 5 6 0.051932 Species: Mus musculus Original motif 0.275794 0.208450 0.159913 0.355844 0.497677 0.116961 0.192392 0.192970 0.631989 0.046840 0.128233 0.192937 0.254344 0.174293 0.398254 0.173109 0.093136 0.758419 0.133433 0.015012 0.006001 0.821576 0.000980 0.171443 0.849518 0.014712 0.000851 0.134919 0.021811 0.974976 0.001053 0.002160 0.003203 0.004826 0.002014 0.989957 0.006614 0.218026 0.000597 0.774763 0.279108 0.177972 0.527161 0.015759 0.886451 0.002536 0.025740 0.085273 0.428825 0.384523 0.148566 0.038086 0.510791 0.162011 0.044233 0.282965 0.225089 0.190300 0.047629 0.536981 0.135904 0.254965 0.051167 0.557964 Consensus sequence: HDAVCCACTTRAMWTT Reverse complement motif 0.557964 0.254965 0.051167 0.135904 0.536981 0.190300 0.047629 0.225089 0.282965 0.162011 0.044233 0.510791 0.038086 0.384523 0.148566 0.428825 0.085273 0.002536 0.025740 0.886451 0.279108 0.527161 0.177972 0.015759 0.774763 0.218026 0.000597 0.006614 0.989957 0.004826 0.002014 0.003203 0.021811 0.001053 0.974976 0.002160 0.134919 0.014712 0.000851 0.849518 0.006001 0.000980 0.821576 0.171443 0.093136 0.133433 0.758419 0.015012 0.254344 0.398254 0.174293 0.173109 0.192937 0.046840 0.128233 0.631989 0.192970 0.116961 0.192392 0.497677 0.355844 0.208450 0.159913 0.275794 Consensus sequence: AAWYTMAAGTGGVTDH Alignment: AAWYTMAAGTGGVTDH ------CAGTGC---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00193 Rhox11_2205.1 Reverse Complement Reverse Complement Forward 9 6 0.053048 Species: Mus musculus Original motif 0.504898 0.140204 0.135418 0.219480 0.282348 0.244881 0.300572 0.172199 0.183939 0.100670 0.384783 0.330608 0.326709 0.269523 0.194043 0.209724 0.142989 0.557393 0.066826 0.232792 0.038356 0.014052 0.932450 0.015142 0.092102 0.778844 0.125082 0.003972 0.010254 0.001252 0.005231 0.983263 0.033486 0.000891 0.947486 0.018137 0.005360 0.007407 0.003729 0.983504 0.603485 0.007179 0.003482 0.385853 0.798026 0.029788 0.032370 0.139816 0.529622 0.100632 0.016507 0.353238 0.243581 0.126094 0.401402 0.228923 0.207484 0.285456 0.353715 0.153346 0.282413 0.188410 0.441463 0.087715 0.422774 0.152965 0.094106 0.330155 Consensus sequence: AVDHCGCTGTWAWDVVW Reverse complement motif 0.330155 0.152965 0.094106 0.422774 0.282413 0.441463 0.188410 0.087715 0.207484 0.353715 0.285456 0.153346 0.243581 0.401402 0.126094 0.228923 0.353238 0.100632 0.016507 0.529622 0.139816 0.029788 0.032370 0.798026 0.385853 0.007179 0.003482 0.603485 0.983504 0.007407 0.003729 0.005360 0.033486 0.947486 0.000891 0.018137 0.983263 0.001252 0.005231 0.010254 0.092102 0.125082 0.778844 0.003972 0.038356 0.932450 0.014052 0.015142 0.142989 0.066826 0.557393 0.232792 0.209724 0.269523 0.194043 0.326709 0.183939 0.384783 0.100670 0.330608 0.282348 0.300572 0.244881 0.172199 0.219480 0.140204 0.135418 0.504898 Consensus sequence: WVVHWTWACAGCGHHVT Alignment: WVVHWTWACAGCGHHVT --------CAGTGC--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00057 Zic2_secondary Original Motif Original Motif Backward 8 6 0.053907 Species: Mus musculus Original motif 0.201522 0.336845 0.183740 0.277892 0.238705 0.354378 0.165332 0.241585 0.350858 0.031427 0.308482 0.309233 0.104423 0.870794 0.018676 0.006107 0.313246 0.259944 0.277570 0.149241 0.003590 0.973377 0.002520 0.020513 0.899716 0.025489 0.015458 0.059336 0.049224 0.006415 0.938214 0.006147 0.002021 0.859631 0.007903 0.130445 0.772818 0.002659 0.187334 0.037190 0.008456 0.015170 0.594695 0.381679 0.004118 0.009188 0.961506 0.025188 0.367151 0.230955 0.204475 0.197419 0.267508 0.193660 0.430070 0.108762 0.444449 0.099127 0.212182 0.244241 Consensus sequence: HHDCVCAGCAKGVVD Reverse complement motif 0.244241 0.099127 0.212182 0.444449 0.267508 0.430070 0.193660 0.108762 0.197419 0.230955 0.204475 0.367151 0.004118 0.961506 0.009188 0.025188 0.008456 0.594695 0.015170 0.381679 0.037190 0.002659 0.187334 0.772818 0.002021 0.007903 0.859631 0.130445 0.049224 0.938214 0.006415 0.006147 0.059336 0.025489 0.015458 0.899716 0.003590 0.002520 0.973377 0.020513 0.149241 0.259944 0.277570 0.313246 0.104423 0.018676 0.870794 0.006107 0.309233 0.031427 0.308482 0.350858 0.238705 0.165332 0.354378 0.241585 0.201522 0.183740 0.336845 0.277892 Consensus sequence: DVBCYTGCTGBGDDD Alignment: HHDCVCAGCAKGVVD --GCACTG------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 5 Motif ID: 85 Motif name: TFW1 Original motif 0.000000 0.000000 0.025000 0.975000 0.000000 0.000000 0.000000 1.000000 0.100000 0.025000 0.825000 0.050000 0.150000 0.625000 0.050000 0.175000 0.175000 0.050000 0.625000 0.150000 0.050000 0.825000 0.025000 0.100000 1.000000 0.000000 0.000000 0.000000 0.975000 0.025000 0.000000 0.000000 Consensus sequence: TTGCGCAA Reserve complement motif 0.000000 0.025000 0.000000 0.975000 0.000000 0.000000 0.000000 1.000000 0.050000 0.025000 0.825000 0.100000 0.175000 0.625000 0.050000 0.150000 0.150000 0.050000 0.625000 0.175000 0.100000 0.825000 0.025000 0.050000 1.000000 0.000000 0.000000 0.000000 0.975000 0.000000 0.025000 0.000000 Consensus sequence: TTGCGCAA ************************************************************************ Best Matches for Motif ID 85 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00045 Mafb_secondary Original Motif Reverse Complement Forward 5 8 0.009570 Species: Mus musculus Original motif 0.252282 0.327541 0.191496 0.228681 0.414891 0.181997 0.235538 0.167574 0.369812 0.192315 0.212893 0.224980 0.081917 0.107880 0.138544 0.671658 0.047759 0.100595 0.120673 0.730973 0.047381 0.062772 0.828041 0.061806 0.072158 0.761630 0.036201 0.130011 0.864499 0.033229 0.075644 0.026628 0.582375 0.061546 0.165161 0.190919 0.759130 0.069223 0.042608 0.129039 0.876128 0.026080 0.044094 0.053698 0.591029 0.038029 0.042683 0.328259 0.386455 0.121389 0.078693 0.413463 0.325396 0.158893 0.282102 0.233609 0.218806 0.187059 0.151824 0.442312 Consensus sequence: HVDTTGCAAAAWWDH Reverse complement motif 0.442312 0.187059 0.151824 0.218806 0.233609 0.158893 0.282102 0.325396 0.413463 0.121389 0.078693 0.386455 0.328259 0.038029 0.042683 0.591029 0.053698 0.026080 0.044094 0.876128 0.129039 0.069223 0.042608 0.759130 0.190919 0.061546 0.165161 0.582375 0.026628 0.033229 0.075644 0.864499 0.072158 0.036201 0.761630 0.130011 0.047381 0.828041 0.062772 0.061806 0.730973 0.100595 0.120673 0.047759 0.671658 0.107880 0.138544 0.081917 0.224980 0.192315 0.212893 0.369812 0.167574 0.181997 0.235538 0.414891 0.252282 0.191496 0.327541 0.228681 Consensus sequence: HDWWTTTTGCAADBD Alignment: HDWWTTTTGCAADBD ----TTGCGCAA--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00097 Mtf1_primary Original Motif Original Motif Backward 4 8 0.018462 Species: Mus musculus Original motif 0.220880 0.102939 0.418146 0.258035 0.154303 0.210788 0.420671 0.214238 0.229141 0.160788 0.412818 0.197253 0.167193 0.404248 0.092489 0.336070 0.025978 0.931335 0.023830 0.018857 0.009150 0.002023 0.977342 0.011485 0.044768 0.024113 0.039091 0.892028 0.007577 0.008370 0.973767 0.010286 0.005251 0.264996 0.004018 0.725735 0.009165 0.002428 0.980566 0.007841 0.021296 0.956027 0.008893 0.013784 0.982532 0.003341 0.005773 0.008353 0.500983 0.226027 0.143944 0.129045 0.544466 0.285936 0.044719 0.124879 0.321158 0.168428 0.261827 0.248587 0.271460 0.263221 0.199083 0.266236 Consensus sequence: DBDHCGTGTGCAAMDH Reverse complement motif 0.266236 0.263221 0.199083 0.271460 0.248587 0.168428 0.261827 0.321158 0.124879 0.285936 0.044719 0.544466 0.129045 0.226027 0.143944 0.500983 0.008353 0.003341 0.005773 0.982532 0.021296 0.008893 0.956027 0.013784 0.009165 0.980566 0.002428 0.007841 0.725735 0.264996 0.004018 0.005251 0.007577 0.973767 0.008370 0.010286 0.892028 0.024113 0.039091 0.044768 0.009150 0.977342 0.002023 0.011485 0.025978 0.023830 0.931335 0.018857 0.167193 0.092489 0.404248 0.336070 0.229141 0.412818 0.160788 0.197253 0.154303 0.420671 0.210788 0.214238 0.220880 0.418146 0.102939 0.258035 Consensus sequence: HDYTTGCACACGDHBH Alignment: DBDHCGTGTGCAAMDH -----TTGCGCAA--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00259 Hoxb6 Original Motif Original Motif Backward 8 8 0.022600 Species: Mus musculus Original motif 0.285750 0.141861 0.055341 0.517047 0.548840 0.096589 0.075248 0.279324 0.181874 0.041138 0.180661 0.596326 0.176788 0.096024 0.346904 0.380283 0.171188 0.295681 0.330641 0.202489 0.074696 0.111978 0.671994 0.141332 0.022223 0.197771 0.015214 0.764793 0.833470 0.118870 0.018756 0.028904 0.953513 0.012047 0.011588 0.022853 0.022853 0.011588 0.012047 0.953513 0.028904 0.018756 0.118870 0.833470 0.764793 0.015214 0.197771 0.022223 0.112355 0.737510 0.058135 0.092001 0.202489 0.330641 0.295681 0.171188 0.257218 0.134472 0.290939 0.317371 0.178633 0.246536 0.240081 0.334751 Consensus sequence: WWTDBGTAATTACVDB Reverse complement motif 0.334751 0.246536 0.240081 0.178633 0.317371 0.134472 0.290939 0.257218 0.202489 0.295681 0.330641 0.171188 0.112355 0.058135 0.737510 0.092001 0.022223 0.015214 0.197771 0.764793 0.833470 0.018756 0.118870 0.028904 0.953513 0.011588 0.012047 0.022853 0.022853 0.012047 0.011588 0.953513 0.028904 0.118870 0.018756 0.833470 0.764793 0.197771 0.015214 0.022223 0.074696 0.671994 0.111978 0.141332 0.171188 0.330641 0.295681 0.202489 0.380283 0.096024 0.346904 0.176788 0.596326 0.041138 0.180661 0.181874 0.279324 0.096589 0.075248 0.548840 0.517047 0.141861 0.055341 0.285750 Consensus sequence: VDVGTAATTACBDAWW Alignment: WWTDBGTAATTACVDB -TTGCGCAA------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00528 Foxm1_secondary Original Motif Reverse Complement Forward 6 8 0.023996 Species: Mus musculus Original motif 0.399785 0.446658 0.111435 0.042122 0.535175 0.103991 0.089706 0.271128 0.078171 0.387987 0.375083 0.158759 0.309001 0.519142 0.070618 0.101239 0.201844 0.255818 0.323149 0.219190 0.534101 0.109845 0.235026 0.121028 0.656038 0.037473 0.261484 0.045006 0.315713 0.164290 0.471815 0.048182 0.651960 0.009412 0.328237 0.010391 0.937365 0.017313 0.007516 0.037807 0.019983 0.044238 0.012387 0.923392 0.061195 0.021485 0.881645 0.035675 0.017521 0.952998 0.013139 0.016342 0.254160 0.029735 0.493023 0.223082 0.239200 0.593324 0.114503 0.052973 0.610822 0.071539 0.099169 0.218470 0.166610 0.389712 0.204400 0.239278 0.227752 0.361626 0.178497 0.232125 0.537030 0.182466 0.026035 0.254470 0.235902 0.151006 0.043788 0.569304 0.081851 0.250397 0.590059 0.077693 0.340417 0.189613 0.272075 0.197895 Consensus sequence: MWSMBAARRATGCDCABHATGD Reverse complement motif 0.197895 0.189613 0.272075 0.340417 0.081851 0.590059 0.250397 0.077693 0.569304 0.151006 0.043788 0.235902 0.254470 0.182466 0.026035 0.537030 0.227752 0.178497 0.361626 0.232125 0.166610 0.204400 0.389712 0.239278 0.218470 0.071539 0.099169 0.610822 0.239200 0.114503 0.593324 0.052973 0.254160 0.493023 0.029735 0.223082 0.017521 0.013139 0.952998 0.016342 0.061195 0.881645 0.021485 0.035675 0.923392 0.044238 0.012387 0.019983 0.037807 0.017313 0.007516 0.937365 0.010391 0.009412 0.328237 0.651960 0.315713 0.471815 0.164290 0.048182 0.045006 0.037473 0.261484 0.656038 0.121028 0.109845 0.235026 0.534101 0.201844 0.323149 0.255818 0.219190 0.309001 0.070618 0.519142 0.101239 0.078171 0.375083 0.387987 0.158759 0.271128 0.103991 0.089706 0.535175 0.399785 0.111435 0.446658 0.042122 Consensus sequence: DCATDBTGHGCATKMTTBRSWR Alignment: DCATDBTGHGCATKMTTBRSWR -----TTGCGCAA--------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00035 Hic1_secondary Reverse Complement Reverse Complement Backward 5 8 0.026147 Species: Mus musculus Original motif 0.204898 0.149951 0.363373 0.281778 0.112946 0.243700 0.437938 0.205417 0.205232 0.182319 0.383143 0.229305 0.242063 0.152491 0.296426 0.309020 0.312922 0.028523 0.585026 0.073529 0.006754 0.011178 0.005346 0.976723 0.127589 0.005562 0.859436 0.007414 0.010046 0.974694 0.007001 0.008259 0.010262 0.974769 0.006069 0.008899 0.015122 0.966101 0.007970 0.010807 0.556511 0.167389 0.114635 0.161465 0.586459 0.044786 0.073450 0.295305 0.297710 0.194666 0.223655 0.283969 0.303202 0.250809 0.206475 0.239514 0.279338 0.160655 0.314457 0.245550 0.266477 0.266890 0.299970 0.166662 Consensus sequence: DBDDRTGCCCAWDHDV Reverse complement motif 0.266477 0.299970 0.266890 0.166662 0.279338 0.314457 0.160655 0.245550 0.239514 0.250809 0.206475 0.303202 0.283969 0.194666 0.223655 0.297710 0.295305 0.044786 0.073450 0.586459 0.161465 0.167389 0.114635 0.556511 0.015122 0.007970 0.966101 0.010807 0.010262 0.006069 0.974769 0.008899 0.010046 0.007001 0.974694 0.008259 0.127589 0.859436 0.005562 0.007414 0.976723 0.011178 0.005346 0.006754 0.312922 0.585026 0.028523 0.073529 0.309020 0.152491 0.296426 0.242063 0.205232 0.383143 0.182319 0.229305 0.112946 0.437938 0.243700 0.205417 0.204898 0.363373 0.149951 0.281778 Consensus sequence: VHHDWTGGGCAMDHBH Alignment: VHHDWTGGGCAMDHBH ----TTGCGCAA---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00004 Sox14_secondary Original Motif Original Motif Forward 2 8 0.027231 Species: Mus musculus Original motif 0.191264 0.345487 0.212142 0.251106 0.105033 0.130838 0.338939 0.425191 0.126539 0.333031 0.233364 0.307066 0.641901 0.114039 0.195933 0.048127 0.153349 0.532437 0.272427 0.041786 0.934680 0.009395 0.019668 0.036257 0.013611 0.927298 0.037729 0.021361 0.964293 0.018416 0.006724 0.010568 0.962181 0.018004 0.014592 0.005223 0.229593 0.016301 0.007632 0.746474 0.268456 0.030092 0.519349 0.182102 0.201484 0.107350 0.588833 0.102334 0.253726 0.259057 0.242924 0.244293 0.168663 0.203061 0.347898 0.280378 0.175853 0.339716 0.301724 0.182707 Consensus sequence: BKBASACAATRGHBB Reverse complement motif 0.175853 0.301724 0.339716 0.182707 0.168663 0.347898 0.203061 0.280378 0.253726 0.242924 0.259057 0.244293 0.201484 0.588833 0.107350 0.102334 0.268456 0.519349 0.030092 0.182102 0.746474 0.016301 0.007632 0.229593 0.005223 0.018004 0.014592 0.962181 0.010568 0.018416 0.006724 0.964293 0.013611 0.037729 0.927298 0.021361 0.036257 0.009395 0.019668 0.934680 0.153349 0.272427 0.532437 0.041786 0.048127 0.114039 0.195933 0.641901 0.126539 0.233364 0.333031 0.307066 0.425191 0.130838 0.338939 0.105033 0.191264 0.212142 0.345487 0.251106 Consensus sequence: BBDCMATTGTSTBRB Alignment: BKBASACAATRGHBB -TTGCGCAA------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00055 Hbp1_secondary Original Motif Reverse Complement Backward 9 8 0.027878 Species: Mus musculus Original motif 0.313621 0.149049 0.200899 0.336432 0.262644 0.147616 0.334882 0.254859 0.175848 0.137857 0.292272 0.394023 0.045910 0.364107 0.180535 0.409448 0.093235 0.718630 0.093516 0.094619 0.095552 0.724866 0.044589 0.134993 0.058227 0.785149 0.029814 0.126810 0.897368 0.023735 0.019064 0.059832 0.043826 0.041750 0.020731 0.893692 0.044268 0.013557 0.014689 0.927487 0.102208 0.026005 0.709573 0.162214 0.058404 0.046118 0.135257 0.760221 0.303689 0.280676 0.320259 0.095375 0.258633 0.262177 0.197029 0.282161 0.564761 0.122466 0.194691 0.118082 0.104738 0.358061 0.310533 0.226668 0.267450 0.230099 0.197859 0.304593 Consensus sequence: DDDYCCCATTGTVHABH Reverse complement motif 0.304593 0.230099 0.197859 0.267450 0.104738 0.310533 0.358061 0.226668 0.118082 0.122466 0.194691 0.564761 0.282161 0.262177 0.197029 0.258633 0.303689 0.320259 0.280676 0.095375 0.760221 0.046118 0.135257 0.058404 0.102208 0.709573 0.026005 0.162214 0.927487 0.013557 0.014689 0.044268 0.893692 0.041750 0.020731 0.043826 0.059832 0.023735 0.019064 0.897368 0.058227 0.029814 0.785149 0.126810 0.095552 0.044589 0.724866 0.134993 0.093235 0.093516 0.718630 0.094619 0.409448 0.364107 0.180535 0.045910 0.394023 0.137857 0.292272 0.175848 0.262644 0.334882 0.147616 0.254859 0.336432 0.149049 0.200899 0.313621 Consensus sequence: HBTHVACAATGGGMDHD Alignment: HBTHVACAATGGGMDHD -TTGCGCAA-------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00138 Bsx Original Motif Original Motif Forward 8 8 0.028162 Species: Mus musculus Original motif 0.300810 0.361653 0.277518 0.060019 0.415580 0.269576 0.248677 0.066167 0.276307 0.071112 0.495444 0.157137 0.205201 0.128060 0.449377 0.217362 0.005975 0.454761 0.000446 0.538819 0.923080 0.052108 0.022468 0.002344 0.980320 0.011144 0.004548 0.003988 0.003988 0.004548 0.011144 0.980320 0.002344 0.022468 0.052108 0.923080 0.538819 0.000446 0.454761 0.005975 0.198577 0.320840 0.276798 0.203784 0.157137 0.495444 0.071112 0.276307 0.138722 0.188316 0.180010 0.492952 0.211637 0.368966 0.311498 0.107899 0.746067 0.051554 0.127512 0.074866 0.287674 0.124689 0.315447 0.272190 Consensus sequence: VVRDYAATTRBYBVAD Reverse complement motif 0.287674 0.315447 0.124689 0.272190 0.074866 0.051554 0.127512 0.746067 0.211637 0.311498 0.368966 0.107899 0.492952 0.188316 0.180010 0.138722 0.157137 0.071112 0.495444 0.276307 0.198577 0.276798 0.320840 0.203784 0.005975 0.000446 0.454761 0.538819 0.923080 0.022468 0.052108 0.002344 0.980320 0.004548 0.011144 0.003988 0.003988 0.011144 0.004548 0.980320 0.002344 0.052108 0.022468 0.923080 0.538819 0.454761 0.000446 0.005975 0.205201 0.449377 0.128060 0.217362 0.276307 0.495444 0.071112 0.157137 0.066167 0.269576 0.248677 0.415580 0.300810 0.277518 0.361653 0.060019 Consensus sequence: HTVVKBKAATTMHMBV Alignment: VVRDYAATTRBYBVAD -------TTGCGCAA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00126 Dlx2 Original Motif Original Motif Backward 2 8 0.030109 Species: Mus musculus Original motif 0.325237 0.286661 0.343859 0.044243 0.268070 0.236142 0.380964 0.114824 0.314889 0.078265 0.310443 0.296403 0.488521 0.091236 0.312895 0.107348 0.011042 0.293634 0.000384 0.694940 0.974839 0.008852 0.008637 0.007673 0.979637 0.003933 0.001610 0.014820 0.014820 0.001610 0.003933 0.979637 0.007673 0.008637 0.008852 0.974839 0.694940 0.000384 0.293634 0.011042 0.081356 0.369572 0.282530 0.266541 0.296403 0.310443 0.078265 0.314889 0.177909 0.317594 0.080845 0.423652 0.254519 0.435683 0.118544 0.191255 0.618085 0.106442 0.153195 0.122279 0.172720 0.190763 0.450827 0.185690 Consensus sequence: VVDRTAATTABHHHAB Reverse complement motif 0.172720 0.450827 0.190763 0.185690 0.122279 0.106442 0.153195 0.618085 0.254519 0.118544 0.435683 0.191255 0.423652 0.317594 0.080845 0.177909 0.314889 0.310443 0.078265 0.296403 0.081356 0.282530 0.369572 0.266541 0.011042 0.000384 0.293634 0.694940 0.974839 0.008637 0.008852 0.007673 0.979637 0.001610 0.003933 0.014820 0.014820 0.003933 0.001610 0.979637 0.007673 0.008852 0.008637 0.974839 0.694940 0.293634 0.000384 0.011042 0.107348 0.091236 0.312895 0.488521 0.296403 0.078265 0.310443 0.314889 0.268070 0.380964 0.236142 0.114824 0.325237 0.343859 0.286661 0.044243 Consensus sequence: BTDHHBTAATTAKDVV Alignment: VVDRTAATTABHHHAB -------TTGCGCAA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00182 Hoxa6 Original Motif Original Motif Backward 2 8 0.030852 Species: Mus musculus Original motif 0.583501 0.146680 0.197544 0.072276 0.427857 0.353560 0.089642 0.128941 0.195697 0.096442 0.593720 0.114140 0.189276 0.048267 0.483269 0.279188 0.005990 0.090620 0.000813 0.902576 0.949399 0.035300 0.001844 0.013457 0.984085 0.006313 0.001863 0.007739 0.007739 0.001863 0.006313 0.984085 0.013457 0.001844 0.035300 0.949399 0.902576 0.000813 0.090620 0.005990 0.152255 0.677055 0.087732 0.082958 0.114140 0.593720 0.096442 0.195697 0.234649 0.271494 0.063511 0.430347 0.334155 0.324603 0.120490 0.220751 0.602114 0.075922 0.081032 0.240932 0.219592 0.167291 0.277257 0.335860 Consensus sequence: AMGKTAATTACCHHAD Reverse complement motif 0.335860 0.167291 0.277257 0.219592 0.240932 0.075922 0.081032 0.602114 0.220751 0.324603 0.120490 0.334155 0.430347 0.271494 0.063511 0.234649 0.114140 0.096442 0.593720 0.195697 0.152255 0.087732 0.677055 0.082958 0.005990 0.000813 0.090620 0.902576 0.949399 0.001844 0.035300 0.013457 0.984085 0.001863 0.006313 0.007739 0.007739 0.006313 0.001863 0.984085 0.013457 0.035300 0.001844 0.949399 0.902576 0.090620 0.000813 0.005990 0.189276 0.483269 0.048267 0.279188 0.195697 0.593720 0.096442 0.114140 0.128941 0.353560 0.089642 0.427857 0.072276 0.146680 0.197544 0.583501 Consensus sequence: DTHHGGTAATTAYCYT Alignment: AMGKTAATTACCHHAD -------TTGCGCAA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 5 Motif ID: 86 Motif name: TFW2 Original motif 0.222222 0.444444 0.000000 0.333333 0.000000 0.000000 0.888889 0.111111 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.111111 0.000000 0.888889 0.888889 0.000000 0.111111 0.000000 0.222222 0.666667 0.111111 0.000000 0.000000 0.333333 0.666667 0.000000 Consensus sequence: YGGACTTACG Reserve complement motif 0.000000 0.666667 0.333333 0.000000 0.222222 0.111111 0.666667 0.000000 0.000000 0.000000 0.111111 0.888889 0.888889 0.111111 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.888889 0.000000 0.111111 0.222222 0.000000 0.444444 0.333333 Consensus sequence: CGTAAGTCCK ************************************************************************ Best Matches for Motif ID 86 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00066 Hnf4a_secondary Original Motif Reverse Complement Forward 5 10 0.000000 Species: Mus musculus Original motif 0.131680 0.169949 0.346277 0.352094 0.109910 0.144258 0.373681 0.372151 0.196671 0.411335 0.159689 0.232305 0.311086 0.307077 0.122332 0.259505 0.895155 0.013238 0.038874 0.052733 0.779629 0.018399 0.171269 0.030703 0.950546 0.002649 0.041825 0.004980 0.004769 0.002646 0.985847 0.006739 0.004458 0.002117 0.012011 0.981414 0.016789 0.969626 0.003890 0.009695 0.002468 0.982852 0.004754 0.009926 0.891448 0.003193 0.097548 0.007811 0.513330 0.308971 0.070467 0.107232 0.179371 0.115514 0.130898 0.574217 0.285826 0.277536 0.166982 0.269655 0.319407 0.227783 0.129020 0.323790 Consensus sequence: BBHHAAAGTCCAMTHH Reverse complement motif 0.323790 0.227783 0.129020 0.319407 0.269655 0.277536 0.166982 0.285826 0.574217 0.115514 0.130898 0.179371 0.107232 0.308971 0.070467 0.513330 0.007811 0.003193 0.097548 0.891448 0.002468 0.004754 0.982852 0.009926 0.016789 0.003890 0.969626 0.009695 0.981414 0.002117 0.012011 0.004458 0.004769 0.985847 0.002646 0.006739 0.004980 0.002649 0.041825 0.950546 0.030703 0.018399 0.171269 0.779629 0.052733 0.013238 0.038874 0.895155 0.259505 0.307077 0.122332 0.311086 0.196671 0.159689 0.411335 0.232305 0.109910 0.373681 0.144258 0.372151 0.352094 0.169949 0.346277 0.131680 Consensus sequence: HHAYTGGACTTTHDBV Alignment: HHAYTGGACTTTHDBV ----YGGACTTACG-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00259 Hoxb6 Original Motif Reverse Complement Backward 5 10 0.013327 Species: Mus musculus Original motif 0.285750 0.141861 0.055341 0.517047 0.548840 0.096589 0.075248 0.279324 0.181874 0.041138 0.180661 0.596326 0.176788 0.096024 0.346904 0.380283 0.171188 0.295681 0.330641 0.202489 0.074696 0.111978 0.671994 0.141332 0.022223 0.197771 0.015214 0.764793 0.833470 0.118870 0.018756 0.028904 0.953513 0.012047 0.011588 0.022853 0.022853 0.011588 0.012047 0.953513 0.028904 0.018756 0.118870 0.833470 0.764793 0.015214 0.197771 0.022223 0.112355 0.737510 0.058135 0.092001 0.202489 0.330641 0.295681 0.171188 0.257218 0.134472 0.290939 0.317371 0.178633 0.246536 0.240081 0.334751 Consensus sequence: WWTDBGTAATTACVDB Reverse complement motif 0.334751 0.246536 0.240081 0.178633 0.317371 0.134472 0.290939 0.257218 0.202489 0.295681 0.330641 0.171188 0.112355 0.058135 0.737510 0.092001 0.022223 0.015214 0.197771 0.764793 0.833470 0.018756 0.118870 0.028904 0.953513 0.011588 0.012047 0.022853 0.022853 0.012047 0.011588 0.953513 0.028904 0.118870 0.018756 0.833470 0.764793 0.197771 0.015214 0.022223 0.074696 0.671994 0.111978 0.141332 0.171188 0.330641 0.295681 0.202489 0.380283 0.096024 0.346904 0.176788 0.596326 0.041138 0.180661 0.181874 0.279324 0.096589 0.075248 0.548840 0.517047 0.141861 0.055341 0.285750 Consensus sequence: VDVGTAATTACBDAWW Alignment: VDVGTAATTACBDAWW --YGGACTTACG---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00228 Bapx1 Reverse Complement Reverse Complement Backward 5 10 0.014535 Species: Mus musculus Original motif 0.301697 0.347856 0.239075 0.111372 0.364458 0.225587 0.074842 0.335112 0.228472 0.141747 0.139010 0.490770 0.559532 0.164793 0.197557 0.078118 0.506611 0.130882 0.113226 0.249281 0.054222 0.680706 0.257913 0.007160 0.001978 0.899030 0.000622 0.098369 0.950561 0.002121 0.000888 0.046429 0.037529 0.960534 0.000660 0.001278 0.001571 0.005538 0.001403 0.991487 0.001274 0.052527 0.000520 0.945679 0.926306 0.006886 0.003823 0.062985 0.638246 0.038639 0.145042 0.178072 0.266452 0.337698 0.283972 0.111878 0.307019 0.250170 0.243307 0.199504 0.550380 0.190997 0.122920 0.135703 0.187982 0.330356 0.168897 0.312765 Consensus sequence: VHHAACCACTTAAVVAH Reverse complement motif 0.187982 0.168897 0.330356 0.312765 0.135703 0.190997 0.122920 0.550380 0.199504 0.250170 0.243307 0.307019 0.266452 0.283972 0.337698 0.111878 0.178072 0.038639 0.145042 0.638246 0.062985 0.006886 0.003823 0.926306 0.945679 0.052527 0.000520 0.001274 0.991487 0.005538 0.001403 0.001571 0.037529 0.000660 0.960534 0.001278 0.046429 0.002121 0.000888 0.950561 0.001978 0.000622 0.899030 0.098369 0.054222 0.257913 0.680706 0.007160 0.249281 0.130882 0.113226 0.506611 0.078118 0.164793 0.197557 0.559532 0.490770 0.141747 0.139010 0.228472 0.335112 0.225587 0.074842 0.364458 0.301697 0.239075 0.347856 0.111372 Consensus sequence: DTBVTTAAGTGGTTHHV Alignment: DTBVTTAAGTGGTTHHV ---CGTAAGTCCK---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00190 Nkx2-3 Reverse Complement Reverse Complement Backward 6 10 0.016742 Species: Mus musculus Original motif 0.112665 0.429746 0.074033 0.383556 0.100414 0.366064 0.135644 0.397877 0.083598 0.139792 0.093637 0.682973 0.157091 0.151456 0.101963 0.589490 0.804069 0.003353 0.166845 0.025733 0.880173 0.006767 0.091214 0.021845 0.009561 0.018555 0.963617 0.008268 0.001409 0.250669 0.002497 0.745425 0.745425 0.002497 0.250669 0.001409 0.008268 0.963617 0.018555 0.009561 0.021845 0.091214 0.006767 0.880173 0.025733 0.166845 0.003353 0.804069 0.534325 0.173500 0.200024 0.092151 0.581546 0.078557 0.226846 0.113051 0.210085 0.208523 0.190951 0.390441 0.231700 0.168938 0.404360 0.195002 Consensus sequence: YYTTAAGTACTTAAHD Reverse complement motif 0.231700 0.404360 0.168938 0.195002 0.390441 0.208523 0.190951 0.210085 0.113051 0.078557 0.226846 0.581546 0.092151 0.173500 0.200024 0.534325 0.804069 0.166845 0.003353 0.025733 0.880173 0.091214 0.006767 0.021845 0.008268 0.018555 0.963617 0.009561 0.001409 0.002497 0.250669 0.745425 0.745425 0.250669 0.002497 0.001409 0.009561 0.963617 0.018555 0.008268 0.021845 0.006767 0.091214 0.880173 0.025733 0.003353 0.166845 0.804069 0.589490 0.151456 0.101963 0.157091 0.682973 0.139792 0.093637 0.083598 0.397877 0.366064 0.135644 0.100414 0.112665 0.074033 0.429746 0.383556 Consensus sequence: HHTTAAGTACTTAAMK Alignment: HHTTAAGTACTTAAMK -CGTAAGTCCK----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00389 Nkx3-1 Reverse Complement Reverse Complement Forward 3 10 0.020167 Species: Mus musculus Original motif 0.230343 0.129202 0.214468 0.425986 0.359358 0.121340 0.162570 0.356732 0.227575 0.345211 0.162386 0.264827 0.285383 0.076814 0.227804 0.409998 0.760754 0.004039 0.216886 0.018321 0.850903 0.006399 0.121474 0.021224 0.007291 0.042579 0.943324 0.006806 0.001583 0.137946 0.005502 0.854969 0.854969 0.005502 0.137946 0.001583 0.006806 0.943324 0.042579 0.007291 0.021224 0.121474 0.006399 0.850903 0.018321 0.216886 0.004039 0.760754 0.691606 0.099604 0.051045 0.157745 0.629431 0.051419 0.224807 0.094342 0.570121 0.143534 0.137491 0.148853 0.303064 0.084741 0.174009 0.438186 0.202801 0.252788 0.303231 0.241180 Consensus sequence: DDHDAAGTACTTAAADB Reverse complement motif 0.202801 0.303231 0.252788 0.241180 0.438186 0.084741 0.174009 0.303064 0.148853 0.143534 0.137491 0.570121 0.094342 0.051419 0.224807 0.629431 0.157745 0.099604 0.051045 0.691606 0.760754 0.216886 0.004039 0.018321 0.850903 0.121474 0.006399 0.021224 0.006806 0.042579 0.943324 0.007291 0.001583 0.005502 0.137946 0.854969 0.854969 0.137946 0.005502 0.001583 0.007291 0.943324 0.042579 0.006806 0.021224 0.006399 0.121474 0.850903 0.018321 0.004039 0.216886 0.760754 0.409998 0.076814 0.227804 0.285383 0.227575 0.162386 0.345211 0.264827 0.356732 0.121340 0.162570 0.359358 0.425986 0.129202 0.214468 0.230343 Consensus sequence: BDTTTAAGTACTTDDDD Alignment: BDTTTAAGTACTTDDDD --CGTAAGTCCK----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00418 Etv6 Original Motif Reverse Complement Forward 6 10 0.020661 Species: Mus musculus Original motif 0.354972 0.069107 0.299350 0.276571 0.209701 0.408003 0.227382 0.154914 0.284336 0.375266 0.162604 0.177794 0.176569 0.181438 0.342172 0.299820 0.106551 0.204378 0.060299 0.628772 0.884088 0.003252 0.103113 0.009546 0.001110 0.704391 0.006294 0.288205 0.014992 0.000892 0.001401 0.982714 0.004842 0.001887 0.002470 0.990801 0.002724 0.992864 0.002206 0.002206 0.001792 0.991200 0.001615 0.005393 0.005151 0.010157 0.940259 0.044433 0.017780 0.199839 0.761921 0.020459 0.230834 0.269936 0.119652 0.379577 0.233019 0.093692 0.034743 0.638546 0.194739 0.181763 0.175340 0.448159 0.145452 0.293709 0.335917 0.224922 Consensus sequence: DVHBTACTTCCGGHTHB Reverse complement motif 0.145452 0.335917 0.293709 0.224922 0.448159 0.181763 0.175340 0.194739 0.638546 0.093692 0.034743 0.233019 0.379577 0.269936 0.119652 0.230834 0.017780 0.761921 0.199839 0.020459 0.005151 0.940259 0.010157 0.044433 0.001792 0.001615 0.991200 0.005393 0.002724 0.002206 0.992864 0.002206 0.990801 0.001887 0.002470 0.004842 0.982714 0.000892 0.001401 0.014992 0.001110 0.006294 0.704391 0.288205 0.009546 0.003252 0.103113 0.884088 0.628772 0.204378 0.060299 0.106551 0.176569 0.342172 0.181438 0.299820 0.284336 0.162604 0.375266 0.177794 0.209701 0.227382 0.408003 0.154914 0.276571 0.069107 0.299350 0.354972 Consensus sequence: BHAHCCGGAAGTABDVD Alignment: BHAHCCGGAAGTABDVD -----YGGACTTACG-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00112 Gsc Original Motif Reverse Complement Backward 4 10 0.020843 Species: Mus musculus Original motif 0.471765 0.155805 0.130216 0.242214 0.336226 0.217033 0.236748 0.209992 0.397939 0.127567 0.045155 0.429339 0.262638 0.456883 0.100119 0.180360 0.277939 0.114100 0.520395 0.087567 0.069718 0.401925 0.012565 0.515792 0.026036 0.001115 0.000374 0.972475 0.985609 0.000281 0.009340 0.004771 0.992498 0.001751 0.001641 0.004110 0.003048 0.000589 0.009260 0.987104 0.005338 0.968427 0.001002 0.025233 0.001736 0.954156 0.002782 0.041326 0.030103 0.441404 0.400145 0.128348 0.083495 0.360697 0.075527 0.480281 0.219244 0.119908 0.236702 0.424146 0.256872 0.229901 0.124714 0.388513 0.313903 0.308509 0.263518 0.114070 Consensus sequence: HVWHRYTAATCCSYDHV Reverse complement motif 0.114070 0.308509 0.263518 0.313903 0.388513 0.229901 0.124714 0.256872 0.424146 0.119908 0.236702 0.219244 0.480281 0.360697 0.075527 0.083495 0.030103 0.400145 0.441404 0.128348 0.001736 0.002782 0.954156 0.041326 0.005338 0.001002 0.968427 0.025233 0.987104 0.000589 0.009260 0.003048 0.004110 0.001751 0.001641 0.992498 0.004771 0.000281 0.009340 0.985609 0.972475 0.001115 0.000374 0.026036 0.515792 0.401925 0.012565 0.069718 0.277939 0.520395 0.114100 0.087567 0.262638 0.100119 0.456883 0.180360 0.429339 0.127567 0.045155 0.397939 0.209992 0.217033 0.236748 0.336226 0.242214 0.155805 0.130216 0.471765 Consensus sequence: BHDMSGGATTAMMDWBH Alignment: BHDMSGGATTAMMDWBH ----YGGACTTACG--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00093 Klf7_secondary Original Motif Reverse Complement Backward 4 10 0.021800 Species: Mus musculus Original motif 0.386646 0.259902 0.253791 0.099661 0.421388 0.207885 0.231243 0.139483 0.257377 0.193145 0.314893 0.234586 0.061783 0.371675 0.214607 0.351935 0.610889 0.007047 0.106287 0.275777 0.181496 0.007153 0.071824 0.739527 0.759998 0.222078 0.005710 0.012214 0.003816 0.977244 0.004175 0.014765 0.037124 0.002582 0.946042 0.014252 0.009124 0.982167 0.005065 0.003644 0.007023 0.980091 0.008044 0.004842 0.005328 0.930742 0.002828 0.061102 0.389804 0.299794 0.050877 0.259525 0.507764 0.121280 0.163196 0.207759 0.296269 0.307462 0.196230 0.200039 0.301339 0.231088 0.150226 0.317347 0.185149 0.176068 0.292944 0.345838 Consensus sequence: VVDBATACGCCCHAHHD Reverse complement motif 0.345838 0.176068 0.292944 0.185149 0.317347 0.231088 0.150226 0.301339 0.296269 0.196230 0.307462 0.200039 0.207759 0.121280 0.163196 0.507764 0.259525 0.299794 0.050877 0.389804 0.005328 0.002828 0.930742 0.061102 0.007023 0.008044 0.980091 0.004842 0.009124 0.005065 0.982167 0.003644 0.037124 0.946042 0.002582 0.014252 0.003816 0.004175 0.977244 0.014765 0.012214 0.222078 0.005710 0.759998 0.739527 0.007153 0.071824 0.181496 0.275777 0.007047 0.106287 0.610889 0.061783 0.214607 0.371675 0.351935 0.257377 0.314893 0.193145 0.234586 0.139483 0.207885 0.231243 0.421388 0.099661 0.259902 0.253791 0.386646 Consensus sequence: DHDTHGGGCGTATBHBB Alignment: DHDTHGGGCGTATBHBB ----YGGACTTACG--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00404 Elf2 Reverse Complement Reverse Complement Forward 6 10 0.022068 Species: Mus musculus Original motif 0.381592 0.198656 0.201326 0.218426 0.091509 0.331644 0.302830 0.274017 0.165404 0.272650 0.352528 0.209418 0.322145 0.255685 0.129399 0.292771 0.853490 0.012857 0.078563 0.055090 0.002655 0.792907 0.026436 0.178002 0.058923 0.001063 0.002976 0.937038 0.014944 0.001369 0.002865 0.980822 0.003786 0.992305 0.002102 0.001807 0.001365 0.988969 0.001554 0.008111 0.001527 0.009592 0.891056 0.097824 0.003671 0.143708 0.836117 0.016503 0.242982 0.061527 0.305342 0.390148 0.426709 0.117673 0.096260 0.359357 0.202520 0.113885 0.262005 0.421589 0.137957 0.359367 0.163919 0.338758 Consensus sequence: DBBHACTTCCGGDWDB Reverse complement motif 0.137957 0.163919 0.359367 0.338758 0.421589 0.113885 0.262005 0.202520 0.359357 0.117673 0.096260 0.426709 0.390148 0.061527 0.305342 0.242982 0.003671 0.836117 0.143708 0.016503 0.001527 0.891056 0.009592 0.097824 0.001365 0.001554 0.988969 0.008111 0.003786 0.002102 0.992305 0.001807 0.980822 0.001369 0.002865 0.014944 0.937038 0.001063 0.002976 0.058923 0.002655 0.026436 0.792907 0.178002 0.055090 0.012857 0.078563 0.853490 0.292771 0.255685 0.129399 0.322145 0.165404 0.352528 0.272650 0.209418 0.091509 0.302830 0.331644 0.274017 0.218426 0.198656 0.201326 0.381592 Consensus sequence: BDWDCCGGAAGTHBBD Alignment: BDWDCCGGAAGTHBBD -----CGTAAGTCCK- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00413 Elf4 Reverse Complement Reverse Complement Forward 6 10 0.022142 Species: Mus musculus Original motif 0.349744 0.139466 0.209326 0.301464 0.080478 0.359482 0.307083 0.252956 0.145756 0.213763 0.350557 0.289924 0.317307 0.199359 0.096089 0.387245 0.868576 0.009724 0.088821 0.032878 0.001975 0.827004 0.014159 0.156862 0.045494 0.000985 0.001907 0.951615 0.011012 0.001203 0.002186 0.985599 0.002743 0.992908 0.002226 0.002123 0.001498 0.990840 0.001556 0.006106 0.000951 0.005138 0.880591 0.113319 0.003127 0.107962 0.867980 0.020930 0.156602 0.055355 0.396563 0.391480 0.421246 0.049379 0.084495 0.444880 0.223879 0.068063 0.203809 0.504249 0.144100 0.323579 0.131544 0.400777 Consensus sequence: DBBHACTTCCGGKWTH Reverse complement motif 0.400777 0.323579 0.131544 0.144100 0.504249 0.068063 0.203809 0.223879 0.444880 0.049379 0.084495 0.421246 0.156602 0.396563 0.055355 0.391480 0.003127 0.867980 0.107962 0.020930 0.000951 0.880591 0.005138 0.113319 0.001498 0.001556 0.990840 0.006106 0.002743 0.002226 0.992908 0.002123 0.985599 0.001203 0.002186 0.011012 0.951615 0.000985 0.001907 0.045494 0.001975 0.014159 0.827004 0.156862 0.032878 0.009724 0.088821 0.868576 0.387245 0.199359 0.096089 0.317307 0.145756 0.350557 0.213763 0.289924 0.080478 0.307083 0.359482 0.252956 0.301464 0.139466 0.209326 0.349744 Consensus sequence: HAWYCCGGAAGTHBBD Alignment: HAWYCCGGAAGTHBBD -----CGTAAGTCCK- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 5 Motif ID: 87 Motif name: TFF1 Original motif 0.894366 0.007042 0.056338 0.042254 0.021127 0.042254 0.922535 0.014085 0.161972 0.091549 0.661972 0.084507 0.535211 0.140845 0.126761 0.197183 0.007042 0.957746 0.028169 0.007042 0.957746 0.007042 0.035211 0.000000 0.612676 0.225352 0.091549 0.070423 0.732394 0.028169 0.133803 0.105634 0.084507 0.183099 0.676056 0.056338 0.514085 0.154930 0.176056 0.154930 0.225352 0.190141 0.443662 0.140845 0.232394 0.352113 0.232394 0.183099 Consensus sequence: AGGACAAAGAVV Reserve complement motif 0.232394 0.232394 0.352113 0.183099 0.225352 0.443662 0.190141 0.140845 0.154930 0.154930 0.176056 0.514085 0.084507 0.676056 0.183099 0.056338 0.105634 0.028169 0.133803 0.732394 0.070423 0.225352 0.091549 0.612676 0.000000 0.007042 0.035211 0.957746 0.007042 0.028169 0.957746 0.007042 0.197183 0.140845 0.126761 0.535211 0.161972 0.661972 0.091549 0.084507 0.021127 0.922535 0.042254 0.014085 0.042254 0.007042 0.056338 0.894366 Consensus sequence: VVTCTTTGTCCT ************************************************************************ Best Matches for Motif ID 87 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00062 Sox4_primary Original Motif Original Motif Backward 3 12 0.025854 Species: Mus musculus Original motif 0.427843 0.231210 0.119424 0.221523 0.196506 0.239531 0.304906 0.259057 0.302488 0.156922 0.290190 0.250401 0.433872 0.149126 0.196496 0.220506 0.258426 0.076511 0.475100 0.189963 0.841714 0.046453 0.099915 0.011918 0.983853 0.001612 0.001362 0.013174 0.003460 0.982032 0.005728 0.008780 0.989743 0.002253 0.002020 0.005984 0.990761 0.003397 0.002843 0.003000 0.770864 0.003540 0.001549 0.224048 0.235342 0.002598 0.757383 0.004677 0.371426 0.089574 0.529959 0.009040 0.480804 0.196949 0.240413 0.081833 0.187158 0.355102 0.216599 0.241142 0.248006 0.232182 0.157452 0.362360 0.403367 0.177684 0.164649 0.254300 Consensus sequence: HBDDDAACAAAGRVBHH Reverse complement motif 0.254300 0.177684 0.164649 0.403367 0.362360 0.232182 0.157452 0.248006 0.187158 0.216599 0.355102 0.241142 0.081833 0.196949 0.240413 0.480804 0.371426 0.529959 0.089574 0.009040 0.235342 0.757383 0.002598 0.004677 0.224048 0.003540 0.001549 0.770864 0.003000 0.003397 0.002843 0.990761 0.005984 0.002253 0.002020 0.989743 0.003460 0.005728 0.982032 0.008780 0.013174 0.001612 0.001362 0.983853 0.011918 0.046453 0.099915 0.841714 0.258426 0.475100 0.076511 0.189963 0.220506 0.149126 0.196496 0.433872 0.250401 0.156922 0.290190 0.302488 0.196506 0.304906 0.239531 0.259057 0.221523 0.231210 0.119424 0.427843 Consensus sequence: HHBBMCTTTGTTHDDBH Alignment: HBDDDAACAAAGRVBHH ---AGGACAAAGAVV-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00072 IRC900814_primary Original Motif Original Motif Backward 1 12 0.025858 Species: Mus musculus Original motif 0.365594 0.139520 0.170474 0.324412 0.273874 0.192800 0.250453 0.282872 0.161547 0.330332 0.098428 0.409694 0.084003 0.205596 0.098191 0.612210 0.953705 0.016367 0.006314 0.023614 0.003494 0.989648 0.003278 0.003580 0.004722 0.003156 0.988805 0.003317 0.939828 0.001925 0.052151 0.006096 0.183998 0.760396 0.030845 0.024762 0.917564 0.003661 0.065438 0.013337 0.965452 0.006559 0.005183 0.022807 0.730611 0.054369 0.006576 0.208444 0.266519 0.133801 0.067418 0.532262 0.329952 0.210903 0.220319 0.238826 0.250220 0.197954 0.314202 0.237625 0.172311 0.401218 0.189340 0.237131 Consensus sequence: DDHTACGACAAAWDDB Reverse complement motif 0.172311 0.189340 0.401218 0.237131 0.250220 0.314202 0.197954 0.237625 0.238826 0.210903 0.220319 0.329952 0.532262 0.133801 0.067418 0.266519 0.208444 0.054369 0.006576 0.730611 0.022807 0.006559 0.005183 0.965452 0.013337 0.003661 0.065438 0.917564 0.183998 0.030845 0.760396 0.024762 0.006096 0.001925 0.052151 0.939828 0.004722 0.988805 0.003156 0.003317 0.003494 0.003278 0.989648 0.003580 0.023614 0.016367 0.006314 0.953705 0.612210 0.205596 0.098191 0.084003 0.409694 0.330332 0.098428 0.161547 0.282872 0.192800 0.250453 0.273874 0.324412 0.139520 0.170474 0.365594 Consensus sequence: BHDWTTTGTCGTAHDD Alignment: DDHTACGACAAAWDDB ----AGGACAAAGAVV ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00030 Sox11_primary Original Motif Original Motif Backward 3 12 0.028417 Species: Mus musculus Original motif 0.351812 0.238467 0.143954 0.265768 0.195246 0.235838 0.281473 0.287443 0.349478 0.172616 0.210739 0.267167 0.484061 0.110438 0.173131 0.232370 0.276692 0.070713 0.479604 0.172991 0.859124 0.044167 0.083951 0.012758 0.975608 0.002029 0.002285 0.020079 0.006422 0.978485 0.007124 0.007969 0.987489 0.003025 0.002868 0.006617 0.987739 0.005463 0.002730 0.004067 0.693013 0.004067 0.002445 0.300475 0.189100 0.003677 0.801408 0.005814 0.352090 0.072517 0.567737 0.007656 0.542316 0.176545 0.192768 0.088371 0.196382 0.304176 0.205985 0.293457 0.289415 0.201358 0.182937 0.326290 0.385801 0.216362 0.152363 0.245475 Consensus sequence: HBDDRAACAAAGRABHH Reverse complement motif 0.245475 0.216362 0.152363 0.385801 0.326290 0.201358 0.182937 0.289415 0.196382 0.205985 0.304176 0.293457 0.088371 0.176545 0.192768 0.542316 0.352090 0.567737 0.072517 0.007656 0.189100 0.801408 0.003677 0.005814 0.300475 0.004067 0.002445 0.693013 0.004067 0.005463 0.002730 0.987739 0.006617 0.003025 0.002868 0.987489 0.006422 0.007124 0.978485 0.007969 0.020079 0.002029 0.002285 0.975608 0.012758 0.044167 0.083951 0.859124 0.276692 0.479604 0.070713 0.172991 0.232370 0.110438 0.173131 0.484061 0.267167 0.172616 0.210739 0.349478 0.287443 0.235838 0.281473 0.195246 0.265768 0.238467 0.143954 0.351812 Consensus sequence: HHBTMCTTTGTTMDDVH Alignment: HBDDRAACAAAGRABHH ---AGGACAAAGAVV-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00101 Sox12_secondary Original Motif Original Motif Backward 2 12 0.031787 Species: Mus musculus Original motif 0.378898 0.318901 0.205859 0.096341 0.352524 0.321236 0.224504 0.101736 0.323551 0.182056 0.210897 0.283496 0.135539 0.325230 0.208031 0.331200 0.663106 0.055471 0.154459 0.126963 0.051748 0.292567 0.537307 0.118378 0.886489 0.042361 0.035742 0.035408 0.043647 0.688744 0.094358 0.173252 0.882052 0.039818 0.018899 0.059231 0.864171 0.036011 0.068363 0.031455 0.790158 0.046868 0.041594 0.121379 0.087447 0.143905 0.707798 0.060849 0.295919 0.132479 0.485703 0.085899 0.653156 0.133004 0.110012 0.103828 0.351764 0.131771 0.217730 0.298736 0.203977 0.196773 0.099958 0.499292 Consensus sequence: VVDBASACAAAGRADH Reverse complement motif 0.499292 0.196773 0.099958 0.203977 0.298736 0.131771 0.217730 0.351764 0.103828 0.133004 0.110012 0.653156 0.295919 0.485703 0.132479 0.085899 0.087447 0.707798 0.143905 0.060849 0.121379 0.046868 0.041594 0.790158 0.031455 0.036011 0.068363 0.864171 0.059231 0.039818 0.018899 0.882052 0.043647 0.094358 0.688744 0.173252 0.035408 0.042361 0.035742 0.886489 0.051748 0.537307 0.292567 0.118378 0.126963 0.055471 0.154459 0.663106 0.331200 0.325230 0.208031 0.135539 0.283496 0.182056 0.210897 0.323551 0.101736 0.321236 0.224504 0.352524 0.096341 0.318901 0.205859 0.378898 Consensus sequence: HDTMCTTTGTSTVDBB Alignment: VVDBASACAAAGRADH ---AGGACAAAGAVV- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00067 Lef1_primary Original Motif Reverse Complement Backward 3 12 0.031804 Species: Mus musculus Original motif 0.281920 0.214207 0.278077 0.225796 0.325566 0.151435 0.298797 0.224202 0.290253 0.145824 0.243443 0.320480 0.069286 0.404645 0.141614 0.384454 0.070044 0.621448 0.142647 0.165862 0.007295 0.907657 0.038110 0.046938 0.015587 0.018273 0.000658 0.965482 0.005527 0.005886 0.001905 0.986682 0.024512 0.001189 0.001344 0.972955 0.007384 0.025221 0.952270 0.015125 0.966438 0.000630 0.002693 0.030239 0.082252 0.001173 0.001495 0.915080 0.030255 0.677155 0.275323 0.017267 0.199467 0.118815 0.056814 0.624905 0.345445 0.169597 0.216831 0.268127 0.278106 0.150864 0.173693 0.397336 0.251834 0.339733 0.219703 0.188730 Consensus sequence: DDDYCCTTTGATCTDDV Reverse complement motif 0.251834 0.219703 0.339733 0.188730 0.397336 0.150864 0.173693 0.278106 0.268127 0.169597 0.216831 0.345445 0.624905 0.118815 0.056814 0.199467 0.030255 0.275323 0.677155 0.017267 0.915080 0.001173 0.001495 0.082252 0.030239 0.000630 0.002693 0.966438 0.007384 0.952270 0.025221 0.015125 0.972955 0.001189 0.001344 0.024512 0.986682 0.005886 0.001905 0.005527 0.965482 0.018273 0.000658 0.015587 0.007295 0.038110 0.907657 0.046938 0.070044 0.142647 0.621448 0.165862 0.069286 0.141614 0.404645 0.384454 0.320480 0.145824 0.243443 0.290253 0.224202 0.151435 0.298797 0.325566 0.225796 0.214207 0.278077 0.281920 Consensus sequence: VDDAGATCAAAGGKDDD Alignment: VDDAGATCAAAGGKDDD ---AGGACAAAGAVV-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00058 Tcf3_primary Original Motif Original Motif Forward 4 12 0.032939 Species: Mus musculus Original motif 0.185864 0.201179 0.183663 0.429294 0.371100 0.233868 0.122934 0.272098 0.249563 0.171285 0.128851 0.450301 0.582940 0.043382 0.129099 0.244578 0.041400 0.395349 0.497087 0.066163 0.759123 0.009670 0.005936 0.225270 0.056579 0.008662 0.003986 0.930772 0.043968 0.865783 0.056001 0.034249 0.962748 0.003731 0.003265 0.030256 0.971318 0.003542 0.012299 0.012841 0.937558 0.003991 0.020195 0.038256 0.125931 0.057976 0.798081 0.018012 0.209401 0.172342 0.483980 0.134277 0.485703 0.129227 0.309936 0.075134 0.397027 0.195902 0.152395 0.254676 0.311636 0.231510 0.157732 0.299122 0.320965 0.206031 0.164299 0.308705 Consensus sequence: HHHASATCAAAGVRHHH Reverse complement motif 0.308705 0.206031 0.164299 0.320965 0.299122 0.231510 0.157732 0.311636 0.254676 0.195902 0.152395 0.397027 0.075134 0.129227 0.309936 0.485703 0.209401 0.483980 0.172342 0.134277 0.125931 0.798081 0.057976 0.018012 0.038256 0.003991 0.020195 0.937558 0.012841 0.003542 0.012299 0.971318 0.030256 0.003731 0.003265 0.962748 0.043968 0.056001 0.865783 0.034249 0.930772 0.008662 0.003986 0.056579 0.225270 0.009670 0.005936 0.759123 0.041400 0.497087 0.395349 0.066163 0.244578 0.043382 0.129099 0.582940 0.450301 0.171285 0.128851 0.249563 0.272098 0.233868 0.122934 0.371100 0.429294 0.201179 0.183663 0.185864 Consensus sequence: HHHKVCTTTGATSTHHH Alignment: HHHASATCAAAGVRHHH ---AGGACAAAGAVV-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00054 Tcf7_primary Original Motif Original Motif Forward 4 12 0.034480 Species: Mus musculus Original motif 0.170811 0.196976 0.220503 0.411710 0.337231 0.228482 0.140137 0.294150 0.299312 0.173780 0.143426 0.383481 0.603957 0.053557 0.128214 0.214271 0.036338 0.377925 0.534647 0.051091 0.725865 0.010314 0.008501 0.255320 0.067855 0.007849 0.004559 0.919737 0.049387 0.815496 0.098330 0.036787 0.960514 0.005036 0.005137 0.029313 0.960631 0.004550 0.018815 0.016004 0.935245 0.005169 0.023866 0.035720 0.159760 0.060340 0.761341 0.018559 0.228534 0.153897 0.523052 0.094517 0.557984 0.123512 0.254154 0.064350 0.490252 0.211976 0.124557 0.173215 0.310463 0.250279 0.132612 0.306646 0.332720 0.248937 0.120633 0.297711 Consensus sequence: BHHASATCAAAGGAHHH Reverse complement motif 0.297711 0.248937 0.120633 0.332720 0.306646 0.250279 0.132612 0.310463 0.173215 0.211976 0.124557 0.490252 0.064350 0.123512 0.254154 0.557984 0.228534 0.523052 0.153897 0.094517 0.159760 0.761341 0.060340 0.018559 0.035720 0.005169 0.023866 0.935245 0.016004 0.004550 0.018815 0.960631 0.029313 0.005036 0.005137 0.960514 0.049387 0.098330 0.815496 0.036787 0.919737 0.007849 0.004559 0.067855 0.255320 0.010314 0.008501 0.725865 0.036338 0.534647 0.377925 0.051091 0.214271 0.053557 0.128214 0.603957 0.383481 0.173780 0.143426 0.299312 0.294150 0.228482 0.140137 0.337231 0.411710 0.196976 0.220503 0.170811 Consensus sequence: HHHTCCTTTGATSTHHV Alignment: BHHASATCAAAGGAHHH ---AGGACAAAGAVV-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00026 Zscan4_secondary Reverse Complement Reverse Complement Backward 4 12 0.034481 Species: Mus musculus Original motif 0.275231 0.387763 0.112851 0.224155 0.269193 0.327669 0.360934 0.042204 0.439403 0.233641 0.022359 0.304596 0.409796 0.139856 0.390450 0.059899 0.038409 0.011231 0.936209 0.014150 0.067382 0.909014 0.021244 0.002359 0.962897 0.009563 0.009687 0.017854 0.043757 0.937596 0.007648 0.010999 0.970698 0.005379 0.016825 0.007098 0.066033 0.636556 0.043955 0.253456 0.797406 0.066726 0.011988 0.123879 0.774632 0.121694 0.017773 0.085901 0.324017 0.235408 0.213365 0.227210 0.365796 0.192247 0.134547 0.307410 0.299601 0.246867 0.098395 0.355137 0.328229 0.242048 0.251143 0.178579 Consensus sequence: HVHRGCACACAAHHHV Reverse complement motif 0.178579 0.242048 0.251143 0.328229 0.355137 0.246867 0.098395 0.299601 0.307410 0.192247 0.134547 0.365796 0.227210 0.235408 0.213365 0.324017 0.085901 0.121694 0.017773 0.774632 0.123879 0.066726 0.011988 0.797406 0.066033 0.043955 0.636556 0.253456 0.007098 0.005379 0.016825 0.970698 0.043757 0.007648 0.937596 0.010999 0.017854 0.009563 0.009687 0.962897 0.067382 0.021244 0.909014 0.002359 0.038409 0.936209 0.011231 0.014150 0.059899 0.139856 0.390450 0.409796 0.304596 0.233641 0.022359 0.439403 0.269193 0.360934 0.327669 0.042204 0.275231 0.112851 0.387763 0.224155 Consensus sequence: BHHHTTGTGTGCKHVD Alignment: BHHHTTGTGTGCKHVD -VVTCTTTGTCCT--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00083 Tcf7l2_primary Reverse Complement Original Motif Backward 4 12 0.034488 Species: Mus musculus Original motif 0.285725 0.187143 0.254855 0.272277 0.276264 0.157893 0.258178 0.307665 0.238788 0.161120 0.254018 0.346074 0.076041 0.333901 0.150903 0.439156 0.093376 0.526578 0.180529 0.199517 0.010827 0.880320 0.034150 0.074703 0.016546 0.023834 0.000940 0.958680 0.007166 0.008215 0.001941 0.982678 0.029634 0.001363 0.001379 0.967625 0.010872 0.031751 0.926186 0.031190 0.949407 0.000760 0.002581 0.047253 0.109203 0.001362 0.002094 0.887341 0.044198 0.567994 0.353059 0.034749 0.222623 0.142360 0.041281 0.593736 0.358872 0.167597 0.220534 0.252997 0.233072 0.141480 0.230985 0.394463 0.350703 0.243129 0.233961 0.172207 Consensus sequence: DDDYCCTTTGATSTDDV Reverse complement motif 0.172207 0.243129 0.233961 0.350703 0.394463 0.141480 0.230985 0.233072 0.252997 0.167597 0.220534 0.358872 0.593736 0.142360 0.041281 0.222623 0.044198 0.353059 0.567994 0.034749 0.887341 0.001362 0.002094 0.109203 0.047253 0.000760 0.002581 0.949407 0.010872 0.926186 0.031751 0.031190 0.967625 0.001363 0.001379 0.029634 0.982678 0.008215 0.001941 0.007166 0.958680 0.023834 0.000940 0.016546 0.010827 0.034150 0.880320 0.074703 0.093376 0.180529 0.526578 0.199517 0.439156 0.333901 0.150903 0.076041 0.346074 0.161120 0.254018 0.238788 0.307665 0.157893 0.258178 0.276264 0.272277 0.187143 0.254855 0.285725 Consensus sequence: BDDASATCAAAGGMDDD Alignment: DDDYCCTTTGATSTDDV --VVTCTTTGTCCT--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00020 Atf1_secondary Original Motif Original Motif Backward 1 12 0.035204 Species: Mus musculus Original motif 0.190871 0.208590 0.418111 0.182428 0.317846 0.111669 0.286306 0.284179 0.648958 0.110707 0.203307 0.037028 0.036931 0.051884 0.046511 0.864674 0.083831 0.047140 0.807374 0.061655 0.825537 0.040814 0.065502 0.068147 0.036229 0.860339 0.049032 0.054400 0.158667 0.026582 0.782382 0.032369 0.564584 0.233981 0.083790 0.117646 0.398929 0.020841 0.349286 0.230944 0.018357 0.259286 0.208353 0.514004 0.691640 0.068711 0.099394 0.140256 0.455948 0.106302 0.180732 0.257017 0.257719 0.300244 0.204520 0.237517 Consensus sequence: VDATGACGADYADH Reverse complement motif 0.257719 0.204520 0.300244 0.237517 0.257017 0.106302 0.180732 0.455948 0.140256 0.068711 0.099394 0.691640 0.514004 0.259286 0.208353 0.018357 0.230944 0.020841 0.349286 0.398929 0.117646 0.233981 0.083790 0.564584 0.158667 0.782382 0.026582 0.032369 0.036229 0.049032 0.860339 0.054400 0.068147 0.040814 0.065502 0.825537 0.083831 0.807374 0.047140 0.061655 0.864674 0.051884 0.046511 0.036931 0.037028 0.110707 0.203307 0.648958 0.284179 0.111669 0.286306 0.317846 0.190871 0.418111 0.208590 0.182428 Consensus sequence: DDTMDTCGTCATDV Alignment: VDATGACGADYADH --AGGACAAAGAVV ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 5 Motif ID: 88 Motif name: TFF11 Original motif 0.098592 0.556338 0.246479 0.098592 0.281690 0.007042 0.098592 0.612676 0.007042 0.021127 0.971831 0.000000 0.007042 0.971831 0.007042 0.014085 0.007042 0.000000 0.000000 0.992958 0.000000 0.000000 1.000000 0.000000 0.176056 0.415493 0.232394 0.176056 0.267606 0.197183 0.267606 0.267606 0.119718 0.190141 0.401408 0.288732 0.098592 0.436620 0.211268 0.253521 0.239437 0.154930 0.183099 0.422535 0.126761 0.140845 0.619718 0.112676 0.190141 0.281690 0.225352 0.302817 0.232394 0.176056 0.373239 0.218310 Consensus sequence: CTGCTGBDBBDGBD Reserve complement motif 0.232394 0.373239 0.176056 0.218310 0.302817 0.281690 0.225352 0.190141 0.126761 0.619718 0.140845 0.112676 0.422535 0.154930 0.183099 0.239437 0.098592 0.211268 0.436620 0.253521 0.119718 0.401408 0.190141 0.288732 0.267606 0.197183 0.267606 0.267606 0.176056 0.232394 0.415493 0.176056 0.000000 1.000000 0.000000 0.000000 0.992958 0.000000 0.000000 0.007042 0.007042 0.007042 0.971831 0.014085 0.007042 0.971831 0.021127 0.000000 0.612676 0.007042 0.098592 0.281690 0.098592 0.246479 0.556338 0.098592 Consensus sequence: HVCDBBDBCAGCAG ************************************************************************ Best Matches for Motif ID 88 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00193 Rhox11_1765.2 Reverse Complement Reverse Complement Forward 1 14 0.054015 Species: Mus musculus Original motif 0.538735 0.129821 0.147336 0.184107 0.331267 0.275123 0.227609 0.166001 0.174654 0.113319 0.383610 0.328417 0.296734 0.281670 0.230068 0.191527 0.128222 0.561296 0.062928 0.247554 0.027028 0.014676 0.949335 0.008962 0.087209 0.761581 0.147964 0.003246 0.006796 0.000741 0.006037 0.986427 0.039496 0.000533 0.943453 0.016517 0.005541 0.005164 0.002805 0.986489 0.561957 0.002761 0.004207 0.431075 0.780197 0.037155 0.031222 0.151425 0.518642 0.104220 0.012670 0.364468 0.314451 0.111366 0.333508 0.240676 0.236936 0.357992 0.280813 0.124259 0.314846 0.163774 0.426195 0.095185 0.408340 0.134111 0.102987 0.354562 Consensus sequence: AVDVCGCTGTWAWDVVW Reverse complement motif 0.354562 0.134111 0.102987 0.408340 0.314846 0.426195 0.163774 0.095185 0.236936 0.280813 0.357992 0.124259 0.314451 0.333508 0.111366 0.240676 0.364468 0.104220 0.012670 0.518642 0.151425 0.037155 0.031222 0.780197 0.431075 0.002761 0.004207 0.561957 0.986489 0.005164 0.002805 0.005541 0.039496 0.943453 0.000533 0.016517 0.986427 0.000741 0.006037 0.006796 0.087209 0.147964 0.761581 0.003246 0.027028 0.949335 0.014676 0.008962 0.128222 0.062928 0.561296 0.247554 0.191527 0.281670 0.230068 0.296734 0.174654 0.383610 0.113319 0.328417 0.166001 0.275123 0.227609 0.331267 0.184107 0.129821 0.147336 0.538735 Consensus sequence: WVVHWTWACAGCGBHBT Alignment: WVVHWTWACAGCGBHBT HVCDBBDBCAGCAG--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00193 Rhox11_2205.1 Reverse Complement Reverse Complement Forward 1 14 0.054385 Species: Mus musculus Original motif 0.504898 0.140204 0.135418 0.219480 0.282348 0.244881 0.300572 0.172199 0.183939 0.100670 0.384783 0.330608 0.326709 0.269523 0.194043 0.209724 0.142989 0.557393 0.066826 0.232792 0.038356 0.014052 0.932450 0.015142 0.092102 0.778844 0.125082 0.003972 0.010254 0.001252 0.005231 0.983263 0.033486 0.000891 0.947486 0.018137 0.005360 0.007407 0.003729 0.983504 0.603485 0.007179 0.003482 0.385853 0.798026 0.029788 0.032370 0.139816 0.529622 0.100632 0.016507 0.353238 0.243581 0.126094 0.401402 0.228923 0.207484 0.285456 0.353715 0.153346 0.282413 0.188410 0.441463 0.087715 0.422774 0.152965 0.094106 0.330155 Consensus sequence: AVDHCGCTGTWAWDVVW Reverse complement motif 0.330155 0.152965 0.094106 0.422774 0.282413 0.441463 0.188410 0.087715 0.207484 0.353715 0.285456 0.153346 0.243581 0.401402 0.126094 0.228923 0.353238 0.100632 0.016507 0.529622 0.139816 0.029788 0.032370 0.798026 0.385853 0.007179 0.003482 0.603485 0.983504 0.007407 0.003729 0.005360 0.033486 0.947486 0.000891 0.018137 0.983263 0.001252 0.005231 0.010254 0.092102 0.125082 0.778844 0.003972 0.038356 0.932450 0.014052 0.015142 0.142989 0.066826 0.557393 0.232792 0.209724 0.269523 0.194043 0.326709 0.183939 0.384783 0.100670 0.330608 0.282348 0.300572 0.244881 0.172199 0.219480 0.140204 0.135418 0.504898 Consensus sequence: WVVHWTWACAGCGHHVT Alignment: WVVHWTWACAGCGHHVT HVCDBBDBCAGCAG--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00027 Osr1_primary Original Motif Reverse Complement Backward 1 14 0.055447 Species: Mus musculus Original motif 0.260366 0.252887 0.224273 0.262474 0.239931 0.233883 0.190643 0.335543 0.257637 0.188706 0.242480 0.311177 0.323833 0.165978 0.161144 0.349046 0.824983 0.119267 0.027014 0.028736 0.009055 0.974108 0.000889 0.015947 0.659219 0.001516 0.337361 0.001905 0.002965 0.001643 0.993070 0.002321 0.047380 0.001758 0.009593 0.941269 0.974073 0.000741 0.023187 0.001999 0.006256 0.001341 0.990114 0.002290 0.001372 0.921382 0.010719 0.066527 0.449788 0.160658 0.105504 0.284050 0.392727 0.304490 0.187448 0.115335 0.361758 0.209213 0.175805 0.253224 0.420972 0.108912 0.289406 0.180710 Consensus sequence: HHDHACRGTAGCHVHD Reverse complement motif 0.180710 0.108912 0.289406 0.420972 0.253224 0.209213 0.175805 0.361758 0.115335 0.304490 0.187448 0.392727 0.284050 0.160658 0.105504 0.449788 0.001372 0.010719 0.921382 0.066527 0.006256 0.990114 0.001341 0.002290 0.001999 0.000741 0.023187 0.974073 0.941269 0.001758 0.009593 0.047380 0.002965 0.993070 0.001643 0.002321 0.001905 0.001516 0.337361 0.659219 0.009055 0.000889 0.974108 0.015947 0.028736 0.119267 0.027014 0.824983 0.349046 0.165978 0.161144 0.323833 0.311177 0.188706 0.242480 0.257637 0.335543 0.233883 0.190643 0.239931 0.262474 0.252887 0.224273 0.260366 Consensus sequence: DHBHGCTACKGTHDHH Alignment: HHDHACRGTAGCHVHD --CTGCTGBDBBDGBD ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00052 Osr2_secondary Reverse Complement Reverse Complement Backward 3 14 0.057641 Species: Mus musculus Original motif 0.503814 0.061521 0.249336 0.185328 0.254929 0.299710 0.169910 0.275451 0.227652 0.250215 0.156720 0.365413 0.204377 0.213835 0.124161 0.457627 0.092364 0.094662 0.750364 0.062611 0.026436 0.897855 0.038986 0.036722 0.035250 0.085429 0.030496 0.848825 0.819775 0.042925 0.032996 0.104304 0.145642 0.810774 0.021549 0.022035 0.031252 0.486827 0.015181 0.466740 0.255316 0.101783 0.039552 0.603348 0.466712 0.084471 0.436303 0.012514 0.344321 0.408616 0.064696 0.182367 0.422210 0.112319 0.109923 0.355548 0.221064 0.283525 0.217775 0.277636 0.280658 0.350363 0.211925 0.157054 Consensus sequence: AHHHGCTACYTRMWHV Reverse complement motif 0.280658 0.211925 0.350363 0.157054 0.221064 0.217775 0.283525 0.277636 0.355548 0.112319 0.109923 0.422210 0.344321 0.064696 0.408616 0.182367 0.012514 0.084471 0.436303 0.466712 0.603348 0.101783 0.039552 0.255316 0.031252 0.015181 0.486827 0.466740 0.145642 0.021549 0.810774 0.022035 0.104304 0.042925 0.032996 0.819775 0.848825 0.085429 0.030496 0.035250 0.026436 0.038986 0.897855 0.036722 0.092364 0.750364 0.094662 0.062611 0.457627 0.213835 0.124161 0.204377 0.365413 0.250215 0.156720 0.227652 0.254929 0.169910 0.299710 0.275451 0.185328 0.061521 0.249336 0.503814 Consensus sequence: VDWRKAKGTAGCHHDT Alignment: VDWRKAKGTAGCHHDT HVCDBBDBCAGCAG-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00099 Ascl2_primary Reverse Complement Original Motif Forward 1 14 0.058112 Species: Mus musculus Original motif 0.168852 0.325948 0.188604 0.316596 0.150343 0.193286 0.241301 0.415069 0.091518 0.482905 0.122928 0.302648 0.472493 0.198776 0.225796 0.102935 0.294513 0.179919 0.447250 0.078318 0.014660 0.972080 0.005591 0.007668 0.954848 0.008107 0.008474 0.028571 0.006076 0.178912 0.760021 0.054991 0.052082 0.817415 0.124797 0.005707 0.019342 0.010406 0.008905 0.961347 0.005455 0.008073 0.977684 0.008788 0.042946 0.715551 0.087020 0.154483 0.116888 0.241739 0.170073 0.471300 0.315931 0.324343 0.291451 0.068274 0.199164 0.366921 0.163690 0.270226 0.218561 0.211076 0.187732 0.382631 0.145317 0.139808 0.389262 0.325614 Consensus sequence: BBYVVCAGCTGCBVHHD Reverse complement motif 0.145317 0.389262 0.139808 0.325614 0.382631 0.211076 0.187732 0.218561 0.199164 0.163690 0.366921 0.270226 0.315931 0.291451 0.324343 0.068274 0.471300 0.241739 0.170073 0.116888 0.042946 0.087020 0.715551 0.154483 0.005455 0.977684 0.008073 0.008788 0.961347 0.010406 0.008905 0.019342 0.052082 0.124797 0.817415 0.005707 0.006076 0.760021 0.178912 0.054991 0.028571 0.008107 0.008474 0.954848 0.014660 0.005591 0.972080 0.007668 0.294513 0.447250 0.179919 0.078318 0.102935 0.198776 0.225796 0.472493 0.091518 0.122928 0.482905 0.302648 0.415069 0.193286 0.241301 0.150343 0.168852 0.188604 0.325948 0.316596 Consensus sequence: HHDVVGCAGCTGVBKVB Alignment: BBYVVCAGCTGCBVHHD HVCDBBDBCAGCAG--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00027 Osr1_secondary Reverse Complement Reverse Complement Forward 1 14 0.058639 Species: Mus musculus Original motif 0.454194 0.092676 0.306326 0.146803 0.183011 0.349823 0.148031 0.319135 0.402809 0.216433 0.154083 0.226674 0.211745 0.252049 0.161182 0.375024 0.136345 0.083690 0.743914 0.036052 0.026957 0.909549 0.024545 0.038949 0.029080 0.082100 0.032574 0.856247 0.787454 0.048202 0.052486 0.111858 0.073461 0.881278 0.022313 0.022948 0.026791 0.545542 0.010815 0.416852 0.322008 0.101565 0.026489 0.549938 0.458267 0.105781 0.425231 0.010720 0.432794 0.314870 0.090685 0.161651 0.260978 0.176097 0.204310 0.358614 0.282877 0.259359 0.208881 0.248883 0.274197 0.291831 0.231013 0.202959 Consensus sequence: RHHHGCTACYWRHDHV Reverse complement motif 0.274197 0.231013 0.291831 0.202959 0.248883 0.259359 0.208881 0.282877 0.358614 0.176097 0.204310 0.260978 0.161651 0.314870 0.090685 0.432794 0.010720 0.105781 0.425231 0.458267 0.549938 0.101565 0.026489 0.322008 0.026791 0.010815 0.545542 0.416852 0.073461 0.022313 0.881278 0.022948 0.111858 0.048202 0.052486 0.787454 0.856247 0.082100 0.032574 0.029080 0.026957 0.024545 0.909549 0.038949 0.136345 0.743914 0.083690 0.036052 0.375024 0.252049 0.161182 0.211745 0.226674 0.216433 0.154083 0.402809 0.183011 0.148031 0.349823 0.319135 0.146803 0.092676 0.306326 0.454194 Consensus sequence: VHDHKWKGTAGCHHDK Alignment: VHDHKWKGTAGCHHDK HVCDBBDBCAGCAG-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00122 Tgif1 Reverse Complement Original Motif Forward 1 14 0.059288 Species: Mus musculus Original motif 0.272977 0.158875 0.284742 0.283406 0.550609 0.124110 0.169608 0.155673 0.114568 0.207160 0.282464 0.395807 0.560868 0.052907 0.053508 0.332716 0.336500 0.068048 0.114050 0.481403 0.007736 0.003722 0.000495 0.988048 0.004489 0.000729 0.992211 0.002571 0.956618 0.000414 0.000890 0.042078 0.004381 0.990925 0.000538 0.004156 0.982797 0.000366 0.015539 0.001298 0.016760 0.002980 0.969991 0.010269 0.036013 0.725983 0.200022 0.037982 0.064755 0.104386 0.133891 0.696968 0.199404 0.263520 0.410228 0.126848 0.222648 0.351390 0.272575 0.153387 0.087778 0.206043 0.395671 0.310507 0.319643 0.144216 0.196041 0.340100 Consensus sequence: DABWWTGACAGCTVVBD Reverse complement motif 0.340100 0.144216 0.196041 0.319643 0.087778 0.395671 0.206043 0.310507 0.222648 0.272575 0.351390 0.153387 0.199404 0.410228 0.263520 0.126848 0.696968 0.104386 0.133891 0.064755 0.036013 0.200022 0.725983 0.037982 0.016760 0.969991 0.002980 0.010269 0.001298 0.000366 0.015539 0.982797 0.004381 0.000538 0.990925 0.004156 0.042078 0.000414 0.000890 0.956618 0.004489 0.992211 0.000729 0.002571 0.988048 0.003722 0.000495 0.007736 0.481403 0.068048 0.114050 0.336500 0.332716 0.052907 0.053508 0.560868 0.395807 0.207160 0.282464 0.114568 0.155673 0.124110 0.169608 0.550609 0.272977 0.284742 0.158875 0.283406 Consensus sequence: DBVVAGCTGTCAWWVTH Alignment: DABWWTGACAGCTVVBD HVCDBBDBCAGCAG--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00052 Osr2_primary Original Motif Reverse Complement Forward 3 14 0.061033 Species: Mus musculus Original motif 0.295210 0.230759 0.178832 0.295199 0.286163 0.186772 0.186150 0.340915 0.287577 0.235045 0.329453 0.147924 0.263264 0.191325 0.081978 0.463433 0.839420 0.118123 0.018788 0.023669 0.005488 0.984397 0.000830 0.009284 0.660134 0.001532 0.336574 0.001760 0.003020 0.001773 0.993144 0.002063 0.039664 0.001060 0.005054 0.954222 0.980339 0.000636 0.016776 0.002249 0.003849 0.001418 0.992166 0.002568 0.000858 0.950172 0.007228 0.041743 0.342840 0.230712 0.133570 0.292878 0.342486 0.316980 0.167294 0.173240 0.362426 0.178913 0.146709 0.311952 0.266586 0.140406 0.435643 0.157365 Consensus sequence: HHVHACRGTAGCHHHD Reverse complement motif 0.266586 0.435643 0.140406 0.157365 0.311952 0.178913 0.146709 0.362426 0.173240 0.316980 0.167294 0.342486 0.292878 0.230712 0.133570 0.342840 0.000858 0.007228 0.950172 0.041743 0.003849 0.992166 0.001418 0.002568 0.002249 0.000636 0.016776 0.980339 0.954222 0.001060 0.005054 0.039664 0.003020 0.993144 0.001773 0.002063 0.001760 0.001532 0.336574 0.660134 0.005488 0.000830 0.984397 0.009284 0.023669 0.118123 0.018788 0.839420 0.463433 0.191325 0.081978 0.263264 0.287577 0.329453 0.235045 0.147924 0.340915 0.186772 0.186150 0.286163 0.295199 0.230759 0.178832 0.295210 Consensus sequence: HHHHGCTACKGTHVHH Alignment: HHHHGCTACKGTHVHH --CTGCTGBDBBDGBD ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00098 Rfx3_primary Original Motif Reverse Complement Forward 9 14 0.062845 Species: Mus musculus Original motif 0.218345 0.231533 0.152528 0.397594 0.264604 0.126115 0.320860 0.288421 0.117304 0.186844 0.172946 0.522906 0.111929 0.277908 0.409084 0.201079 0.343319 0.311376 0.123612 0.221692 0.193354 0.374280 0.157338 0.275028 0.166348 0.578991 0.130872 0.123789 0.006937 0.931183 0.046809 0.015072 0.255581 0.289587 0.125513 0.329319 0.002582 0.012615 0.002782 0.982021 0.850584 0.007973 0.140639 0.000803 0.037792 0.002285 0.957277 0.002646 0.009414 0.921481 0.001636 0.067469 0.943403 0.000980 0.042401 0.013216 0.991166 0.002931 0.003540 0.002364 0.003651 0.987110 0.001106 0.008133 0.208873 0.369705 0.319129 0.102292 0.322535 0.186617 0.374187 0.116660 0.326738 0.179486 0.226374 0.267402 0.299697 0.185329 0.133025 0.381949 0.300824 0.266836 0.096437 0.335904 0.418443 0.191068 0.127183 0.263306 0.386727 0.204062 0.126050 0.283161 Consensus sequence: HDTBHHCCHTAGCAACVVDHHHH Reverse complement motif 0.283161 0.204062 0.126050 0.386727 0.263306 0.191068 0.127183 0.418443 0.335904 0.266836 0.096437 0.300824 0.381949 0.185329 0.133025 0.299697 0.267402 0.179486 0.226374 0.326738 0.322535 0.374187 0.186617 0.116660 0.208873 0.319129 0.369705 0.102292 0.003651 0.001106 0.987110 0.008133 0.002364 0.002931 0.003540 0.991166 0.013216 0.000980 0.042401 0.943403 0.009414 0.001636 0.921481 0.067469 0.037792 0.957277 0.002285 0.002646 0.000803 0.007973 0.140639 0.850584 0.982021 0.012615 0.002782 0.002582 0.329319 0.289587 0.125513 0.255581 0.006937 0.046809 0.931183 0.015072 0.166348 0.130872 0.578991 0.123789 0.193354 0.157338 0.374280 0.275028 0.221692 0.311376 0.123612 0.343319 0.111929 0.409084 0.277908 0.201079 0.522906 0.186844 0.172946 0.117304 0.264604 0.320860 0.126115 0.288421 0.397594 0.231533 0.152528 0.218345 Consensus sequence: HHHHDVVGTTGCTAHGGDHBAHH Alignment: HHHHDVVGTTGCTAHGGDHBAHH --------CTGCTGBDBBDGBD- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00047 Zbtb7b_secondary Original Motif Reverse Complement Backward 1 14 0.063294 Species: Mus musculus Original motif 0.203365 0.307129 0.203712 0.285795 0.306328 0.182359 0.203143 0.308170 0.220878 0.174035 0.265341 0.339746 0.475421 0.085294 0.281054 0.158231 0.395971 0.330114 0.260810 0.013104 0.001970 0.006366 0.962058 0.029606 0.907785 0.081900 0.001279 0.009036 0.008745 0.981422 0.002970 0.006863 0.006791 0.966163 0.017605 0.009441 0.894233 0.081139 0.004949 0.019679 0.007553 0.970771 0.004892 0.016783 0.016719 0.797465 0.011842 0.173974 0.415678 0.189952 0.165207 0.229163 0.092707 0.182206 0.346121 0.378967 0.175722 0.130498 0.215118 0.478662 0.365762 0.163282 0.315788 0.155168 0.214734 0.272805 0.243194 0.269267 Consensus sequence: BDDRVGACCACCHBDVB Reverse complement motif 0.214734 0.243194 0.272805 0.269267 0.155168 0.163282 0.315788 0.365762 0.478662 0.130498 0.215118 0.175722 0.378967 0.182206 0.346121 0.092707 0.229163 0.189952 0.165207 0.415678 0.016719 0.011842 0.797465 0.173974 0.007553 0.004892 0.970771 0.016783 0.019679 0.081139 0.004949 0.894233 0.006791 0.017605 0.966163 0.009441 0.008745 0.002970 0.981422 0.006863 0.009036 0.081900 0.001279 0.907785 0.001970 0.962058 0.006366 0.029606 0.013104 0.330114 0.260810 0.395971 0.158231 0.085294 0.281054 0.475421 0.339746 0.174035 0.265341 0.220878 0.308170 0.182359 0.203143 0.306328 0.203365 0.203712 0.307129 0.285795 Consensus sequence: BBDVHGGTGGTCBKDDB Alignment: BBDVHGGTGGTCBKDDB ---CTGCTGBDBBDGBD ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 5 Motif ID: 89 Motif name: TFM1 Original motif 0.107143 0.642857 0.000000 0.250000 0.785714 0.035714 0.071429 0.107143 0.250000 0.714286 0.035714 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.892857 0.107143 0.000000 0.821429 0.142857 0.000000 0.035714 0.107143 0.785714 0.071429 0.035714 0.857143 0.000000 0.000000 0.142857 0.000000 0.928571 0.035714 0.035714 0.785714 0.000000 0.071429 0.142857 0.142857 0.571429 0.000000 0.285714 0.500000 0.000000 0.214286 0.285714 0.000000 0.821429 0.178571 0.000000 0.750000 0.178571 0.000000 0.071429 0.035714 0.821429 0.000000 0.142857 0.857143 0.035714 0.107143 0.000000 0.178571 0.642857 0.178571 0.000000 0.964286 0.000000 0.035714 0.000000 Consensus sequence: CACACACACACWCACACA Reserve complement motif 0.000000 0.000000 0.035714 0.964286 0.178571 0.178571 0.642857 0.000000 0.000000 0.035714 0.107143 0.857143 0.035714 0.000000 0.821429 0.142857 0.071429 0.178571 0.000000 0.750000 0.000000 0.178571 0.821429 0.000000 0.285714 0.000000 0.214286 0.500000 0.142857 0.000000 0.571429 0.285714 0.142857 0.000000 0.071429 0.785714 0.000000 0.035714 0.928571 0.035714 0.142857 0.000000 0.000000 0.857143 0.107143 0.071429 0.785714 0.035714 0.035714 0.142857 0.000000 0.821429 0.000000 0.107143 0.892857 0.000000 0.000000 0.000000 0.000000 1.000000 0.250000 0.035714 0.714286 0.000000 0.107143 0.035714 0.071429 0.785714 0.107143 0.000000 0.642857 0.250000 Consensus sequence: TGTGTGWGTGTGTGTGTG ************************************************************************ Best Matches for Motif ID 89 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v016060_secondary Original Motif Original Motif Backward 1 18 0.044206 Species: Mus musculus Original motif 0.168550 0.345968 0.396524 0.088958 0.038113 0.360882 0.114042 0.486963 0.349356 0.180599 0.051416 0.418629 0.258773 0.332518 0.244932 0.163778 0.371663 0.208591 0.263136 0.156609 0.225440 0.321741 0.175932 0.276887 0.100827 0.656850 0.018644 0.223679 0.494140 0.155427 0.327424 0.023009 0.105642 0.805846 0.027712 0.060800 0.065110 0.845072 0.058046 0.031772 0.649343 0.110180 0.180680 0.059797 0.064269 0.853604 0.066860 0.015268 0.437421 0.533797 0.016833 0.011948 0.121694 0.787708 0.016177 0.074421 0.625382 0.066925 0.266070 0.041623 0.117819 0.608153 0.165139 0.108889 0.145639 0.102001 0.604926 0.147434 0.521188 0.184986 0.064607 0.229219 0.180371 0.274237 0.096591 0.448801 0.071055 0.455813 0.332817 0.140315 0.084503 0.199982 0.448293 0.267222 0.389451 0.169545 0.155507 0.285497 0.424314 0.227621 0.101210 0.246855 Consensus sequence: VYWVVHCRCCACMCACGAHSBHH Reverse complement motif 0.246855 0.227621 0.101210 0.424314 0.285497 0.169545 0.155507 0.389451 0.084503 0.448293 0.199982 0.267222 0.071055 0.332817 0.455813 0.140315 0.448801 0.274237 0.096591 0.180371 0.229219 0.184986 0.064607 0.521188 0.145639 0.604926 0.102001 0.147434 0.117819 0.165139 0.608153 0.108889 0.041623 0.066925 0.266070 0.625382 0.121694 0.016177 0.787708 0.074421 0.437421 0.016833 0.533797 0.011948 0.064269 0.066860 0.853604 0.015268 0.059797 0.110180 0.180680 0.649343 0.065110 0.058046 0.845072 0.031772 0.105642 0.027712 0.805846 0.060800 0.023009 0.155427 0.327424 0.494140 0.100827 0.018644 0.656850 0.223679 0.225440 0.175932 0.321741 0.276887 0.156609 0.208591 0.263136 0.371663 0.258773 0.244932 0.332518 0.163778 0.418629 0.180599 0.051416 0.349356 0.486963 0.360882 0.114042 0.038113 0.168550 0.396524 0.345968 0.088958 Consensus sequence: HHBSHTCGTGRGTGGKGDBVWMV Alignment: VYWVVHCRCCACMCACGAHSBHH -----CACACACACACWCACACA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v016060_secondary Reverse Complement Original Motif Forward 1 18 0.044812 Species: Mus musculus Original motif 0.319838 0.171199 0.138099 0.370865 0.269358 0.196600 0.346909 0.187133 0.176807 0.338888 0.193903 0.290402 0.230268 0.119645 0.310500 0.339587 0.517372 0.257658 0.111673 0.113296 0.159477 0.126524 0.561119 0.152879 0.117072 0.553013 0.130919 0.198996 0.073372 0.163548 0.525014 0.238066 0.143608 0.186896 0.170528 0.498967 0.054943 0.079034 0.722992 0.143031 0.048852 0.015134 0.852458 0.083556 0.029001 0.023938 0.918900 0.028160 0.036727 0.092645 0.090591 0.780037 0.017757 0.057598 0.895222 0.029423 0.026113 0.048113 0.879744 0.046030 0.023041 0.787043 0.123490 0.066426 0.579766 0.004868 0.296873 0.118493 0.303862 0.042931 0.290151 0.363055 0.099672 0.237431 0.262301 0.400597 0.217788 0.163908 0.367628 0.250676 0.450783 0.141108 0.226137 0.181972 0.485086 0.102553 0.242662 0.169700 0.109057 0.454222 0.145665 0.291056 Consensus sequence: HVBDAGCGBGGGTGGCRDBDDDB Reverse complement motif 0.109057 0.145665 0.454222 0.291056 0.169700 0.102553 0.242662 0.485086 0.181972 0.141108 0.226137 0.450783 0.217788 0.367628 0.163908 0.250676 0.400597 0.237431 0.262301 0.099672 0.363055 0.042931 0.290151 0.303862 0.118493 0.004868 0.296873 0.579766 0.023041 0.123490 0.787043 0.066426 0.026113 0.879744 0.048113 0.046030 0.017757 0.895222 0.057598 0.029423 0.780037 0.092645 0.090591 0.036727 0.029001 0.918900 0.023938 0.028160 0.048852 0.852458 0.015134 0.083556 0.054943 0.722992 0.079034 0.143031 0.498967 0.186896 0.170528 0.143608 0.073372 0.525014 0.163548 0.238066 0.117072 0.130919 0.553013 0.198996 0.159477 0.561119 0.126524 0.152879 0.113296 0.257658 0.111673 0.517372 0.339587 0.119645 0.310500 0.230268 0.176807 0.193903 0.338888 0.290402 0.269358 0.346909 0.196600 0.187133 0.370865 0.171199 0.138099 0.319838 Consensus sequence: BDDHVDKGCCACCCVCGCTDBVH Alignment: BDDHVDKGCCACCCVCGCTDBVH TGTGTGWGTGTGTGTGTG----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00034 Sox7_secondary Reverse Complement Original Motif Forward 1 18 0.046994 Species: Mus musculus Original motif 0.067627 0.131333 0.654425 0.146615 0.156488 0.114442 0.145630 0.583441 0.206450 0.265630 0.358017 0.169903 0.090729 0.460713 0.274712 0.173847 0.285994 0.099998 0.154485 0.459523 0.635908 0.184787 0.072982 0.106323 0.748421 0.039204 0.092605 0.119769 0.081342 0.061327 0.044532 0.812799 0.143120 0.043879 0.024216 0.788785 0.247544 0.092102 0.621453 0.038901 0.295531 0.036295 0.027594 0.640580 0.194561 0.305468 0.339916 0.160055 0.175038 0.193568 0.101212 0.530182 0.145226 0.167488 0.559871 0.127415 0.271501 0.237429 0.206701 0.284369 0.216834 0.109191 0.569605 0.104370 0.182624 0.177160 0.300475 0.339742 0.331737 0.198645 0.265137 0.204482 0.230155 0.359365 0.183450 0.227029 0.056581 0.067297 0.463052 0.413070 0.198891 0.324626 0.304424 0.172059 0.181968 0.287547 0.202419 0.328066 Consensus sequence: GTVBDAATTGTVTGHGDDHKVB Reverse complement motif 0.328066 0.287547 0.202419 0.181968 0.198891 0.304424 0.324626 0.172059 0.056581 0.463052 0.067297 0.413070 0.230155 0.183450 0.359365 0.227029 0.204482 0.198645 0.265137 0.331737 0.339742 0.177160 0.300475 0.182624 0.216834 0.569605 0.109191 0.104370 0.284369 0.237429 0.206701 0.271501 0.145226 0.559871 0.167488 0.127415 0.530182 0.193568 0.101212 0.175038 0.194561 0.339916 0.305468 0.160055 0.640580 0.036295 0.027594 0.295531 0.247544 0.621453 0.092102 0.038901 0.788785 0.043879 0.024216 0.143120 0.812799 0.061327 0.044532 0.081342 0.119769 0.039204 0.092605 0.748421 0.106323 0.184787 0.072982 0.635908 0.459523 0.099998 0.154485 0.285994 0.090729 0.274712 0.460713 0.173847 0.206450 0.358017 0.265630 0.169903 0.583441 0.114442 0.145630 0.156488 0.067627 0.654425 0.131333 0.146615 Consensus sequence: VVYDDDCHCAVACAATTDBVAC Alignment: GTVBDAATTGTVTGHGDDHKVB TGTGTGWGTGTGTGTGTG---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v015681_secondary Original Motif Original Motif Forward 3 18 0.047476 Species: Mus musculus Original motif 0.404007 0.395873 0.173319 0.026801 0.305977 0.215534 0.215359 0.263130 0.370148 0.250957 0.113088 0.265808 0.324336 0.229498 0.174679 0.271487 0.263563 0.137896 0.079217 0.519324 0.265762 0.222582 0.082555 0.429102 0.206721 0.288405 0.017851 0.487023 0.164361 0.236500 0.061051 0.538088 0.593344 0.348446 0.050304 0.007906 0.031328 0.947050 0.007032 0.014590 0.010428 0.956605 0.029142 0.003825 0.459636 0.207616 0.155368 0.177380 0.014573 0.964608 0.012209 0.008610 0.066291 0.918196 0.008729 0.006784 0.019488 0.866774 0.018897 0.094841 0.767405 0.104198 0.029234 0.099164 0.052494 0.772531 0.039832 0.135142 0.296085 0.243498 0.350935 0.109482 0.518843 0.226659 0.124784 0.129714 0.647901 0.019721 0.159901 0.172477 0.113912 0.231511 0.214864 0.439713 0.223117 0.310596 0.293328 0.172959 0.185557 0.487662 0.136321 0.190459 Consensus sequence: MHHHWHYTMCCHCCCACVAABVH Reverse complement motif 0.185557 0.136321 0.487662 0.190459 0.223117 0.293328 0.310596 0.172959 0.439713 0.231511 0.214864 0.113912 0.172477 0.019721 0.159901 0.647901 0.129714 0.226659 0.124784 0.518843 0.296085 0.350935 0.243498 0.109482 0.052494 0.039832 0.772531 0.135142 0.099164 0.104198 0.029234 0.767405 0.019488 0.018897 0.866774 0.094841 0.066291 0.008729 0.918196 0.006784 0.014573 0.012209 0.964608 0.008610 0.177380 0.207616 0.155368 0.459636 0.010428 0.029142 0.956605 0.003825 0.031328 0.007032 0.947050 0.014590 0.007906 0.348446 0.050304 0.593344 0.538088 0.236500 0.061051 0.164361 0.487023 0.288405 0.017851 0.206721 0.429102 0.222582 0.082555 0.265762 0.519324 0.137896 0.079217 0.263563 0.271487 0.229498 0.174679 0.324336 0.265808 0.250957 0.113088 0.370148 0.263130 0.215534 0.215359 0.305977 0.026801 0.395873 0.173319 0.404007 Consensus sequence: DVVTTVGTGGGHGGYAMHWHHHY Alignment: MHHHWHYTMCCHCCCACVAABVH --CACACACACACWCACACA--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v016060_secondary Original Motif Original Motif Backward 2 18 0.048357 Species: Mus musculus Original motif 0.533199 0.080715 0.330435 0.055650 0.152031 0.212841 0.110234 0.524893 0.223934 0.264217 0.087037 0.424811 0.115097 0.339994 0.343861 0.201048 0.124993 0.418259 0.365642 0.091106 0.158365 0.292428 0.088361 0.460847 0.165479 0.561778 0.022254 0.250489 0.136873 0.259822 0.579763 0.023543 0.109570 0.747495 0.055128 0.087807 0.061912 0.792986 0.109031 0.036071 0.508703 0.267806 0.169766 0.053725 0.040912 0.838888 0.057470 0.062730 0.330554 0.606077 0.016192 0.047177 0.068079 0.563969 0.029742 0.338209 0.388799 0.291667 0.191284 0.128249 0.183283 0.578079 0.171100 0.067538 0.165163 0.097206 0.631377 0.106253 0.128564 0.435496 0.253275 0.182665 0.103395 0.088222 0.234758 0.573625 0.432879 0.276641 0.155895 0.134585 0.339199 0.148928 0.311036 0.200836 0.211958 0.298526 0.158443 0.331072 Consensus sequence: RTHBSYCGCCMCMYVCGBTVDH Reverse complement motif 0.331072 0.298526 0.158443 0.211958 0.200836 0.148928 0.311036 0.339199 0.134585 0.276641 0.155895 0.432879 0.573625 0.088222 0.234758 0.103395 0.128564 0.253275 0.435496 0.182665 0.165163 0.631377 0.097206 0.106253 0.183283 0.171100 0.578079 0.067538 0.128249 0.291667 0.191284 0.388799 0.068079 0.029742 0.563969 0.338209 0.330554 0.016192 0.606077 0.047177 0.040912 0.057470 0.838888 0.062730 0.053725 0.267806 0.169766 0.508703 0.061912 0.109031 0.792986 0.036071 0.109570 0.055128 0.747495 0.087807 0.136873 0.579763 0.259822 0.023543 0.165479 0.022254 0.561778 0.250489 0.460847 0.292428 0.088361 0.158365 0.124993 0.365642 0.418259 0.091106 0.115097 0.343861 0.339994 0.201048 0.424811 0.264217 0.087037 0.223934 0.524893 0.212841 0.110234 0.152031 0.055650 0.080715 0.330435 0.533199 Consensus sequence: HDBABCGBKRGYGGCGMSBHAK Alignment: RTHBSYCGCCMCMYVCGBTVDH ---CACACACACACWCACACA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00400 Zif268 Original Motif Original Motif Forward 6 18 0.050201 Species: Mus musculus Original motif 0.104824 0.412716 0.254506 0.227955 0.644922 0.065476 0.140479 0.149122 0.201205 0.166164 0.347131 0.285501 0.360606 0.256316 0.150766 0.232313 0.199831 0.240681 0.279350 0.280137 0.234308 0.204076 0.321306 0.240310 0.274112 0.462435 0.111425 0.152028 0.067070 0.717501 0.073934 0.141496 0.106745 0.084442 0.658566 0.150247 0.025128 0.967053 0.003585 0.004234 0.006412 0.982989 0.003227 0.007371 0.009588 0.877620 0.002571 0.110221 0.621521 0.355443 0.015669 0.007366 0.002600 0.980275 0.004191 0.012934 0.118773 0.026658 0.783843 0.070725 0.022358 0.822101 0.024684 0.130857 0.713212 0.080912 0.128793 0.077084 0.166568 0.250955 0.107934 0.474544 0.225040 0.222494 0.163301 0.389166 0.268976 0.223206 0.265314 0.242504 0.137052 0.229058 0.148439 0.485451 0.135819 0.304550 0.141994 0.417637 0.272440 0.319501 0.230580 0.177478 Consensus sequence: BADHBDHCGCCCMCGCAHHDBBV Reverse complement motif 0.272440 0.230580 0.319501 0.177478 0.417637 0.304550 0.141994 0.135819 0.485451 0.229058 0.148439 0.137052 0.242504 0.223206 0.265314 0.268976 0.389166 0.222494 0.163301 0.225040 0.474544 0.250955 0.107934 0.166568 0.077084 0.080912 0.128793 0.713212 0.022358 0.024684 0.822101 0.130857 0.118773 0.783843 0.026658 0.070725 0.002600 0.004191 0.980275 0.012934 0.007366 0.355443 0.015669 0.621521 0.009588 0.002571 0.877620 0.110221 0.006412 0.003227 0.982989 0.007371 0.025128 0.003585 0.967053 0.004234 0.106745 0.658566 0.084442 0.150247 0.067070 0.073934 0.717501 0.141496 0.274112 0.111425 0.462435 0.152028 0.234308 0.321306 0.204076 0.240310 0.280137 0.240681 0.279350 0.199831 0.232313 0.256316 0.150766 0.360606 0.201205 0.347131 0.166164 0.285501 0.149122 0.065476 0.140479 0.644922 0.104824 0.254506 0.412716 0.227955 Consensus sequence: VVVDHHTGCGYGGGCGDHVHHTB Alignment: BADHBDHCGCCCMCGCAHHDBBV -----CACACACACACWCACACA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00526 Foxn1_secondary Reverse Complement Reverse Complement Forward 4 18 0.055757 Species: Mus musculus Original motif 0.477863 0.106306 0.184102 0.231729 0.304951 0.149020 0.361418 0.184612 0.548996 0.056128 0.348902 0.045974 0.385727 0.477782 0.086218 0.050273 0.409556 0.232265 0.173851 0.184328 0.174550 0.312880 0.307123 0.205448 0.850398 0.047204 0.041665 0.060734 0.141234 0.548534 0.142230 0.168002 0.059462 0.026354 0.892948 0.021236 0.053714 0.870297 0.028935 0.047055 0.086273 0.069147 0.805284 0.039296 0.033781 0.573881 0.034115 0.358223 0.035191 0.079663 0.824970 0.060176 0.051830 0.862631 0.019359 0.066180 0.178685 0.015738 0.762485 0.043092 0.058988 0.042615 0.017608 0.880789 0.202382 0.173360 0.284095 0.340163 0.098493 0.234651 0.506524 0.160333 0.109087 0.336204 0.250510 0.304198 0.130945 0.250843 0.177122 0.441090 0.353830 0.138838 0.162784 0.344548 0.114290 0.417163 0.160662 0.307885 Consensus sequence: DDRMHBACGCGYGCGTDGBBDB Reverse complement motif 0.114290 0.160662 0.417163 0.307885 0.344548 0.138838 0.162784 0.353830 0.441090 0.250843 0.177122 0.130945 0.109087 0.250510 0.336204 0.304198 0.098493 0.506524 0.234651 0.160333 0.340163 0.173360 0.284095 0.202382 0.880789 0.042615 0.017608 0.058988 0.178685 0.762485 0.015738 0.043092 0.051830 0.019359 0.862631 0.066180 0.035191 0.824970 0.079663 0.060176 0.033781 0.034115 0.573881 0.358223 0.086273 0.805284 0.069147 0.039296 0.053714 0.028935 0.870297 0.047055 0.059462 0.892948 0.026354 0.021236 0.141234 0.142230 0.548534 0.168002 0.060734 0.047204 0.041665 0.850398 0.174550 0.307123 0.312880 0.205448 0.184328 0.232265 0.173851 0.409556 0.385727 0.086218 0.477782 0.050273 0.045974 0.056128 0.348902 0.548996 0.304951 0.361418 0.149020 0.184612 0.231729 0.106306 0.184102 0.477863 Consensus sequence: BDVBCDACGCKCGCGTBHRKHD Alignment: BDVBCDACGCKCGCGTBHRKHD ---TGTGTGWGTGTGTGTGTG- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00096 Sox13_secondary Original Motif Reverse Complement Backward 1 17 0.549115 Species: Mus musculus Original motif 0.262581 0.115233 0.405525 0.216661 0.246681 0.142854 0.145056 0.465409 0.341041 0.154355 0.306628 0.197976 0.242211 0.263918 0.113187 0.380684 0.119326 0.241913 0.117198 0.521563 0.054120 0.036135 0.784219 0.125525 0.076634 0.048399 0.788586 0.086381 0.215316 0.044119 0.663927 0.076638 0.248538 0.159141 0.015452 0.576869 0.047049 0.083570 0.788798 0.080583 0.071948 0.035098 0.768849 0.124105 0.123777 0.030383 0.713425 0.132415 0.294760 0.182119 0.181553 0.341567 0.516589 0.129377 0.116698 0.237336 0.350326 0.186505 0.112598 0.350571 0.311469 0.198085 0.147986 0.342460 0.185126 0.130721 0.242572 0.441582 Consensus sequence: DDDHTGGGTGGGHAHHD Reverse complement motif 0.441582 0.130721 0.242572 0.185126 0.342460 0.198085 0.147986 0.311469 0.350571 0.186505 0.112598 0.350326 0.237336 0.129377 0.116698 0.516589 0.341567 0.182119 0.181553 0.294760 0.123777 0.713425 0.030383 0.132415 0.071948 0.768849 0.035098 0.124105 0.047049 0.788798 0.083570 0.080583 0.576869 0.159141 0.015452 0.248538 0.215316 0.663927 0.044119 0.076638 0.076634 0.788586 0.048399 0.086381 0.054120 0.784219 0.036135 0.125525 0.521563 0.241913 0.117198 0.119326 0.380684 0.263918 0.113187 0.242211 0.197976 0.154355 0.306628 0.341041 0.465409 0.142854 0.145056 0.246681 0.262581 0.405525 0.115233 0.216661 Consensus sequence: DHHTHCCCACCCAHDDH Alignment: -DHHTHCCCACCCAHDDH CACACACACACWCACACA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v015681_primary Original Motif Original Motif Forward 7 17 0.550082 Species: Mus musculus Original motif 0.183797 0.268049 0.330111 0.218043 0.127599 0.330310 0.243614 0.298477 0.143199 0.188046 0.268593 0.400162 0.214690 0.205230 0.247090 0.332990 0.294688 0.299104 0.327152 0.079056 0.221909 0.193223 0.480155 0.104712 0.444072 0.068239 0.481838 0.005852 0.006182 0.015429 0.901278 0.077111 0.766535 0.111138 0.121632 0.000696 0.014848 0.973961 0.000298 0.010893 0.001807 0.992200 0.002669 0.003324 0.795344 0.140510 0.018576 0.045571 0.006990 0.988200 0.002510 0.002299 0.154898 0.842296 0.000998 0.001808 0.029577 0.919262 0.006935 0.044226 0.677987 0.032075 0.185065 0.104874 0.195132 0.364580 0.319321 0.120967 0.225412 0.115034 0.612849 0.046705 0.548628 0.058900 0.162857 0.229616 0.112531 0.340331 0.165910 0.381227 0.073029 0.303078 0.363896 0.259997 0.561485 0.260567 0.092979 0.084969 0.132283 0.457691 0.140159 0.269867 Consensus sequence: BBBDVVRGACCACCCAVGABBAB Reverse complement motif 0.132283 0.140159 0.457691 0.269867 0.084969 0.260567 0.092979 0.561485 0.073029 0.363896 0.303078 0.259997 0.381227 0.340331 0.165910 0.112531 0.229616 0.058900 0.162857 0.548628 0.225412 0.612849 0.115034 0.046705 0.195132 0.319321 0.364580 0.120967 0.104874 0.032075 0.185065 0.677987 0.029577 0.006935 0.919262 0.044226 0.154898 0.000998 0.842296 0.001808 0.006990 0.002510 0.988200 0.002299 0.045571 0.140510 0.018576 0.795344 0.001807 0.002669 0.992200 0.003324 0.014848 0.000298 0.973961 0.010893 0.000696 0.111138 0.121632 0.766535 0.006182 0.901278 0.015429 0.077111 0.444072 0.481838 0.068239 0.005852 0.221909 0.480155 0.193223 0.104712 0.294688 0.327152 0.299104 0.079056 0.332990 0.205230 0.247090 0.214690 0.400162 0.188046 0.268593 0.143199 0.127599 0.243614 0.330310 0.298477 0.183797 0.330111 0.268049 0.218043 Consensus sequence: BTBVTCVTGGGTGGTCMVVDVBB Alignment: BBBDVVRGACCACCCAVGABBAB- ------CACACACACACWCACACA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00228 Bapx1 Original Motif Original Motif Backward 2 17 0.553591 Species: Mus musculus Original motif 0.301697 0.347856 0.239075 0.111372 0.364458 0.225587 0.074842 0.335112 0.228472 0.141747 0.139010 0.490770 0.559532 0.164793 0.197557 0.078118 0.506611 0.130882 0.113226 0.249281 0.054222 0.680706 0.257913 0.007160 0.001978 0.899030 0.000622 0.098369 0.950561 0.002121 0.000888 0.046429 0.037529 0.960534 0.000660 0.001278 0.001571 0.005538 0.001403 0.991487 0.001274 0.052527 0.000520 0.945679 0.926306 0.006886 0.003823 0.062985 0.638246 0.038639 0.145042 0.178072 0.266452 0.337698 0.283972 0.111878 0.307019 0.250170 0.243307 0.199504 0.550380 0.190997 0.122920 0.135703 0.187982 0.330356 0.168897 0.312765 Consensus sequence: VHHAACCACTTAAVVAH Reverse complement motif 0.187982 0.168897 0.330356 0.312765 0.135703 0.190997 0.122920 0.550380 0.199504 0.250170 0.243307 0.307019 0.266452 0.283972 0.337698 0.111878 0.178072 0.038639 0.145042 0.638246 0.062985 0.006886 0.003823 0.926306 0.945679 0.052527 0.000520 0.001274 0.991487 0.005538 0.001403 0.001571 0.037529 0.000660 0.960534 0.001278 0.046429 0.002121 0.000888 0.950561 0.001978 0.000622 0.899030 0.098369 0.054222 0.257913 0.680706 0.007160 0.249281 0.130882 0.113226 0.506611 0.078118 0.164793 0.197557 0.559532 0.490770 0.141747 0.139010 0.228472 0.335112 0.225587 0.074842 0.364458 0.301697 0.239075 0.347856 0.111372 Consensus sequence: DTBVTTAAGTGGTTHHV Alignment: -VHHAACCACTTAAVVAH CACACACACACWCACACA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 5 Motif ID: 90 Motif name: TFM2 Original motif 0.105634 0.514085 0.154930 0.225352 0.239437 0.408451 0.098592 0.253521 0.302817 0.239437 0.042254 0.415493 0.147887 0.598592 0.169014 0.084507 0.316901 0.422535 0.021127 0.239437 0.049296 0.380282 0.218310 0.352113 0.183099 0.133803 0.091549 0.591549 0.000000 0.598592 0.246479 0.154930 0.070423 0.753521 0.000000 0.176056 0.232394 0.000000 0.063380 0.704225 0.000000 0.394366 0.556338 0.049296 0.035211 0.901408 0.000000 0.063380 0.056338 0.591549 0.000000 0.352113 0.119718 0.246479 0.028169 0.605634 0.028169 0.626761 0.253521 0.091549 0.211268 0.000000 0.077465 0.711268 0.063380 0.190141 0.654930 0.091549 0.126761 0.584507 0.000000 0.288732 Consensus sequence: CHHCHBTCCTSCYTCTGC Reserve complement motif 0.126761 0.000000 0.584507 0.288732 0.063380 0.654930 0.190141 0.091549 0.711268 0.000000 0.077465 0.211268 0.028169 0.253521 0.626761 0.091549 0.605634 0.246479 0.028169 0.119718 0.056338 0.000000 0.591549 0.352113 0.035211 0.000000 0.901408 0.063380 0.000000 0.556338 0.394366 0.049296 0.704225 0.000000 0.063380 0.232394 0.070423 0.000000 0.753521 0.176056 0.000000 0.246479 0.598592 0.154930 0.591549 0.133803 0.091549 0.183099 0.049296 0.218310 0.380282 0.352113 0.316901 0.021127 0.422535 0.239437 0.147887 0.169014 0.598592 0.084507 0.415493 0.239437 0.042254 0.302817 0.239437 0.098592 0.408451 0.253521 0.105634 0.154930 0.514085 0.225352 Consensus sequence: GCAGAKGSAGGABDGHDG ************************************************************************ Best Matches for Motif ID 90 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v016060_secondary Original Motif Original Motif Forward 1 18 0.049879 Species: Mus musculus Original motif 0.533199 0.080715 0.330435 0.055650 0.152031 0.212841 0.110234 0.524893 0.223934 0.264217 0.087037 0.424811 0.115097 0.339994 0.343861 0.201048 0.124993 0.418259 0.365642 0.091106 0.158365 0.292428 0.088361 0.460847 0.165479 0.561778 0.022254 0.250489 0.136873 0.259822 0.579763 0.023543 0.109570 0.747495 0.055128 0.087807 0.061912 0.792986 0.109031 0.036071 0.508703 0.267806 0.169766 0.053725 0.040912 0.838888 0.057470 0.062730 0.330554 0.606077 0.016192 0.047177 0.068079 0.563969 0.029742 0.338209 0.388799 0.291667 0.191284 0.128249 0.183283 0.578079 0.171100 0.067538 0.165163 0.097206 0.631377 0.106253 0.128564 0.435496 0.253275 0.182665 0.103395 0.088222 0.234758 0.573625 0.432879 0.276641 0.155895 0.134585 0.339199 0.148928 0.311036 0.200836 0.211958 0.298526 0.158443 0.331072 Consensus sequence: RTHBSYCGCCMCMYVCGBTVDH Reverse complement motif 0.331072 0.298526 0.158443 0.211958 0.200836 0.148928 0.311036 0.339199 0.134585 0.276641 0.155895 0.432879 0.573625 0.088222 0.234758 0.103395 0.128564 0.253275 0.435496 0.182665 0.165163 0.631377 0.097206 0.106253 0.183283 0.171100 0.578079 0.067538 0.128249 0.291667 0.191284 0.388799 0.068079 0.029742 0.563969 0.338209 0.330554 0.016192 0.606077 0.047177 0.040912 0.057470 0.838888 0.062730 0.053725 0.267806 0.169766 0.508703 0.061912 0.109031 0.792986 0.036071 0.109570 0.055128 0.747495 0.087807 0.136873 0.579763 0.259822 0.023543 0.165479 0.022254 0.561778 0.250489 0.460847 0.292428 0.088361 0.158365 0.124993 0.365642 0.418259 0.091106 0.115097 0.343861 0.339994 0.201048 0.424811 0.264217 0.087037 0.223934 0.524893 0.212841 0.110234 0.152031 0.055650 0.080715 0.330435 0.533199 Consensus sequence: HDBABCGBKRGYGGCGMSBHAK Alignment: RTHBSYCGCCMCMYVCGBTVDH CHHCHBTCCTSCYTCTGC---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00528 Foxm1_primary Reverse Complement Original Motif Backward 1 18 0.056442 Species: Mus musculus Original motif 0.402634 0.249702 0.143705 0.203959 0.709619 0.108953 0.130781 0.050647 0.334232 0.077498 0.228818 0.359452 0.131721 0.094794 0.234481 0.539005 0.170102 0.237609 0.252464 0.339824 0.244961 0.347304 0.228129 0.179606 0.612141 0.132244 0.180110 0.075504 0.472236 0.042388 0.234419 0.250957 0.125213 0.007413 0.849788 0.017587 0.702068 0.064216 0.141992 0.091724 0.008657 0.038238 0.002959 0.950145 0.007170 0.002244 0.986824 0.003763 0.002862 0.979956 0.000711 0.016471 0.971196 0.001954 0.011441 0.015409 0.105575 0.031482 0.022836 0.840107 0.031534 0.736742 0.032785 0.198939 0.479153 0.347558 0.031799 0.141490 0.056405 0.123140 0.023989 0.796466 0.111194 0.195344 0.501360 0.192102 0.376359 0.416820 0.072818 0.134004 0.225111 0.249460 0.306563 0.218866 0.405251 0.168478 0.108618 0.317653 0.165386 0.191749 0.268604 0.374261 Consensus sequence: HADTBVADGATGCATCMTGMVHB Reverse complement motif 0.374261 0.191749 0.268604 0.165386 0.317653 0.168478 0.108618 0.405251 0.225111 0.306563 0.249460 0.218866 0.376359 0.072818 0.416820 0.134004 0.111194 0.501360 0.195344 0.192102 0.796466 0.123140 0.023989 0.056405 0.141490 0.347558 0.031799 0.479153 0.031534 0.032785 0.736742 0.198939 0.840107 0.031482 0.022836 0.105575 0.015409 0.001954 0.011441 0.971196 0.002862 0.000711 0.979956 0.016471 0.007170 0.986824 0.002244 0.003763 0.950145 0.038238 0.002959 0.008657 0.091724 0.064216 0.141992 0.702068 0.125213 0.849788 0.007413 0.017587 0.250957 0.042388 0.234419 0.472236 0.075504 0.132244 0.180110 0.612141 0.244961 0.228129 0.347304 0.179606 0.339824 0.237609 0.252464 0.170102 0.539005 0.094794 0.234481 0.131721 0.359452 0.077498 0.228818 0.334232 0.050647 0.108953 0.130781 0.709619 0.203959 0.249702 0.143705 0.402634 Consensus sequence: VHVRCAYGATGCATCDTVVADTH Alignment: HADTBVADGATGCATCMTGMVHB -----GCAGAKGSAGGABDGHDG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v015681_secondary Original Motif Reverse Complement Backward 5 18 0.056596 Species: Mus musculus Original motif 0.331499 0.188505 0.182841 0.297156 0.328961 0.213025 0.273530 0.184484 0.197213 0.129292 0.524914 0.148581 0.274491 0.226406 0.312118 0.186986 0.103231 0.393726 0.364988 0.138055 0.552594 0.166422 0.186262 0.094722 0.157618 0.064773 0.616497 0.161112 0.139166 0.176098 0.621185 0.063551 0.748420 0.062398 0.012447 0.176735 0.116584 0.009438 0.860326 0.013653 0.005030 0.003646 0.974877 0.016447 0.055257 0.007181 0.921760 0.015802 0.032748 0.058249 0.052709 0.856293 0.105606 0.872231 0.014370 0.007793 0.019480 0.497379 0.125899 0.357242 0.478582 0.269713 0.061464 0.190242 0.253985 0.287006 0.201320 0.257689 0.319384 0.210231 0.175842 0.294543 0.222123 0.287802 0.201294 0.288782 0.139951 0.376041 0.081133 0.402875 0.213450 0.343835 0.383676 0.059039 0.322294 0.355918 0.148062 0.173725 Consensus sequence: HVGVSAGGAGGGTCYHHHHYVH Reverse complement motif 0.322294 0.148062 0.355918 0.173725 0.213450 0.383676 0.343835 0.059039 0.402875 0.376041 0.081133 0.139951 0.288782 0.287802 0.201294 0.222123 0.294543 0.210231 0.175842 0.319384 0.253985 0.201320 0.287006 0.257689 0.190242 0.269713 0.061464 0.478582 0.019480 0.125899 0.497379 0.357242 0.105606 0.014370 0.872231 0.007793 0.856293 0.058249 0.052709 0.032748 0.055257 0.921760 0.007181 0.015802 0.005030 0.974877 0.003646 0.016447 0.116584 0.860326 0.009438 0.013653 0.176735 0.062398 0.012447 0.748420 0.139166 0.621185 0.176098 0.063551 0.157618 0.616497 0.064773 0.161112 0.094722 0.166422 0.186262 0.552594 0.103231 0.364988 0.393726 0.138055 0.274491 0.312118 0.226406 0.186986 0.197213 0.524914 0.129292 0.148581 0.184484 0.213025 0.273530 0.328961 0.297156 0.188505 0.182841 0.331499 Consensus sequence: DVMHHDHKGACCCTCCTSVCBH Alignment: DVMHHDHKGACCCTCCTSVCBH CHHCHBTCCTSCYTCTGC---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v016060_secondary Original Motif Reverse Complement Backward 6 18 0.057335 Species: Mus musculus Original motif 0.319838 0.171199 0.138099 0.370865 0.269358 0.196600 0.346909 0.187133 0.176807 0.338888 0.193903 0.290402 0.230268 0.119645 0.310500 0.339587 0.517372 0.257658 0.111673 0.113296 0.159477 0.126524 0.561119 0.152879 0.117072 0.553013 0.130919 0.198996 0.073372 0.163548 0.525014 0.238066 0.143608 0.186896 0.170528 0.498967 0.054943 0.079034 0.722992 0.143031 0.048852 0.015134 0.852458 0.083556 0.029001 0.023938 0.918900 0.028160 0.036727 0.092645 0.090591 0.780037 0.017757 0.057598 0.895222 0.029423 0.026113 0.048113 0.879744 0.046030 0.023041 0.787043 0.123490 0.066426 0.579766 0.004868 0.296873 0.118493 0.303862 0.042931 0.290151 0.363055 0.099672 0.237431 0.262301 0.400597 0.217788 0.163908 0.367628 0.250676 0.450783 0.141108 0.226137 0.181972 0.485086 0.102553 0.242662 0.169700 0.109057 0.454222 0.145665 0.291056 Consensus sequence: HVBDAGCGBGGGTGGCRDBDDDB Reverse complement motif 0.109057 0.145665 0.454222 0.291056 0.169700 0.102553 0.242662 0.485086 0.181972 0.141108 0.226137 0.450783 0.217788 0.367628 0.163908 0.250676 0.400597 0.237431 0.262301 0.099672 0.363055 0.042931 0.290151 0.303862 0.118493 0.004868 0.296873 0.579766 0.023041 0.123490 0.787043 0.066426 0.026113 0.879744 0.048113 0.046030 0.017757 0.895222 0.057598 0.029423 0.780037 0.092645 0.090591 0.036727 0.029001 0.918900 0.023938 0.028160 0.048852 0.852458 0.015134 0.083556 0.054943 0.722992 0.079034 0.143031 0.498967 0.186896 0.170528 0.143608 0.073372 0.525014 0.163548 0.238066 0.117072 0.130919 0.553013 0.198996 0.159477 0.561119 0.126524 0.152879 0.113296 0.257658 0.111673 0.517372 0.339587 0.119645 0.310500 0.230268 0.176807 0.193903 0.338888 0.290402 0.269358 0.346909 0.196600 0.187133 0.370865 0.171199 0.138099 0.319838 Consensus sequence: BDDHVDKGCCACCCVCGCTDBVH Alignment: BDDHVDKGCCACCCVCGCTDBVH CHHCHBTCCTSCYTCTGC----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v016060_secondary Original Motif Original Motif Backward 6 18 0.059861 Species: Mus musculus Original motif 0.168550 0.345968 0.396524 0.088958 0.038113 0.360882 0.114042 0.486963 0.349356 0.180599 0.051416 0.418629 0.258773 0.332518 0.244932 0.163778 0.371663 0.208591 0.263136 0.156609 0.225440 0.321741 0.175932 0.276887 0.100827 0.656850 0.018644 0.223679 0.494140 0.155427 0.327424 0.023009 0.105642 0.805846 0.027712 0.060800 0.065110 0.845072 0.058046 0.031772 0.649343 0.110180 0.180680 0.059797 0.064269 0.853604 0.066860 0.015268 0.437421 0.533797 0.016833 0.011948 0.121694 0.787708 0.016177 0.074421 0.625382 0.066925 0.266070 0.041623 0.117819 0.608153 0.165139 0.108889 0.145639 0.102001 0.604926 0.147434 0.521188 0.184986 0.064607 0.229219 0.180371 0.274237 0.096591 0.448801 0.071055 0.455813 0.332817 0.140315 0.084503 0.199982 0.448293 0.267222 0.389451 0.169545 0.155507 0.285497 0.424314 0.227621 0.101210 0.246855 Consensus sequence: VYWVVHCRCCACMCACGAHSBHH Reverse complement motif 0.246855 0.227621 0.101210 0.424314 0.285497 0.169545 0.155507 0.389451 0.084503 0.448293 0.199982 0.267222 0.071055 0.332817 0.455813 0.140315 0.448801 0.274237 0.096591 0.180371 0.229219 0.184986 0.064607 0.521188 0.145639 0.604926 0.102001 0.147434 0.117819 0.165139 0.608153 0.108889 0.041623 0.066925 0.266070 0.625382 0.121694 0.016177 0.787708 0.074421 0.437421 0.016833 0.533797 0.011948 0.064269 0.066860 0.853604 0.015268 0.059797 0.110180 0.180680 0.649343 0.065110 0.058046 0.845072 0.031772 0.105642 0.027712 0.805846 0.060800 0.023009 0.155427 0.327424 0.494140 0.100827 0.018644 0.656850 0.223679 0.225440 0.175932 0.321741 0.276887 0.156609 0.208591 0.263136 0.371663 0.258773 0.244932 0.332518 0.163778 0.418629 0.180599 0.051416 0.349356 0.486963 0.360882 0.114042 0.038113 0.168550 0.396524 0.345968 0.088958 Consensus sequence: HHBSHTCGTGRGTGGKGDBVWMV Alignment: VYWVVHCRCCACMCACGAHSBHH CHHCHBTCCTSCYTCTGC----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v015681_secondary Original Motif Original Motif Backward 4 18 0.059878 Species: Mus musculus Original motif 0.404007 0.395873 0.173319 0.026801 0.305977 0.215534 0.215359 0.263130 0.370148 0.250957 0.113088 0.265808 0.324336 0.229498 0.174679 0.271487 0.263563 0.137896 0.079217 0.519324 0.265762 0.222582 0.082555 0.429102 0.206721 0.288405 0.017851 0.487023 0.164361 0.236500 0.061051 0.538088 0.593344 0.348446 0.050304 0.007906 0.031328 0.947050 0.007032 0.014590 0.010428 0.956605 0.029142 0.003825 0.459636 0.207616 0.155368 0.177380 0.014573 0.964608 0.012209 0.008610 0.066291 0.918196 0.008729 0.006784 0.019488 0.866774 0.018897 0.094841 0.767405 0.104198 0.029234 0.099164 0.052494 0.772531 0.039832 0.135142 0.296085 0.243498 0.350935 0.109482 0.518843 0.226659 0.124784 0.129714 0.647901 0.019721 0.159901 0.172477 0.113912 0.231511 0.214864 0.439713 0.223117 0.310596 0.293328 0.172959 0.185557 0.487662 0.136321 0.190459 Consensus sequence: MHHHWHYTMCCHCCCACVAABVH Reverse complement motif 0.185557 0.136321 0.487662 0.190459 0.223117 0.293328 0.310596 0.172959 0.439713 0.231511 0.214864 0.113912 0.172477 0.019721 0.159901 0.647901 0.129714 0.226659 0.124784 0.518843 0.296085 0.350935 0.243498 0.109482 0.052494 0.039832 0.772531 0.135142 0.099164 0.104198 0.029234 0.767405 0.019488 0.018897 0.866774 0.094841 0.066291 0.008729 0.918196 0.006784 0.014573 0.012209 0.964608 0.008610 0.177380 0.207616 0.155368 0.459636 0.010428 0.029142 0.956605 0.003825 0.031328 0.007032 0.947050 0.014590 0.007906 0.348446 0.050304 0.593344 0.538088 0.236500 0.061051 0.164361 0.487023 0.288405 0.017851 0.206721 0.429102 0.222582 0.082555 0.265762 0.519324 0.137896 0.079217 0.263563 0.271487 0.229498 0.174679 0.324336 0.265808 0.250957 0.113088 0.370148 0.263130 0.215534 0.215359 0.305977 0.026801 0.395873 0.173319 0.404007 Consensus sequence: DVVTTVGTGGGHGGYAMHWHHHY Alignment: MHHHWHYTMCCHCCCACVAABVH --CHHCHBTCCTSCYTCTGC--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00034 Sox7_secondary Reverse Complement Original Motif Forward 3 18 0.060645 Species: Mus musculus Original motif 0.067627 0.131333 0.654425 0.146615 0.156488 0.114442 0.145630 0.583441 0.206450 0.265630 0.358017 0.169903 0.090729 0.460713 0.274712 0.173847 0.285994 0.099998 0.154485 0.459523 0.635908 0.184787 0.072982 0.106323 0.748421 0.039204 0.092605 0.119769 0.081342 0.061327 0.044532 0.812799 0.143120 0.043879 0.024216 0.788785 0.247544 0.092102 0.621453 0.038901 0.295531 0.036295 0.027594 0.640580 0.194561 0.305468 0.339916 0.160055 0.175038 0.193568 0.101212 0.530182 0.145226 0.167488 0.559871 0.127415 0.271501 0.237429 0.206701 0.284369 0.216834 0.109191 0.569605 0.104370 0.182624 0.177160 0.300475 0.339742 0.331737 0.198645 0.265137 0.204482 0.230155 0.359365 0.183450 0.227029 0.056581 0.067297 0.463052 0.413070 0.198891 0.324626 0.304424 0.172059 0.181968 0.287547 0.202419 0.328066 Consensus sequence: GTVBDAATTGTVTGHGDDHKVB Reverse complement motif 0.328066 0.287547 0.202419 0.181968 0.198891 0.304424 0.324626 0.172059 0.056581 0.463052 0.067297 0.413070 0.230155 0.183450 0.359365 0.227029 0.204482 0.198645 0.265137 0.331737 0.339742 0.177160 0.300475 0.182624 0.216834 0.569605 0.109191 0.104370 0.284369 0.237429 0.206701 0.271501 0.145226 0.559871 0.167488 0.127415 0.530182 0.193568 0.101212 0.175038 0.194561 0.339916 0.305468 0.160055 0.640580 0.036295 0.027594 0.295531 0.247544 0.621453 0.092102 0.038901 0.788785 0.043879 0.024216 0.143120 0.812799 0.061327 0.044532 0.081342 0.119769 0.039204 0.092605 0.748421 0.106323 0.184787 0.072982 0.635908 0.459523 0.099998 0.154485 0.285994 0.090729 0.274712 0.460713 0.173847 0.206450 0.358017 0.265630 0.169903 0.583441 0.114442 0.145630 0.156488 0.067627 0.654425 0.131333 0.146615 Consensus sequence: VVYDDDCHCAVACAATTDBVAC Alignment: GTVBDAATTGTVTGHGDDHKVB --GCAGAKGSAGGABDGHDG-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v015681_secondary Original Motif Reverse Complement Backward 4 18 0.062629 Species: Mus musculus Original motif 0.214165 0.143436 0.372522 0.269876 0.314445 0.406003 0.160351 0.119201 0.137147 0.092924 0.042921 0.727007 0.044121 0.072843 0.051741 0.831295 0.261292 0.324124 0.298498 0.116086 0.258125 0.323243 0.263362 0.155271 0.204557 0.589399 0.107153 0.098891 0.371021 0.244027 0.291102 0.093849 0.096327 0.572718 0.011797 0.319159 0.027282 0.046183 0.844519 0.082016 0.018921 0.012887 0.915917 0.052275 0.364793 0.166722 0.084229 0.384256 0.028216 0.011233 0.951056 0.009495 0.054974 0.004738 0.890377 0.049911 0.006802 0.312915 0.134247 0.546036 0.241289 0.628210 0.104788 0.025713 0.237863 0.302807 0.213018 0.246311 0.349399 0.203220 0.086635 0.360746 0.386634 0.144693 0.246895 0.221779 0.425101 0.354676 0.093374 0.126849 0.060272 0.391320 0.104905 0.443503 0.162090 0.190233 0.227433 0.420244 Consensus sequence: DVTTVVCVYGGHGGYCHHDMYB Reverse complement motif 0.420244 0.190233 0.227433 0.162090 0.443503 0.391320 0.104905 0.060272 0.126849 0.354676 0.093374 0.425101 0.221779 0.144693 0.246895 0.386634 0.360746 0.203220 0.086635 0.349399 0.237863 0.213018 0.302807 0.246311 0.241289 0.104788 0.628210 0.025713 0.546036 0.312915 0.134247 0.006802 0.054974 0.890377 0.004738 0.049911 0.028216 0.951056 0.011233 0.009495 0.384256 0.166722 0.084229 0.364793 0.018921 0.915917 0.012887 0.052275 0.027282 0.844519 0.046183 0.082016 0.096327 0.011797 0.572718 0.319159 0.093849 0.244027 0.291102 0.371021 0.204557 0.107153 0.589399 0.098891 0.258125 0.263362 0.323243 0.155271 0.261292 0.298498 0.324124 0.116086 0.831295 0.072843 0.051741 0.044121 0.727007 0.092924 0.042921 0.137147 0.314445 0.160351 0.406003 0.119201 0.214165 0.372522 0.143436 0.269876 Consensus sequence: VMYDHDGMCCHCCKBGVVAAVH Alignment: VMYDHDGMCCHCCKBGVVAAVH -CHHCHBTCCTSCYTCTGC--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00527 Foxn4_secondary Original Motif Reverse Complement Backward 4 18 0.062657 Species: Mus musculus Original motif 0.298336 0.418632 0.208054 0.074978 0.289907 0.015608 0.457100 0.237385 0.273583 0.077889 0.107860 0.540668 0.184954 0.161611 0.384390 0.269045 0.521826 0.156340 0.089019 0.232815 0.356716 0.131104 0.394857 0.117323 0.266669 0.108765 0.505273 0.119293 0.020778 0.047199 0.919524 0.012500 0.948536 0.018775 0.008113 0.024576 0.010822 0.964042 0.014701 0.010434 0.007428 0.019505 0.966351 0.006717 0.010025 0.975678 0.008648 0.005649 0.043796 0.120935 0.742979 0.092289 0.008252 0.250704 0.541132 0.199913 0.474428 0.044681 0.134430 0.346461 0.146597 0.421317 0.143166 0.288920 0.020540 0.181479 0.553811 0.244170 0.129612 0.173360 0.535219 0.161808 0.506084 0.158156 0.130983 0.204776 0.054872 0.103043 0.545792 0.296293 0.389882 0.171037 0.164162 0.274918 0.225861 0.314031 0.288872 0.171237 Consensus sequence: VDWDARRGACGCGGWHGGAKHV Reverse complement motif 0.225861 0.288872 0.314031 0.171237 0.274918 0.171037 0.164162 0.389882 0.054872 0.545792 0.103043 0.296293 0.204776 0.158156 0.130983 0.506084 0.129612 0.535219 0.173360 0.161808 0.020540 0.553811 0.181479 0.244170 0.146597 0.143166 0.421317 0.288920 0.346461 0.044681 0.134430 0.474428 0.008252 0.541132 0.250704 0.199913 0.043796 0.742979 0.120935 0.092289 0.010025 0.008648 0.975678 0.005649 0.007428 0.966351 0.019505 0.006717 0.010822 0.014701 0.964042 0.010434 0.024576 0.018775 0.008113 0.948536 0.020778 0.919524 0.047199 0.012500 0.266669 0.505273 0.108765 0.119293 0.356716 0.394857 0.131104 0.117323 0.232815 0.156340 0.089019 0.521826 0.184954 0.384390 0.161611 0.269045 0.540668 0.077889 0.107860 0.273583 0.289907 0.457100 0.015608 0.237385 0.298336 0.208054 0.418632 0.074978 Consensus sequence: VHYTCCDWCCGCGTCMMTHWHV Alignment: VHYTCCDWCCGCGTCMMTHWHV -CHHCHBTCCTSCYTCTGC--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00032 Gata3_primary Original Motif Reverse Complement Backward 4 18 0.064761 Species: Mus musculus Original motif 0.151572 0.262753 0.258275 0.327401 0.221834 0.113385 0.275380 0.389400 0.297769 0.136928 0.134678 0.430625 0.270099 0.110415 0.271106 0.348380 0.265471 0.090253 0.223340 0.420936 0.616582 0.090091 0.171960 0.121367 0.197318 0.107541 0.406904 0.288237 0.798258 0.046950 0.001406 0.153385 0.003195 0.002516 0.989707 0.004582 0.991503 0.002748 0.002617 0.003132 0.005015 0.002764 0.003026 0.989195 0.948394 0.008932 0.001344 0.041330 0.973109 0.004100 0.004081 0.018710 0.040365 0.113905 0.828185 0.017545 0.736608 0.130524 0.113464 0.019404 0.415921 0.106101 0.316613 0.161365 0.376582 0.170927 0.155572 0.296919 0.137731 0.197151 0.211055 0.454064 0.324853 0.122747 0.246107 0.306293 0.462490 0.207311 0.159392 0.170807 0.380420 0.188972 0.311990 0.118618 0.222178 0.157873 0.380486 0.239463 Consensus sequence: BDHDDADAGATAAGADHBDHVD Reverse complement motif 0.222178 0.380486 0.157873 0.239463 0.118618 0.188972 0.311990 0.380420 0.170807 0.207311 0.159392 0.462490 0.306293 0.122747 0.246107 0.324853 0.454064 0.197151 0.211055 0.137731 0.296919 0.170927 0.155572 0.376582 0.161365 0.106101 0.316613 0.415921 0.019404 0.130524 0.113464 0.736608 0.040365 0.828185 0.113905 0.017545 0.018710 0.004100 0.004081 0.973109 0.041330 0.008932 0.001344 0.948394 0.989195 0.002764 0.003026 0.005015 0.003132 0.002748 0.002617 0.991503 0.003195 0.989707 0.002516 0.004582 0.153385 0.046950 0.001406 0.798258 0.197318 0.406904 0.107541 0.288237 0.121367 0.090091 0.171960 0.616582 0.420936 0.090253 0.223340 0.265471 0.348380 0.110415 0.271106 0.270099 0.430625 0.136928 0.134678 0.297769 0.389400 0.113385 0.275380 0.221834 0.327401 0.262753 0.258275 0.151572 Consensus sequence: HBHDVHDTCTTATCTHTDDHDV Alignment: HBHDVHDTCTTATCTHTDDHDV -CHHCHBTCCTSCYTCTGC--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 5 Motif ID: 91 Motif name: TFM3 Original motif 0.062500 0.062500 0.312500 0.562500 0.125000 0.062500 0.000000 0.812500 0.000000 0.000000 0.062500 0.937500 0.000000 0.000000 0.187500 0.812500 0.000000 0.000000 0.125000 0.875000 0.000000 0.250000 0.000000 0.750000 0.000000 0.000000 0.125000 0.875000 0.187500 0.000000 0.437500 0.375000 0.000000 0.000000 0.125000 0.875000 0.000000 0.125000 0.000000 0.875000 0.000000 0.062500 0.000000 0.937500 0.125000 0.000000 0.000000 0.875000 0.125000 0.062500 0.000000 0.812500 0.000000 0.000000 0.250000 0.750000 0.250000 0.000000 0.375000 0.375000 0.937500 0.062500 0.000000 0.000000 0.937500 0.000000 0.000000 0.062500 0.000000 0.312500 0.437500 0.250000 Consensus sequence: KTTTTTTKTTTTTTDAAB Reserve complement motif 0.000000 0.437500 0.312500 0.250000 0.062500 0.000000 0.000000 0.937500 0.000000 0.062500 0.000000 0.937500 0.250000 0.375000 0.000000 0.375000 0.750000 0.000000 0.250000 0.000000 0.812500 0.062500 0.000000 0.125000 0.875000 0.000000 0.000000 0.125000 0.937500 0.062500 0.000000 0.000000 0.875000 0.125000 0.000000 0.000000 0.875000 0.000000 0.125000 0.000000 0.187500 0.437500 0.000000 0.375000 0.875000 0.000000 0.125000 0.000000 0.750000 0.250000 0.000000 0.000000 0.875000 0.000000 0.125000 0.000000 0.812500 0.000000 0.187500 0.000000 0.937500 0.000000 0.062500 0.000000 0.812500 0.062500 0.000000 0.125000 0.562500 0.062500 0.312500 0.062500 Consensus sequence: BTTHAAAAAAYAAAAAAR ************************************************************************ Best Matches for Motif ID 91 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00032 Gata3_primary Reverse Complement Original Motif Forward 1 18 0.042615 Species: Mus musculus Original motif 0.151572 0.262753 0.258275 0.327401 0.221834 0.113385 0.275380 0.389400 0.297769 0.136928 0.134678 0.430625 0.270099 0.110415 0.271106 0.348380 0.265471 0.090253 0.223340 0.420936 0.616582 0.090091 0.171960 0.121367 0.197318 0.107541 0.406904 0.288237 0.798258 0.046950 0.001406 0.153385 0.003195 0.002516 0.989707 0.004582 0.991503 0.002748 0.002617 0.003132 0.005015 0.002764 0.003026 0.989195 0.948394 0.008932 0.001344 0.041330 0.973109 0.004100 0.004081 0.018710 0.040365 0.113905 0.828185 0.017545 0.736608 0.130524 0.113464 0.019404 0.415921 0.106101 0.316613 0.161365 0.376582 0.170927 0.155572 0.296919 0.137731 0.197151 0.211055 0.454064 0.324853 0.122747 0.246107 0.306293 0.462490 0.207311 0.159392 0.170807 0.380420 0.188972 0.311990 0.118618 0.222178 0.157873 0.380486 0.239463 Consensus sequence: BDHDDADAGATAAGADHBDHVD Reverse complement motif 0.222178 0.380486 0.157873 0.239463 0.118618 0.188972 0.311990 0.380420 0.170807 0.207311 0.159392 0.462490 0.306293 0.122747 0.246107 0.324853 0.454064 0.197151 0.211055 0.137731 0.296919 0.170927 0.155572 0.376582 0.161365 0.106101 0.316613 0.415921 0.019404 0.130524 0.113464 0.736608 0.040365 0.828185 0.113905 0.017545 0.018710 0.004100 0.004081 0.973109 0.041330 0.008932 0.001344 0.948394 0.989195 0.002764 0.003026 0.005015 0.003132 0.002748 0.002617 0.991503 0.003195 0.989707 0.002516 0.004582 0.153385 0.046950 0.001406 0.798258 0.197318 0.406904 0.107541 0.288237 0.121367 0.090091 0.171960 0.616582 0.420936 0.090253 0.223340 0.265471 0.348380 0.110415 0.271106 0.270099 0.430625 0.136928 0.134678 0.297769 0.389400 0.113385 0.275380 0.221834 0.327401 0.262753 0.258275 0.151572 Consensus sequence: HBHDVHDTCTTATCTHTDDHDV Alignment: HBHDVHDTCTTATCTHTDDHDV BTTHAAAAAAYAAAAAAR---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00034 Sox7_primary Reverse Complement Original Motif Backward 3 18 0.047877 Species: Mus musculus Original motif 0.360997 0.300272 0.115555 0.223177 0.309749 0.228429 0.166233 0.295589 0.149419 0.176868 0.240155 0.433558 0.379704 0.095791 0.276373 0.248133 0.394549 0.174184 0.130641 0.300626 0.443749 0.070776 0.211081 0.274393 0.364301 0.074356 0.370406 0.190936 0.791976 0.038475 0.093390 0.076159 0.963721 0.001826 0.002456 0.031997 0.004516 0.954596 0.008092 0.032796 0.981080 0.002062 0.002161 0.014697 0.986185 0.001846 0.006976 0.004992 0.059567 0.003649 0.002189 0.934595 0.495328 0.024257 0.240450 0.239965 0.305027 0.094878 0.526069 0.074025 0.418442 0.196237 0.158323 0.226998 0.336713 0.220452 0.191155 0.251680 0.192296 0.300342 0.169047 0.338315 0.240387 0.144634 0.128513 0.486465 0.290763 0.271259 0.116600 0.321377 0.224825 0.296233 0.229255 0.249687 0.493240 0.171285 0.075148 0.260326 Consensus sequence: HHBDHDDAACAATDRHHHHHBW Reverse complement motif 0.260326 0.171285 0.075148 0.493240 0.224825 0.229255 0.296233 0.249687 0.321377 0.271259 0.116600 0.290763 0.486465 0.144634 0.128513 0.240387 0.338315 0.300342 0.169047 0.192296 0.251680 0.220452 0.191155 0.336713 0.226998 0.196237 0.158323 0.418442 0.305027 0.526069 0.094878 0.074025 0.239965 0.024257 0.240450 0.495328 0.934595 0.003649 0.002189 0.059567 0.004992 0.001846 0.006976 0.986185 0.014697 0.002062 0.002161 0.981080 0.004516 0.008092 0.954596 0.032796 0.031997 0.001826 0.002456 0.963721 0.076159 0.038475 0.093390 0.791976 0.364301 0.370406 0.074356 0.190936 0.274393 0.070776 0.211081 0.443749 0.300626 0.174184 0.130641 0.394549 0.248133 0.095791 0.276373 0.379704 0.433558 0.176868 0.240155 0.149419 0.295589 0.228429 0.166233 0.309749 0.223177 0.300272 0.115555 0.360997 Consensus sequence: WBHHHHHMDATTGTTHDHDVHH Alignment: HHBDHDDAACAATDRHHHHHBW --BTTHAAAAAAYAAAAAAR-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00034 Sox7_secondary Reverse Complement Reverse Complement Forward 1 18 0.056469 Species: Mus musculus Original motif 0.067627 0.131333 0.654425 0.146615 0.156488 0.114442 0.145630 0.583441 0.206450 0.265630 0.358017 0.169903 0.090729 0.460713 0.274712 0.173847 0.285994 0.099998 0.154485 0.459523 0.635908 0.184787 0.072982 0.106323 0.748421 0.039204 0.092605 0.119769 0.081342 0.061327 0.044532 0.812799 0.143120 0.043879 0.024216 0.788785 0.247544 0.092102 0.621453 0.038901 0.295531 0.036295 0.027594 0.640580 0.194561 0.305468 0.339916 0.160055 0.175038 0.193568 0.101212 0.530182 0.145226 0.167488 0.559871 0.127415 0.271501 0.237429 0.206701 0.284369 0.216834 0.109191 0.569605 0.104370 0.182624 0.177160 0.300475 0.339742 0.331737 0.198645 0.265137 0.204482 0.230155 0.359365 0.183450 0.227029 0.056581 0.067297 0.463052 0.413070 0.198891 0.324626 0.304424 0.172059 0.181968 0.287547 0.202419 0.328066 Consensus sequence: GTVBDAATTGTVTGHGDDHKVB Reverse complement motif 0.328066 0.287547 0.202419 0.181968 0.198891 0.304424 0.324626 0.172059 0.056581 0.463052 0.067297 0.413070 0.230155 0.183450 0.359365 0.227029 0.204482 0.198645 0.265137 0.331737 0.339742 0.177160 0.300475 0.182624 0.216834 0.569605 0.109191 0.104370 0.284369 0.237429 0.206701 0.271501 0.145226 0.559871 0.167488 0.127415 0.530182 0.193568 0.101212 0.175038 0.194561 0.339916 0.305468 0.160055 0.640580 0.036295 0.027594 0.295531 0.247544 0.621453 0.092102 0.038901 0.788785 0.043879 0.024216 0.143120 0.812799 0.061327 0.044532 0.081342 0.119769 0.039204 0.092605 0.748421 0.106323 0.184787 0.072982 0.635908 0.459523 0.099998 0.154485 0.285994 0.090729 0.274712 0.460713 0.173847 0.206450 0.358017 0.265630 0.169903 0.583441 0.114442 0.145630 0.156488 0.067627 0.654425 0.131333 0.146615 Consensus sequence: VVYDDDCHCAVACAATTDBVAC Alignment: VVYDDDCHCAVACAATTDBVAC BTTHAAAAAAYAAAAAAR---- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00077 Srf_secondary Original Motif Reverse Complement Backward 1 17 0.524520 Species: Mus musculus Original motif 0.162968 0.284828 0.440984 0.111220 0.151392 0.200635 0.205316 0.442657 0.267215 0.083669 0.192498 0.456618 0.332771 0.180711 0.200027 0.286491 0.509370 0.102954 0.242569 0.145107 0.666262 0.077309 0.154466 0.101962 0.737968 0.113335 0.100401 0.048296 0.658878 0.141580 0.134033 0.065510 0.766115 0.094051 0.069763 0.070072 0.755621 0.088491 0.044802 0.111086 0.749083 0.135917 0.047510 0.067490 0.663231 0.176795 0.028134 0.131839 0.553358 0.277659 0.038655 0.130328 0.392578 0.314083 0.209844 0.083495 0.198462 0.237132 0.239466 0.324940 0.275121 0.210087 0.194779 0.320013 0.287748 0.277395 0.142704 0.292154 Consensus sequence: VBDDAAAAAAAAMVBHH Reverse complement motif 0.292154 0.277395 0.142704 0.287748 0.320013 0.210087 0.194779 0.275121 0.324940 0.237132 0.239466 0.198462 0.083495 0.314083 0.209844 0.392578 0.130328 0.277659 0.038655 0.553358 0.131839 0.176795 0.028134 0.663231 0.067490 0.135917 0.047510 0.749083 0.111086 0.088491 0.044802 0.755621 0.070072 0.094051 0.069763 0.766115 0.065510 0.141580 0.134033 0.658878 0.048296 0.113335 0.100401 0.737968 0.101962 0.077309 0.154466 0.666262 0.145107 0.102954 0.242569 0.509370 0.286491 0.180711 0.200027 0.332771 0.456618 0.083669 0.192498 0.267215 0.442657 0.200635 0.205316 0.151392 0.162968 0.440984 0.284828 0.111220 Consensus sequence: HHVBYTTTTTTTTDDVV Alignment: -HHVBYTTTTTTTTDDVV KTTTTTTKTTTTTTDAAB ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00090 Elf3_secondary Original Motif Reverse Complement Backward 1 17 0.531868 Species: Mus musculus Original motif 0.155083 0.152982 0.490906 0.201030 0.123195 0.312681 0.220770 0.343354 0.110252 0.131358 0.153983 0.604406 0.216489 0.490160 0.101348 0.192003 0.396130 0.292429 0.103252 0.208189 0.634770 0.070898 0.070668 0.223664 0.667102 0.099915 0.067576 0.165407 0.625495 0.095579 0.039353 0.239573 0.717478 0.093228 0.024737 0.164558 0.729965 0.048628 0.024557 0.196850 0.670909 0.118718 0.043692 0.166681 0.689441 0.050145 0.038829 0.221584 0.506735 0.159498 0.095635 0.238132 0.406093 0.298915 0.149902 0.145090 0.193913 0.282078 0.096706 0.427303 0.272324 0.154790 0.262469 0.310417 0.224484 0.458724 0.060144 0.256647 Consensus sequence: DBTHHAAAAAAAAVHDH Reverse complement motif 0.224484 0.060144 0.458724 0.256647 0.310417 0.154790 0.262469 0.272324 0.427303 0.282078 0.096706 0.193913 0.145090 0.298915 0.149902 0.406093 0.238132 0.159498 0.095635 0.506735 0.221584 0.050145 0.038829 0.689441 0.166681 0.118718 0.043692 0.670909 0.196850 0.048628 0.024557 0.729965 0.164558 0.093228 0.024737 0.717478 0.239573 0.095579 0.039353 0.625495 0.165407 0.099915 0.067576 0.667102 0.223664 0.070898 0.070668 0.634770 0.208189 0.292429 0.103252 0.396130 0.216489 0.101348 0.490160 0.192003 0.604406 0.131358 0.153983 0.110252 0.343354 0.312681 0.220770 0.123195 0.155083 0.490906 0.152982 0.201030 Consensus sequence: DDHBTTTTTTTTHDAVH Alignment: -DDHBTTTTTTTTHDAVH KTTTTTTKTTTTTTDAAB ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00121 Hoxd10 Original Motif Reverse Complement Backward 1 17 0.539211 Species: Mus musculus Original motif 0.405345 0.293266 0.220907 0.080482 0.398063 0.099034 0.333525 0.169378 0.049753 0.190411 0.336789 0.423048 0.243698 0.226261 0.324346 0.205696 0.030873 0.549741 0.008321 0.411065 0.714225 0.228092 0.020960 0.036723 0.833992 0.010944 0.021918 0.133146 0.008898 0.026169 0.008341 0.956591 0.811684 0.004889 0.004751 0.178676 0.952107 0.004322 0.004587 0.038984 0.925365 0.008360 0.006811 0.059464 0.850659 0.058250 0.065237 0.025855 0.193369 0.242985 0.049515 0.514131 0.266774 0.080601 0.239781 0.412844 0.335522 0.125500 0.188170 0.350809 0.407171 0.120540 0.187300 0.284989 0.281181 0.242348 0.160247 0.316224 Consensus sequence: VDKVYAATAAAATDDDH Reverse complement motif 0.316224 0.242348 0.160247 0.281181 0.284989 0.120540 0.187300 0.407171 0.350809 0.125500 0.188170 0.335522 0.412844 0.080601 0.239781 0.266774 0.514131 0.242985 0.049515 0.193369 0.025855 0.058250 0.065237 0.850659 0.059464 0.008360 0.006811 0.925365 0.038984 0.004322 0.004587 0.952107 0.178676 0.004889 0.004751 0.811684 0.956591 0.026169 0.008341 0.008898 0.133146 0.010944 0.021918 0.833992 0.036723 0.228092 0.020960 0.714225 0.030873 0.008321 0.549741 0.411065 0.243698 0.324346 0.226261 0.205696 0.423048 0.190411 0.336789 0.049753 0.169378 0.099034 0.333525 0.398063 0.080482 0.293266 0.220907 0.405345 Consensus sequence: HDDDATTTTATTKVRDB Alignment: -HDDDATTTTATTKVRDB KTTTTTTKTTTTTTDAAB ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00073 Foxa2_primary Original Motif Reverse Complement Forward 2 17 0.539687 Species: Mus musculus Original motif 0.335487 0.205062 0.128957 0.330494 0.411635 0.179625 0.175701 0.233038 0.412976 0.128602 0.091890 0.366532 0.608396 0.079002 0.107142 0.205460 0.433474 0.035203 0.153143 0.378180 0.087552 0.005003 0.894586 0.012858 0.004459 0.038951 0.001109 0.955481 0.924470 0.068560 0.001165 0.005805 0.920483 0.070039 0.001674 0.007805 0.988335 0.001902 0.003155 0.006608 0.001527 0.656726 0.002699 0.339047 0.987505 0.001810 0.004336 0.006349 0.719584 0.065184 0.050384 0.164848 0.535389 0.099997 0.102849 0.261764 0.245215 0.272017 0.301499 0.181269 0.306107 0.209040 0.248687 0.236166 0.223744 0.278668 0.251931 0.245657 Consensus sequence: HHWAWGTAAAYAAAVDB Reverse complement motif 0.223744 0.251931 0.278668 0.245657 0.236166 0.209040 0.248687 0.306107 0.245215 0.301499 0.272017 0.181269 0.261764 0.099997 0.102849 0.535389 0.164848 0.065184 0.050384 0.719584 0.006349 0.001810 0.004336 0.987505 0.001527 0.002699 0.656726 0.339047 0.006608 0.001902 0.003155 0.988335 0.007805 0.070039 0.001674 0.920483 0.005805 0.068560 0.001165 0.924470 0.955481 0.038951 0.001109 0.004459 0.087552 0.894586 0.005003 0.012858 0.378180 0.035203 0.153143 0.433474 0.205460 0.079002 0.107142 0.608396 0.366532 0.128602 0.091890 0.412976 0.233038 0.179625 0.175701 0.411635 0.330494 0.205062 0.128957 0.335487 Consensus sequence: BDVTTTKTTTACWTWHH Alignment: HHWAWGTAAAYAAAVDB- -KTTTTTTKTTTTTTDAAB ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00039 Foxj3_primary Reverse Complement Original Motif Forward 1 17 0.542507 Species: Mus musculus Original motif 0.273456 0.257473 0.208488 0.260583 0.338566 0.133379 0.306363 0.221693 0.475488 0.192852 0.156858 0.174803 0.506619 0.132646 0.170373 0.190362 0.349042 0.127275 0.325924 0.197759 0.303850 0.013619 0.678034 0.004497 0.014136 0.015691 0.003073 0.967100 0.913373 0.082928 0.001910 0.001789 0.956294 0.017745 0.000584 0.025378 0.987796 0.001685 0.004159 0.006360 0.002288 0.814764 0.001427 0.181521 0.986707 0.002688 0.003346 0.007259 0.787378 0.065481 0.057961 0.089180 0.572982 0.089910 0.066184 0.270924 0.224167 0.339979 0.258886 0.176968 0.268414 0.272007 0.239541 0.220038 0.241771 0.394748 0.174273 0.189208 Consensus sequence: HDHADGTAAACAAAVVH Reverse complement motif 0.241771 0.174273 0.394748 0.189208 0.268414 0.239541 0.272007 0.220038 0.224167 0.258886 0.339979 0.176968 0.270924 0.089910 0.066184 0.572982 0.089180 0.065481 0.057961 0.787378 0.007259 0.002688 0.003346 0.986707 0.002288 0.001427 0.814764 0.181521 0.006360 0.001685 0.004159 0.987796 0.025378 0.017745 0.000584 0.956294 0.001789 0.082928 0.001910 0.913373 0.967100 0.015691 0.003073 0.014136 0.303850 0.678034 0.013619 0.004497 0.197759 0.127275 0.325924 0.349042 0.190362 0.132646 0.170373 0.506619 0.174803 0.192852 0.156858 0.475488 0.221693 0.133379 0.306363 0.338566 0.260583 0.257473 0.208488 0.273456 Consensus sequence: DVVTTTGTTTACDTHDH Alignment: DVVTTTGTTTACDTHDH- BTTHAAAAAAYAAAAAAR ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00061 Foxl1_primary Reverse Complement Original Motif Backward 2 17 0.547029 Species: Mus musculus Original motif 0.323208 0.152915 0.185111 0.338766 0.428132 0.056109 0.099487 0.416272 0.659386 0.039965 0.035805 0.264843 0.647143 0.049206 0.078984 0.224667 0.208834 0.076592 0.071631 0.642943 0.341077 0.003865 0.649511 0.005547 0.016627 0.001866 0.001715 0.979792 0.952319 0.045294 0.000870 0.001516 0.988834 0.004620 0.000720 0.005826 0.989346 0.001005 0.006467 0.003182 0.001093 0.784230 0.001235 0.213442 0.991209 0.002017 0.001737 0.005037 0.801581 0.037084 0.023060 0.138274 0.528554 0.089350 0.107501 0.274595 0.208802 0.268646 0.368022 0.154530 0.280218 0.221367 0.340497 0.157918 0.146611 0.250725 0.293524 0.309140 Consensus sequence: DWAATRTAAACAAWVVB Reverse complement motif 0.309140 0.250725 0.293524 0.146611 0.280218 0.340497 0.221367 0.157918 0.208802 0.368022 0.268646 0.154530 0.274595 0.089350 0.107501 0.528554 0.138274 0.037084 0.023060 0.801581 0.005037 0.002017 0.001737 0.991209 0.001093 0.001235 0.784230 0.213442 0.003182 0.001005 0.006467 0.989346 0.005826 0.004620 0.000720 0.988834 0.001516 0.045294 0.000870 0.952319 0.979792 0.001866 0.001715 0.016627 0.341077 0.649511 0.003865 0.005547 0.642943 0.076592 0.071631 0.208834 0.224667 0.049206 0.078984 0.647143 0.264843 0.039965 0.035805 0.659386 0.416272 0.056109 0.099487 0.428132 0.338766 0.152915 0.185111 0.323208 Consensus sequence: VVVWTTGTTTAMATTWD Alignment: -VVVWTTGTTTAMATTWD BTTHAAAAAAYAAAAAAR- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00051 Sox8_primary Reverse Complement Reverse Complement Backward 2 17 0.547298 Species: Mus musculus Original motif 0.244952 0.197659 0.278014 0.279374 0.244434 0.136006 0.278446 0.341114 0.512025 0.129954 0.139069 0.218951 0.190001 0.086232 0.125500 0.598267 0.154692 0.325860 0.193904 0.325544 0.384624 0.130540 0.035110 0.449726 0.945021 0.006713 0.011975 0.036291 0.008386 0.026630 0.004166 0.960817 0.020908 0.005554 0.009294 0.964244 0.149285 0.038995 0.806085 0.005635 0.110990 0.007155 0.007797 0.874058 0.087283 0.099671 0.059611 0.753435 0.250662 0.432576 0.082152 0.234610 0.251277 0.174578 0.147771 0.426374 0.205121 0.137656 0.296366 0.360857 0.316796 0.152457 0.164403 0.366344 0.475864 0.128717 0.153551 0.241867 Consensus sequence: DDATBWATTGTTHHDDD Reverse complement motif 0.241867 0.128717 0.153551 0.475864 0.366344 0.152457 0.164403 0.316796 0.360857 0.137656 0.296366 0.205121 0.426374 0.174578 0.147771 0.251277 0.250662 0.082152 0.432576 0.234610 0.753435 0.099671 0.059611 0.087283 0.874058 0.007155 0.007797 0.110990 0.149285 0.806085 0.038995 0.005635 0.964244 0.005554 0.009294 0.020908 0.960817 0.026630 0.004166 0.008386 0.036291 0.006713 0.011975 0.945021 0.449726 0.130540 0.035110 0.384624 0.154692 0.193904 0.325860 0.325544 0.598267 0.086232 0.125500 0.190001 0.218951 0.129954 0.139069 0.512025 0.341114 0.136006 0.278446 0.244434 0.279374 0.197659 0.278014 0.244952 Consensus sequence: DDDHDAACAATWBATDD Alignment: -DDDHDAACAATWBATDD BTTHAAAAAAYAAAAAAR- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 5 Motif ID: 92 Motif name: TFM11 Original motif 0.000000 0.769231 0.000000 0.230769 0.730769 0.000000 0.192308 0.076923 0.346154 0.576923 0.038462 0.038462 0.923077 0.076923 0.000000 0.000000 0.153846 0.769231 0.076923 0.000000 0.923077 0.076923 0.000000 0.000000 0.000000 0.807692 0.076923 0.115385 0.846154 0.153846 0.000000 0.000000 0.115385 0.846154 0.038462 0.000000 0.807692 0.000000 0.000000 0.192308 0.038462 0.884615 0.000000 0.076923 0.692308 0.000000 0.076923 0.230769 0.076923 0.538462 0.000000 0.384615 0.461538 0.038462 0.269231 0.230769 0.000000 0.807692 0.192308 0.000000 0.807692 0.153846 0.000000 0.038462 0.076923 0.692308 0.000000 0.230769 0.807692 0.000000 0.192308 0.000000 0.076923 0.730769 0.115385 0.076923 0.923077 0.000000 0.000000 0.076923 Consensus sequence: CAMACACACACAYDCACACA Reserve complement motif 0.076923 0.000000 0.000000 0.923077 0.076923 0.115385 0.730769 0.076923 0.000000 0.000000 0.192308 0.807692 0.076923 0.000000 0.692308 0.230769 0.038462 0.153846 0.000000 0.807692 0.000000 0.192308 0.807692 0.000000 0.230769 0.038462 0.269231 0.461538 0.076923 0.000000 0.538462 0.384615 0.230769 0.000000 0.076923 0.692308 0.038462 0.000000 0.884615 0.076923 0.192308 0.000000 0.000000 0.807692 0.115385 0.038462 0.846154 0.000000 0.000000 0.153846 0.000000 0.846154 0.000000 0.076923 0.807692 0.115385 0.000000 0.076923 0.000000 0.923077 0.153846 0.076923 0.769231 0.000000 0.000000 0.076923 0.000000 0.923077 0.346154 0.038462 0.576923 0.038462 0.076923 0.000000 0.192308 0.730769 0.000000 0.000000 0.769231 0.230769 Consensus sequence: TGTGTGDKTGTGTGTGTRTG ************************************************************************ Best Matches for Motif ID 92 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v016060_secondary Reverse Complement Original Motif Forward 1 20 0.042676 Species: Mus musculus Original motif 0.319838 0.171199 0.138099 0.370865 0.269358 0.196600 0.346909 0.187133 0.176807 0.338888 0.193903 0.290402 0.230268 0.119645 0.310500 0.339587 0.517372 0.257658 0.111673 0.113296 0.159477 0.126524 0.561119 0.152879 0.117072 0.553013 0.130919 0.198996 0.073372 0.163548 0.525014 0.238066 0.143608 0.186896 0.170528 0.498967 0.054943 0.079034 0.722992 0.143031 0.048852 0.015134 0.852458 0.083556 0.029001 0.023938 0.918900 0.028160 0.036727 0.092645 0.090591 0.780037 0.017757 0.057598 0.895222 0.029423 0.026113 0.048113 0.879744 0.046030 0.023041 0.787043 0.123490 0.066426 0.579766 0.004868 0.296873 0.118493 0.303862 0.042931 0.290151 0.363055 0.099672 0.237431 0.262301 0.400597 0.217788 0.163908 0.367628 0.250676 0.450783 0.141108 0.226137 0.181972 0.485086 0.102553 0.242662 0.169700 0.109057 0.454222 0.145665 0.291056 Consensus sequence: HVBDAGCGBGGGTGGCRDBDDDB Reverse complement motif 0.109057 0.145665 0.454222 0.291056 0.169700 0.102553 0.242662 0.485086 0.181972 0.141108 0.226137 0.450783 0.217788 0.367628 0.163908 0.250676 0.400597 0.237431 0.262301 0.099672 0.363055 0.042931 0.290151 0.303862 0.118493 0.004868 0.296873 0.579766 0.023041 0.123490 0.787043 0.066426 0.026113 0.879744 0.048113 0.046030 0.017757 0.895222 0.057598 0.029423 0.780037 0.092645 0.090591 0.036727 0.029001 0.918900 0.023938 0.028160 0.048852 0.852458 0.015134 0.083556 0.054943 0.722992 0.079034 0.143031 0.498967 0.186896 0.170528 0.143608 0.073372 0.525014 0.163548 0.238066 0.117072 0.130919 0.553013 0.198996 0.159477 0.561119 0.126524 0.152879 0.113296 0.257658 0.111673 0.517372 0.339587 0.119645 0.310500 0.230268 0.176807 0.193903 0.338888 0.290402 0.269358 0.346909 0.196600 0.187133 0.370865 0.171199 0.138099 0.319838 Consensus sequence: BDDHVDKGCCACCCVCGCTDBVH Alignment: BDDHVDKGCCACCCVCGCTDBVH TGTGTGDKTGTGTGTGTRTG--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00034 Sox7_secondary Reverse Complement Original Motif Backward 3 20 0.043962 Species: Mus musculus Original motif 0.067627 0.131333 0.654425 0.146615 0.156488 0.114442 0.145630 0.583441 0.206450 0.265630 0.358017 0.169903 0.090729 0.460713 0.274712 0.173847 0.285994 0.099998 0.154485 0.459523 0.635908 0.184787 0.072982 0.106323 0.748421 0.039204 0.092605 0.119769 0.081342 0.061327 0.044532 0.812799 0.143120 0.043879 0.024216 0.788785 0.247544 0.092102 0.621453 0.038901 0.295531 0.036295 0.027594 0.640580 0.194561 0.305468 0.339916 0.160055 0.175038 0.193568 0.101212 0.530182 0.145226 0.167488 0.559871 0.127415 0.271501 0.237429 0.206701 0.284369 0.216834 0.109191 0.569605 0.104370 0.182624 0.177160 0.300475 0.339742 0.331737 0.198645 0.265137 0.204482 0.230155 0.359365 0.183450 0.227029 0.056581 0.067297 0.463052 0.413070 0.198891 0.324626 0.304424 0.172059 0.181968 0.287547 0.202419 0.328066 Consensus sequence: GTVBDAATTGTVTGHGDDHKVB Reverse complement motif 0.328066 0.287547 0.202419 0.181968 0.198891 0.304424 0.324626 0.172059 0.056581 0.463052 0.067297 0.413070 0.230155 0.183450 0.359365 0.227029 0.204482 0.198645 0.265137 0.331737 0.339742 0.177160 0.300475 0.182624 0.216834 0.569605 0.109191 0.104370 0.284369 0.237429 0.206701 0.271501 0.145226 0.559871 0.167488 0.127415 0.530182 0.193568 0.101212 0.175038 0.194561 0.339916 0.305468 0.160055 0.640580 0.036295 0.027594 0.295531 0.247544 0.621453 0.092102 0.038901 0.788785 0.043879 0.024216 0.143120 0.812799 0.061327 0.044532 0.081342 0.119769 0.039204 0.092605 0.748421 0.106323 0.184787 0.072982 0.635908 0.459523 0.099998 0.154485 0.285994 0.090729 0.274712 0.460713 0.173847 0.206450 0.358017 0.265630 0.169903 0.583441 0.114442 0.145630 0.156488 0.067627 0.654425 0.131333 0.146615 Consensus sequence: VVYDDDCHCAVACAATTDBVAC Alignment: GTVBDAATTGTVTGHGDDHKVB TGTGTGDKTGTGTGTGTRTG-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v016060_secondary Original Motif Original Motif Backward 1 20 0.044900 Species: Mus musculus Original motif 0.168550 0.345968 0.396524 0.088958 0.038113 0.360882 0.114042 0.486963 0.349356 0.180599 0.051416 0.418629 0.258773 0.332518 0.244932 0.163778 0.371663 0.208591 0.263136 0.156609 0.225440 0.321741 0.175932 0.276887 0.100827 0.656850 0.018644 0.223679 0.494140 0.155427 0.327424 0.023009 0.105642 0.805846 0.027712 0.060800 0.065110 0.845072 0.058046 0.031772 0.649343 0.110180 0.180680 0.059797 0.064269 0.853604 0.066860 0.015268 0.437421 0.533797 0.016833 0.011948 0.121694 0.787708 0.016177 0.074421 0.625382 0.066925 0.266070 0.041623 0.117819 0.608153 0.165139 0.108889 0.145639 0.102001 0.604926 0.147434 0.521188 0.184986 0.064607 0.229219 0.180371 0.274237 0.096591 0.448801 0.071055 0.455813 0.332817 0.140315 0.084503 0.199982 0.448293 0.267222 0.389451 0.169545 0.155507 0.285497 0.424314 0.227621 0.101210 0.246855 Consensus sequence: VYWVVHCRCCACMCACGAHSBHH Reverse complement motif 0.246855 0.227621 0.101210 0.424314 0.285497 0.169545 0.155507 0.389451 0.084503 0.448293 0.199982 0.267222 0.071055 0.332817 0.455813 0.140315 0.448801 0.274237 0.096591 0.180371 0.229219 0.184986 0.064607 0.521188 0.145639 0.604926 0.102001 0.147434 0.117819 0.165139 0.608153 0.108889 0.041623 0.066925 0.266070 0.625382 0.121694 0.016177 0.787708 0.074421 0.437421 0.016833 0.533797 0.011948 0.064269 0.066860 0.853604 0.015268 0.059797 0.110180 0.180680 0.649343 0.065110 0.058046 0.845072 0.031772 0.105642 0.027712 0.805846 0.060800 0.023009 0.155427 0.327424 0.494140 0.100827 0.018644 0.656850 0.223679 0.225440 0.175932 0.321741 0.276887 0.156609 0.208591 0.263136 0.371663 0.258773 0.244932 0.332518 0.163778 0.418629 0.180599 0.051416 0.349356 0.486963 0.360882 0.114042 0.038113 0.168550 0.396524 0.345968 0.088958 Consensus sequence: HHBSHTCGTGRGTGGKGDBVWMV Alignment: VYWVVHCRCCACMCACGAHSBHH ---CAMACACACACAYDCACACA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v015681_secondary Original Motif Original Motif Forward 1 20 0.049224 Species: Mus musculus Original motif 0.404007 0.395873 0.173319 0.026801 0.305977 0.215534 0.215359 0.263130 0.370148 0.250957 0.113088 0.265808 0.324336 0.229498 0.174679 0.271487 0.263563 0.137896 0.079217 0.519324 0.265762 0.222582 0.082555 0.429102 0.206721 0.288405 0.017851 0.487023 0.164361 0.236500 0.061051 0.538088 0.593344 0.348446 0.050304 0.007906 0.031328 0.947050 0.007032 0.014590 0.010428 0.956605 0.029142 0.003825 0.459636 0.207616 0.155368 0.177380 0.014573 0.964608 0.012209 0.008610 0.066291 0.918196 0.008729 0.006784 0.019488 0.866774 0.018897 0.094841 0.767405 0.104198 0.029234 0.099164 0.052494 0.772531 0.039832 0.135142 0.296085 0.243498 0.350935 0.109482 0.518843 0.226659 0.124784 0.129714 0.647901 0.019721 0.159901 0.172477 0.113912 0.231511 0.214864 0.439713 0.223117 0.310596 0.293328 0.172959 0.185557 0.487662 0.136321 0.190459 Consensus sequence: MHHHWHYTMCCHCCCACVAABVH Reverse complement motif 0.185557 0.136321 0.487662 0.190459 0.223117 0.293328 0.310596 0.172959 0.439713 0.231511 0.214864 0.113912 0.172477 0.019721 0.159901 0.647901 0.129714 0.226659 0.124784 0.518843 0.296085 0.350935 0.243498 0.109482 0.052494 0.039832 0.772531 0.135142 0.099164 0.104198 0.029234 0.767405 0.019488 0.018897 0.866774 0.094841 0.066291 0.008729 0.918196 0.006784 0.014573 0.012209 0.964608 0.008610 0.177380 0.207616 0.155368 0.459636 0.010428 0.029142 0.956605 0.003825 0.031328 0.007032 0.947050 0.014590 0.007906 0.348446 0.050304 0.593344 0.538088 0.236500 0.061051 0.164361 0.487023 0.288405 0.017851 0.206721 0.429102 0.222582 0.082555 0.265762 0.519324 0.137896 0.079217 0.263563 0.271487 0.229498 0.174679 0.324336 0.265808 0.250957 0.113088 0.370148 0.263130 0.215534 0.215359 0.305977 0.026801 0.395873 0.173319 0.404007 Consensus sequence: DVVTTVGTGGGHGGYAMHWHHHY Alignment: MHHHWHYTMCCHCCCACVAABVH CAMACACACACAYDCACACA--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v016060_secondary Original Motif Original Motif Backward 2 20 0.052401 Species: Mus musculus Original motif 0.533199 0.080715 0.330435 0.055650 0.152031 0.212841 0.110234 0.524893 0.223934 0.264217 0.087037 0.424811 0.115097 0.339994 0.343861 0.201048 0.124993 0.418259 0.365642 0.091106 0.158365 0.292428 0.088361 0.460847 0.165479 0.561778 0.022254 0.250489 0.136873 0.259822 0.579763 0.023543 0.109570 0.747495 0.055128 0.087807 0.061912 0.792986 0.109031 0.036071 0.508703 0.267806 0.169766 0.053725 0.040912 0.838888 0.057470 0.062730 0.330554 0.606077 0.016192 0.047177 0.068079 0.563969 0.029742 0.338209 0.388799 0.291667 0.191284 0.128249 0.183283 0.578079 0.171100 0.067538 0.165163 0.097206 0.631377 0.106253 0.128564 0.435496 0.253275 0.182665 0.103395 0.088222 0.234758 0.573625 0.432879 0.276641 0.155895 0.134585 0.339199 0.148928 0.311036 0.200836 0.211958 0.298526 0.158443 0.331072 Consensus sequence: RTHBSYCGCCMCMYVCGBTVDH Reverse complement motif 0.331072 0.298526 0.158443 0.211958 0.200836 0.148928 0.311036 0.339199 0.134585 0.276641 0.155895 0.432879 0.573625 0.088222 0.234758 0.103395 0.128564 0.253275 0.435496 0.182665 0.165163 0.631377 0.097206 0.106253 0.183283 0.171100 0.578079 0.067538 0.128249 0.291667 0.191284 0.388799 0.068079 0.029742 0.563969 0.338209 0.330554 0.016192 0.606077 0.047177 0.040912 0.057470 0.838888 0.062730 0.053725 0.267806 0.169766 0.508703 0.061912 0.109031 0.792986 0.036071 0.109570 0.055128 0.747495 0.087807 0.136873 0.579763 0.259822 0.023543 0.165479 0.022254 0.561778 0.250489 0.460847 0.292428 0.088361 0.158365 0.124993 0.365642 0.418259 0.091106 0.115097 0.343861 0.339994 0.201048 0.424811 0.264217 0.087037 0.223934 0.524893 0.212841 0.110234 0.152031 0.055650 0.080715 0.330435 0.533199 Consensus sequence: HDBABCGBKRGYGGCGMSBHAK Alignment: RTHBSYCGCCMCMYVCGBTVDH -CAMACACACACAYDCACACA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00400 Zif268 Original Motif Original Motif Backward 1 20 0.052793 Species: Mus musculus Original motif 0.104824 0.412716 0.254506 0.227955 0.644922 0.065476 0.140479 0.149122 0.201205 0.166164 0.347131 0.285501 0.360606 0.256316 0.150766 0.232313 0.199831 0.240681 0.279350 0.280137 0.234308 0.204076 0.321306 0.240310 0.274112 0.462435 0.111425 0.152028 0.067070 0.717501 0.073934 0.141496 0.106745 0.084442 0.658566 0.150247 0.025128 0.967053 0.003585 0.004234 0.006412 0.982989 0.003227 0.007371 0.009588 0.877620 0.002571 0.110221 0.621521 0.355443 0.015669 0.007366 0.002600 0.980275 0.004191 0.012934 0.118773 0.026658 0.783843 0.070725 0.022358 0.822101 0.024684 0.130857 0.713212 0.080912 0.128793 0.077084 0.166568 0.250955 0.107934 0.474544 0.225040 0.222494 0.163301 0.389166 0.268976 0.223206 0.265314 0.242504 0.137052 0.229058 0.148439 0.485451 0.135819 0.304550 0.141994 0.417637 0.272440 0.319501 0.230580 0.177478 Consensus sequence: BADHBDHCGCCCMCGCAHHDBBV Reverse complement motif 0.272440 0.230580 0.319501 0.177478 0.417637 0.304550 0.141994 0.135819 0.485451 0.229058 0.148439 0.137052 0.242504 0.223206 0.265314 0.268976 0.389166 0.222494 0.163301 0.225040 0.474544 0.250955 0.107934 0.166568 0.077084 0.080912 0.128793 0.713212 0.022358 0.024684 0.822101 0.130857 0.118773 0.783843 0.026658 0.070725 0.002600 0.004191 0.980275 0.012934 0.007366 0.355443 0.015669 0.621521 0.009588 0.002571 0.877620 0.110221 0.006412 0.003227 0.982989 0.007371 0.025128 0.003585 0.967053 0.004234 0.106745 0.658566 0.084442 0.150247 0.067070 0.073934 0.717501 0.141496 0.274112 0.111425 0.462435 0.152028 0.234308 0.321306 0.204076 0.240310 0.280137 0.240681 0.279350 0.199831 0.232313 0.256316 0.150766 0.360606 0.201205 0.347131 0.166164 0.285501 0.149122 0.065476 0.140479 0.644922 0.104824 0.254506 0.412716 0.227955 Consensus sequence: VVVDHHTGCGYGGGCGDHVHHTB Alignment: BADHBDHCGCCCMCGCAHHDBBV ---CAMACACACACAYDCACACA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00050 Bhlhb2_secondary Original Motif Reverse Complement Forward 2 20 0.054766 Species: Mus musculus Original motif 0.120938 0.344851 0.124072 0.410138 0.220931 0.169844 0.422396 0.186829 0.127752 0.260812 0.103811 0.507625 0.140641 0.405473 0.287668 0.166218 0.296957 0.155579 0.301094 0.246370 0.219647 0.287193 0.154072 0.339087 0.049294 0.026059 0.121789 0.802859 0.520042 0.289284 0.173423 0.017251 0.049190 0.943472 0.004308 0.003030 0.902609 0.006767 0.074770 0.015854 0.003221 0.971329 0.005512 0.019937 0.019937 0.005512 0.971329 0.003221 0.015854 0.074770 0.006767 0.902609 0.003030 0.004308 0.943472 0.049190 0.003497 0.088920 0.685942 0.221641 0.802859 0.121789 0.026059 0.049294 0.334544 0.155170 0.275193 0.235092 0.275957 0.132104 0.454982 0.136957 0.134097 0.254352 0.422940 0.188611 0.396163 0.432784 0.051281 0.119772 0.276474 0.115627 0.419844 0.188056 0.160759 0.088061 0.649863 0.101318 0.203314 0.166595 0.106821 0.523270 Consensus sequence: YDYBDHTMCACGTGGADDBMDGT Reverse complement motif 0.523270 0.166595 0.106821 0.203314 0.160759 0.649863 0.088061 0.101318 0.276474 0.419844 0.115627 0.188056 0.396163 0.051281 0.432784 0.119772 0.134097 0.422940 0.254352 0.188611 0.275957 0.454982 0.132104 0.136957 0.235092 0.155170 0.275193 0.334544 0.049294 0.121789 0.026059 0.802859 0.003497 0.685942 0.088920 0.221641 0.003030 0.943472 0.004308 0.049190 0.902609 0.074770 0.006767 0.015854 0.019937 0.971329 0.005512 0.003221 0.003221 0.005512 0.971329 0.019937 0.015854 0.006767 0.074770 0.902609 0.049190 0.004308 0.943472 0.003030 0.017251 0.289284 0.173423 0.520042 0.802859 0.026059 0.121789 0.049294 0.339087 0.287193 0.154072 0.219647 0.296957 0.301094 0.155579 0.246370 0.140641 0.287668 0.405473 0.166218 0.507625 0.260812 0.103811 0.127752 0.220931 0.422396 0.169844 0.186829 0.410138 0.344851 0.124072 0.120938 Consensus sequence: ACHRBHDTCCACGTGYAHHBMHM Alignment: ACHRBHDTCCACGTGYAHHBMHM -CAMACACACACAYDCACACA-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00526 Foxn1_secondary Original Motif Original Motif Forward 2 20 0.057516 Species: Mus musculus Original motif 0.477863 0.106306 0.184102 0.231729 0.304951 0.149020 0.361418 0.184612 0.548996 0.056128 0.348902 0.045974 0.385727 0.477782 0.086218 0.050273 0.409556 0.232265 0.173851 0.184328 0.174550 0.312880 0.307123 0.205448 0.850398 0.047204 0.041665 0.060734 0.141234 0.548534 0.142230 0.168002 0.059462 0.026354 0.892948 0.021236 0.053714 0.870297 0.028935 0.047055 0.086273 0.069147 0.805284 0.039296 0.033781 0.573881 0.034115 0.358223 0.035191 0.079663 0.824970 0.060176 0.051830 0.862631 0.019359 0.066180 0.178685 0.015738 0.762485 0.043092 0.058988 0.042615 0.017608 0.880789 0.202382 0.173360 0.284095 0.340163 0.098493 0.234651 0.506524 0.160333 0.109087 0.336204 0.250510 0.304198 0.130945 0.250843 0.177122 0.441090 0.353830 0.138838 0.162784 0.344548 0.114290 0.417163 0.160662 0.307885 Consensus sequence: DDRMHBACGCGYGCGTDGBBDB Reverse complement motif 0.114290 0.160662 0.417163 0.307885 0.344548 0.138838 0.162784 0.353830 0.441090 0.250843 0.177122 0.130945 0.109087 0.250510 0.336204 0.304198 0.098493 0.506524 0.234651 0.160333 0.340163 0.173360 0.284095 0.202382 0.880789 0.042615 0.017608 0.058988 0.178685 0.762485 0.015738 0.043092 0.051830 0.019359 0.862631 0.066180 0.035191 0.824970 0.079663 0.060176 0.033781 0.034115 0.573881 0.358223 0.086273 0.805284 0.069147 0.039296 0.053714 0.028935 0.870297 0.047055 0.059462 0.892948 0.026354 0.021236 0.141234 0.142230 0.548534 0.168002 0.060734 0.047204 0.041665 0.850398 0.174550 0.307123 0.312880 0.205448 0.184328 0.232265 0.173851 0.409556 0.385727 0.086218 0.477782 0.050273 0.045974 0.056128 0.348902 0.548996 0.304951 0.361418 0.149020 0.184612 0.231729 0.106306 0.184102 0.477863 Consensus sequence: BDVBCDACGCKCGCGTBHRKHD Alignment: DDRMHBACGCGYGCGTDGBBDB -CAMACACACACAYDCACACA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v015681_primary Original Motif Original Motif Backward 2 19 0.551038 Species: Mus musculus Original motif 0.183797 0.268049 0.330111 0.218043 0.127599 0.330310 0.243614 0.298477 0.143199 0.188046 0.268593 0.400162 0.214690 0.205230 0.247090 0.332990 0.294688 0.299104 0.327152 0.079056 0.221909 0.193223 0.480155 0.104712 0.444072 0.068239 0.481838 0.005852 0.006182 0.015429 0.901278 0.077111 0.766535 0.111138 0.121632 0.000696 0.014848 0.973961 0.000298 0.010893 0.001807 0.992200 0.002669 0.003324 0.795344 0.140510 0.018576 0.045571 0.006990 0.988200 0.002510 0.002299 0.154898 0.842296 0.000998 0.001808 0.029577 0.919262 0.006935 0.044226 0.677987 0.032075 0.185065 0.104874 0.195132 0.364580 0.319321 0.120967 0.225412 0.115034 0.612849 0.046705 0.548628 0.058900 0.162857 0.229616 0.112531 0.340331 0.165910 0.381227 0.073029 0.303078 0.363896 0.259997 0.561485 0.260567 0.092979 0.084969 0.132283 0.457691 0.140159 0.269867 Consensus sequence: BBBDVVRGACCACCCAVGABBAB Reverse complement motif 0.132283 0.140159 0.457691 0.269867 0.084969 0.260567 0.092979 0.561485 0.073029 0.363896 0.303078 0.259997 0.381227 0.340331 0.165910 0.112531 0.229616 0.058900 0.162857 0.548628 0.225412 0.612849 0.115034 0.046705 0.195132 0.319321 0.364580 0.120967 0.104874 0.032075 0.185065 0.677987 0.029577 0.006935 0.919262 0.044226 0.154898 0.000998 0.842296 0.001808 0.006990 0.002510 0.988200 0.002299 0.045571 0.140510 0.018576 0.795344 0.001807 0.002669 0.992200 0.003324 0.014848 0.000298 0.973961 0.010893 0.000696 0.111138 0.121632 0.766535 0.006182 0.901278 0.015429 0.077111 0.444072 0.481838 0.068239 0.005852 0.221909 0.480155 0.193223 0.104712 0.294688 0.327152 0.299104 0.079056 0.332990 0.205230 0.247090 0.214690 0.400162 0.188046 0.268593 0.143199 0.127599 0.243614 0.330310 0.298477 0.183797 0.330111 0.268049 0.218043 Consensus sequence: BTBVTCVTGGGTGGTCMVVDVBB Alignment: -BBBDVVRGACCACCCAVGABBAB ---CAMACACACACAYDCACACA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00527 Foxn4_secondary Original Motif Original Motif Backward 2 19 0.551577 Species: Mus musculus Original motif 0.298336 0.418632 0.208054 0.074978 0.289907 0.015608 0.457100 0.237385 0.273583 0.077889 0.107860 0.540668 0.184954 0.161611 0.384390 0.269045 0.521826 0.156340 0.089019 0.232815 0.356716 0.131104 0.394857 0.117323 0.266669 0.108765 0.505273 0.119293 0.020778 0.047199 0.919524 0.012500 0.948536 0.018775 0.008113 0.024576 0.010822 0.964042 0.014701 0.010434 0.007428 0.019505 0.966351 0.006717 0.010025 0.975678 0.008648 0.005649 0.043796 0.120935 0.742979 0.092289 0.008252 0.250704 0.541132 0.199913 0.474428 0.044681 0.134430 0.346461 0.146597 0.421317 0.143166 0.288920 0.020540 0.181479 0.553811 0.244170 0.129612 0.173360 0.535219 0.161808 0.506084 0.158156 0.130983 0.204776 0.054872 0.103043 0.545792 0.296293 0.389882 0.171037 0.164162 0.274918 0.225861 0.314031 0.288872 0.171237 Consensus sequence: VDWDARRGACGCGGWHGGAKHV Reverse complement motif 0.225861 0.288872 0.314031 0.171237 0.274918 0.171037 0.164162 0.389882 0.054872 0.545792 0.103043 0.296293 0.204776 0.158156 0.130983 0.506084 0.129612 0.535219 0.173360 0.161808 0.020540 0.553811 0.181479 0.244170 0.146597 0.143166 0.421317 0.288920 0.346461 0.044681 0.134430 0.474428 0.008252 0.541132 0.250704 0.199913 0.043796 0.742979 0.120935 0.092289 0.010025 0.008648 0.975678 0.005649 0.007428 0.966351 0.019505 0.006717 0.010822 0.014701 0.964042 0.010434 0.024576 0.018775 0.008113 0.948536 0.020778 0.919524 0.047199 0.012500 0.266669 0.505273 0.108765 0.119293 0.356716 0.394857 0.131104 0.117323 0.232815 0.156340 0.089019 0.521826 0.184954 0.384390 0.161611 0.269045 0.540668 0.077889 0.107860 0.273583 0.289907 0.457100 0.015608 0.237385 0.298336 0.208054 0.418632 0.074978 Consensus sequence: VHYTCCDWCCGCGTCMMTHWHV Alignment: -VDWDARRGACGCGGWHGGAKHV --CAMACACACACAYDCACACA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 5 Motif ID: 93 Motif name: TFM12 Original motif 0.380282 0.211268 0.373239 0.035211 0.746479 0.042254 0.119718 0.091549 0.281690 0.049296 0.563380 0.105634 0.218310 0.000000 0.443662 0.338028 0.161972 0.126761 0.598592 0.112676 0.267606 0.528169 0.176056 0.028169 0.640845 0.028169 0.091549 0.239437 0.063380 0.084507 0.809859 0.042254 0.366197 0.246479 0.211268 0.176056 0.471831 0.140845 0.309859 0.077465 0.373239 0.000000 0.542254 0.084507 0.211268 0.105634 0.605634 0.077465 0.197183 0.302817 0.478873 0.021127 0.408451 0.140845 0.387324 0.063380 0.098592 0.704225 0.197183 0.000000 0.683099 0.028169 0.070423 0.218310 0.140845 0.373239 0.485915 0.000000 0.788732 0.000000 0.063380 0.147887 0.000000 0.169014 0.816901 0.014085 0.274648 0.295775 0.239437 0.190141 Consensus sequence: RAGKGMAGVRRGSRCASAGV Reserve complement motif 0.274648 0.239437 0.295775 0.190141 0.000000 0.816901 0.169014 0.014085 0.147887 0.000000 0.063380 0.788732 0.140845 0.485915 0.373239 0.000000 0.218310 0.028169 0.070423 0.683099 0.098592 0.197183 0.704225 0.000000 0.063380 0.140845 0.387324 0.408451 0.197183 0.478873 0.302817 0.021127 0.211268 0.605634 0.105634 0.077465 0.373239 0.542254 0.000000 0.084507 0.077465 0.140845 0.309859 0.471831 0.176056 0.246479 0.211268 0.366197 0.063380 0.809859 0.084507 0.042254 0.239437 0.028169 0.091549 0.640845 0.267606 0.176056 0.528169 0.028169 0.161972 0.598592 0.126761 0.112676 0.218310 0.443662 0.000000 0.338028 0.281690 0.563380 0.049296 0.105634 0.091549 0.042254 0.119718 0.746479 0.035211 0.211268 0.373239 0.380282 Consensus sequence: VCTSTGKSCMKBCTRCYCTK ************************************************************************ Best Matches for Motif ID 93 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00528 Foxm1_secondary Original Motif Original Motif Forward 1 20 0.046584 Species: Mus musculus Original motif 0.399785 0.446658 0.111435 0.042122 0.535175 0.103991 0.089706 0.271128 0.078171 0.387987 0.375083 0.158759 0.309001 0.519142 0.070618 0.101239 0.201844 0.255818 0.323149 0.219190 0.534101 0.109845 0.235026 0.121028 0.656038 0.037473 0.261484 0.045006 0.315713 0.164290 0.471815 0.048182 0.651960 0.009412 0.328237 0.010391 0.937365 0.017313 0.007516 0.037807 0.019983 0.044238 0.012387 0.923392 0.061195 0.021485 0.881645 0.035675 0.017521 0.952998 0.013139 0.016342 0.254160 0.029735 0.493023 0.223082 0.239200 0.593324 0.114503 0.052973 0.610822 0.071539 0.099169 0.218470 0.166610 0.389712 0.204400 0.239278 0.227752 0.361626 0.178497 0.232125 0.537030 0.182466 0.026035 0.254470 0.235902 0.151006 0.043788 0.569304 0.081851 0.250397 0.590059 0.077693 0.340417 0.189613 0.272075 0.197895 Consensus sequence: MWSMBAARRATGCDCABHATGD Reverse complement motif 0.197895 0.189613 0.272075 0.340417 0.081851 0.590059 0.250397 0.077693 0.569304 0.151006 0.043788 0.235902 0.254470 0.182466 0.026035 0.537030 0.227752 0.178497 0.361626 0.232125 0.166610 0.204400 0.389712 0.239278 0.218470 0.071539 0.099169 0.610822 0.239200 0.114503 0.593324 0.052973 0.254160 0.493023 0.029735 0.223082 0.017521 0.013139 0.952998 0.016342 0.061195 0.881645 0.021485 0.035675 0.923392 0.044238 0.012387 0.019983 0.037807 0.017313 0.007516 0.937365 0.010391 0.009412 0.328237 0.651960 0.315713 0.471815 0.164290 0.048182 0.045006 0.037473 0.261484 0.656038 0.121028 0.109845 0.235026 0.534101 0.201844 0.323149 0.255818 0.219190 0.309001 0.070618 0.519142 0.101239 0.078171 0.375083 0.387987 0.158759 0.271128 0.103991 0.089706 0.535175 0.399785 0.111435 0.446658 0.042122 Consensus sequence: DCATDBTGHGCATKMTTBRSWR Alignment: MWSMBAARRATGCDCABHATGD RAGKGMAGVRRGSRCASAGV-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v015681_secondary Reverse Complement Reverse Complement Backward 1 20 0.047222 Species: Mus musculus Original motif 0.331499 0.188505 0.182841 0.297156 0.328961 0.213025 0.273530 0.184484 0.197213 0.129292 0.524914 0.148581 0.274491 0.226406 0.312118 0.186986 0.103231 0.393726 0.364988 0.138055 0.552594 0.166422 0.186262 0.094722 0.157618 0.064773 0.616497 0.161112 0.139166 0.176098 0.621185 0.063551 0.748420 0.062398 0.012447 0.176735 0.116584 0.009438 0.860326 0.013653 0.005030 0.003646 0.974877 0.016447 0.055257 0.007181 0.921760 0.015802 0.032748 0.058249 0.052709 0.856293 0.105606 0.872231 0.014370 0.007793 0.019480 0.497379 0.125899 0.357242 0.478582 0.269713 0.061464 0.190242 0.253985 0.287006 0.201320 0.257689 0.319384 0.210231 0.175842 0.294543 0.222123 0.287802 0.201294 0.288782 0.139951 0.376041 0.081133 0.402875 0.213450 0.343835 0.383676 0.059039 0.322294 0.355918 0.148062 0.173725 Consensus sequence: HVGVSAGGAGGGTCYHHHHYVH Reverse complement motif 0.322294 0.148062 0.355918 0.173725 0.213450 0.383676 0.343835 0.059039 0.402875 0.376041 0.081133 0.139951 0.288782 0.287802 0.201294 0.222123 0.294543 0.210231 0.175842 0.319384 0.253985 0.201320 0.287006 0.257689 0.190242 0.269713 0.061464 0.478582 0.019480 0.125899 0.497379 0.357242 0.105606 0.014370 0.872231 0.007793 0.856293 0.058249 0.052709 0.032748 0.055257 0.921760 0.007181 0.015802 0.005030 0.974877 0.003646 0.016447 0.116584 0.860326 0.009438 0.013653 0.176735 0.062398 0.012447 0.748420 0.139166 0.621185 0.176098 0.063551 0.157618 0.616497 0.064773 0.161112 0.094722 0.166422 0.186262 0.552594 0.103231 0.364988 0.393726 0.138055 0.274491 0.312118 0.226406 0.186986 0.197213 0.524914 0.129292 0.148581 0.184484 0.213025 0.273530 0.328961 0.297156 0.188505 0.182841 0.331499 Consensus sequence: DVMHHDHKGACCCTCCTSVCBH Alignment: DVMHHDHKGACCCTCCTSVCBH --VCTSTGKSCMKBCTRCYCTK ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00539 Gli2_v016060_secondary Reverse Complement Original Motif Forward 1 20 0.047753 Species: Mus musculus Original motif 0.533199 0.080715 0.330435 0.055650 0.152031 0.212841 0.110234 0.524893 0.223934 0.264217 0.087037 0.424811 0.115097 0.339994 0.343861 0.201048 0.124993 0.418259 0.365642 0.091106 0.158365 0.292428 0.088361 0.460847 0.165479 0.561778 0.022254 0.250489 0.136873 0.259822 0.579763 0.023543 0.109570 0.747495 0.055128 0.087807 0.061912 0.792986 0.109031 0.036071 0.508703 0.267806 0.169766 0.053725 0.040912 0.838888 0.057470 0.062730 0.330554 0.606077 0.016192 0.047177 0.068079 0.563969 0.029742 0.338209 0.388799 0.291667 0.191284 0.128249 0.183283 0.578079 0.171100 0.067538 0.165163 0.097206 0.631377 0.106253 0.128564 0.435496 0.253275 0.182665 0.103395 0.088222 0.234758 0.573625 0.432879 0.276641 0.155895 0.134585 0.339199 0.148928 0.311036 0.200836 0.211958 0.298526 0.158443 0.331072 Consensus sequence: RTHBSYCGCCMCMYVCGBTVDH Reverse complement motif 0.331072 0.298526 0.158443 0.211958 0.200836 0.148928 0.311036 0.339199 0.134585 0.276641 0.155895 0.432879 0.573625 0.088222 0.234758 0.103395 0.128564 0.253275 0.435496 0.182665 0.165163 0.631377 0.097206 0.106253 0.183283 0.171100 0.578079 0.067538 0.128249 0.291667 0.191284 0.388799 0.068079 0.029742 0.563969 0.338209 0.330554 0.016192 0.606077 0.047177 0.040912 0.057470 0.838888 0.062730 0.053725 0.267806 0.169766 0.508703 0.061912 0.109031 0.792986 0.036071 0.109570 0.055128 0.747495 0.087807 0.136873 0.579763 0.259822 0.023543 0.165479 0.022254 0.561778 0.250489 0.460847 0.292428 0.088361 0.158365 0.124993 0.365642 0.418259 0.091106 0.115097 0.343861 0.339994 0.201048 0.424811 0.264217 0.087037 0.223934 0.524893 0.212841 0.110234 0.152031 0.055650 0.080715 0.330435 0.533199 Consensus sequence: HDBABCGBKRGYGGCGMSBHAK Alignment: RTHBSYCGCCMCMYVCGBTVDH VCTSTGKSCMKBCTRCYCTK-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00034 Sox7_secondary Reverse Complement Reverse Complement Backward 3 20 0.047977 Species: Mus musculus Original motif 0.067627 0.131333 0.654425 0.146615 0.156488 0.114442 0.145630 0.583441 0.206450 0.265630 0.358017 0.169903 0.090729 0.460713 0.274712 0.173847 0.285994 0.099998 0.154485 0.459523 0.635908 0.184787 0.072982 0.106323 0.748421 0.039204 0.092605 0.119769 0.081342 0.061327 0.044532 0.812799 0.143120 0.043879 0.024216 0.788785 0.247544 0.092102 0.621453 0.038901 0.295531 0.036295 0.027594 0.640580 0.194561 0.305468 0.339916 0.160055 0.175038 0.193568 0.101212 0.530182 0.145226 0.167488 0.559871 0.127415 0.271501 0.237429 0.206701 0.284369 0.216834 0.109191 0.569605 0.104370 0.182624 0.177160 0.300475 0.339742 0.331737 0.198645 0.265137 0.204482 0.230155 0.359365 0.183450 0.227029 0.056581 0.067297 0.463052 0.413070 0.198891 0.324626 0.304424 0.172059 0.181968 0.287547 0.202419 0.328066 Consensus sequence: GTVBDAATTGTVTGHGDDHKVB Reverse complement motif 0.328066 0.287547 0.202419 0.181968 0.198891 0.304424 0.324626 0.172059 0.056581 0.463052 0.067297 0.413070 0.230155 0.183450 0.359365 0.227029 0.204482 0.198645 0.265137 0.331737 0.339742 0.177160 0.300475 0.182624 0.216834 0.569605 0.109191 0.104370 0.284369 0.237429 0.206701 0.271501 0.145226 0.559871 0.167488 0.127415 0.530182 0.193568 0.101212 0.175038 0.194561 0.339916 0.305468 0.160055 0.640580 0.036295 0.027594 0.295531 0.247544 0.621453 0.092102 0.038901 0.788785 0.043879 0.024216 0.143120 0.812799 0.061327 0.044532 0.081342 0.119769 0.039204 0.092605 0.748421 0.106323 0.184787 0.072982 0.635908 0.459523 0.099998 0.154485 0.285994 0.090729 0.274712 0.460713 0.173847 0.206450 0.358017 0.265630 0.169903 0.583441 0.114442 0.145630 0.156488 0.067627 0.654425 0.131333 0.146615 Consensus sequence: VVYDDDCHCAVACAATTDBVAC Alignment: VVYDDDCHCAVACAATTDBVAC VCTSTGKSCMKBCTRCYCTK-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00538 Gli1_v016060_secondary Reverse Complement Reverse Complement Forward 1 20 0.048732 Species: Mus musculus Original motif 0.319838 0.171199 0.138099 0.370865 0.269358 0.196600 0.346909 0.187133 0.176807 0.338888 0.193903 0.290402 0.230268 0.119645 0.310500 0.339587 0.517372 0.257658 0.111673 0.113296 0.159477 0.126524 0.561119 0.152879 0.117072 0.553013 0.130919 0.198996 0.073372 0.163548 0.525014 0.238066 0.143608 0.186896 0.170528 0.498967 0.054943 0.079034 0.722992 0.143031 0.048852 0.015134 0.852458 0.083556 0.029001 0.023938 0.918900 0.028160 0.036727 0.092645 0.090591 0.780037 0.017757 0.057598 0.895222 0.029423 0.026113 0.048113 0.879744 0.046030 0.023041 0.787043 0.123490 0.066426 0.579766 0.004868 0.296873 0.118493 0.303862 0.042931 0.290151 0.363055 0.099672 0.237431 0.262301 0.400597 0.217788 0.163908 0.367628 0.250676 0.450783 0.141108 0.226137 0.181972 0.485086 0.102553 0.242662 0.169700 0.109057 0.454222 0.145665 0.291056 Consensus sequence: HVBDAGCGBGGGTGGCRDBDDDB Reverse complement motif 0.109057 0.145665 0.454222 0.291056 0.169700 0.102553 0.242662 0.485086 0.181972 0.141108 0.226137 0.450783 0.217788 0.367628 0.163908 0.250676 0.400597 0.237431 0.262301 0.099672 0.363055 0.042931 0.290151 0.303862 0.118493 0.004868 0.296873 0.579766 0.023041 0.123490 0.787043 0.066426 0.026113 0.879744 0.048113 0.046030 0.017757 0.895222 0.057598 0.029423 0.780037 0.092645 0.090591 0.036727 0.029001 0.918900 0.023938 0.028160 0.048852 0.852458 0.015134 0.083556 0.054943 0.722992 0.079034 0.143031 0.498967 0.186896 0.170528 0.143608 0.073372 0.525014 0.163548 0.238066 0.117072 0.130919 0.553013 0.198996 0.159477 0.561119 0.126524 0.152879 0.113296 0.257658 0.111673 0.517372 0.339587 0.119645 0.310500 0.230268 0.176807 0.193903 0.338888 0.290402 0.269358 0.346909 0.196600 0.187133 0.370865 0.171199 0.138099 0.319838 Consensus sequence: BDDHVDKGCCACCCVCGCTDBVH Alignment: BDDHVDKGCCACCCVCGCTDBVH VCTSTGKSCMKBCTRCYCTK--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v016060_secondary Reverse Complement Original Motif Backward 4 20 0.049567 Species: Mus musculus Original motif 0.168550 0.345968 0.396524 0.088958 0.038113 0.360882 0.114042 0.486963 0.349356 0.180599 0.051416 0.418629 0.258773 0.332518 0.244932 0.163778 0.371663 0.208591 0.263136 0.156609 0.225440 0.321741 0.175932 0.276887 0.100827 0.656850 0.018644 0.223679 0.494140 0.155427 0.327424 0.023009 0.105642 0.805846 0.027712 0.060800 0.065110 0.845072 0.058046 0.031772 0.649343 0.110180 0.180680 0.059797 0.064269 0.853604 0.066860 0.015268 0.437421 0.533797 0.016833 0.011948 0.121694 0.787708 0.016177 0.074421 0.625382 0.066925 0.266070 0.041623 0.117819 0.608153 0.165139 0.108889 0.145639 0.102001 0.604926 0.147434 0.521188 0.184986 0.064607 0.229219 0.180371 0.274237 0.096591 0.448801 0.071055 0.455813 0.332817 0.140315 0.084503 0.199982 0.448293 0.267222 0.389451 0.169545 0.155507 0.285497 0.424314 0.227621 0.101210 0.246855 Consensus sequence: VYWVVHCRCCACMCACGAHSBHH Reverse complement motif 0.246855 0.227621 0.101210 0.424314 0.285497 0.169545 0.155507 0.389451 0.084503 0.448293 0.199982 0.267222 0.071055 0.332817 0.455813 0.140315 0.448801 0.274237 0.096591 0.180371 0.229219 0.184986 0.064607 0.521188 0.145639 0.604926 0.102001 0.147434 0.117819 0.165139 0.608153 0.108889 0.041623 0.066925 0.266070 0.625382 0.121694 0.016177 0.787708 0.074421 0.437421 0.016833 0.533797 0.011948 0.064269 0.066860 0.853604 0.015268 0.059797 0.110180 0.180680 0.649343 0.065110 0.058046 0.845072 0.031772 0.105642 0.027712 0.805846 0.060800 0.023009 0.155427 0.327424 0.494140 0.100827 0.018644 0.656850 0.223679 0.225440 0.175932 0.321741 0.276887 0.156609 0.208591 0.263136 0.371663 0.258773 0.244932 0.332518 0.163778 0.418629 0.180599 0.051416 0.349356 0.486963 0.360882 0.114042 0.038113 0.168550 0.396524 0.345968 0.088958 Consensus sequence: HHBSHTCGTGRGTGGKGDBVWMV Alignment: VYWVVHCRCCACMCACGAHSBHH VCTSTGKSCMKBCTRCYCTK--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00540 Gli3_v015681_secondary Reverse Complement Reverse Complement Backward 3 20 0.050670 Species: Mus musculus Original motif 0.214165 0.143436 0.372522 0.269876 0.314445 0.406003 0.160351 0.119201 0.137147 0.092924 0.042921 0.727007 0.044121 0.072843 0.051741 0.831295 0.261292 0.324124 0.298498 0.116086 0.258125 0.323243 0.263362 0.155271 0.204557 0.589399 0.107153 0.098891 0.371021 0.244027 0.291102 0.093849 0.096327 0.572718 0.011797 0.319159 0.027282 0.046183 0.844519 0.082016 0.018921 0.012887 0.915917 0.052275 0.364793 0.166722 0.084229 0.384256 0.028216 0.011233 0.951056 0.009495 0.054974 0.004738 0.890377 0.049911 0.006802 0.312915 0.134247 0.546036 0.241289 0.628210 0.104788 0.025713 0.237863 0.302807 0.213018 0.246311 0.349399 0.203220 0.086635 0.360746 0.386634 0.144693 0.246895 0.221779 0.425101 0.354676 0.093374 0.126849 0.060272 0.391320 0.104905 0.443503 0.162090 0.190233 0.227433 0.420244 Consensus sequence: DVTTVVCVYGGHGGYCHHDMYB Reverse complement motif 0.420244 0.190233 0.227433 0.162090 0.443503 0.391320 0.104905 0.060272 0.126849 0.354676 0.093374 0.425101 0.221779 0.144693 0.246895 0.386634 0.360746 0.203220 0.086635 0.349399 0.237863 0.213018 0.302807 0.246311 0.241289 0.104788 0.628210 0.025713 0.546036 0.312915 0.134247 0.006802 0.054974 0.890377 0.004738 0.049911 0.028216 0.951056 0.011233 0.009495 0.384256 0.166722 0.084229 0.364793 0.018921 0.915917 0.012887 0.052275 0.027282 0.844519 0.046183 0.082016 0.096327 0.011797 0.572718 0.319159 0.093849 0.244027 0.291102 0.371021 0.204557 0.107153 0.589399 0.098891 0.258125 0.263362 0.323243 0.155271 0.261292 0.298498 0.324124 0.116086 0.831295 0.072843 0.051741 0.044121 0.727007 0.092924 0.042921 0.137147 0.314445 0.160351 0.406003 0.119201 0.214165 0.372522 0.143436 0.269876 Consensus sequence: VMYDHDGMCCHCCKBGVVAAVH Alignment: VMYDHDGMCCHCCKBGVVAAVH VCTSTGKSCMKBCTRCYCTK-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00400 Zif268 Original Motif Reverse Complement Forward 1 20 0.053252 Species: Mus musculus Original motif 0.104824 0.412716 0.254506 0.227955 0.644922 0.065476 0.140479 0.149122 0.201205 0.166164 0.347131 0.285501 0.360606 0.256316 0.150766 0.232313 0.199831 0.240681 0.279350 0.280137 0.234308 0.204076 0.321306 0.240310 0.274112 0.462435 0.111425 0.152028 0.067070 0.717501 0.073934 0.141496 0.106745 0.084442 0.658566 0.150247 0.025128 0.967053 0.003585 0.004234 0.006412 0.982989 0.003227 0.007371 0.009588 0.877620 0.002571 0.110221 0.621521 0.355443 0.015669 0.007366 0.002600 0.980275 0.004191 0.012934 0.118773 0.026658 0.783843 0.070725 0.022358 0.822101 0.024684 0.130857 0.713212 0.080912 0.128793 0.077084 0.166568 0.250955 0.107934 0.474544 0.225040 0.222494 0.163301 0.389166 0.268976 0.223206 0.265314 0.242504 0.137052 0.229058 0.148439 0.485451 0.135819 0.304550 0.141994 0.417637 0.272440 0.319501 0.230580 0.177478 Consensus sequence: BADHBDHCGCCCMCGCAHHDBBV Reverse complement motif 0.272440 0.230580 0.319501 0.177478 0.417637 0.304550 0.141994 0.135819 0.485451 0.229058 0.148439 0.137052 0.242504 0.223206 0.265314 0.268976 0.389166 0.222494 0.163301 0.225040 0.474544 0.250955 0.107934 0.166568 0.077084 0.080912 0.128793 0.713212 0.022358 0.024684 0.822101 0.130857 0.118773 0.783843 0.026658 0.070725 0.002600 0.004191 0.980275 0.012934 0.007366 0.355443 0.015669 0.621521 0.009588 0.002571 0.877620 0.110221 0.006412 0.003227 0.982989 0.007371 0.025128 0.003585 0.967053 0.004234 0.106745 0.658566 0.084442 0.150247 0.067070 0.073934 0.717501 0.141496 0.274112 0.111425 0.462435 0.152028 0.234308 0.321306 0.204076 0.240310 0.280137 0.240681 0.279350 0.199831 0.232313 0.256316 0.150766 0.360606 0.201205 0.347131 0.166164 0.285501 0.149122 0.065476 0.140479 0.644922 0.104824 0.254506 0.412716 0.227955 Consensus sequence: VVVDHHTGCGYGGGCGDHVHHTB Alignment: BADHBDHCGCCCMCGCAHHDBBV RAGKGMAGVRRGSRCASAGV--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00526 Foxn1_primary Reverse Complement Reverse Complement Forward 2 20 0.053608 Species: Mus musculus Original motif 0.456612 0.057181 0.078281 0.407926 0.460529 0.185506 0.083106 0.270859 0.445717 0.179510 0.239355 0.135417 0.116339 0.145186 0.275331 0.463144 0.239398 0.142078 0.480004 0.138520 0.355157 0.217877 0.284296 0.142670 0.318602 0.444835 0.153321 0.083243 0.609569 0.055866 0.280349 0.054216 0.062297 0.769824 0.027844 0.140035 0.151868 0.019245 0.803188 0.025699 0.011842 0.952534 0.017959 0.017665 0.017665 0.017959 0.952534 0.011842 0.025699 0.803188 0.019245 0.151868 0.140035 0.027844 0.769824 0.062297 0.054216 0.280349 0.055866 0.609569 0.013084 0.624655 0.177956 0.184305 0.287647 0.183527 0.295753 0.233074 0.042309 0.345931 0.198458 0.413301 0.338138 0.266033 0.045367 0.350462 0.302850 0.155320 0.074662 0.467168 0.240926 0.068901 0.283055 0.407118 0.409954 0.183157 0.154186 0.252704 Consensus sequence: WHVBVVMACGCGCGTCDYHWDH Reverse complement motif 0.252704 0.183157 0.154186 0.409954 0.407118 0.068901 0.283055 0.240926 0.467168 0.155320 0.074662 0.302850 0.350462 0.266033 0.045367 0.338138 0.413301 0.345931 0.198458 0.042309 0.287647 0.295753 0.183527 0.233074 0.013084 0.177956 0.624655 0.184305 0.609569 0.280349 0.055866 0.054216 0.140035 0.769824 0.027844 0.062297 0.025699 0.019245 0.803188 0.151868 0.017665 0.952534 0.017959 0.011842 0.011842 0.017959 0.952534 0.017665 0.151868 0.803188 0.019245 0.025699 0.062297 0.027844 0.769824 0.140035 0.054216 0.055866 0.280349 0.609569 0.318602 0.153321 0.444835 0.083243 0.142670 0.217877 0.284296 0.355157 0.239398 0.480004 0.142078 0.138520 0.463144 0.145186 0.275331 0.116339 0.135417 0.179510 0.239355 0.445717 0.270859 0.185506 0.083106 0.460529 0.407926 0.057181 0.078281 0.456612 Consensus sequence: HDWHMHGACGCGCGTRBVVBHW Alignment: HDWHMHGACGCGCGTRBVVBHW -VCTSTGKSCMKBCTRCYCTK- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00098 Rfx3_secondary Original Motif Reverse Complement Forward 4 20 0.055457 Species: Mus musculus Original motif 0.314514 0.275352 0.257617 0.152518 0.126939 0.598294 0.130576 0.144192 0.102265 0.155334 0.177957 0.564445 0.129288 0.282678 0.326990 0.261044 0.318166 0.227823 0.175681 0.278330 0.109019 0.380838 0.278328 0.231815 0.226145 0.289206 0.291300 0.193348 0.035863 0.844339 0.072582 0.047216 0.223793 0.187244 0.088092 0.500871 0.039800 0.029681 0.026201 0.904317 0.298298 0.032147 0.654746 0.014809 0.014729 0.022023 0.944826 0.018422 0.485114 0.004925 0.013785 0.496176 0.035708 0.020381 0.240804 0.703108 0.951152 0.012738 0.017886 0.018224 0.023713 0.944394 0.009538 0.022355 0.291067 0.385205 0.232388 0.091339 0.340334 0.199588 0.311526 0.148552 0.198713 0.472138 0.178319 0.150830 0.321155 0.269932 0.311301 0.097612 0.412646 0.195252 0.231950 0.160152 0.297134 0.180928 0.250400 0.271538 0.151169 0.305386 0.358574 0.184871 Consensus sequence: VCTBHBVCTTGGWTACVVVVVDB Reverse complement motif 0.151169 0.358574 0.305386 0.184871 0.271538 0.180928 0.250400 0.297134 0.160152 0.195252 0.231950 0.412646 0.097612 0.269932 0.311301 0.321155 0.198713 0.178319 0.472138 0.150830 0.148552 0.199588 0.311526 0.340334 0.291067 0.232388 0.385205 0.091339 0.023713 0.009538 0.944394 0.022355 0.018224 0.012738 0.017886 0.951152 0.703108 0.020381 0.240804 0.035708 0.496176 0.004925 0.013785 0.485114 0.014729 0.944826 0.022023 0.018422 0.298298 0.654746 0.032147 0.014809 0.904317 0.029681 0.026201 0.039800 0.500871 0.187244 0.088092 0.223793 0.035863 0.072582 0.844339 0.047216 0.226145 0.291300 0.289206 0.193348 0.109019 0.278328 0.380838 0.231815 0.278330 0.227823 0.175681 0.318166 0.129288 0.326990 0.282678 0.261044 0.564445 0.155334 0.177957 0.102265 0.126939 0.130576 0.598294 0.144192 0.152518 0.275352 0.257617 0.314514 Consensus sequence: BDBBVBVGTAWCCAAGVBHBAGB Alignment: BDBBVBVGTAWCCAAGVBHBAGB ---RAGKGMAGVRRGSRCASAGV ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 5 Motif ID: 94 Motif name: TFM13 Original motif 0.071429 0.142857 0.000000 0.785714 0.071429 0.071429 0.000000 0.857143 0.000000 0.000000 0.000000 1.000000 0.000000 0.071429 0.285714 0.642857 0.000000 0.142857 0.000000 0.857143 0.000000 0.000000 0.000000 1.000000 0.071429 0.000000 0.071429 0.857143 0.142857 0.000000 0.357143 0.500000 0.071429 0.000000 0.000000 0.928571 0.000000 0.071429 0.000000 0.928571 0.000000 0.000000 0.357143 0.642857 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.214286 0.785714 0.142857 0.000000 0.000000 0.857143 0.571429 0.071429 0.214286 0.142857 0.857143 0.000000 0.000000 0.142857 0.142857 0.000000 0.285714 0.571429 0.000000 0.071429 0.285714 0.642857 0.357143 0.357143 0.071429 0.214286 0.428571 0.000000 0.071429 0.500000 Consensus sequence: TTTTTTTKTTKTTTAATTHW Reserve complement motif 0.500000 0.000000 0.071429 0.428571 0.214286 0.357143 0.071429 0.357143 0.642857 0.071429 0.285714 0.000000 0.571429 0.000000 0.285714 0.142857 0.142857 0.000000 0.000000 0.857143 0.142857 0.071429 0.214286 0.571429 0.857143 0.000000 0.000000 0.142857 0.785714 0.000000 0.214286 0.000000 1.000000 0.000000 0.000000 0.000000 0.642857 0.000000 0.357143 0.000000 0.928571 0.071429 0.000000 0.000000 0.928571 0.000000 0.000000 0.071429 0.500000 0.000000 0.357143 0.142857 0.857143 0.000000 0.071429 0.071429 1.000000 0.000000 0.000000 0.000000 0.857143 0.142857 0.000000 0.000000 0.642857 0.071429 0.285714 0.000000 1.000000 0.000000 0.000000 0.000000 0.857143 0.071429 0.000000 0.071429 0.785714 0.142857 0.000000 0.071429 Consensus sequence: WHAATTAAARAARAAAAAAA ************************************************************************ Best Matches for Motif ID 94 (Highest to Lowest) ************************************************************************ Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00032 Gata3_primary Reverse Complement Original Motif Forward 2 20 0.055871 Species: Mus musculus Original motif 0.151572 0.262753 0.258275 0.327401 0.221834 0.113385 0.275380 0.389400 0.297769 0.136928 0.134678 0.430625 0.270099 0.110415 0.271106 0.348380 0.265471 0.090253 0.223340 0.420936 0.616582 0.090091 0.171960 0.121367 0.197318 0.107541 0.406904 0.288237 0.798258 0.046950 0.001406 0.153385 0.003195 0.002516 0.989707 0.004582 0.991503 0.002748 0.002617 0.003132 0.005015 0.002764 0.003026 0.989195 0.948394 0.008932 0.001344 0.041330 0.973109 0.004100 0.004081 0.018710 0.040365 0.113905 0.828185 0.017545 0.736608 0.130524 0.113464 0.019404 0.415921 0.106101 0.316613 0.161365 0.376582 0.170927 0.155572 0.296919 0.137731 0.197151 0.211055 0.454064 0.324853 0.122747 0.246107 0.306293 0.462490 0.207311 0.159392 0.170807 0.380420 0.188972 0.311990 0.118618 0.222178 0.157873 0.380486 0.239463 Consensus sequence: BDHDDADAGATAAGADHBDHVD Reverse complement motif 0.222178 0.380486 0.157873 0.239463 0.118618 0.188972 0.311990 0.380420 0.170807 0.207311 0.159392 0.462490 0.306293 0.122747 0.246107 0.324853 0.454064 0.197151 0.211055 0.137731 0.296919 0.170927 0.155572 0.376582 0.161365 0.106101 0.316613 0.415921 0.019404 0.130524 0.113464 0.736608 0.040365 0.828185 0.113905 0.017545 0.018710 0.004100 0.004081 0.973109 0.041330 0.008932 0.001344 0.948394 0.989195 0.002764 0.003026 0.005015 0.003132 0.002748 0.002617 0.991503 0.003195 0.989707 0.002516 0.004582 0.153385 0.046950 0.001406 0.798258 0.197318 0.406904 0.107541 0.288237 0.121367 0.090091 0.171960 0.616582 0.420936 0.090253 0.223340 0.265471 0.348380 0.110415 0.271106 0.270099 0.430625 0.136928 0.134678 0.297769 0.389400 0.113385 0.275380 0.221834 0.327401 0.262753 0.258275 0.151572 Consensus sequence: HBHDVHDTCTTATCTHTDDHDV Alignment: BDHDDADAGATAAGADHBDHVD -WHAATTAAARAARAAAAAAA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00034 Sox7_primary Reverse Complement Original Motif Backward 3 20 0.060496 Species: Mus musculus Original motif 0.360997 0.300272 0.115555 0.223177 0.309749 0.228429 0.166233 0.295589 0.149419 0.176868 0.240155 0.433558 0.379704 0.095791 0.276373 0.248133 0.394549 0.174184 0.130641 0.300626 0.443749 0.070776 0.211081 0.274393 0.364301 0.074356 0.370406 0.190936 0.791976 0.038475 0.093390 0.076159 0.963721 0.001826 0.002456 0.031997 0.004516 0.954596 0.008092 0.032796 0.981080 0.002062 0.002161 0.014697 0.986185 0.001846 0.006976 0.004992 0.059567 0.003649 0.002189 0.934595 0.495328 0.024257 0.240450 0.239965 0.305027 0.094878 0.526069 0.074025 0.418442 0.196237 0.158323 0.226998 0.336713 0.220452 0.191155 0.251680 0.192296 0.300342 0.169047 0.338315 0.240387 0.144634 0.128513 0.486465 0.290763 0.271259 0.116600 0.321377 0.224825 0.296233 0.229255 0.249687 0.493240 0.171285 0.075148 0.260326 Consensus sequence: HHBDHDDAACAATDRHHHHHBW Reverse complement motif 0.260326 0.171285 0.075148 0.493240 0.224825 0.229255 0.296233 0.249687 0.321377 0.271259 0.116600 0.290763 0.486465 0.144634 0.128513 0.240387 0.338315 0.300342 0.169047 0.192296 0.251680 0.220452 0.191155 0.336713 0.226998 0.196237 0.158323 0.418442 0.305027 0.526069 0.094878 0.074025 0.239965 0.024257 0.240450 0.495328 0.934595 0.003649 0.002189 0.059567 0.004992 0.001846 0.006976 0.986185 0.014697 0.002062 0.002161 0.981080 0.004516 0.008092 0.954596 0.032796 0.031997 0.001826 0.002456 0.963721 0.076159 0.038475 0.093390 0.791976 0.364301 0.370406 0.074356 0.190936 0.274393 0.070776 0.211081 0.443749 0.300626 0.174184 0.130641 0.394549 0.248133 0.095791 0.276373 0.379704 0.433558 0.176868 0.240155 0.149419 0.295589 0.228429 0.166233 0.309749 0.223177 0.300272 0.115555 0.360997 Consensus sequence: WBHHHHHMDATTGTTHDHDVHH Alignment: HHBDHDDAACAATDRHHHHHBW WHAATTAAARAARAAAAAAA-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00032 Gata3_secondary Original Motif Original Motif Backward 2 20 0.078424 Species: Mus musculus Original motif 0.177641 0.319872 0.115137 0.387350 0.136644 0.182137 0.205873 0.475347 0.254263 0.244280 0.165207 0.336250 0.240415 0.207557 0.237497 0.314530 0.271041 0.214702 0.364395 0.149863 0.095475 0.320104 0.191738 0.392682 0.500902 0.142722 0.026556 0.329820 0.051221 0.023698 0.897245 0.027836 0.922410 0.027509 0.024058 0.026023 0.030735 0.070903 0.024248 0.874114 0.242120 0.231992 0.225143 0.300745 0.106956 0.220471 0.283490 0.389083 0.152079 0.165830 0.135066 0.547025 0.839205 0.051581 0.060119 0.049095 0.041204 0.069147 0.070830 0.818819 0.051861 0.848177 0.027599 0.072363 0.383793 0.016807 0.397470 0.201931 0.381899 0.215846 0.255908 0.146347 0.094792 0.358651 0.280905 0.265652 0.296132 0.181545 0.178433 0.343890 0.301997 0.254722 0.108566 0.334714 0.349481 0.270693 0.137507 0.242319 Consensus sequence: HBHDVBWGATHBTATCRVBHHH Reverse complement motif 0.242319 0.270693 0.137507 0.349481 0.334714 0.254722 0.108566 0.301997 0.343890 0.181545 0.178433 0.296132 0.094792 0.280905 0.358651 0.265652 0.146347 0.215846 0.255908 0.381899 0.383793 0.397470 0.016807 0.201931 0.051861 0.027599 0.848177 0.072363 0.818819 0.069147 0.070830 0.041204 0.049095 0.051581 0.060119 0.839205 0.547025 0.165830 0.135066 0.152079 0.389083 0.220471 0.283490 0.106956 0.300745 0.231992 0.225143 0.242120 0.874114 0.070903 0.024248 0.030735 0.026023 0.027509 0.024058 0.922410 0.051221 0.897245 0.023698 0.027836 0.329820 0.142722 0.026556 0.500902 0.392682 0.320104 0.191738 0.095475 0.271041 0.364395 0.214702 0.149863 0.314530 0.207557 0.237497 0.240415 0.336250 0.244280 0.165207 0.254263 0.475347 0.182137 0.205873 0.136644 0.387350 0.319872 0.115137 0.177641 Consensus sequence: HHHBBMGATAVHATCWVVDHVH Alignment: HBHDVBWGATHBTATCRVBHHH -TTTTTTTKTTKTTTAATTHW- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00034 Sox7_secondary Original Motif Original Motif Backward 1 20 0.079035 Species: Mus musculus Original motif 0.067627 0.131333 0.654425 0.146615 0.156488 0.114442 0.145630 0.583441 0.206450 0.265630 0.358017 0.169903 0.090729 0.460713 0.274712 0.173847 0.285994 0.099998 0.154485 0.459523 0.635908 0.184787 0.072982 0.106323 0.748421 0.039204 0.092605 0.119769 0.081342 0.061327 0.044532 0.812799 0.143120 0.043879 0.024216 0.788785 0.247544 0.092102 0.621453 0.038901 0.295531 0.036295 0.027594 0.640580 0.194561 0.305468 0.339916 0.160055 0.175038 0.193568 0.101212 0.530182 0.145226 0.167488 0.559871 0.127415 0.271501 0.237429 0.206701 0.284369 0.216834 0.109191 0.569605 0.104370 0.182624 0.177160 0.300475 0.339742 0.331737 0.198645 0.265137 0.204482 0.230155 0.359365 0.183450 0.227029 0.056581 0.067297 0.463052 0.413070 0.198891 0.324626 0.304424 0.172059 0.181968 0.287547 0.202419 0.328066 Consensus sequence: GTVBDAATTGTVTGHGDDHKVB Reverse complement motif 0.328066 0.287547 0.202419 0.181968 0.198891 0.304424 0.324626 0.172059 0.056581 0.463052 0.067297 0.413070 0.230155 0.183450 0.359365 0.227029 0.204482 0.198645 0.265137 0.331737 0.339742 0.177160 0.300475 0.182624 0.216834 0.569605 0.109191 0.104370 0.284369 0.237429 0.206701 0.271501 0.145226 0.559871 0.167488 0.127415 0.530182 0.193568 0.101212 0.175038 0.194561 0.339916 0.305468 0.160055 0.640580 0.036295 0.027594 0.295531 0.247544 0.621453 0.092102 0.038901 0.788785 0.043879 0.024216 0.143120 0.812799 0.061327 0.044532 0.081342 0.119769 0.039204 0.092605 0.748421 0.106323 0.184787 0.072982 0.635908 0.459523 0.099998 0.154485 0.285994 0.090729 0.274712 0.460713 0.173847 0.206450 0.358017 0.265630 0.169903 0.583441 0.114442 0.145630 0.156488 0.067627 0.654425 0.131333 0.146615 Consensus sequence: VVYDDDCHCAVACAATTDBVAC Alignment: GTVBDAATTGTVTGHGDDHKVB --TTTTTTTKTTKTTTAATTHW ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00528 Foxm1_secondary Reverse Complement Original Motif Backward 4 19 0.574613 Species: Mus musculus Original motif 0.399785 0.446658 0.111435 0.042122 0.535175 0.103991 0.089706 0.271128 0.078171 0.387987 0.375083 0.158759 0.309001 0.519142 0.070618 0.101239 0.201844 0.255818 0.323149 0.219190 0.534101 0.109845 0.235026 0.121028 0.656038 0.037473 0.261484 0.045006 0.315713 0.164290 0.471815 0.048182 0.651960 0.009412 0.328237 0.010391 0.937365 0.017313 0.007516 0.037807 0.019983 0.044238 0.012387 0.923392 0.061195 0.021485 0.881645 0.035675 0.017521 0.952998 0.013139 0.016342 0.254160 0.029735 0.493023 0.223082 0.239200 0.593324 0.114503 0.052973 0.610822 0.071539 0.099169 0.218470 0.166610 0.389712 0.204400 0.239278 0.227752 0.361626 0.178497 0.232125 0.537030 0.182466 0.026035 0.254470 0.235902 0.151006 0.043788 0.569304 0.081851 0.250397 0.590059 0.077693 0.340417 0.189613 0.272075 0.197895 Consensus sequence: MWSMBAARRATGCDCABHATGD Reverse complement motif 0.197895 0.189613 0.272075 0.340417 0.081851 0.590059 0.250397 0.077693 0.569304 0.151006 0.043788 0.235902 0.254470 0.182466 0.026035 0.537030 0.227752 0.178497 0.361626 0.232125 0.166610 0.204400 0.389712 0.239278 0.218470 0.071539 0.099169 0.610822 0.239200 0.114503 0.593324 0.052973 0.254160 0.493023 0.029735 0.223082 0.017521 0.013139 0.952998 0.016342 0.061195 0.881645 0.021485 0.035675 0.923392 0.044238 0.012387 0.019983 0.037807 0.017313 0.007516 0.937365 0.010391 0.009412 0.328237 0.651960 0.315713 0.471815 0.164290 0.048182 0.045006 0.037473 0.261484 0.656038 0.121028 0.109845 0.235026 0.534101 0.201844 0.323149 0.255818 0.219190 0.309001 0.070618 0.519142 0.101239 0.078171 0.375083 0.387987 0.158759 0.271128 0.103991 0.089706 0.535175 0.399785 0.111435 0.446658 0.042122 Consensus sequence: DCATDBTGHGCATKMTTBRSWR Alignment: -MWSMBAARRATGCDCABHATGD WHAATTAAARAARAAAAAAA--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00077 Srf_secondary Reverse Complement Original Motif Forward 4 17 1.544397 Species: Mus musculus Original motif 0.162968 0.284828 0.440984 0.111220 0.151392 0.200635 0.205316 0.442657 0.267215 0.083669 0.192498 0.456618 0.332771 0.180711 0.200027 0.286491 0.509370 0.102954 0.242569 0.145107 0.666262 0.077309 0.154466 0.101962 0.737968 0.113335 0.100401 0.048296 0.658878 0.141580 0.134033 0.065510 0.766115 0.094051 0.069763 0.070072 0.755621 0.088491 0.044802 0.111086 0.749083 0.135917 0.047510 0.067490 0.663231 0.176795 0.028134 0.131839 0.553358 0.277659 0.038655 0.130328 0.392578 0.314083 0.209844 0.083495 0.198462 0.237132 0.239466 0.324940 0.275121 0.210087 0.194779 0.320013 0.287748 0.277395 0.142704 0.292154 Consensus sequence: VBDDAAAAAAAAMVBHH Reverse complement motif 0.292154 0.277395 0.142704 0.287748 0.320013 0.210087 0.194779 0.275121 0.324940 0.237132 0.239466 0.198462 0.083495 0.314083 0.209844 0.392578 0.130328 0.277659 0.038655 0.553358 0.131839 0.176795 0.028134 0.663231 0.067490 0.135917 0.047510 0.749083 0.111086 0.088491 0.044802 0.755621 0.070072 0.094051 0.069763 0.766115 0.065510 0.141580 0.134033 0.658878 0.048296 0.113335 0.100401 0.737968 0.101962 0.077309 0.154466 0.666262 0.145107 0.102954 0.242569 0.509370 0.286491 0.180711 0.200027 0.332771 0.456618 0.083669 0.192498 0.267215 0.442657 0.200635 0.205316 0.151392 0.162968 0.440984 0.284828 0.111220 Consensus sequence: HHVBYTTTTTTTTDDVV Alignment: HHVBYTTTTTTTTDDVV--- ---WHAATTAAARAARAAAAAAA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00262 Lhx1 Original Motif Reverse Complement Backward 1 17 1.549722 Species: Mus musculus Original motif 0.315209 0.366241 0.224448 0.094102 0.226797 0.179144 0.492088 0.101972 0.381904 0.174944 0.190109 0.253043 0.579946 0.093451 0.164863 0.161740 0.033857 0.165951 0.023937 0.776255 0.010562 0.080337 0.000382 0.908720 0.983678 0.007671 0.007262 0.001389 0.976701 0.001039 0.004283 0.017977 0.017977 0.004283 0.001039 0.976701 0.001389 0.007262 0.007671 0.983678 0.908720 0.000382 0.080337 0.010562 0.776255 0.023937 0.165951 0.033857 0.372268 0.146397 0.084885 0.396450 0.497647 0.117799 0.091325 0.293229 0.643159 0.113094 0.055630 0.188117 0.275637 0.292310 0.136698 0.295355 0.149905 0.181595 0.349326 0.319174 Consensus sequence: VVDATTAATTAAWWAHB Reverse complement motif 0.149905 0.349326 0.181595 0.319174 0.295355 0.292310 0.136698 0.275637 0.188117 0.113094 0.055630 0.643159 0.293229 0.117799 0.091325 0.497647 0.396450 0.146397 0.084885 0.372268 0.033857 0.023937 0.165951 0.776255 0.010562 0.000382 0.080337 0.908720 0.983678 0.007262 0.007671 0.001389 0.976701 0.004283 0.001039 0.017977 0.017977 0.001039 0.004283 0.976701 0.001389 0.007671 0.007262 0.983678 0.908720 0.080337 0.000382 0.010562 0.776255 0.165951 0.023937 0.033857 0.161740 0.093451 0.164863 0.579946 0.253043 0.174944 0.190109 0.381904 0.226797 0.492088 0.179144 0.101972 0.315209 0.224448 0.366241 0.094102 Consensus sequence: BHTWWTTAATTAATDVV Alignment: ---BHTWWTTAATTAATDVV TTTTTTTKTTKTTTAATTHW ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00188 Lmx1a Original Motif Reverse Complement Forward 4 17 1.551620 Species: Mus musculus Original motif 0.163027 0.506393 0.246327 0.084254 0.173471 0.211164 0.477036 0.138330 0.431859 0.182416 0.155298 0.230427 0.420560 0.127574 0.126915 0.324951 0.060842 0.128686 0.037075 0.773398 0.032236 0.035967 0.001358 0.930439 0.938541 0.008352 0.007051 0.046057 0.964464 0.001596 0.003362 0.030579 0.030579 0.003362 0.001596 0.964464 0.046057 0.007051 0.008352 0.938541 0.930439 0.001358 0.035967 0.032236 0.773398 0.037075 0.128686 0.060842 0.498149 0.057242 0.091924 0.352686 0.520755 0.121277 0.054120 0.303848 0.483290 0.175070 0.069683 0.271957 0.221557 0.366894 0.153619 0.257930 0.167920 0.342643 0.169856 0.319581 Consensus sequence: CVHHTTAATTAAWWWHB Reverse complement motif 0.167920 0.169856 0.342643 0.319581 0.221557 0.153619 0.366894 0.257930 0.271957 0.175070 0.069683 0.483290 0.303848 0.121277 0.054120 0.520755 0.352686 0.057242 0.091924 0.498149 0.060842 0.037075 0.128686 0.773398 0.032236 0.001358 0.035967 0.930439 0.938541 0.007051 0.008352 0.046057 0.964464 0.003362 0.001596 0.030579 0.030579 0.001596 0.003362 0.964464 0.046057 0.008352 0.007051 0.938541 0.930439 0.035967 0.001358 0.032236 0.773398 0.128686 0.037075 0.060842 0.324951 0.127574 0.126915 0.420560 0.230427 0.182416 0.155298 0.431859 0.173471 0.477036 0.211164 0.138330 0.163027 0.246327 0.506393 0.084254 Consensus sequence: BDWWWTTAATTAAHHVG Alignment: CVHHTTAATTAAWWWHB--- ---TTTTTTTKTTKTTTAATTHW ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00244 Tlx2 Original Motif Reverse Complement Backward 2 17 1.552541 Species: Mus musculus Original motif 0.105929 0.200768 0.276304 0.416999 0.605737 0.082484 0.045449 0.266331 0.616140 0.070870 0.219578 0.093411 0.207168 0.101768 0.138909 0.552155 0.205588 0.314073 0.063564 0.416776 0.753104 0.060249 0.064598 0.122049 0.785626 0.028841 0.041793 0.143739 0.035001 0.038504 0.018619 0.907876 0.039875 0.038526 0.009504 0.912095 0.920557 0.010057 0.045031 0.024356 0.806507 0.031077 0.030857 0.131559 0.170184 0.056552 0.043413 0.729851 0.630114 0.051409 0.080078 0.238398 0.554265 0.093528 0.223411 0.128796 0.183854 0.390999 0.093847 0.331300 0.289988 0.101149 0.103803 0.505061 0.400594 0.061089 0.136478 0.401839 Consensus sequence: BAATHAATTAATAAHWW Reverse complement motif 0.401839 0.061089 0.136478 0.400594 0.505061 0.101149 0.103803 0.289988 0.183854 0.093847 0.390999 0.331300 0.128796 0.093528 0.223411 0.554265 0.238398 0.051409 0.080078 0.630114 0.729851 0.056552 0.043413 0.170184 0.131559 0.031077 0.030857 0.806507 0.024356 0.010057 0.045031 0.920557 0.912095 0.038526 0.009504 0.039875 0.907876 0.038504 0.018619 0.035001 0.143739 0.028841 0.041793 0.785626 0.122049 0.060249 0.064598 0.753104 0.416776 0.314073 0.063564 0.205588 0.552155 0.101768 0.138909 0.207168 0.093411 0.070870 0.219578 0.616140 0.266331 0.082484 0.045449 0.605737 0.416999 0.200768 0.276304 0.105929 Consensus sequence: WWDTTATTAATTHATTV Alignment: ---BAATHAATTAATAAHWW TTTTTTTKTTKTTTAATTHW- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score UP00169 Lmx1b Reverse Complement Reverse Complement Backward 4 17 1.552585 Species: Mus musculus Original motif 0.336931 0.220707 0.306671 0.135692 0.251068 0.126246 0.394767 0.227919 0.318914 0.086872 0.150663 0.443551 0.368649 0.051170 0.092361 0.487819 0.359682 0.088506 0.064771 0.487041 0.019535 0.162692 0.015925 0.801848 0.015902 0.024224 0.000652 0.959222 0.974698 0.006086 0.002334 0.016882 0.978085 0.001281 0.005421 0.015214 0.015214 0.005421 0.001281 0.978085 0.016882 0.002334 0.006086 0.974698 0.959222 0.000652 0.024224 0.015902 0.801848 0.015925 0.162692 0.019535 0.242323 0.115688 0.116364 0.525625 0.283782 0.097563 0.188384 0.430271 0.252386 0.255982 0.135946 0.355686 0.141430 0.249462 0.350759 0.258349 Consensus sequence: VDWWWTTAATTAATDHB Reverse complement motif 0.141430 0.350759 0.249462 0.258349 0.355686 0.255982 0.135946 0.252386 0.430271 0.097563 0.188384 0.283782 0.525625 0.115688 0.116364 0.242323 0.019535 0.015925 0.162692 0.801848 0.015902 0.000652 0.024224 0.959222 0.974698 0.002334 0.006086 0.016882 0.978085 0.005421 0.001281 0.015214 0.015214 0.001281 0.005421 0.978085 0.016882 0.006086 0.002334 0.974698 0.959222 0.024224 0.000652 0.015902 0.801848 0.162692 0.015925 0.019535 0.487041 0.088506 0.064771 0.359682 0.487819 0.051170 0.092361 0.368649 0.443551 0.086872 0.150663 0.318914 0.251068 0.394767 0.126246 0.227919 0.135692 0.220707 0.306671 0.336931 Consensus sequence: BHDATTAATTAAWWWHB Alignment: ---BHDATTAATTAAWWWHB WHAATTAAARAARAAAAAAA--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Results created by MOTIFSIM on 06-18-2018 15:05:43 Runtime: 848.838021 seconds MOTIFSIM is written by Ngoc Tam L. Tran