**************************************************************************************************************************************************************************************************** MOTIFSIM - Motif Similarity Detection Tool Version 2.2 **************************************************************************************************************************************************************************************************** INPUT **************************************************************************************************************************************************************************************************** Input Parameters Number of files: 2 Number of top significant motifs: 10 Number of best matches: 10 Similarity cutoff: >= 0.75 Matching motif database: UniProbe Mus Musculus Motif tree: Yes Combined similar motifs: Yes Output file type: All Output file format: All Input files and motif counts File name Count of motifs Dataset # PScanChIP_DM05.txt 16 1 RSAT_peak-motifs_DM05.txt 17 2 **************************************************************************************************************************************************************************************************** RESULTS **************************************************************************************************************************************************************************************************** ****************************************************************** Top 10 Significant Motifs - Global Matching (Highest to Lowest) ****************************************************************** Dataset #: 1 Motif ID: 5 Motif name: ZEB1 Original motif 0.024390 0.829268 0.024390 0.121951 0.926829 0.000000 0.048780 0.024390 0.000000 0.975610 0.024390 0.000000 0.000000 0.926829 0.073171 0.000000 0.000000 0.024390 0.000000 0.975610 0.243902 0.024390 0.390244 0.341463 Consensus sequence: CACCTD Reverse complement motif 0.243902 0.390244 0.024390 0.341463 0.975610 0.024390 0.000000 0.000000 0.000000 0.073171 0.926829 0.000000 0.000000 0.024390 0.975610 0.000000 0.024390 0.000000 0.048780 0.926829 0.024390 0.024390 0.829268 0.121951 Consensus sequence: HAGGTG *************************************************************** Best Matches for Top Significant Motif ID 5 (Highest to Lowest) *************************************************************** Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 21 AmTGTGACACCACAGT Reverse Complement Reverse Complement Forward 4 6 0.034978 Original motif 0.703125 0.187500 0.015625 0.093750 0.265625 0.500000 0.125000 0.109375 0.015625 0.046875 0.031250 0.906250 0.078125 0.015625 0.890625 0.015625 0.000000 0.000000 0.000000 1.000000 0.000000 0.031250 0.906250 0.062500 0.953125 0.000000 0.015625 0.031250 0.046875 0.890625 0.000000 0.062500 0.968750 0.000000 0.015625 0.015625 0.109375 0.781250 0.062500 0.046875 0.062500 0.890625 0.000000 0.046875 0.953125 0.000000 0.031250 0.015625 0.031250 0.781250 0.046875 0.140625 0.937500 0.015625 0.031250 0.015625 0.093750 0.078125 0.734375 0.093750 0.031250 0.078125 0.000000 0.890625 Consensus sequence: AMTGTGACACCACAGT Reverse complement motif 0.890625 0.078125 0.000000 0.031250 0.093750 0.734375 0.078125 0.093750 0.015625 0.015625 0.031250 0.937500 0.031250 0.046875 0.781250 0.140625 0.015625 0.000000 0.031250 0.953125 0.062500 0.000000 0.890625 0.046875 0.109375 0.062500 0.781250 0.046875 0.015625 0.000000 0.015625 0.968750 0.046875 0.000000 0.890625 0.062500 0.031250 0.000000 0.015625 0.953125 0.000000 0.906250 0.031250 0.062500 1.000000 0.000000 0.000000 0.000000 0.078125 0.890625 0.015625 0.015625 0.906250 0.046875 0.031250 0.015625 0.265625 0.125000 0.500000 0.109375 0.093750 0.187500 0.015625 0.703125 Consensus sequence: ACTGTGGTGTCACART Alignment: ACTGTGGTGTCACART ---HAGGTG------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 17 TgTGgTGTCACAGTGCTCC Reverse Complement Original Motif Forward 2 6 0.036277 Original motif 0.111111 0.083333 0.055556 0.750000 0.125000 0.097222 0.652778 0.125000 0.041667 0.097222 0.027778 0.833333 0.027778 0.027778 0.791667 0.152778 0.055556 0.166667 0.652778 0.125000 0.000000 0.041667 0.013889 0.944444 0.041667 0.000000 0.888889 0.069444 0.027778 0.027778 0.000000 0.944444 0.041667 0.944444 0.013889 0.000000 0.916667 0.027778 0.000000 0.055556 0.069444 0.875000 0.000000 0.055556 0.833333 0.013889 0.013889 0.138889 0.041667 0.069444 0.819444 0.069444 0.027778 0.027778 0.027778 0.916667 0.069444 0.013889 0.847222 0.069444 0.069444 0.777778 0.027778 0.125000 0.055556 0.041667 0.027778 0.875000 0.041667 0.708333 0.125000 0.125000 0.111111 0.819444 0.055556 0.013889 Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif 0.111111 0.055556 0.819444 0.013889 0.041667 0.125000 0.708333 0.125000 0.875000 0.041667 0.027778 0.055556 0.069444 0.027778 0.777778 0.125000 0.069444 0.847222 0.013889 0.069444 0.916667 0.027778 0.027778 0.027778 0.041667 0.819444 0.069444 0.069444 0.138889 0.013889 0.013889 0.833333 0.069444 0.000000 0.875000 0.055556 0.055556 0.027778 0.000000 0.916667 0.041667 0.013889 0.944444 0.000000 0.944444 0.027778 0.000000 0.027778 0.041667 0.888889 0.000000 0.069444 0.944444 0.041667 0.013889 0.000000 0.055556 0.652778 0.166667 0.125000 0.027778 0.791667 0.027778 0.152778 0.833333 0.097222 0.027778 0.041667 0.125000 0.652778 0.097222 0.125000 0.750000 0.083333 0.055556 0.111111 Consensus sequence: GGAGCACTGTGACACCACA Alignment: TGTGGTGTCACAGTGCTCC -HAGGTG------------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 27 AgTGCTCCACTGTGgTGTCACAgT Reverse Complement Original Motif Forward 12 6 0.040961 Original motif 0.690141 0.126761 0.042254 0.140845 0.169014 0.098592 0.676056 0.056338 0.042254 0.028169 0.028169 0.901408 0.056338 0.000000 0.774648 0.169014 0.042254 0.887324 0.042254 0.028169 0.000000 0.014085 0.000000 0.985915 0.056338 0.830986 0.042254 0.070423 0.028169 0.957746 0.014085 0.000000 0.957746 0.000000 0.014085 0.028169 0.084507 0.845070 0.014085 0.056338 0.028169 0.014085 0.000000 0.957746 0.140845 0.028169 0.802817 0.028169 0.014085 0.014085 0.014085 0.957746 0.014085 0.000000 0.929577 0.056338 0.056338 0.154930 0.619718 0.169014 0.014085 0.028169 0.000000 0.957746 0.056338 0.014085 0.873239 0.056338 0.014085 0.000000 0.000000 0.985915 0.042254 0.929577 0.000000 0.028169 0.957746 0.028169 0.000000 0.014085 0.028169 0.845070 0.028169 0.098592 0.873239 0.014085 0.042254 0.070423 0.098592 0.154930 0.563380 0.183099 0.070423 0.014085 0.112676 0.802817 Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif 0.802817 0.014085 0.112676 0.070423 0.098592 0.563380 0.154930 0.183099 0.070423 0.014085 0.042254 0.873239 0.028169 0.028169 0.845070 0.098592 0.014085 0.028169 0.000000 0.957746 0.042254 0.000000 0.929577 0.028169 0.985915 0.000000 0.000000 0.014085 0.056338 0.873239 0.014085 0.056338 0.957746 0.028169 0.000000 0.014085 0.056338 0.619718 0.154930 0.169014 0.014085 0.929577 0.000000 0.056338 0.957746 0.014085 0.014085 0.014085 0.140845 0.802817 0.028169 0.028169 0.957746 0.014085 0.000000 0.028169 0.084507 0.014085 0.845070 0.056338 0.028169 0.000000 0.014085 0.957746 0.028169 0.014085 0.957746 0.000000 0.056338 0.042254 0.830986 0.070423 0.985915 0.014085 0.000000 0.000000 0.042254 0.042254 0.887324 0.028169 0.056338 0.774648 0.000000 0.169014 0.901408 0.028169 0.028169 0.042254 0.169014 0.676056 0.098592 0.056338 0.140845 0.126761 0.042254 0.690141 Consensus sequence: ACTGTGACACCACAGTGGAGCACT Alignment: AGTGCTCCACTGTGGTGTCACAGT -----------HAGGTG------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 33 srACyCCGAyr Reverse Complement Reverse Complement Forward 3 6 0.042600 Original motif 0.000000 0.500000 0.500000 0.000000 0.500000 0.000000 0.500000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.000000 0.500000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.000000 0.500000 0.500000 0.000000 0.500000 0.000000 Consensus sequence: SRACYCCGAYR Reverse complement motif 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.500000 0.500000 0.000000 Consensus sequence: KKTCGGKGTKS Alignment: KKTCGGKGTKS --HAGGTG--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 23 TGGAGCACTGTGACAcCACAGTGg Reverse Complement Reverse Complement Forward 6 6 0.049618 Original motif 0.054054 0.040541 0.054054 0.851351 0.040541 0.013514 0.824324 0.121622 0.094595 0.135135 0.756757 0.013514 0.891892 0.000000 0.000000 0.108108 0.040541 0.094595 0.810811 0.054054 0.081081 0.797297 0.054054 0.067568 0.932432 0.027027 0.000000 0.040541 0.054054 0.756757 0.135135 0.054054 0.108108 0.027027 0.013514 0.851351 0.108108 0.000000 0.851351 0.040541 0.013514 0.000000 0.027027 0.959459 0.000000 0.013514 0.945946 0.040541 0.905405 0.000000 0.067568 0.027027 0.054054 0.837838 0.000000 0.108108 0.945946 0.013514 0.040541 0.000000 0.162162 0.500000 0.189189 0.148649 0.108108 0.824324 0.000000 0.067568 0.945946 0.000000 0.040541 0.013514 0.081081 0.837838 0.027027 0.054054 0.945946 0.000000 0.013514 0.040541 0.054054 0.067568 0.783784 0.094595 0.054054 0.027027 0.000000 0.918919 0.040541 0.013514 0.864865 0.081081 0.148649 0.121622 0.675676 0.054054 Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif 0.148649 0.675676 0.121622 0.054054 0.040541 0.864865 0.013514 0.081081 0.918919 0.027027 0.000000 0.054054 0.054054 0.783784 0.067568 0.094595 0.040541 0.000000 0.013514 0.945946 0.081081 0.027027 0.837838 0.054054 0.013514 0.000000 0.040541 0.945946 0.108108 0.000000 0.824324 0.067568 0.162162 0.189189 0.500000 0.148649 0.000000 0.013514 0.040541 0.945946 0.054054 0.000000 0.837838 0.108108 0.027027 0.000000 0.067568 0.905405 0.000000 0.945946 0.013514 0.040541 0.959459 0.000000 0.027027 0.013514 0.108108 0.851351 0.000000 0.040541 0.851351 0.027027 0.013514 0.108108 0.054054 0.135135 0.756757 0.054054 0.040541 0.027027 0.000000 0.932432 0.081081 0.054054 0.797297 0.067568 0.040541 0.810811 0.094595 0.054054 0.108108 0.000000 0.000000 0.891892 0.094595 0.756757 0.135135 0.013514 0.040541 0.824324 0.013514 0.121622 0.851351 0.040541 0.054054 0.054054 Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA Alignment: CCACTGTGVTGTCACAGTGCTCCA -----HAGGTG------------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 26 CAcCACAGTGGAGCAct Reverse Complement Reverse Complement Backward 1 6 0.053874 Original motif 0.078125 0.734375 0.046875 0.140625 0.828125 0.046875 0.078125 0.046875 0.203125 0.484375 0.156250 0.156250 0.015625 0.984375 0.000000 0.000000 0.968750 0.015625 0.015625 0.000000 0.000000 0.906250 0.015625 0.078125 0.859375 0.000000 0.000000 0.140625 0.031250 0.000000 0.906250 0.062500 0.000000 0.015625 0.000000 0.984375 0.000000 0.000000 0.968750 0.031250 0.046875 0.062500 0.812500 0.078125 0.937500 0.015625 0.015625 0.031250 0.015625 0.031250 0.921875 0.031250 0.125000 0.796875 0.000000 0.078125 0.875000 0.046875 0.046875 0.031250 0.093750 0.656250 0.093750 0.156250 0.156250 0.078125 0.109375 0.656250 Consensus sequence: CAHCACAGTGGAGCACT Reverse complement motif 0.656250 0.078125 0.109375 0.156250 0.093750 0.093750 0.656250 0.156250 0.031250 0.046875 0.046875 0.875000 0.125000 0.000000 0.796875 0.078125 0.015625 0.921875 0.031250 0.031250 0.031250 0.015625 0.015625 0.937500 0.046875 0.812500 0.062500 0.078125 0.000000 0.968750 0.000000 0.031250 0.984375 0.015625 0.000000 0.000000 0.031250 0.906250 0.000000 0.062500 0.140625 0.000000 0.000000 0.859375 0.000000 0.015625 0.906250 0.078125 0.000000 0.015625 0.015625 0.968750 0.015625 0.000000 0.984375 0.000000 0.203125 0.156250 0.484375 0.156250 0.046875 0.046875 0.078125 0.828125 0.078125 0.046875 0.734375 0.140625 Consensus sequence: AGTGCTCCACTGTGDTG Alignment: AGTGCTCCACTGTGDTG -----------HAGGTG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 19 atactttggc Original Motif Original Motif Backward 4 6 0.055303 Original motif 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 Consensus sequence: ATACTTTGGC Reverse complement motif 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 Consensus sequence: GCCAAAGTAT Alignment: ATACTTTGGC -CACCTD--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 22 CACTGTGrYrtCACAGTGswsCAcT Original Motif Reverse Complement Forward 19 6 0.056465 Original motif 0.111111 0.746032 0.063492 0.079365 0.857143 0.047619 0.047619 0.047619 0.047619 0.857143 0.079365 0.015873 0.031746 0.000000 0.000000 0.968254 0.031746 0.015873 0.904762 0.047619 0.000000 0.000000 0.000000 1.000000 0.031746 0.000000 0.857143 0.111111 0.396825 0.111111 0.412698 0.079365 0.031746 0.253968 0.015873 0.698413 0.365079 0.000000 0.634921 0.000000 0.079365 0.206349 0.047619 0.666667 0.047619 0.936508 0.015873 0.000000 0.952381 0.000000 0.015873 0.031746 0.015873 0.920635 0.000000 0.063492 0.920635 0.000000 0.000000 0.079365 0.063492 0.047619 0.841270 0.047619 0.000000 0.000000 0.015873 0.984127 0.047619 0.015873 0.904762 0.031746 0.015873 0.603175 0.317460 0.063492 0.396825 0.000000 0.015873 0.587302 0.015873 0.476190 0.428571 0.079365 0.063492 0.920635 0.000000 0.015873 0.920635 0.015873 0.047619 0.015873 0.095238 0.682540 0.095238 0.126984 0.047619 0.015873 0.095238 0.841270 Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif 0.841270 0.015873 0.095238 0.047619 0.095238 0.095238 0.682540 0.126984 0.015873 0.015873 0.047619 0.920635 0.063492 0.000000 0.920635 0.015873 0.015873 0.428571 0.476190 0.079365 0.587302 0.000000 0.015873 0.396825 0.015873 0.317460 0.603175 0.063492 0.047619 0.904762 0.015873 0.031746 0.984127 0.000000 0.015873 0.000000 0.063492 0.841270 0.047619 0.047619 0.079365 0.000000 0.000000 0.920635 0.015873 0.000000 0.920635 0.063492 0.031746 0.000000 0.015873 0.952381 0.047619 0.015873 0.936508 0.000000 0.666667 0.206349 0.047619 0.079365 0.365079 0.634921 0.000000 0.000000 0.698413 0.253968 0.015873 0.031746 0.396825 0.412698 0.111111 0.079365 0.031746 0.857143 0.000000 0.111111 1.000000 0.000000 0.000000 0.000000 0.031746 0.904762 0.015873 0.047619 0.968254 0.000000 0.000000 0.031746 0.047619 0.079365 0.857143 0.015873 0.047619 0.047619 0.047619 0.857143 0.111111 0.063492 0.746032 0.079365 Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG Alignment: AGTGSWSCACTGTGAMAMCACAGTG ------------------CACCTD- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 24 ssCCCCGCSssk Original Motif Original Motif Forward 6 6 0.057185 Original motif 0.000000 0.444444 0.370370 0.185185 0.111111 0.407407 0.333333 0.148148 0.000000 0.888889 0.037037 0.074074 0.000000 0.888889 0.074074 0.037037 0.000000 0.777778 0.222222 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.037037 0.888889 0.000000 0.074074 0.000000 0.703704 0.296296 0.000000 0.000000 0.518519 0.370370 0.111111 0.111111 0.407407 0.259259 0.222222 0.074074 0.222222 0.407407 0.296296 Consensus sequence: SBCCCCGCCSBB Reverse complement motif 0.074074 0.407407 0.222222 0.296296 0.111111 0.259259 0.407407 0.222222 0.000000 0.370370 0.518519 0.111111 0.000000 0.296296 0.703704 0.000000 0.037037 0.000000 0.888889 0.074074 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.222222 0.777778 0.000000 0.000000 0.074074 0.888889 0.037037 0.000000 0.037037 0.888889 0.074074 0.111111 0.333333 0.407407 0.148148 0.000000 0.370370 0.444444 0.185185 Consensus sequence: BBSGGCGGGGBS Alignment: SBCCCCGCCSBB -----CACCTD- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 20 CagTGCTCCACTGTGgT Reverse Complement Reverse Complement Backward 8 6 0.059470 Original motif 0.150000 0.700000 0.016667 0.133333 0.650000 0.150000 0.050000 0.150000 0.166667 0.116667 0.633333 0.083333 0.050000 0.033333 0.066667 0.850000 0.050000 0.000000 0.833333 0.116667 0.016667 0.966667 0.000000 0.016667 0.050000 0.016667 0.000000 0.933333 0.066667 0.833333 0.066667 0.033333 0.033333 0.966667 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.050000 0.916667 0.016667 0.016667 0.166667 0.000000 0.000000 0.833333 0.083333 0.016667 0.900000 0.000000 0.000000 0.016667 0.016667 0.966667 0.000000 0.016667 0.966667 0.016667 0.116667 0.166667 0.483333 0.233333 0.066667 0.083333 0.050000 0.800000 Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif 0.800000 0.083333 0.050000 0.066667 0.116667 0.483333 0.166667 0.233333 0.000000 0.966667 0.016667 0.016667 0.966667 0.016667 0.016667 0.000000 0.083333 0.900000 0.016667 0.000000 0.833333 0.000000 0.000000 0.166667 0.050000 0.016667 0.916667 0.016667 0.000000 0.000000 0.000000 1.000000 0.033333 0.000000 0.966667 0.000000 0.066667 0.066667 0.833333 0.033333 0.933333 0.016667 0.000000 0.050000 0.016667 0.000000 0.966667 0.016667 0.050000 0.833333 0.000000 0.116667 0.850000 0.033333 0.066667 0.050000 0.166667 0.633333 0.116667 0.083333 0.150000 0.150000 0.050000 0.650000 0.150000 0.016667 0.700000 0.133333 Consensus sequence: ABCACAGTGGAGCACTG Alignment: ABCACAGTGGAGCACTG ----HAGGTG------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 6 Motif name: Mycn Original motif 0.349315 0.363014 0.143836 0.143836 0.089041 0.388128 0.447489 0.075342 0.015982 0.984018 0.000000 0.000000 0.945205 0.000000 0.041096 0.013699 0.000000 0.961187 0.018265 0.020548 0.070776 0.002283 0.924658 0.002283 0.054795 0.221461 0.004566 0.719178 0.000000 0.000000 0.938356 0.061644 0.061644 0.111872 0.739726 0.086758 0.139269 0.605023 0.091324 0.164384 Consensus sequence: HSCACGTGGC Reverse complement motif 0.139269 0.091324 0.605023 0.164384 0.061644 0.739726 0.111872 0.086758 0.000000 0.938356 0.000000 0.061644 0.719178 0.221461 0.004566 0.054795 0.070776 0.924658 0.002283 0.002283 0.000000 0.018265 0.961187 0.020548 0.013699 0.000000 0.041096 0.945205 0.015982 0.000000 0.984018 0.000000 0.089041 0.447489 0.388128 0.075342 0.349315 0.143836 0.363014 0.143836 Consensus sequence: GCCACGTGSD *************************************************************** Best Matches for Top Significant Motif ID 6 (Highest to Lowest) *************************************************************** Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 18 sscCCCGCGcs Reverse Complement Original Motif Backward 1 10 0.065482 Original motif 0.147059 0.441176 0.264706 0.147059 0.117647 0.529412 0.294118 0.058824 0.000000 0.676471 0.235294 0.088235 0.029412 0.852941 0.117647 0.000000 0.000000 0.823529 0.176471 0.000000 0.000000 0.794118 0.205882 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.058824 0.941176 0.000000 0.117647 0.470588 0.235294 0.176471 0.000000 0.323529 0.529412 0.147059 Consensus sequence: BSCCCCGCGBS Reverse complement motif 0.000000 0.529412 0.323529 0.147059 0.117647 0.235294 0.470588 0.176471 0.000000 0.941176 0.058824 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.205882 0.794118 0.000000 0.000000 0.176471 0.823529 0.000000 0.029412 0.117647 0.852941 0.000000 0.000000 0.235294 0.676471 0.088235 0.117647 0.294118 0.529412 0.058824 0.147059 0.264706 0.441176 0.147059 Consensus sequence: SBCGCGGGGSB Alignment: BSCCCCGCGBS -GCCACGTGSD ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 24 ssCCCCGCSssk Original Motif Reverse Complement Forward 2 10 0.070499 Original motif 0.000000 0.444444 0.370370 0.185185 0.111111 0.407407 0.333333 0.148148 0.000000 0.888889 0.037037 0.074074 0.000000 0.888889 0.074074 0.037037 0.000000 0.777778 0.222222 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.037037 0.888889 0.000000 0.074074 0.000000 0.703704 0.296296 0.000000 0.000000 0.518519 0.370370 0.111111 0.111111 0.407407 0.259259 0.222222 0.074074 0.222222 0.407407 0.296296 Consensus sequence: SBCCCCGCCSBB Reverse complement motif 0.074074 0.407407 0.222222 0.296296 0.111111 0.259259 0.407407 0.222222 0.000000 0.370370 0.518519 0.111111 0.000000 0.296296 0.703704 0.000000 0.037037 0.000000 0.888889 0.074074 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.222222 0.777778 0.000000 0.000000 0.074074 0.888889 0.037037 0.000000 0.037037 0.888889 0.074074 0.111111 0.333333 0.407407 0.148148 0.000000 0.370370 0.444444 0.185185 Consensus sequence: BBSGGCGGGGBS Alignment: BBSGGCGGGGBS -HSCACGTGGC- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 22 CACTGTGrYrtCACAGTGswsCAcT Reverse Complement Reverse Complement Backward 10 10 0.088322 Original motif 0.111111 0.746032 0.063492 0.079365 0.857143 0.047619 0.047619 0.047619 0.047619 0.857143 0.079365 0.015873 0.031746 0.000000 0.000000 0.968254 0.031746 0.015873 0.904762 0.047619 0.000000 0.000000 0.000000 1.000000 0.031746 0.000000 0.857143 0.111111 0.396825 0.111111 0.412698 0.079365 0.031746 0.253968 0.015873 0.698413 0.365079 0.000000 0.634921 0.000000 0.079365 0.206349 0.047619 0.666667 0.047619 0.936508 0.015873 0.000000 0.952381 0.000000 0.015873 0.031746 0.015873 0.920635 0.000000 0.063492 0.920635 0.000000 0.000000 0.079365 0.063492 0.047619 0.841270 0.047619 0.000000 0.000000 0.015873 0.984127 0.047619 0.015873 0.904762 0.031746 0.015873 0.603175 0.317460 0.063492 0.396825 0.000000 0.015873 0.587302 0.015873 0.476190 0.428571 0.079365 0.063492 0.920635 0.000000 0.015873 0.920635 0.015873 0.047619 0.015873 0.095238 0.682540 0.095238 0.126984 0.047619 0.015873 0.095238 0.841270 Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif 0.841270 0.015873 0.095238 0.047619 0.095238 0.095238 0.682540 0.126984 0.015873 0.015873 0.047619 0.920635 0.063492 0.000000 0.920635 0.015873 0.015873 0.428571 0.476190 0.079365 0.587302 0.000000 0.015873 0.396825 0.015873 0.317460 0.603175 0.063492 0.047619 0.904762 0.015873 0.031746 0.984127 0.000000 0.015873 0.000000 0.063492 0.841270 0.047619 0.047619 0.079365 0.000000 0.000000 0.920635 0.015873 0.000000 0.920635 0.063492 0.031746 0.000000 0.015873 0.952381 0.047619 0.015873 0.936508 0.000000 0.666667 0.206349 0.047619 0.079365 0.365079 0.634921 0.000000 0.000000 0.698413 0.253968 0.015873 0.031746 0.396825 0.412698 0.111111 0.079365 0.031746 0.857143 0.000000 0.111111 1.000000 0.000000 0.000000 0.000000 0.031746 0.904762 0.015873 0.047619 0.968254 0.000000 0.000000 0.031746 0.047619 0.079365 0.857143 0.015873 0.047619 0.047619 0.047619 0.857143 0.111111 0.063492 0.746032 0.079365 Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG Alignment: AGTGSWSCACTGTGAMAMCACAGTG ------GCCACGTGSD--------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 20 CagTGCTCCACTGTGgT Reverse Complement Reverse Complement Backward 7 10 0.094301 Original motif 0.150000 0.700000 0.016667 0.133333 0.650000 0.150000 0.050000 0.150000 0.166667 0.116667 0.633333 0.083333 0.050000 0.033333 0.066667 0.850000 0.050000 0.000000 0.833333 0.116667 0.016667 0.966667 0.000000 0.016667 0.050000 0.016667 0.000000 0.933333 0.066667 0.833333 0.066667 0.033333 0.033333 0.966667 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.050000 0.916667 0.016667 0.016667 0.166667 0.000000 0.000000 0.833333 0.083333 0.016667 0.900000 0.000000 0.000000 0.016667 0.016667 0.966667 0.000000 0.016667 0.966667 0.016667 0.116667 0.166667 0.483333 0.233333 0.066667 0.083333 0.050000 0.800000 Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif 0.800000 0.083333 0.050000 0.066667 0.116667 0.483333 0.166667 0.233333 0.000000 0.966667 0.016667 0.016667 0.966667 0.016667 0.016667 0.000000 0.083333 0.900000 0.016667 0.000000 0.833333 0.000000 0.000000 0.166667 0.050000 0.016667 0.916667 0.016667 0.000000 0.000000 0.000000 1.000000 0.033333 0.000000 0.966667 0.000000 0.066667 0.066667 0.833333 0.033333 0.933333 0.016667 0.000000 0.050000 0.016667 0.000000 0.966667 0.016667 0.050000 0.833333 0.000000 0.116667 0.850000 0.033333 0.066667 0.050000 0.166667 0.633333 0.116667 0.083333 0.150000 0.150000 0.050000 0.650000 0.150000 0.016667 0.700000 0.133333 Consensus sequence: ABCACAGTGGAGCACTG Alignment: ABCACAGTGGAGCACTG -GCCACGTGSD------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 27 AgTGCTCCACTGTGgTGTCACAgT Reverse Complement Reverse Complement Backward 6 10 0.094936 Original motif 0.690141 0.126761 0.042254 0.140845 0.169014 0.098592 0.676056 0.056338 0.042254 0.028169 0.028169 0.901408 0.056338 0.000000 0.774648 0.169014 0.042254 0.887324 0.042254 0.028169 0.000000 0.014085 0.000000 0.985915 0.056338 0.830986 0.042254 0.070423 0.028169 0.957746 0.014085 0.000000 0.957746 0.000000 0.014085 0.028169 0.084507 0.845070 0.014085 0.056338 0.028169 0.014085 0.000000 0.957746 0.140845 0.028169 0.802817 0.028169 0.014085 0.014085 0.014085 0.957746 0.014085 0.000000 0.929577 0.056338 0.056338 0.154930 0.619718 0.169014 0.014085 0.028169 0.000000 0.957746 0.056338 0.014085 0.873239 0.056338 0.014085 0.000000 0.000000 0.985915 0.042254 0.929577 0.000000 0.028169 0.957746 0.028169 0.000000 0.014085 0.028169 0.845070 0.028169 0.098592 0.873239 0.014085 0.042254 0.070423 0.098592 0.154930 0.563380 0.183099 0.070423 0.014085 0.112676 0.802817 Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif 0.802817 0.014085 0.112676 0.070423 0.098592 0.563380 0.154930 0.183099 0.070423 0.014085 0.042254 0.873239 0.028169 0.028169 0.845070 0.098592 0.014085 0.028169 0.000000 0.957746 0.042254 0.000000 0.929577 0.028169 0.985915 0.000000 0.000000 0.014085 0.056338 0.873239 0.014085 0.056338 0.957746 0.028169 0.000000 0.014085 0.056338 0.619718 0.154930 0.169014 0.014085 0.929577 0.000000 0.056338 0.957746 0.014085 0.014085 0.014085 0.140845 0.802817 0.028169 0.028169 0.957746 0.014085 0.000000 0.028169 0.084507 0.014085 0.845070 0.056338 0.028169 0.000000 0.014085 0.957746 0.028169 0.014085 0.957746 0.000000 0.056338 0.042254 0.830986 0.070423 0.985915 0.014085 0.000000 0.000000 0.042254 0.042254 0.887324 0.028169 0.056338 0.774648 0.000000 0.169014 0.901408 0.028169 0.028169 0.042254 0.169014 0.676056 0.098592 0.056338 0.140845 0.126761 0.042254 0.690141 Consensus sequence: ACTGTGACACCACAGTGGAGCACT Alignment: ACTGTGACACCACAGTGGAGCACT ---------GCCACGTGSD----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 23 TGGAGCACTGTGACAcCACAGTGg Original Motif Original Motif Backward 1 10 0.095511 Original motif 0.054054 0.040541 0.054054 0.851351 0.040541 0.013514 0.824324 0.121622 0.094595 0.135135 0.756757 0.013514 0.891892 0.000000 0.000000 0.108108 0.040541 0.094595 0.810811 0.054054 0.081081 0.797297 0.054054 0.067568 0.932432 0.027027 0.000000 0.040541 0.054054 0.756757 0.135135 0.054054 0.108108 0.027027 0.013514 0.851351 0.108108 0.000000 0.851351 0.040541 0.013514 0.000000 0.027027 0.959459 0.000000 0.013514 0.945946 0.040541 0.905405 0.000000 0.067568 0.027027 0.054054 0.837838 0.000000 0.108108 0.945946 0.013514 0.040541 0.000000 0.162162 0.500000 0.189189 0.148649 0.108108 0.824324 0.000000 0.067568 0.945946 0.000000 0.040541 0.013514 0.081081 0.837838 0.027027 0.054054 0.945946 0.000000 0.013514 0.040541 0.054054 0.067568 0.783784 0.094595 0.054054 0.027027 0.000000 0.918919 0.040541 0.013514 0.864865 0.081081 0.148649 0.121622 0.675676 0.054054 Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif 0.148649 0.675676 0.121622 0.054054 0.040541 0.864865 0.013514 0.081081 0.918919 0.027027 0.000000 0.054054 0.054054 0.783784 0.067568 0.094595 0.040541 0.000000 0.013514 0.945946 0.081081 0.027027 0.837838 0.054054 0.013514 0.000000 0.040541 0.945946 0.108108 0.000000 0.824324 0.067568 0.162162 0.189189 0.500000 0.148649 0.000000 0.013514 0.040541 0.945946 0.054054 0.000000 0.837838 0.108108 0.027027 0.000000 0.067568 0.905405 0.000000 0.945946 0.013514 0.040541 0.959459 0.000000 0.027027 0.013514 0.108108 0.851351 0.000000 0.040541 0.851351 0.027027 0.013514 0.108108 0.054054 0.135135 0.756757 0.054054 0.040541 0.027027 0.000000 0.932432 0.081081 0.054054 0.797297 0.067568 0.040541 0.810811 0.094595 0.054054 0.108108 0.000000 0.000000 0.891892 0.094595 0.756757 0.135135 0.013514 0.040541 0.824324 0.013514 0.121622 0.851351 0.040541 0.054054 0.054054 Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA Alignment: TGGAGCACTGTGACAVCACAGTGG --------------HSCACGTGGC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 26 CAcCACAGTGGAGCAct Reverse Complement Original Motif Forward 3 10 0.095963 Original motif 0.078125 0.734375 0.046875 0.140625 0.828125 0.046875 0.078125 0.046875 0.203125 0.484375 0.156250 0.156250 0.015625 0.984375 0.000000 0.000000 0.968750 0.015625 0.015625 0.000000 0.000000 0.906250 0.015625 0.078125 0.859375 0.000000 0.000000 0.140625 0.031250 0.000000 0.906250 0.062500 0.000000 0.015625 0.000000 0.984375 0.000000 0.000000 0.968750 0.031250 0.046875 0.062500 0.812500 0.078125 0.937500 0.015625 0.015625 0.031250 0.015625 0.031250 0.921875 0.031250 0.125000 0.796875 0.000000 0.078125 0.875000 0.046875 0.046875 0.031250 0.093750 0.656250 0.093750 0.156250 0.156250 0.078125 0.109375 0.656250 Consensus sequence: CAHCACAGTGGAGCACT Reverse complement motif 0.656250 0.078125 0.109375 0.156250 0.093750 0.093750 0.656250 0.156250 0.031250 0.046875 0.046875 0.875000 0.125000 0.000000 0.796875 0.078125 0.015625 0.921875 0.031250 0.031250 0.031250 0.015625 0.015625 0.937500 0.046875 0.812500 0.062500 0.078125 0.000000 0.968750 0.000000 0.031250 0.984375 0.015625 0.000000 0.000000 0.031250 0.906250 0.000000 0.062500 0.140625 0.000000 0.000000 0.859375 0.000000 0.015625 0.906250 0.078125 0.000000 0.015625 0.015625 0.968750 0.015625 0.000000 0.984375 0.000000 0.203125 0.156250 0.484375 0.156250 0.046875 0.046875 0.078125 0.828125 0.078125 0.046875 0.734375 0.140625 Consensus sequence: AGTGCTCCACTGTGDTG Alignment: CAHCACAGTGGAGCACT --GCCACGTGSD----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 32 gCGCGCsCgsG Original Motif Original Motif Forward 2 10 0.098993 Original motif 0.105263 0.210526 0.526316 0.157895 0.000000 0.736842 0.105263 0.157895 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.368421 0.631579 0.000000 0.000000 0.894737 0.105263 0.000000 0.157895 0.157895 0.631579 0.052632 0.052632 0.631579 0.263158 0.052632 0.105263 0.052632 0.789474 0.052632 Consensus sequence: GCGCGCSCGCG Reverse complement motif 0.105263 0.789474 0.052632 0.052632 0.052632 0.263158 0.631579 0.052632 0.157895 0.631579 0.157895 0.052632 0.000000 0.105263 0.894737 0.000000 0.000000 0.631579 0.368421 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.105263 0.736842 0.157895 0.105263 0.526316 0.210526 0.157895 Consensus sequence: CGCGSGCGCGC Alignment: GCGCGCSCGCG -HSCACGTGGC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 17 TgTGgTGTCACAGTGCTCC Reverse Complement Reverse Complement Forward 4 10 0.099169 Original motif 0.111111 0.083333 0.055556 0.750000 0.125000 0.097222 0.652778 0.125000 0.041667 0.097222 0.027778 0.833333 0.027778 0.027778 0.791667 0.152778 0.055556 0.166667 0.652778 0.125000 0.000000 0.041667 0.013889 0.944444 0.041667 0.000000 0.888889 0.069444 0.027778 0.027778 0.000000 0.944444 0.041667 0.944444 0.013889 0.000000 0.916667 0.027778 0.000000 0.055556 0.069444 0.875000 0.000000 0.055556 0.833333 0.013889 0.013889 0.138889 0.041667 0.069444 0.819444 0.069444 0.027778 0.027778 0.027778 0.916667 0.069444 0.013889 0.847222 0.069444 0.069444 0.777778 0.027778 0.125000 0.055556 0.041667 0.027778 0.875000 0.041667 0.708333 0.125000 0.125000 0.111111 0.819444 0.055556 0.013889 Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif 0.111111 0.055556 0.819444 0.013889 0.041667 0.125000 0.708333 0.125000 0.875000 0.041667 0.027778 0.055556 0.069444 0.027778 0.777778 0.125000 0.069444 0.847222 0.013889 0.069444 0.916667 0.027778 0.027778 0.027778 0.041667 0.819444 0.069444 0.069444 0.138889 0.013889 0.013889 0.833333 0.069444 0.000000 0.875000 0.055556 0.055556 0.027778 0.000000 0.916667 0.041667 0.013889 0.944444 0.000000 0.944444 0.027778 0.000000 0.027778 0.041667 0.888889 0.000000 0.069444 0.944444 0.041667 0.013889 0.000000 0.055556 0.652778 0.166667 0.125000 0.027778 0.791667 0.027778 0.152778 0.833333 0.097222 0.027778 0.041667 0.125000 0.652778 0.097222 0.125000 0.750000 0.083333 0.055556 0.111111 Consensus sequence: GGAGCACTGTGACACCACA Alignment: GGAGCACTGTGACACCACA ---GCCACGTGSD------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 28 ssGCkTGCssk Original Motif Reverse Complement Forward 1 10 0.101333 Original motif 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 0.500000 0.500000 Consensus sequence: SSGCKTGCSSK Reverse complement motif 0.000000 0.500000 0.000000 0.500000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.000000 0.500000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 Consensus sequence: YSSGCAYGCSS Alignment: YSSGCAYGCSS HSCACGTGGC- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 8 Motif name: Myc Original motif 0.295154 0.422907 0.158590 0.123348 0.149780 0.233480 0.572687 0.044053 0.035242 0.964758 0.000000 0.000000 0.955947 0.017621 0.022026 0.004405 0.000000 0.933921 0.013216 0.052863 0.083700 0.008811 0.898678 0.008811 0.039648 0.193833 0.000000 0.766520 0.000000 0.008811 0.951542 0.039648 0.000000 0.074890 0.806167 0.118943 0.198238 0.471366 0.105727 0.224670 Consensus sequence: VGCACGTGGH Reverse complement motif 0.198238 0.105727 0.471366 0.224670 0.000000 0.806167 0.074890 0.118943 0.000000 0.951542 0.008811 0.039648 0.766520 0.193833 0.000000 0.039648 0.083700 0.898678 0.008811 0.008811 0.000000 0.013216 0.933921 0.052863 0.004405 0.017621 0.022026 0.955947 0.035242 0.000000 0.964758 0.000000 0.149780 0.572687 0.233480 0.044053 0.295154 0.158590 0.422907 0.123348 Consensus sequence: DCCACGTGCV *************************************************************** Best Matches for Top Significant Motif ID 8 (Highest to Lowest) *************************************************************** Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 18 sscCCCGCGcs Reverse Complement Original Motif Backward 1 10 0.064853 Original motif 0.147059 0.441176 0.264706 0.147059 0.117647 0.529412 0.294118 0.058824 0.000000 0.676471 0.235294 0.088235 0.029412 0.852941 0.117647 0.000000 0.000000 0.823529 0.176471 0.000000 0.000000 0.794118 0.205882 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.058824 0.941176 0.000000 0.117647 0.470588 0.235294 0.176471 0.000000 0.323529 0.529412 0.147059 Consensus sequence: BSCCCCGCGBS Reverse complement motif 0.000000 0.529412 0.323529 0.147059 0.117647 0.235294 0.470588 0.176471 0.000000 0.941176 0.058824 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.205882 0.794118 0.000000 0.000000 0.176471 0.823529 0.000000 0.029412 0.117647 0.852941 0.000000 0.000000 0.235294 0.676471 0.088235 0.117647 0.294118 0.529412 0.058824 0.147059 0.264706 0.441176 0.147059 Consensus sequence: SBCGCGGGGSB Alignment: BSCCCCGCGBS -DCCACGTGCV ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 24 ssCCCCGCSssk Reverse Complement Original Motif Backward 2 10 0.072859 Original motif 0.000000 0.444444 0.370370 0.185185 0.111111 0.407407 0.333333 0.148148 0.000000 0.888889 0.037037 0.074074 0.000000 0.888889 0.074074 0.037037 0.000000 0.777778 0.222222 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.037037 0.888889 0.000000 0.074074 0.000000 0.703704 0.296296 0.000000 0.000000 0.518519 0.370370 0.111111 0.111111 0.407407 0.259259 0.222222 0.074074 0.222222 0.407407 0.296296 Consensus sequence: SBCCCCGCCSBB Reverse complement motif 0.074074 0.407407 0.222222 0.296296 0.111111 0.259259 0.407407 0.222222 0.000000 0.370370 0.518519 0.111111 0.000000 0.296296 0.703704 0.000000 0.037037 0.000000 0.888889 0.074074 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.222222 0.777778 0.000000 0.000000 0.074074 0.888889 0.037037 0.000000 0.037037 0.888889 0.074074 0.111111 0.333333 0.407407 0.148148 0.000000 0.370370 0.444444 0.185185 Consensus sequence: BBSGGCGGGGBS Alignment: SBCCCCGCCSBB -DCCACGTGCV- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 22 CACTGTGrYrtCACAGTGswsCAcT Reverse Complement Original Motif Backward 6 10 0.088891 Original motif 0.111111 0.746032 0.063492 0.079365 0.857143 0.047619 0.047619 0.047619 0.047619 0.857143 0.079365 0.015873 0.031746 0.000000 0.000000 0.968254 0.031746 0.015873 0.904762 0.047619 0.000000 0.000000 0.000000 1.000000 0.031746 0.000000 0.857143 0.111111 0.396825 0.111111 0.412698 0.079365 0.031746 0.253968 0.015873 0.698413 0.365079 0.000000 0.634921 0.000000 0.079365 0.206349 0.047619 0.666667 0.047619 0.936508 0.015873 0.000000 0.952381 0.000000 0.015873 0.031746 0.015873 0.920635 0.000000 0.063492 0.920635 0.000000 0.000000 0.079365 0.063492 0.047619 0.841270 0.047619 0.000000 0.000000 0.015873 0.984127 0.047619 0.015873 0.904762 0.031746 0.015873 0.603175 0.317460 0.063492 0.396825 0.000000 0.015873 0.587302 0.015873 0.476190 0.428571 0.079365 0.063492 0.920635 0.000000 0.015873 0.920635 0.015873 0.047619 0.015873 0.095238 0.682540 0.095238 0.126984 0.047619 0.015873 0.095238 0.841270 Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif 0.841270 0.015873 0.095238 0.047619 0.095238 0.095238 0.682540 0.126984 0.015873 0.015873 0.047619 0.920635 0.063492 0.000000 0.920635 0.015873 0.015873 0.428571 0.476190 0.079365 0.587302 0.000000 0.015873 0.396825 0.015873 0.317460 0.603175 0.063492 0.047619 0.904762 0.015873 0.031746 0.984127 0.000000 0.015873 0.000000 0.063492 0.841270 0.047619 0.047619 0.079365 0.000000 0.000000 0.920635 0.015873 0.000000 0.920635 0.063492 0.031746 0.000000 0.015873 0.952381 0.047619 0.015873 0.936508 0.000000 0.666667 0.206349 0.047619 0.079365 0.365079 0.634921 0.000000 0.000000 0.698413 0.253968 0.015873 0.031746 0.396825 0.412698 0.111111 0.079365 0.031746 0.857143 0.000000 0.111111 1.000000 0.000000 0.000000 0.000000 0.031746 0.904762 0.015873 0.047619 0.968254 0.000000 0.000000 0.031746 0.047619 0.079365 0.857143 0.015873 0.047619 0.047619 0.047619 0.857143 0.111111 0.063492 0.746032 0.079365 Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG Alignment: CACTGTGRTRTCACAGTGSWSCACT ----------DCCACGTGCV----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 20 CagTGCTCCACTGTGgT Reverse Complement Reverse Complement Backward 7 10 0.095523 Original motif 0.150000 0.700000 0.016667 0.133333 0.650000 0.150000 0.050000 0.150000 0.166667 0.116667 0.633333 0.083333 0.050000 0.033333 0.066667 0.850000 0.050000 0.000000 0.833333 0.116667 0.016667 0.966667 0.000000 0.016667 0.050000 0.016667 0.000000 0.933333 0.066667 0.833333 0.066667 0.033333 0.033333 0.966667 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.050000 0.916667 0.016667 0.016667 0.166667 0.000000 0.000000 0.833333 0.083333 0.016667 0.900000 0.000000 0.000000 0.016667 0.016667 0.966667 0.000000 0.016667 0.966667 0.016667 0.116667 0.166667 0.483333 0.233333 0.066667 0.083333 0.050000 0.800000 Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif 0.800000 0.083333 0.050000 0.066667 0.116667 0.483333 0.166667 0.233333 0.000000 0.966667 0.016667 0.016667 0.966667 0.016667 0.016667 0.000000 0.083333 0.900000 0.016667 0.000000 0.833333 0.000000 0.000000 0.166667 0.050000 0.016667 0.916667 0.016667 0.000000 0.000000 0.000000 1.000000 0.033333 0.000000 0.966667 0.000000 0.066667 0.066667 0.833333 0.033333 0.933333 0.016667 0.000000 0.050000 0.016667 0.000000 0.966667 0.016667 0.050000 0.833333 0.000000 0.116667 0.850000 0.033333 0.066667 0.050000 0.166667 0.633333 0.116667 0.083333 0.150000 0.150000 0.050000 0.650000 0.150000 0.016667 0.700000 0.133333 Consensus sequence: ABCACAGTGGAGCACTG Alignment: ABCACAGTGGAGCACTG -DCCACGTGCV------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 23 TGGAGCACTGTGACAcCACAGTGg Reverse Complement Original Motif Backward 11 10 0.097113 Original motif 0.054054 0.040541 0.054054 0.851351 0.040541 0.013514 0.824324 0.121622 0.094595 0.135135 0.756757 0.013514 0.891892 0.000000 0.000000 0.108108 0.040541 0.094595 0.810811 0.054054 0.081081 0.797297 0.054054 0.067568 0.932432 0.027027 0.000000 0.040541 0.054054 0.756757 0.135135 0.054054 0.108108 0.027027 0.013514 0.851351 0.108108 0.000000 0.851351 0.040541 0.013514 0.000000 0.027027 0.959459 0.000000 0.013514 0.945946 0.040541 0.905405 0.000000 0.067568 0.027027 0.054054 0.837838 0.000000 0.108108 0.945946 0.013514 0.040541 0.000000 0.162162 0.500000 0.189189 0.148649 0.108108 0.824324 0.000000 0.067568 0.945946 0.000000 0.040541 0.013514 0.081081 0.837838 0.027027 0.054054 0.945946 0.000000 0.013514 0.040541 0.054054 0.067568 0.783784 0.094595 0.054054 0.027027 0.000000 0.918919 0.040541 0.013514 0.864865 0.081081 0.148649 0.121622 0.675676 0.054054 Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif 0.148649 0.675676 0.121622 0.054054 0.040541 0.864865 0.013514 0.081081 0.918919 0.027027 0.000000 0.054054 0.054054 0.783784 0.067568 0.094595 0.040541 0.000000 0.013514 0.945946 0.081081 0.027027 0.837838 0.054054 0.013514 0.000000 0.040541 0.945946 0.108108 0.000000 0.824324 0.067568 0.162162 0.189189 0.500000 0.148649 0.000000 0.013514 0.040541 0.945946 0.054054 0.000000 0.837838 0.108108 0.027027 0.000000 0.067568 0.905405 0.000000 0.945946 0.013514 0.040541 0.959459 0.000000 0.027027 0.013514 0.108108 0.851351 0.000000 0.040541 0.851351 0.027027 0.013514 0.108108 0.054054 0.135135 0.756757 0.054054 0.040541 0.027027 0.000000 0.932432 0.081081 0.054054 0.797297 0.067568 0.040541 0.810811 0.094595 0.054054 0.108108 0.000000 0.000000 0.891892 0.094595 0.756757 0.135135 0.013514 0.040541 0.824324 0.013514 0.121622 0.851351 0.040541 0.054054 0.054054 Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA Alignment: TGGAGCACTGTGACAVCACAGTGG ----DCCACGTGCV---------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 25 wwCCAmAGTCmt Original Motif Reverse Complement Forward 2 10 0.097404 Original motif 0.454545 0.045455 0.227273 0.272727 0.363636 0.136364 0.136364 0.363636 0.000000 1.000000 0.000000 0.000000 0.000000 0.954545 0.045455 0.000000 1.000000 0.000000 0.000000 0.000000 0.409091 0.590909 0.000000 0.000000 0.909091 0.045455 0.045455 0.000000 0.000000 0.000000 1.000000 0.000000 0.045455 0.000000 0.000000 0.954545 0.045455 0.909091 0.000000 0.045455 0.272727 0.318182 0.181818 0.227273 0.181818 0.227273 0.227273 0.363636 Consensus sequence: DDCCAMAGTCHB Reverse complement motif 0.363636 0.227273 0.227273 0.181818 0.272727 0.181818 0.318182 0.227273 0.045455 0.000000 0.909091 0.045455 0.954545 0.000000 0.000000 0.045455 0.000000 1.000000 0.000000 0.000000 0.000000 0.045455 0.045455 0.909091 0.409091 0.000000 0.590909 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.045455 0.954545 0.000000 0.000000 0.000000 1.000000 0.000000 0.363636 0.136364 0.136364 0.363636 0.272727 0.045455 0.227273 0.454545 Consensus sequence: VDGACTRTGGDD Alignment: VDGACTRTGGDD -VGCACGTGGH- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 26 CAcCACAGTGGAGCAct Reverse Complement Original Motif Forward 3 10 0.097970 Original motif 0.078125 0.734375 0.046875 0.140625 0.828125 0.046875 0.078125 0.046875 0.203125 0.484375 0.156250 0.156250 0.015625 0.984375 0.000000 0.000000 0.968750 0.015625 0.015625 0.000000 0.000000 0.906250 0.015625 0.078125 0.859375 0.000000 0.000000 0.140625 0.031250 0.000000 0.906250 0.062500 0.000000 0.015625 0.000000 0.984375 0.000000 0.000000 0.968750 0.031250 0.046875 0.062500 0.812500 0.078125 0.937500 0.015625 0.015625 0.031250 0.015625 0.031250 0.921875 0.031250 0.125000 0.796875 0.000000 0.078125 0.875000 0.046875 0.046875 0.031250 0.093750 0.656250 0.093750 0.156250 0.156250 0.078125 0.109375 0.656250 Consensus sequence: CAHCACAGTGGAGCACT Reverse complement motif 0.656250 0.078125 0.109375 0.156250 0.093750 0.093750 0.656250 0.156250 0.031250 0.046875 0.046875 0.875000 0.125000 0.000000 0.796875 0.078125 0.015625 0.921875 0.031250 0.031250 0.031250 0.015625 0.015625 0.937500 0.046875 0.812500 0.062500 0.078125 0.000000 0.968750 0.000000 0.031250 0.984375 0.015625 0.000000 0.000000 0.031250 0.906250 0.000000 0.062500 0.140625 0.000000 0.000000 0.859375 0.000000 0.015625 0.906250 0.078125 0.000000 0.015625 0.015625 0.968750 0.015625 0.000000 0.984375 0.000000 0.203125 0.156250 0.484375 0.156250 0.046875 0.046875 0.078125 0.828125 0.078125 0.046875 0.734375 0.140625 Consensus sequence: AGTGCTCCACTGTGDTG Alignment: CAHCACAGTGGAGCACT --DCCACGTGCV----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 27 AgTGCTCCACTGTGgTGTCACAgT Reverse Complement Reverse Complement Backward 6 10 0.098002 Original motif 0.690141 0.126761 0.042254 0.140845 0.169014 0.098592 0.676056 0.056338 0.042254 0.028169 0.028169 0.901408 0.056338 0.000000 0.774648 0.169014 0.042254 0.887324 0.042254 0.028169 0.000000 0.014085 0.000000 0.985915 0.056338 0.830986 0.042254 0.070423 0.028169 0.957746 0.014085 0.000000 0.957746 0.000000 0.014085 0.028169 0.084507 0.845070 0.014085 0.056338 0.028169 0.014085 0.000000 0.957746 0.140845 0.028169 0.802817 0.028169 0.014085 0.014085 0.014085 0.957746 0.014085 0.000000 0.929577 0.056338 0.056338 0.154930 0.619718 0.169014 0.014085 0.028169 0.000000 0.957746 0.056338 0.014085 0.873239 0.056338 0.014085 0.000000 0.000000 0.985915 0.042254 0.929577 0.000000 0.028169 0.957746 0.028169 0.000000 0.014085 0.028169 0.845070 0.028169 0.098592 0.873239 0.014085 0.042254 0.070423 0.098592 0.154930 0.563380 0.183099 0.070423 0.014085 0.112676 0.802817 Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif 0.802817 0.014085 0.112676 0.070423 0.098592 0.563380 0.154930 0.183099 0.070423 0.014085 0.042254 0.873239 0.028169 0.028169 0.845070 0.098592 0.014085 0.028169 0.000000 0.957746 0.042254 0.000000 0.929577 0.028169 0.985915 0.000000 0.000000 0.014085 0.056338 0.873239 0.014085 0.056338 0.957746 0.028169 0.000000 0.014085 0.056338 0.619718 0.154930 0.169014 0.014085 0.929577 0.000000 0.056338 0.957746 0.014085 0.014085 0.014085 0.140845 0.802817 0.028169 0.028169 0.957746 0.014085 0.000000 0.028169 0.084507 0.014085 0.845070 0.056338 0.028169 0.000000 0.014085 0.957746 0.028169 0.014085 0.957746 0.000000 0.056338 0.042254 0.830986 0.070423 0.985915 0.014085 0.000000 0.000000 0.042254 0.042254 0.887324 0.028169 0.056338 0.774648 0.000000 0.169014 0.901408 0.028169 0.028169 0.042254 0.169014 0.676056 0.098592 0.056338 0.140845 0.126761 0.042254 0.690141 Consensus sequence: ACTGTGACACCACAGTGGAGCACT Alignment: ACTGTGACACCACAGTGGAGCACT ---------DCCACGTGCV----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 32 gCGCGCsCgsG Original Motif Reverse Complement Backward 2 10 0.098912 Original motif 0.105263 0.210526 0.526316 0.157895 0.000000 0.736842 0.105263 0.157895 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.368421 0.631579 0.000000 0.000000 0.894737 0.105263 0.000000 0.157895 0.157895 0.631579 0.052632 0.052632 0.631579 0.263158 0.052632 0.105263 0.052632 0.789474 0.052632 Consensus sequence: GCGCGCSCGCG Reverse complement motif 0.105263 0.789474 0.052632 0.052632 0.052632 0.263158 0.631579 0.052632 0.157895 0.631579 0.157895 0.052632 0.000000 0.105263 0.894737 0.000000 0.000000 0.631579 0.368421 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.105263 0.736842 0.157895 0.105263 0.526316 0.210526 0.157895 Consensus sequence: CGCGSGCGCGC Alignment: CGCGSGCGCGC VGCACGTGGH- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 17 TgTGgTGTCACAGTGCTCC Reverse Complement Reverse Complement Backward 7 10 0.099320 Original motif 0.111111 0.083333 0.055556 0.750000 0.125000 0.097222 0.652778 0.125000 0.041667 0.097222 0.027778 0.833333 0.027778 0.027778 0.791667 0.152778 0.055556 0.166667 0.652778 0.125000 0.000000 0.041667 0.013889 0.944444 0.041667 0.000000 0.888889 0.069444 0.027778 0.027778 0.000000 0.944444 0.041667 0.944444 0.013889 0.000000 0.916667 0.027778 0.000000 0.055556 0.069444 0.875000 0.000000 0.055556 0.833333 0.013889 0.013889 0.138889 0.041667 0.069444 0.819444 0.069444 0.027778 0.027778 0.027778 0.916667 0.069444 0.013889 0.847222 0.069444 0.069444 0.777778 0.027778 0.125000 0.055556 0.041667 0.027778 0.875000 0.041667 0.708333 0.125000 0.125000 0.111111 0.819444 0.055556 0.013889 Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif 0.111111 0.055556 0.819444 0.013889 0.041667 0.125000 0.708333 0.125000 0.875000 0.041667 0.027778 0.055556 0.069444 0.027778 0.777778 0.125000 0.069444 0.847222 0.013889 0.069444 0.916667 0.027778 0.027778 0.027778 0.041667 0.819444 0.069444 0.069444 0.138889 0.013889 0.013889 0.833333 0.069444 0.000000 0.875000 0.055556 0.055556 0.027778 0.000000 0.916667 0.041667 0.013889 0.944444 0.000000 0.944444 0.027778 0.000000 0.027778 0.041667 0.888889 0.000000 0.069444 0.944444 0.041667 0.013889 0.000000 0.055556 0.652778 0.166667 0.125000 0.027778 0.791667 0.027778 0.152778 0.833333 0.097222 0.027778 0.041667 0.125000 0.652778 0.097222 0.125000 0.750000 0.083333 0.055556 0.111111 Consensus sequence: GGAGCACTGTGACACCACA Alignment: GGAGCACTGTGACACCACA ---DCCACGTGCV------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 11 Motif name: NR4A2 Original motif 0.615385 0.076923 0.230769 0.076923 0.928571 0.000000 0.071429 0.000000 0.000000 0.000000 0.928571 0.071429 0.214286 0.000000 0.785714 0.000000 0.142857 0.142857 0.000000 0.714286 0.000000 0.928571 0.000000 0.071429 1.000000 0.000000 0.000000 0.000000 0.230769 0.615385 0.153846 0.000000 Consensus sequence: AAGGTCAC Reverse complement motif 0.230769 0.153846 0.615385 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.928571 0.071429 0.714286 0.142857 0.000000 0.142857 0.214286 0.785714 0.000000 0.000000 0.000000 0.928571 0.000000 0.071429 0.000000 0.000000 0.071429 0.928571 0.076923 0.076923 0.230769 0.615385 Consensus sequence: GTGACCTT *************************************************************** Best Matches for Top Significant Motif ID 11 (Highest to Lowest) *************************************************************** Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 22 CACTGTGrYrtCACAGTGswsCAcT Original Motif Original Motif Forward 7 8 0.055724 Original motif 0.111111 0.746032 0.063492 0.079365 0.857143 0.047619 0.047619 0.047619 0.047619 0.857143 0.079365 0.015873 0.031746 0.000000 0.000000 0.968254 0.031746 0.015873 0.904762 0.047619 0.000000 0.000000 0.000000 1.000000 0.031746 0.000000 0.857143 0.111111 0.396825 0.111111 0.412698 0.079365 0.031746 0.253968 0.015873 0.698413 0.365079 0.000000 0.634921 0.000000 0.079365 0.206349 0.047619 0.666667 0.047619 0.936508 0.015873 0.000000 0.952381 0.000000 0.015873 0.031746 0.015873 0.920635 0.000000 0.063492 0.920635 0.000000 0.000000 0.079365 0.063492 0.047619 0.841270 0.047619 0.000000 0.000000 0.015873 0.984127 0.047619 0.015873 0.904762 0.031746 0.015873 0.603175 0.317460 0.063492 0.396825 0.000000 0.015873 0.587302 0.015873 0.476190 0.428571 0.079365 0.063492 0.920635 0.000000 0.015873 0.920635 0.015873 0.047619 0.015873 0.095238 0.682540 0.095238 0.126984 0.047619 0.015873 0.095238 0.841270 Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif 0.841270 0.015873 0.095238 0.047619 0.095238 0.095238 0.682540 0.126984 0.015873 0.015873 0.047619 0.920635 0.063492 0.000000 0.920635 0.015873 0.015873 0.428571 0.476190 0.079365 0.587302 0.000000 0.015873 0.396825 0.015873 0.317460 0.603175 0.063492 0.047619 0.904762 0.015873 0.031746 0.984127 0.000000 0.015873 0.000000 0.063492 0.841270 0.047619 0.047619 0.079365 0.000000 0.000000 0.920635 0.015873 0.000000 0.920635 0.063492 0.031746 0.000000 0.015873 0.952381 0.047619 0.015873 0.936508 0.000000 0.666667 0.206349 0.047619 0.079365 0.365079 0.634921 0.000000 0.000000 0.698413 0.253968 0.015873 0.031746 0.396825 0.412698 0.111111 0.079365 0.031746 0.857143 0.000000 0.111111 1.000000 0.000000 0.000000 0.000000 0.031746 0.904762 0.015873 0.047619 0.968254 0.000000 0.000000 0.031746 0.047619 0.079365 0.857143 0.015873 0.047619 0.047619 0.047619 0.857143 0.111111 0.063492 0.746032 0.079365 Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG Alignment: CACTGTGRTRTCACAGTGSWSCACT ------AAGGTCAC----------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 23 TGGAGCACTGTGACAcCACAGTGg Original Motif Reverse Complement Forward 8 8 0.060729 Original motif 0.054054 0.040541 0.054054 0.851351 0.040541 0.013514 0.824324 0.121622 0.094595 0.135135 0.756757 0.013514 0.891892 0.000000 0.000000 0.108108 0.040541 0.094595 0.810811 0.054054 0.081081 0.797297 0.054054 0.067568 0.932432 0.027027 0.000000 0.040541 0.054054 0.756757 0.135135 0.054054 0.108108 0.027027 0.013514 0.851351 0.108108 0.000000 0.851351 0.040541 0.013514 0.000000 0.027027 0.959459 0.000000 0.013514 0.945946 0.040541 0.905405 0.000000 0.067568 0.027027 0.054054 0.837838 0.000000 0.108108 0.945946 0.013514 0.040541 0.000000 0.162162 0.500000 0.189189 0.148649 0.108108 0.824324 0.000000 0.067568 0.945946 0.000000 0.040541 0.013514 0.081081 0.837838 0.027027 0.054054 0.945946 0.000000 0.013514 0.040541 0.054054 0.067568 0.783784 0.094595 0.054054 0.027027 0.000000 0.918919 0.040541 0.013514 0.864865 0.081081 0.148649 0.121622 0.675676 0.054054 Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif 0.148649 0.675676 0.121622 0.054054 0.040541 0.864865 0.013514 0.081081 0.918919 0.027027 0.000000 0.054054 0.054054 0.783784 0.067568 0.094595 0.040541 0.000000 0.013514 0.945946 0.081081 0.027027 0.837838 0.054054 0.013514 0.000000 0.040541 0.945946 0.108108 0.000000 0.824324 0.067568 0.162162 0.189189 0.500000 0.148649 0.000000 0.013514 0.040541 0.945946 0.054054 0.000000 0.837838 0.108108 0.027027 0.000000 0.067568 0.905405 0.000000 0.945946 0.013514 0.040541 0.959459 0.000000 0.027027 0.013514 0.108108 0.851351 0.000000 0.040541 0.851351 0.027027 0.013514 0.108108 0.054054 0.135135 0.756757 0.054054 0.040541 0.027027 0.000000 0.932432 0.081081 0.054054 0.797297 0.067568 0.040541 0.810811 0.094595 0.054054 0.108108 0.000000 0.000000 0.891892 0.094595 0.756757 0.135135 0.013514 0.040541 0.824324 0.013514 0.121622 0.851351 0.040541 0.054054 0.054054 Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA Alignment: CCACTGTGVTGTCACAGTGCTCCA -------AAGGTCAC--------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 21 AmTGTGACACCACAGT Original Motif Reverse Complement Forward 6 8 0.064515 Original motif 0.703125 0.187500 0.015625 0.093750 0.265625 0.500000 0.125000 0.109375 0.015625 0.046875 0.031250 0.906250 0.078125 0.015625 0.890625 0.015625 0.000000 0.000000 0.000000 1.000000 0.000000 0.031250 0.906250 0.062500 0.953125 0.000000 0.015625 0.031250 0.046875 0.890625 0.000000 0.062500 0.968750 0.000000 0.015625 0.015625 0.109375 0.781250 0.062500 0.046875 0.062500 0.890625 0.000000 0.046875 0.953125 0.000000 0.031250 0.015625 0.031250 0.781250 0.046875 0.140625 0.937500 0.015625 0.031250 0.015625 0.093750 0.078125 0.734375 0.093750 0.031250 0.078125 0.000000 0.890625 Consensus sequence: AMTGTGACACCACAGT Reverse complement motif 0.890625 0.078125 0.000000 0.031250 0.093750 0.734375 0.078125 0.093750 0.015625 0.015625 0.031250 0.937500 0.031250 0.046875 0.781250 0.140625 0.015625 0.000000 0.031250 0.953125 0.062500 0.000000 0.890625 0.046875 0.109375 0.062500 0.781250 0.046875 0.015625 0.000000 0.015625 0.968750 0.046875 0.000000 0.890625 0.062500 0.031250 0.000000 0.015625 0.953125 0.000000 0.906250 0.031250 0.062500 1.000000 0.000000 0.000000 0.000000 0.078125 0.890625 0.015625 0.015625 0.906250 0.046875 0.031250 0.015625 0.265625 0.125000 0.500000 0.109375 0.093750 0.187500 0.015625 0.703125 Consensus sequence: ACTGTGGTGTCACART Alignment: ACTGTGGTGTCACART -----AAGGTCAC--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 17 TgTGgTGTCACAGTGCTCC Original Motif Original Motif Backward 9 8 0.069551 Original motif 0.111111 0.083333 0.055556 0.750000 0.125000 0.097222 0.652778 0.125000 0.041667 0.097222 0.027778 0.833333 0.027778 0.027778 0.791667 0.152778 0.055556 0.166667 0.652778 0.125000 0.000000 0.041667 0.013889 0.944444 0.041667 0.000000 0.888889 0.069444 0.027778 0.027778 0.000000 0.944444 0.041667 0.944444 0.013889 0.000000 0.916667 0.027778 0.000000 0.055556 0.069444 0.875000 0.000000 0.055556 0.833333 0.013889 0.013889 0.138889 0.041667 0.069444 0.819444 0.069444 0.027778 0.027778 0.027778 0.916667 0.069444 0.013889 0.847222 0.069444 0.069444 0.777778 0.027778 0.125000 0.055556 0.041667 0.027778 0.875000 0.041667 0.708333 0.125000 0.125000 0.111111 0.819444 0.055556 0.013889 Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif 0.111111 0.055556 0.819444 0.013889 0.041667 0.125000 0.708333 0.125000 0.875000 0.041667 0.027778 0.055556 0.069444 0.027778 0.777778 0.125000 0.069444 0.847222 0.013889 0.069444 0.916667 0.027778 0.027778 0.027778 0.041667 0.819444 0.069444 0.069444 0.138889 0.013889 0.013889 0.833333 0.069444 0.000000 0.875000 0.055556 0.055556 0.027778 0.000000 0.916667 0.041667 0.013889 0.944444 0.000000 0.944444 0.027778 0.000000 0.027778 0.041667 0.888889 0.000000 0.069444 0.944444 0.041667 0.013889 0.000000 0.055556 0.652778 0.166667 0.125000 0.027778 0.791667 0.027778 0.152778 0.833333 0.097222 0.027778 0.041667 0.125000 0.652778 0.097222 0.125000 0.750000 0.083333 0.055556 0.111111 Consensus sequence: GGAGCACTGTGACACCACA Alignment: TGTGGTGTCACAGTGCTCC ---AAGGTCAC-------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 27 AgTGCTCCACTGTGgTGTCACAgT Original Motif Original Motif Backward 4 8 0.070983 Original motif 0.690141 0.126761 0.042254 0.140845 0.169014 0.098592 0.676056 0.056338 0.042254 0.028169 0.028169 0.901408 0.056338 0.000000 0.774648 0.169014 0.042254 0.887324 0.042254 0.028169 0.000000 0.014085 0.000000 0.985915 0.056338 0.830986 0.042254 0.070423 0.028169 0.957746 0.014085 0.000000 0.957746 0.000000 0.014085 0.028169 0.084507 0.845070 0.014085 0.056338 0.028169 0.014085 0.000000 0.957746 0.140845 0.028169 0.802817 0.028169 0.014085 0.014085 0.014085 0.957746 0.014085 0.000000 0.929577 0.056338 0.056338 0.154930 0.619718 0.169014 0.014085 0.028169 0.000000 0.957746 0.056338 0.014085 0.873239 0.056338 0.014085 0.000000 0.000000 0.985915 0.042254 0.929577 0.000000 0.028169 0.957746 0.028169 0.000000 0.014085 0.028169 0.845070 0.028169 0.098592 0.873239 0.014085 0.042254 0.070423 0.098592 0.154930 0.563380 0.183099 0.070423 0.014085 0.112676 0.802817 Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif 0.802817 0.014085 0.112676 0.070423 0.098592 0.563380 0.154930 0.183099 0.070423 0.014085 0.042254 0.873239 0.028169 0.028169 0.845070 0.098592 0.014085 0.028169 0.000000 0.957746 0.042254 0.000000 0.929577 0.028169 0.985915 0.000000 0.000000 0.014085 0.056338 0.873239 0.014085 0.056338 0.957746 0.028169 0.000000 0.014085 0.056338 0.619718 0.154930 0.169014 0.014085 0.929577 0.000000 0.056338 0.957746 0.014085 0.014085 0.014085 0.140845 0.802817 0.028169 0.028169 0.957746 0.014085 0.000000 0.028169 0.084507 0.014085 0.845070 0.056338 0.028169 0.000000 0.014085 0.957746 0.028169 0.014085 0.957746 0.000000 0.056338 0.042254 0.830986 0.070423 0.985915 0.014085 0.000000 0.000000 0.042254 0.042254 0.887324 0.028169 0.056338 0.774648 0.000000 0.169014 0.901408 0.028169 0.028169 0.042254 0.169014 0.676056 0.098592 0.056338 0.140845 0.126761 0.042254 0.690141 Consensus sequence: ACTGTGACACCACAGTGGAGCACT Alignment: AGTGCTCCACTGTGGTGTCACAGT -------------AAGGTCAC--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 29 cCGCGGrCACG Original Motif Original Motif Forward 3 8 0.077229 Original motif 0.000000 0.600000 0.200000 0.200000 0.000000 0.800000 0.000000 0.200000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.600000 0.000000 0.400000 0.000000 0.000000 0.800000 0.200000 0.000000 0.800000 0.000000 0.200000 0.000000 0.000000 0.800000 0.200000 0.000000 0.200000 0.000000 0.800000 0.000000 Consensus sequence: CCGCGGRCACG Reverse complement motif 0.200000 0.800000 0.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.200000 0.800000 0.000000 0.000000 0.000000 0.400000 0.600000 0.000000 0.800000 0.200000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.800000 0.200000 0.000000 0.200000 0.600000 0.200000 Consensus sequence: CGTGKCCGCGG Alignment: CCGCGGRCACG --AAGGTCAC- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 25 wwCCAmAGTCmt Original Motif Original Motif Forward 5 8 0.078840 Original motif 0.454545 0.045455 0.227273 0.272727 0.363636 0.136364 0.136364 0.363636 0.000000 1.000000 0.000000 0.000000 0.000000 0.954545 0.045455 0.000000 1.000000 0.000000 0.000000 0.000000 0.409091 0.590909 0.000000 0.000000 0.909091 0.045455 0.045455 0.000000 0.000000 0.000000 1.000000 0.000000 0.045455 0.000000 0.000000 0.954545 0.045455 0.909091 0.000000 0.045455 0.272727 0.318182 0.181818 0.227273 0.181818 0.227273 0.227273 0.363636 Consensus sequence: DDCCAMAGTCHB Reverse complement motif 0.363636 0.227273 0.227273 0.181818 0.272727 0.181818 0.318182 0.227273 0.045455 0.000000 0.909091 0.045455 0.954545 0.000000 0.000000 0.045455 0.000000 1.000000 0.000000 0.000000 0.000000 0.045455 0.045455 0.909091 0.409091 0.000000 0.590909 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.045455 0.954545 0.000000 0.000000 0.000000 1.000000 0.000000 0.363636 0.136364 0.136364 0.363636 0.272727 0.045455 0.227273 0.454545 Consensus sequence: VDGACTRTGGDD Alignment: DDCCAMAGTCHB ----AAGGTCAC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 20 CagTGCTCCACTGTGgT Reverse Complement Reverse Complement Forward 10 8 0.086404 Original motif 0.150000 0.700000 0.016667 0.133333 0.650000 0.150000 0.050000 0.150000 0.166667 0.116667 0.633333 0.083333 0.050000 0.033333 0.066667 0.850000 0.050000 0.000000 0.833333 0.116667 0.016667 0.966667 0.000000 0.016667 0.050000 0.016667 0.000000 0.933333 0.066667 0.833333 0.066667 0.033333 0.033333 0.966667 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.050000 0.916667 0.016667 0.016667 0.166667 0.000000 0.000000 0.833333 0.083333 0.016667 0.900000 0.000000 0.000000 0.016667 0.016667 0.966667 0.000000 0.016667 0.966667 0.016667 0.116667 0.166667 0.483333 0.233333 0.066667 0.083333 0.050000 0.800000 Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif 0.800000 0.083333 0.050000 0.066667 0.116667 0.483333 0.166667 0.233333 0.000000 0.966667 0.016667 0.016667 0.966667 0.016667 0.016667 0.000000 0.083333 0.900000 0.016667 0.000000 0.833333 0.000000 0.000000 0.166667 0.050000 0.016667 0.916667 0.016667 0.000000 0.000000 0.000000 1.000000 0.033333 0.000000 0.966667 0.000000 0.066667 0.066667 0.833333 0.033333 0.933333 0.016667 0.000000 0.050000 0.016667 0.000000 0.966667 0.016667 0.050000 0.833333 0.000000 0.116667 0.850000 0.033333 0.066667 0.050000 0.166667 0.633333 0.116667 0.083333 0.150000 0.150000 0.050000 0.650000 0.150000 0.016667 0.700000 0.133333 Consensus sequence: ABCACAGTGGAGCACTG Alignment: ABCACAGTGGAGCACTG ---------GTGACCTT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 28 ssGCkTGCssk Reverse Complement Original Motif Forward 5 7 0.568556 Original motif 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 0.500000 0.500000 Consensus sequence: SSGCKTGCSSK Reverse complement motif 0.000000 0.500000 0.000000 0.500000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.000000 0.500000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 Consensus sequence: YSSGCAYGCSS Alignment: SSGCKTGCSSK- ----GTGACCTT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 26 CAcCACAGTGGAGCAct Reverse Complement Original Motif Forward 11 7 0.581814 Original motif 0.078125 0.734375 0.046875 0.140625 0.828125 0.046875 0.078125 0.046875 0.203125 0.484375 0.156250 0.156250 0.015625 0.984375 0.000000 0.000000 0.968750 0.015625 0.015625 0.000000 0.000000 0.906250 0.015625 0.078125 0.859375 0.000000 0.000000 0.140625 0.031250 0.000000 0.906250 0.062500 0.000000 0.015625 0.000000 0.984375 0.000000 0.000000 0.968750 0.031250 0.046875 0.062500 0.812500 0.078125 0.937500 0.015625 0.015625 0.031250 0.015625 0.031250 0.921875 0.031250 0.125000 0.796875 0.000000 0.078125 0.875000 0.046875 0.046875 0.031250 0.093750 0.656250 0.093750 0.156250 0.156250 0.078125 0.109375 0.656250 Consensus sequence: CAHCACAGTGGAGCACT Reverse complement motif 0.656250 0.078125 0.109375 0.156250 0.093750 0.093750 0.656250 0.156250 0.031250 0.046875 0.046875 0.875000 0.125000 0.000000 0.796875 0.078125 0.015625 0.921875 0.031250 0.031250 0.031250 0.015625 0.015625 0.937500 0.046875 0.812500 0.062500 0.078125 0.000000 0.968750 0.000000 0.031250 0.984375 0.015625 0.000000 0.000000 0.031250 0.906250 0.000000 0.062500 0.140625 0.000000 0.000000 0.859375 0.000000 0.015625 0.906250 0.078125 0.000000 0.015625 0.015625 0.968750 0.015625 0.000000 0.984375 0.000000 0.203125 0.156250 0.484375 0.156250 0.046875 0.046875 0.078125 0.828125 0.078125 0.046875 0.734375 0.140625 Consensus sequence: AGTGCTCCACTGTGDTG Alignment: CAHCACAGTGGAGCACT- ----------GTGACCTT ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 2 Motif ID: 25 Motif name: wwCCAmAGTCmt Original motif 0.454545 0.045455 0.227273 0.272727 0.363636 0.136364 0.136364 0.363636 0.000000 1.000000 0.000000 0.000000 0.000000 0.954545 0.045455 0.000000 1.000000 0.000000 0.000000 0.000000 0.409091 0.590909 0.000000 0.000000 0.909091 0.045455 0.045455 0.000000 0.000000 0.000000 1.000000 0.000000 0.045455 0.000000 0.000000 0.954545 0.045455 0.909091 0.000000 0.045455 0.272727 0.318182 0.181818 0.227273 0.181818 0.227273 0.227273 0.363636 Consensus sequence: DDCCAMAGTCHB Reverse complement motif 0.363636 0.227273 0.227273 0.181818 0.272727 0.181818 0.318182 0.227273 0.045455 0.000000 0.909091 0.045455 0.954545 0.000000 0.000000 0.045455 0.000000 1.000000 0.000000 0.000000 0.000000 0.045455 0.045455 0.909091 0.409091 0.000000 0.590909 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.045455 0.954545 0.000000 0.000000 0.000000 1.000000 0.000000 0.363636 0.136364 0.136364 0.363636 0.272727 0.045455 0.227273 0.454545 Consensus sequence: VDGACTRTGGDD *************************************************************** Best Matches for Top Significant Motif ID 25 (Highest to Lowest) *************************************************************** Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 1 HNF4A Original Motif Original Motif Forward 2 12 0.032442 Original motif 0.417910 0.104478 0.402985 0.074627 0.029851 0.029851 0.835821 0.104478 0.179104 0.059701 0.522388 0.238806 0.074627 0.343284 0.298507 0.283582 0.044776 0.761194 0.059701 0.134328 0.880597 0.014925 0.044776 0.059701 0.791045 0.029851 0.149254 0.029851 0.835821 0.014925 0.119403 0.029851 0.059701 0.059701 0.865672 0.014925 0.089552 0.029851 0.492537 0.388060 0.044776 0.328358 0.164179 0.462687 0.059701 0.731343 0.074627 0.134328 0.626866 0.104478 0.149254 0.119403 Consensus sequence: RGGBCAAAGKYCA Reverse complement motif 0.119403 0.104478 0.149254 0.626866 0.059701 0.074627 0.731343 0.134328 0.462687 0.328358 0.164179 0.044776 0.089552 0.492537 0.029851 0.388060 0.059701 0.865672 0.059701 0.014925 0.029851 0.014925 0.119403 0.835821 0.029851 0.029851 0.149254 0.791045 0.059701 0.014925 0.044776 0.880597 0.044776 0.059701 0.761194 0.134328 0.074627 0.298507 0.343284 0.283582 0.179104 0.522388 0.059701 0.238806 0.029851 0.835821 0.029851 0.104478 0.074627 0.104478 0.402985 0.417910 Consensus sequence: TGMYCTTTGBCCK Alignment: RGGBCAAAGKYCA -DDCCAMAGTCHB ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 7 REST Original Motif Reverse Complement Forward 4 12 0.039123 Original motif 0.132621 0.109365 0.230044 0.527970 0.036318 0.168441 0.091421 0.703820 0.047589 0.855354 0.031309 0.065748 0.906367 0.018727 0.058677 0.016230 0.021197 0.027431 0.945137 0.006234 0.076012 0.609346 0.201246 0.113396 0.980697 0.004359 0.007472 0.007472 0.001868 0.987547 0.007472 0.003113 0.021793 0.922167 0.012453 0.043587 0.568847 0.125234 0.100935 0.204984 0.136534 0.233791 0.077307 0.552369 0.024314 0.004364 0.966958 0.004364 0.012469 0.003117 0.983167 0.001247 0.877105 0.069869 0.021210 0.031815 0.008125 0.800000 0.145625 0.046250 0.983750 0.005625 0.004375 0.006250 0.026349 0.008156 0.959849 0.005646 0.128688 0.632141 0.114878 0.124294 0.229899 0.019472 0.432161 0.318467 0.133962 0.586792 0.200629 0.078616 0.112579 0.700629 0.023270 0.163522 Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif 0.112579 0.023270 0.700629 0.163522 0.133962 0.200629 0.586792 0.078616 0.229899 0.432161 0.019472 0.318467 0.128688 0.114878 0.632141 0.124294 0.026349 0.959849 0.008156 0.005646 0.006250 0.005625 0.004375 0.983750 0.008125 0.145625 0.800000 0.046250 0.031815 0.069869 0.021210 0.877105 0.012469 0.983167 0.003117 0.001247 0.024314 0.966958 0.004364 0.004364 0.552369 0.233791 0.077307 0.136534 0.204984 0.125234 0.100935 0.568847 0.021793 0.012453 0.922167 0.043587 0.001868 0.007472 0.987547 0.003113 0.007472 0.004359 0.007472 0.980697 0.076012 0.201246 0.609346 0.113396 0.021197 0.945137 0.027431 0.006234 0.016230 0.018727 0.058677 0.906367 0.047589 0.031309 0.855354 0.065748 0.703820 0.168441 0.091421 0.036318 0.527970 0.109365 0.230044 0.132621 Consensus sequence: GGYGCTGTCCATGGTGCTGAA Alignment: GGYGCTGTCCATGGTGCTGAA ---DDCCAMAGTCHB------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 3 ESR1 Original Motif Original Motif Backward 9 12 0.040730 Original motif 0.261242 0.256959 0.329764 0.152034 0.228632 0.170940 0.350427 0.250000 0.136752 0.369658 0.318376 0.175214 0.176596 0.487234 0.138298 0.197872 0.285106 0.493617 0.100000 0.121277 0.651163 0.059197 0.188161 0.101480 0.075949 0.016878 0.816456 0.090717 0.040000 0.037895 0.884211 0.037895 0.069474 0.086316 0.191579 0.652632 0.008421 0.829474 0.111579 0.050526 0.837895 0.027368 0.056842 0.077895 0.122105 0.526316 0.225263 0.126316 0.132632 0.581053 0.111579 0.174737 0.134737 0.543158 0.204211 0.117895 0.067368 0.040000 0.016842 0.875789 0.044211 0.046316 0.896842 0.012632 0.642105 0.223158 0.065263 0.069474 0.021053 0.917895 0.025263 0.035789 0.124211 0.743158 0.004211 0.128421 0.054737 0.347368 0.046316 0.551579 Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif 0.551579 0.347368 0.046316 0.054737 0.124211 0.004211 0.743158 0.128421 0.021053 0.025263 0.917895 0.035789 0.069474 0.223158 0.065263 0.642105 0.044211 0.896842 0.046316 0.012632 0.875789 0.040000 0.016842 0.067368 0.134737 0.204211 0.543158 0.117895 0.132632 0.111579 0.581053 0.174737 0.122105 0.225263 0.526316 0.126316 0.077895 0.027368 0.056842 0.837895 0.008421 0.111579 0.829474 0.050526 0.652632 0.086316 0.191579 0.069474 0.040000 0.884211 0.037895 0.037895 0.075949 0.816456 0.016878 0.090717 0.101480 0.059197 0.188161 0.651163 0.285106 0.100000 0.493617 0.121277 0.176596 0.138298 0.487234 0.197872 0.136752 0.318376 0.369658 0.175214 0.228632 0.350427 0.170940 0.250000 0.261242 0.329764 0.256959 0.152034 Consensus sequence: MGGTCAGGGTGACCTRDBHV Alignment: VDBHMAGGTCACCCTGACCY DDCCAMAGTCHB-------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 10 NR1H2RXRA Original Motif Original Motif Backward 2 12 0.046338 Original motif 0.680000 0.200000 0.000000 0.120000 0.680000 0.040000 0.200000 0.080000 0.800000 0.000000 0.200000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.040000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.000000 0.040000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.800000 0.040000 0.080000 0.080000 0.000000 0.600000 0.240000 0.160000 Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif 0.000000 0.240000 0.600000 0.160000 0.080000 0.040000 0.080000 0.800000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.040000 0.000000 0.000000 0.960000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.040000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.200000 0.800000 0.080000 0.040000 0.200000 0.680000 0.120000 0.200000 0.000000 0.680000 Consensus sequence: GTTGACCTTTGACCTTT Alignment: AAAGGTCAAAGGTCAAC ----DDCCAMAGTCHB- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 14 PPARGRXRA Original Motif Reverse Complement Forward 3 12 0.048041 Original motif 0.109685 0.369895 0.373396 0.147025 0.117716 0.193473 0.148019 0.540793 0.453488 0.026744 0.427907 0.091860 0.116144 0.003484 0.779326 0.101045 0.161253 0.017401 0.781903 0.039443 0.168213 0.149652 0.458237 0.223898 0.082271 0.633835 0.207416 0.076477 0.949015 0.024334 0.017381 0.009270 0.604867 0.055620 0.312862 0.026651 0.825231 0.005787 0.158565 0.010417 0.095017 0.002317 0.888760 0.013905 0.047509 0.010429 0.803013 0.139050 0.025492 0.114716 0.304751 0.555041 0.062645 0.643852 0.167053 0.126450 0.784223 0.067285 0.054524 0.093968 Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif 0.093968 0.067285 0.054524 0.784223 0.062645 0.167053 0.643852 0.126450 0.555041 0.114716 0.304751 0.025492 0.047509 0.803013 0.010429 0.139050 0.095017 0.888760 0.002317 0.013905 0.010417 0.005787 0.158565 0.825231 0.026651 0.055620 0.312862 0.604867 0.009270 0.024334 0.017381 0.949015 0.082271 0.207416 0.633835 0.076477 0.168213 0.458237 0.149652 0.223898 0.161253 0.781903 0.017401 0.039443 0.116144 0.779326 0.003484 0.101045 0.091860 0.026744 0.427907 0.453488 0.540793 0.193473 0.148019 0.117716 0.109685 0.373396 0.369895 0.147025 Consensus sequence: TGRCCTKTGHCCKAB Alignment: TGRCCTKTGHCCKAB --DDCCAMAGTCHB- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 2 NR2F1 Reverse Complement Original Motif Backward 1 12 0.050651 Original motif 0.000000 0.000000 0.153846 0.846154 0.076923 0.000000 0.923077 0.000000 0.923077 0.000000 0.076923 0.000000 0.461538 0.538462 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.230769 0.000000 0.769231 0.000000 0.153846 0.000000 0.846154 0.076923 0.000000 0.000000 0.923077 0.153846 0.000000 0.846154 0.000000 0.461538 0.307692 0.230769 0.000000 0.461538 0.384615 0.076923 0.076923 0.076923 0.769231 0.076923 0.076923 0.230769 0.461538 0.000000 0.307692 0.000000 0.230769 0.230769 0.538462 Consensus sequence: TGAMCTTTGMMCYT Reverse complement motif 0.538462 0.230769 0.230769 0.000000 0.230769 0.000000 0.461538 0.307692 0.076923 0.076923 0.769231 0.076923 0.076923 0.384615 0.076923 0.461538 0.000000 0.307692 0.230769 0.461538 0.153846 0.846154 0.000000 0.000000 0.923077 0.000000 0.000000 0.076923 0.846154 0.153846 0.000000 0.000000 0.769231 0.230769 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.461538 0.000000 0.538462 0.000000 0.000000 0.000000 0.076923 0.923077 0.076923 0.923077 0.000000 0.000000 0.846154 0.000000 0.153846 0.000000 Consensus sequence: AKGYYCAAAGRTCA Alignment: TGAMCTTTGMMCYT --VDGACTRTGGDD ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 16 CTCF Original Motif Reverse Complement Backward 8 12 0.052358 Original motif 0.095290 0.318729 0.083242 0.502738 0.182913 0.158817 0.453450 0.204819 0.307777 0.053669 0.491785 0.146769 0.061336 0.876232 0.023001 0.039430 0.008762 0.989047 0.000000 0.002191 0.814896 0.014239 0.071194 0.099671 0.043812 0.578313 0.365827 0.012048 0.117325 0.474781 0.052632 0.355263 0.933114 0.012061 0.035088 0.019737 0.005488 0.000000 0.991218 0.003293 0.365532 0.003293 0.621295 0.009879 0.059276 0.013172 0.553238 0.374314 0.013187 0.000000 0.978022 0.008791 0.061538 0.008791 0.851648 0.078022 0.114411 0.806381 0.005501 0.073707 0.409241 0.014301 0.557756 0.018702 0.090308 0.530837 0.338106 0.040749 0.128855 0.354626 0.080396 0.436123 0.442731 0.199339 0.292952 0.064978 Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif 0.064978 0.199339 0.292952 0.442731 0.436123 0.354626 0.080396 0.128855 0.090308 0.338106 0.530837 0.040749 0.409241 0.557756 0.014301 0.018702 0.114411 0.005501 0.806381 0.073707 0.061538 0.851648 0.008791 0.078022 0.013187 0.978022 0.000000 0.008791 0.059276 0.553238 0.013172 0.374314 0.365532 0.621295 0.003293 0.009879 0.005488 0.991218 0.000000 0.003293 0.019737 0.012061 0.035088 0.933114 0.117325 0.052632 0.474781 0.355263 0.043812 0.365827 0.578313 0.012048 0.099671 0.014239 0.071194 0.814896 0.008762 0.000000 0.989047 0.002191 0.061336 0.023001 0.876232 0.039430 0.307777 0.491785 0.053669 0.146769 0.182913 0.453450 0.158817 0.204819 0.502738 0.318729 0.083242 0.095290 Consensus sequence: BMSMGCCYMCTKSTGGMHM Alignment: BMSMGCCYMCTKSTGGMHM DDCCAMAGTCHB------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 9 ESR2 Original Motif Original Motif Backward 4 12 0.057672 Original motif 0.218487 0.450980 0.176471 0.154062 0.442577 0.142857 0.114846 0.299720 0.521008 0.042017 0.431373 0.005602 0.075630 0.000000 0.770308 0.154062 0.050420 0.056022 0.893557 0.000000 0.036415 0.053221 0.092437 0.817927 0.000000 1.000000 0.000000 0.000000 0.943978 0.002801 0.000000 0.053221 0.137255 0.344538 0.316527 0.201681 0.179272 0.176471 0.417367 0.226891 0.145658 0.170868 0.411765 0.271709 0.058824 0.092437 0.067227 0.781513 0.176471 0.070028 0.742297 0.011204 0.498599 0.277311 0.053221 0.170868 0.095238 0.750700 0.005602 0.148459 0.128852 0.809524 0.000000 0.061625 0.075630 0.252101 0.000000 0.672269 0.168067 0.263305 0.380952 0.187675 Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif 0.168067 0.380952 0.263305 0.187675 0.672269 0.252101 0.000000 0.075630 0.128852 0.000000 0.809524 0.061625 0.095238 0.005602 0.750700 0.148459 0.170868 0.277311 0.053221 0.498599 0.176471 0.742297 0.070028 0.011204 0.781513 0.092437 0.067227 0.058824 0.145658 0.411765 0.170868 0.271709 0.179272 0.417367 0.176471 0.226891 0.137255 0.316527 0.344538 0.201681 0.053221 0.002801 0.000000 0.943978 0.000000 0.000000 1.000000 0.000000 0.817927 0.053221 0.092437 0.036415 0.050420 0.893557 0.056022 0.000000 0.075630 0.770308 0.000000 0.154062 0.005602 0.042017 0.431373 0.521008 0.299720 0.142857 0.114846 0.442577 0.218487 0.176471 0.450980 0.154062 Consensus sequence: BAGGYCABHBTGACCKHV Alignment: VHRGGTCABDBTGMCCTB ---DDCCAMAGTCHB--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 4 Esrrb Original Motif Original Motif Forward 2 11 0.525631 Original motif 0.290198 0.220264 0.271200 0.218337 0.184941 0.227810 0.376477 0.210772 0.115226 0.332236 0.331687 0.220850 0.070959 0.342466 0.122740 0.463836 0.084862 0.729264 0.171640 0.014235 0.909737 0.008753 0.067834 0.013676 0.975656 0.000547 0.016411 0.007385 0.008758 0.001368 0.981390 0.008484 0.005750 0.003286 0.986309 0.004655 0.049904 0.012613 0.066904 0.870579 0.002473 0.927473 0.046703 0.023352 0.951569 0.005504 0.035498 0.007430 Consensus sequence: VBBYCAAGGTCA Reverse complement motif 0.007430 0.005504 0.035498 0.951569 0.002473 0.046703 0.927473 0.023352 0.870579 0.012613 0.066904 0.049904 0.005750 0.986309 0.003286 0.004655 0.008758 0.981390 0.001368 0.008484 0.007385 0.000547 0.016411 0.975656 0.013676 0.008753 0.067834 0.909737 0.084862 0.171640 0.729264 0.014235 0.463836 0.342466 0.122740 0.070959 0.115226 0.331687 0.332236 0.220850 0.184941 0.376477 0.227810 0.210772 0.218337 0.220264 0.271200 0.290198 Consensus sequence: TGACCTTGMBBB Alignment: VBBYCAAGGTCA- -DDCCAMAGTCHB ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 8 Myc Reverse Complement Original Motif Backward 1 10 1.057800 Original motif 0.295154 0.422907 0.158590 0.123348 0.149780 0.233480 0.572687 0.044053 0.035242 0.964758 0.000000 0.000000 0.955947 0.017621 0.022026 0.004405 0.000000 0.933921 0.013216 0.052863 0.083700 0.008811 0.898678 0.008811 0.039648 0.193833 0.000000 0.766520 0.000000 0.008811 0.951542 0.039648 0.000000 0.074890 0.806167 0.118943 0.198238 0.471366 0.105727 0.224670 Consensus sequence: VGCACGTGGH Reverse complement motif 0.198238 0.105727 0.471366 0.224670 0.000000 0.806167 0.074890 0.118943 0.000000 0.951542 0.008811 0.039648 0.766520 0.193833 0.000000 0.039648 0.083700 0.898678 0.008811 0.008811 0.000000 0.013216 0.933921 0.052863 0.004405 0.017621 0.022026 0.955947 0.035242 0.000000 0.964758 0.000000 0.149780 0.572687 0.233480 0.044053 0.295154 0.158590 0.422907 0.123348 Consensus sequence: DCCACGTGCV Alignment: --VGCACGTGGH VDGACTRTGGDD ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 2 Motif ID: 28 Motif name: ssGCkTGCssk Original motif 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 0.500000 0.500000 Consensus sequence: SSGCKTGCSSK Reverse complement motif 0.000000 0.500000 0.000000 0.500000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.000000 0.500000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 Consensus sequence: YSSGCAYGCSS *************************************************************** Best Matches for Top Significant Motif ID 28 (Highest to Lowest) *************************************************************** Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 16 CTCF Original Motif Original Motif Forward 8 11 0.034944 Original motif 0.095290 0.318729 0.083242 0.502738 0.182913 0.158817 0.453450 0.204819 0.307777 0.053669 0.491785 0.146769 0.061336 0.876232 0.023001 0.039430 0.008762 0.989047 0.000000 0.002191 0.814896 0.014239 0.071194 0.099671 0.043812 0.578313 0.365827 0.012048 0.117325 0.474781 0.052632 0.355263 0.933114 0.012061 0.035088 0.019737 0.005488 0.000000 0.991218 0.003293 0.365532 0.003293 0.621295 0.009879 0.059276 0.013172 0.553238 0.374314 0.013187 0.000000 0.978022 0.008791 0.061538 0.008791 0.851648 0.078022 0.114411 0.806381 0.005501 0.073707 0.409241 0.014301 0.557756 0.018702 0.090308 0.530837 0.338106 0.040749 0.128855 0.354626 0.080396 0.436123 0.442731 0.199339 0.292952 0.064978 Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif 0.064978 0.199339 0.292952 0.442731 0.436123 0.354626 0.080396 0.128855 0.090308 0.338106 0.530837 0.040749 0.409241 0.557756 0.014301 0.018702 0.114411 0.005501 0.806381 0.073707 0.061538 0.851648 0.008791 0.078022 0.013187 0.978022 0.000000 0.008791 0.059276 0.553238 0.013172 0.374314 0.365532 0.621295 0.003293 0.009879 0.005488 0.991218 0.000000 0.003293 0.019737 0.012061 0.035088 0.933114 0.117325 0.052632 0.474781 0.355263 0.043812 0.365827 0.578313 0.012048 0.099671 0.014239 0.071194 0.814896 0.008762 0.000000 0.989047 0.002191 0.061336 0.023001 0.876232 0.039430 0.307777 0.491785 0.053669 0.146769 0.182913 0.453450 0.158817 0.204819 0.502738 0.318729 0.083242 0.095290 Consensus sequence: BMSMGCCYMCTKSTGGMHM Alignment: YDRCCASYAGRKGGCRSYV -------SSGCKTGCSSK- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 4 Esrrb Reverse Complement Original Motif Backward 1 11 0.035870 Original motif 0.290198 0.220264 0.271200 0.218337 0.184941 0.227810 0.376477 0.210772 0.115226 0.332236 0.331687 0.220850 0.070959 0.342466 0.122740 0.463836 0.084862 0.729264 0.171640 0.014235 0.909737 0.008753 0.067834 0.013676 0.975656 0.000547 0.016411 0.007385 0.008758 0.001368 0.981390 0.008484 0.005750 0.003286 0.986309 0.004655 0.049904 0.012613 0.066904 0.870579 0.002473 0.927473 0.046703 0.023352 0.951569 0.005504 0.035498 0.007430 Consensus sequence: VBBYCAAGGTCA Reverse complement motif 0.007430 0.005504 0.035498 0.951569 0.002473 0.046703 0.927473 0.023352 0.870579 0.012613 0.066904 0.049904 0.005750 0.986309 0.003286 0.004655 0.008758 0.981390 0.001368 0.008484 0.007385 0.000547 0.016411 0.975656 0.013676 0.008753 0.067834 0.909737 0.084862 0.171640 0.729264 0.014235 0.463836 0.342466 0.122740 0.070959 0.115226 0.331687 0.332236 0.220850 0.184941 0.376477 0.227810 0.210772 0.218337 0.220264 0.271200 0.290198 Consensus sequence: TGACCTTGMBBB Alignment: VBBYCAAGGTCA -YSSGCAYGCSS ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 9 ESR2 Reverse Complement Original Motif Backward 3 11 0.037907 Original motif 0.218487 0.450980 0.176471 0.154062 0.442577 0.142857 0.114846 0.299720 0.521008 0.042017 0.431373 0.005602 0.075630 0.000000 0.770308 0.154062 0.050420 0.056022 0.893557 0.000000 0.036415 0.053221 0.092437 0.817927 0.000000 1.000000 0.000000 0.000000 0.943978 0.002801 0.000000 0.053221 0.137255 0.344538 0.316527 0.201681 0.179272 0.176471 0.417367 0.226891 0.145658 0.170868 0.411765 0.271709 0.058824 0.092437 0.067227 0.781513 0.176471 0.070028 0.742297 0.011204 0.498599 0.277311 0.053221 0.170868 0.095238 0.750700 0.005602 0.148459 0.128852 0.809524 0.000000 0.061625 0.075630 0.252101 0.000000 0.672269 0.168067 0.263305 0.380952 0.187675 Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif 0.168067 0.380952 0.263305 0.187675 0.672269 0.252101 0.000000 0.075630 0.128852 0.000000 0.809524 0.061625 0.095238 0.005602 0.750700 0.148459 0.170868 0.277311 0.053221 0.498599 0.176471 0.742297 0.070028 0.011204 0.781513 0.092437 0.067227 0.058824 0.145658 0.411765 0.170868 0.271709 0.179272 0.417367 0.176471 0.226891 0.137255 0.316527 0.344538 0.201681 0.053221 0.002801 0.000000 0.943978 0.000000 0.000000 1.000000 0.000000 0.817927 0.053221 0.092437 0.036415 0.050420 0.893557 0.056022 0.000000 0.075630 0.770308 0.000000 0.154062 0.005602 0.042017 0.431373 0.521008 0.299720 0.142857 0.114846 0.442577 0.218487 0.176471 0.450980 0.154062 Consensus sequence: BAGGYCABHBTGACCKHV Alignment: VHRGGTCABDBTGMCCTB -----YSSGCAYGCSS-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 7 REST Reverse Complement Original Motif Backward 10 11 0.040932 Original motif 0.132621 0.109365 0.230044 0.527970 0.036318 0.168441 0.091421 0.703820 0.047589 0.855354 0.031309 0.065748 0.906367 0.018727 0.058677 0.016230 0.021197 0.027431 0.945137 0.006234 0.076012 0.609346 0.201246 0.113396 0.980697 0.004359 0.007472 0.007472 0.001868 0.987547 0.007472 0.003113 0.021793 0.922167 0.012453 0.043587 0.568847 0.125234 0.100935 0.204984 0.136534 0.233791 0.077307 0.552369 0.024314 0.004364 0.966958 0.004364 0.012469 0.003117 0.983167 0.001247 0.877105 0.069869 0.021210 0.031815 0.008125 0.800000 0.145625 0.046250 0.983750 0.005625 0.004375 0.006250 0.026349 0.008156 0.959849 0.005646 0.128688 0.632141 0.114878 0.124294 0.229899 0.019472 0.432161 0.318467 0.133962 0.586792 0.200629 0.078616 0.112579 0.700629 0.023270 0.163522 Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif 0.112579 0.023270 0.700629 0.163522 0.133962 0.200629 0.586792 0.078616 0.229899 0.432161 0.019472 0.318467 0.128688 0.114878 0.632141 0.124294 0.026349 0.959849 0.008156 0.005646 0.006250 0.005625 0.004375 0.983750 0.008125 0.145625 0.800000 0.046250 0.031815 0.069869 0.021210 0.877105 0.012469 0.983167 0.003117 0.001247 0.024314 0.966958 0.004364 0.004364 0.552369 0.233791 0.077307 0.136534 0.204984 0.125234 0.100935 0.568847 0.021793 0.012453 0.922167 0.043587 0.001868 0.007472 0.987547 0.003113 0.007472 0.004359 0.007472 0.980697 0.076012 0.201246 0.609346 0.113396 0.021197 0.945137 0.027431 0.006234 0.016230 0.018727 0.058677 0.906367 0.047589 0.031309 0.855354 0.065748 0.703820 0.168441 0.091421 0.036318 0.527970 0.109365 0.230044 0.132621 Consensus sequence: GGYGCTGTCCATGGTGCTGAA Alignment: TTCAGCACCATGGACAGCKCC -YSSGCAYGCSS--------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 14 PPARGRXRA Reverse Complement Original Motif Forward 3 11 0.041419 Original motif 0.109685 0.369895 0.373396 0.147025 0.117716 0.193473 0.148019 0.540793 0.453488 0.026744 0.427907 0.091860 0.116144 0.003484 0.779326 0.101045 0.161253 0.017401 0.781903 0.039443 0.168213 0.149652 0.458237 0.223898 0.082271 0.633835 0.207416 0.076477 0.949015 0.024334 0.017381 0.009270 0.604867 0.055620 0.312862 0.026651 0.825231 0.005787 0.158565 0.010417 0.095017 0.002317 0.888760 0.013905 0.047509 0.010429 0.803013 0.139050 0.025492 0.114716 0.304751 0.555041 0.062645 0.643852 0.167053 0.126450 0.784223 0.067285 0.054524 0.093968 Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif 0.093968 0.067285 0.054524 0.784223 0.062645 0.167053 0.643852 0.126450 0.555041 0.114716 0.304751 0.025492 0.047509 0.803013 0.010429 0.139050 0.095017 0.888760 0.002317 0.013905 0.010417 0.005787 0.158565 0.825231 0.026651 0.055620 0.312862 0.604867 0.009270 0.024334 0.017381 0.949015 0.082271 0.207416 0.633835 0.076477 0.168213 0.458237 0.149652 0.223898 0.161253 0.781903 0.017401 0.039443 0.116144 0.779326 0.003484 0.101045 0.091860 0.026744 0.427907 0.453488 0.540793 0.193473 0.148019 0.117716 0.109685 0.373396 0.369895 0.147025 Consensus sequence: TGRCCTKTGHCCKAB Alignment: BTRGGDCARAGGKCA --YSSGCAYGCSS-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 1 HNF4A Reverse Complement Original Motif Backward 1 11 0.043798 Original motif 0.417910 0.104478 0.402985 0.074627 0.029851 0.029851 0.835821 0.104478 0.179104 0.059701 0.522388 0.238806 0.074627 0.343284 0.298507 0.283582 0.044776 0.761194 0.059701 0.134328 0.880597 0.014925 0.044776 0.059701 0.791045 0.029851 0.149254 0.029851 0.835821 0.014925 0.119403 0.029851 0.059701 0.059701 0.865672 0.014925 0.089552 0.029851 0.492537 0.388060 0.044776 0.328358 0.164179 0.462687 0.059701 0.731343 0.074627 0.134328 0.626866 0.104478 0.149254 0.119403 Consensus sequence: RGGBCAAAGKYCA Reverse complement motif 0.119403 0.104478 0.149254 0.626866 0.059701 0.074627 0.731343 0.134328 0.462687 0.328358 0.164179 0.044776 0.089552 0.492537 0.029851 0.388060 0.059701 0.865672 0.059701 0.014925 0.029851 0.014925 0.119403 0.835821 0.029851 0.029851 0.149254 0.791045 0.059701 0.014925 0.044776 0.880597 0.044776 0.059701 0.761194 0.134328 0.074627 0.298507 0.343284 0.283582 0.179104 0.522388 0.059701 0.238806 0.029851 0.835821 0.029851 0.104478 0.074627 0.104478 0.402985 0.417910 Consensus sequence: TGMYCTTTGBCCK Alignment: RGGBCAAAGKYCA --YSSGCAYGCSS ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 6 Mycn Original Motif Reverse Complement Forward 1 10 0.538870 Original motif 0.349315 0.363014 0.143836 0.143836 0.089041 0.388128 0.447489 0.075342 0.015982 0.984018 0.000000 0.000000 0.945205 0.000000 0.041096 0.013699 0.000000 0.961187 0.018265 0.020548 0.070776 0.002283 0.924658 0.002283 0.054795 0.221461 0.004566 0.719178 0.000000 0.000000 0.938356 0.061644 0.061644 0.111872 0.739726 0.086758 0.139269 0.605023 0.091324 0.164384 Consensus sequence: HSCACGTGGC Reverse complement motif 0.139269 0.091324 0.605023 0.164384 0.061644 0.739726 0.111872 0.086758 0.000000 0.938356 0.000000 0.061644 0.719178 0.221461 0.004566 0.054795 0.070776 0.924658 0.002283 0.002283 0.000000 0.018265 0.961187 0.020548 0.013699 0.000000 0.041096 0.945205 0.015982 0.000000 0.984018 0.000000 0.089041 0.447489 0.388128 0.075342 0.349315 0.143836 0.363014 0.143836 Consensus sequence: GCCACGTGSD Alignment: GCCACGTGSD- SSGCKTGCSSK ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 8 Myc Original Motif Reverse Complement Forward 1 10 0.542915 Original motif 0.295154 0.422907 0.158590 0.123348 0.149780 0.233480 0.572687 0.044053 0.035242 0.964758 0.000000 0.000000 0.955947 0.017621 0.022026 0.004405 0.000000 0.933921 0.013216 0.052863 0.083700 0.008811 0.898678 0.008811 0.039648 0.193833 0.000000 0.766520 0.000000 0.008811 0.951542 0.039648 0.000000 0.074890 0.806167 0.118943 0.198238 0.471366 0.105727 0.224670 Consensus sequence: VGCACGTGGH Reverse complement motif 0.198238 0.105727 0.471366 0.224670 0.000000 0.806167 0.074890 0.118943 0.000000 0.951542 0.008811 0.039648 0.766520 0.193833 0.000000 0.039648 0.083700 0.898678 0.008811 0.008811 0.000000 0.013216 0.933921 0.052863 0.004405 0.017621 0.022026 0.955947 0.035242 0.000000 0.964758 0.000000 0.149780 0.572687 0.233480 0.044053 0.295154 0.158590 0.422907 0.123348 Consensus sequence: DCCACGTGCV Alignment: DCCACGTGCV- SSGCKTGCSSK ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 10 NR1H2RXRA Reverse Complement Original Motif Backward 10 8 1.535833 Original motif 0.680000 0.200000 0.000000 0.120000 0.680000 0.040000 0.200000 0.080000 0.800000 0.000000 0.200000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.040000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.000000 0.040000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.800000 0.040000 0.080000 0.080000 0.000000 0.600000 0.240000 0.160000 Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif 0.000000 0.240000 0.600000 0.160000 0.080000 0.040000 0.080000 0.800000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.040000 0.000000 0.000000 0.960000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.040000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.200000 0.800000 0.080000 0.040000 0.200000 0.680000 0.120000 0.200000 0.000000 0.680000 Consensus sequence: GTTGACCTTTGACCTTT Alignment: ---AAAGGTCAAAGGTCAAC YSSGCAYGCSS--------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 15 Tcfcp2l1 Reverse Complement Original Motif Backward 7 8 1.537042 Original motif 0.001968 0.925480 0.062715 0.009838 0.069973 0.807513 0.005401 0.117113 0.594508 0.005148 0.275803 0.124540 0.005884 0.023780 0.967149 0.003187 0.175477 0.336270 0.025698 0.462555 0.098385 0.289280 0.062163 0.550171 0.173924 0.397260 0.151174 0.277642 0.357213 0.224939 0.252323 0.165526 0.631540 0.069682 0.190954 0.107824 0.394421 0.051382 0.310497 0.243700 0.003669 0.933219 0.054795 0.008317 0.061719 0.812148 0.002939 0.123194 0.536555 0.007360 0.305937 0.150147 0.012039 0.028993 0.954791 0.004177 Consensus sequence: CCAGYYHVADCCRG Reverse complement motif 0.012039 0.954791 0.028993 0.004177 0.150147 0.007360 0.305937 0.536555 0.061719 0.002939 0.812148 0.123194 0.003669 0.054795 0.933219 0.008317 0.243700 0.051382 0.310497 0.394421 0.107824 0.069682 0.190954 0.631540 0.165526 0.224939 0.252323 0.357213 0.173924 0.151174 0.397260 0.277642 0.550171 0.289280 0.062163 0.098385 0.462555 0.336270 0.025698 0.175477 0.005884 0.967149 0.023780 0.003187 0.124540 0.005148 0.275803 0.594508 0.069973 0.005401 0.807513 0.117113 0.001968 0.062715 0.925480 0.009838 Consensus sequence: CKGGDTBDMMCTGG Alignment: ---CCAGYYHVADCCRG YSSGCAYGCSS------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 2 Motif ID: 24 Motif name: ssCCCCGCSssk Original motif 0.000000 0.444444 0.370370 0.185185 0.111111 0.407407 0.333333 0.148148 0.000000 0.888889 0.037037 0.074074 0.000000 0.888889 0.074074 0.037037 0.000000 0.777778 0.222222 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.037037 0.888889 0.000000 0.074074 0.000000 0.703704 0.296296 0.000000 0.000000 0.518519 0.370370 0.111111 0.111111 0.407407 0.259259 0.222222 0.074074 0.222222 0.407407 0.296296 Consensus sequence: SBCCCCGCCSBB Reverse complement motif 0.074074 0.407407 0.222222 0.296296 0.111111 0.259259 0.407407 0.222222 0.000000 0.370370 0.518519 0.111111 0.000000 0.296296 0.703704 0.000000 0.037037 0.000000 0.888889 0.074074 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.222222 0.777778 0.000000 0.000000 0.074074 0.888889 0.037037 0.000000 0.037037 0.888889 0.074074 0.111111 0.333333 0.407407 0.148148 0.000000 0.370370 0.444444 0.185185 Consensus sequence: BBSGGCGGGGBS *************************************************************** Best Matches for Top Significant Motif ID 24 (Highest to Lowest) *************************************************************** Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 3 ESR1 Reverse Complement Reverse Complement Backward 2 12 0.063076 Original motif 0.261242 0.256959 0.329764 0.152034 0.228632 0.170940 0.350427 0.250000 0.136752 0.369658 0.318376 0.175214 0.176596 0.487234 0.138298 0.197872 0.285106 0.493617 0.100000 0.121277 0.651163 0.059197 0.188161 0.101480 0.075949 0.016878 0.816456 0.090717 0.040000 0.037895 0.884211 0.037895 0.069474 0.086316 0.191579 0.652632 0.008421 0.829474 0.111579 0.050526 0.837895 0.027368 0.056842 0.077895 0.122105 0.526316 0.225263 0.126316 0.132632 0.581053 0.111579 0.174737 0.134737 0.543158 0.204211 0.117895 0.067368 0.040000 0.016842 0.875789 0.044211 0.046316 0.896842 0.012632 0.642105 0.223158 0.065263 0.069474 0.021053 0.917895 0.025263 0.035789 0.124211 0.743158 0.004211 0.128421 0.054737 0.347368 0.046316 0.551579 Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif 0.551579 0.347368 0.046316 0.054737 0.124211 0.004211 0.743158 0.128421 0.021053 0.025263 0.917895 0.035789 0.069474 0.223158 0.065263 0.642105 0.044211 0.896842 0.046316 0.012632 0.875789 0.040000 0.016842 0.067368 0.134737 0.204211 0.543158 0.117895 0.132632 0.111579 0.581053 0.174737 0.122105 0.225263 0.526316 0.126316 0.077895 0.027368 0.056842 0.837895 0.008421 0.111579 0.829474 0.050526 0.652632 0.086316 0.191579 0.069474 0.040000 0.884211 0.037895 0.037895 0.075949 0.816456 0.016878 0.090717 0.101480 0.059197 0.188161 0.651163 0.285106 0.100000 0.493617 0.121277 0.176596 0.138298 0.487234 0.197872 0.136752 0.318376 0.369658 0.175214 0.228632 0.350427 0.170940 0.250000 0.261242 0.329764 0.256959 0.152034 Consensus sequence: MGGTCAGGGTGACCTRDBHV Alignment: MGGTCAGGGTGACCTRDBHV -------BBSGGCGGGGBS- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 16 CTCF Reverse Complement Original Motif Forward 2 12 0.064209 Original motif 0.095290 0.318729 0.083242 0.502738 0.182913 0.158817 0.453450 0.204819 0.307777 0.053669 0.491785 0.146769 0.061336 0.876232 0.023001 0.039430 0.008762 0.989047 0.000000 0.002191 0.814896 0.014239 0.071194 0.099671 0.043812 0.578313 0.365827 0.012048 0.117325 0.474781 0.052632 0.355263 0.933114 0.012061 0.035088 0.019737 0.005488 0.000000 0.991218 0.003293 0.365532 0.003293 0.621295 0.009879 0.059276 0.013172 0.553238 0.374314 0.013187 0.000000 0.978022 0.008791 0.061538 0.008791 0.851648 0.078022 0.114411 0.806381 0.005501 0.073707 0.409241 0.014301 0.557756 0.018702 0.090308 0.530837 0.338106 0.040749 0.128855 0.354626 0.080396 0.436123 0.442731 0.199339 0.292952 0.064978 Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif 0.064978 0.199339 0.292952 0.442731 0.436123 0.354626 0.080396 0.128855 0.090308 0.338106 0.530837 0.040749 0.409241 0.557756 0.014301 0.018702 0.114411 0.005501 0.806381 0.073707 0.061538 0.851648 0.008791 0.078022 0.013187 0.978022 0.000000 0.008791 0.059276 0.553238 0.013172 0.374314 0.365532 0.621295 0.003293 0.009879 0.005488 0.991218 0.000000 0.003293 0.019737 0.012061 0.035088 0.933114 0.117325 0.052632 0.474781 0.355263 0.043812 0.365827 0.578313 0.012048 0.099671 0.014239 0.071194 0.814896 0.008762 0.000000 0.989047 0.002191 0.061336 0.023001 0.876232 0.039430 0.307777 0.491785 0.053669 0.146769 0.182913 0.453450 0.158817 0.204819 0.502738 0.318729 0.083242 0.095290 Consensus sequence: BMSMGCCYMCTKSTGGMHM Alignment: YDRCCASYAGRKGGCRSYV -BBSGGCGGGGBS------ ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 14 PPARGRXRA Original Motif Reverse Complement Forward 2 12 0.067155 Original motif 0.109685 0.369895 0.373396 0.147025 0.117716 0.193473 0.148019 0.540793 0.453488 0.026744 0.427907 0.091860 0.116144 0.003484 0.779326 0.101045 0.161253 0.017401 0.781903 0.039443 0.168213 0.149652 0.458237 0.223898 0.082271 0.633835 0.207416 0.076477 0.949015 0.024334 0.017381 0.009270 0.604867 0.055620 0.312862 0.026651 0.825231 0.005787 0.158565 0.010417 0.095017 0.002317 0.888760 0.013905 0.047509 0.010429 0.803013 0.139050 0.025492 0.114716 0.304751 0.555041 0.062645 0.643852 0.167053 0.126450 0.784223 0.067285 0.054524 0.093968 Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif 0.093968 0.067285 0.054524 0.784223 0.062645 0.167053 0.643852 0.126450 0.555041 0.114716 0.304751 0.025492 0.047509 0.803013 0.010429 0.139050 0.095017 0.888760 0.002317 0.013905 0.010417 0.005787 0.158565 0.825231 0.026651 0.055620 0.312862 0.604867 0.009270 0.024334 0.017381 0.949015 0.082271 0.207416 0.633835 0.076477 0.168213 0.458237 0.149652 0.223898 0.161253 0.781903 0.017401 0.039443 0.116144 0.779326 0.003484 0.101045 0.091860 0.026744 0.427907 0.453488 0.540793 0.193473 0.148019 0.117716 0.109685 0.373396 0.369895 0.147025 Consensus sequence: TGRCCTKTGHCCKAB Alignment: TGRCCTKTGHCCKAB -SBCCCCGCCSBB-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 9 ESR2 Original Motif Reverse Complement Forward 2 12 0.073448 Original motif 0.218487 0.450980 0.176471 0.154062 0.442577 0.142857 0.114846 0.299720 0.521008 0.042017 0.431373 0.005602 0.075630 0.000000 0.770308 0.154062 0.050420 0.056022 0.893557 0.000000 0.036415 0.053221 0.092437 0.817927 0.000000 1.000000 0.000000 0.000000 0.943978 0.002801 0.000000 0.053221 0.137255 0.344538 0.316527 0.201681 0.179272 0.176471 0.417367 0.226891 0.145658 0.170868 0.411765 0.271709 0.058824 0.092437 0.067227 0.781513 0.176471 0.070028 0.742297 0.011204 0.498599 0.277311 0.053221 0.170868 0.095238 0.750700 0.005602 0.148459 0.128852 0.809524 0.000000 0.061625 0.075630 0.252101 0.000000 0.672269 0.168067 0.263305 0.380952 0.187675 Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif 0.168067 0.380952 0.263305 0.187675 0.672269 0.252101 0.000000 0.075630 0.128852 0.000000 0.809524 0.061625 0.095238 0.005602 0.750700 0.148459 0.170868 0.277311 0.053221 0.498599 0.176471 0.742297 0.070028 0.011204 0.781513 0.092437 0.067227 0.058824 0.145658 0.411765 0.170868 0.271709 0.179272 0.417367 0.176471 0.226891 0.137255 0.316527 0.344538 0.201681 0.053221 0.002801 0.000000 0.943978 0.000000 0.000000 1.000000 0.000000 0.817927 0.053221 0.092437 0.036415 0.050420 0.893557 0.056022 0.000000 0.075630 0.770308 0.000000 0.154062 0.005602 0.042017 0.431373 0.521008 0.299720 0.142857 0.114846 0.442577 0.218487 0.176471 0.450980 0.154062 Consensus sequence: BAGGYCABHBTGACCKHV Alignment: BAGGYCABHBTGACCKHV -SBCCCCGCCSBB----- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 7 REST Reverse Complement Original Motif Backward 10 12 0.075108 Original motif 0.132621 0.109365 0.230044 0.527970 0.036318 0.168441 0.091421 0.703820 0.047589 0.855354 0.031309 0.065748 0.906367 0.018727 0.058677 0.016230 0.021197 0.027431 0.945137 0.006234 0.076012 0.609346 0.201246 0.113396 0.980697 0.004359 0.007472 0.007472 0.001868 0.987547 0.007472 0.003113 0.021793 0.922167 0.012453 0.043587 0.568847 0.125234 0.100935 0.204984 0.136534 0.233791 0.077307 0.552369 0.024314 0.004364 0.966958 0.004364 0.012469 0.003117 0.983167 0.001247 0.877105 0.069869 0.021210 0.031815 0.008125 0.800000 0.145625 0.046250 0.983750 0.005625 0.004375 0.006250 0.026349 0.008156 0.959849 0.005646 0.128688 0.632141 0.114878 0.124294 0.229899 0.019472 0.432161 0.318467 0.133962 0.586792 0.200629 0.078616 0.112579 0.700629 0.023270 0.163522 Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif 0.112579 0.023270 0.700629 0.163522 0.133962 0.200629 0.586792 0.078616 0.229899 0.432161 0.019472 0.318467 0.128688 0.114878 0.632141 0.124294 0.026349 0.959849 0.008156 0.005646 0.006250 0.005625 0.004375 0.983750 0.008125 0.145625 0.800000 0.046250 0.031815 0.069869 0.021210 0.877105 0.012469 0.983167 0.003117 0.001247 0.024314 0.966958 0.004364 0.004364 0.552369 0.233791 0.077307 0.136534 0.204984 0.125234 0.100935 0.568847 0.021793 0.012453 0.922167 0.043587 0.001868 0.007472 0.987547 0.003113 0.007472 0.004359 0.007472 0.980697 0.076012 0.201246 0.609346 0.113396 0.021197 0.945137 0.027431 0.006234 0.016230 0.018727 0.058677 0.906367 0.047589 0.031309 0.855354 0.065748 0.703820 0.168441 0.091421 0.036318 0.527970 0.109365 0.230044 0.132621 Consensus sequence: GGYGCTGTCCATGGTGCTGAA Alignment: TTCAGCACCATGGACAGCKCC BBSGGCGGGGBS--------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 4 Esrrb Reverse Complement Original Motif Forward 2 11 0.571364 Original motif 0.290198 0.220264 0.271200 0.218337 0.184941 0.227810 0.376477 0.210772 0.115226 0.332236 0.331687 0.220850 0.070959 0.342466 0.122740 0.463836 0.084862 0.729264 0.171640 0.014235 0.909737 0.008753 0.067834 0.013676 0.975656 0.000547 0.016411 0.007385 0.008758 0.001368 0.981390 0.008484 0.005750 0.003286 0.986309 0.004655 0.049904 0.012613 0.066904 0.870579 0.002473 0.927473 0.046703 0.023352 0.951569 0.005504 0.035498 0.007430 Consensus sequence: VBBYCAAGGTCA Reverse complement motif 0.007430 0.005504 0.035498 0.951569 0.002473 0.046703 0.927473 0.023352 0.870579 0.012613 0.066904 0.049904 0.005750 0.986309 0.003286 0.004655 0.008758 0.981390 0.001368 0.008484 0.007385 0.000547 0.016411 0.975656 0.013676 0.008753 0.067834 0.909737 0.084862 0.171640 0.729264 0.014235 0.463836 0.342466 0.122740 0.070959 0.115226 0.331687 0.332236 0.220850 0.184941 0.376477 0.227810 0.210772 0.218337 0.220264 0.271200 0.290198 Consensus sequence: TGACCTTGMBBB Alignment: VBBYCAAGGTCA- -BBSGGCGGGGBS ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 1 HNF4A Original Motif Reverse Complement Backward 3 11 0.573202 Original motif 0.417910 0.104478 0.402985 0.074627 0.029851 0.029851 0.835821 0.104478 0.179104 0.059701 0.522388 0.238806 0.074627 0.343284 0.298507 0.283582 0.044776 0.761194 0.059701 0.134328 0.880597 0.014925 0.044776 0.059701 0.791045 0.029851 0.149254 0.029851 0.835821 0.014925 0.119403 0.029851 0.059701 0.059701 0.865672 0.014925 0.089552 0.029851 0.492537 0.388060 0.044776 0.328358 0.164179 0.462687 0.059701 0.731343 0.074627 0.134328 0.626866 0.104478 0.149254 0.119403 Consensus sequence: RGGBCAAAGKYCA Reverse complement motif 0.119403 0.104478 0.149254 0.626866 0.059701 0.074627 0.731343 0.134328 0.462687 0.328358 0.164179 0.044776 0.089552 0.492537 0.029851 0.388060 0.059701 0.865672 0.059701 0.014925 0.029851 0.014925 0.119403 0.835821 0.029851 0.029851 0.149254 0.791045 0.059701 0.014925 0.044776 0.880597 0.044776 0.059701 0.761194 0.134328 0.074627 0.298507 0.343284 0.283582 0.179104 0.522388 0.059701 0.238806 0.029851 0.835821 0.029851 0.104478 0.074627 0.104478 0.402985 0.417910 Consensus sequence: TGMYCTTTGBCCK Alignment: -TGMYCTTTGBCCK SBCCCCGCCSBB-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 15 Tcfcp2l1 Reverse Complement Reverse Complement Forward 6 9 1.549134 Original motif 0.001968 0.925480 0.062715 0.009838 0.069973 0.807513 0.005401 0.117113 0.594508 0.005148 0.275803 0.124540 0.005884 0.023780 0.967149 0.003187 0.175477 0.336270 0.025698 0.462555 0.098385 0.289280 0.062163 0.550171 0.173924 0.397260 0.151174 0.277642 0.357213 0.224939 0.252323 0.165526 0.631540 0.069682 0.190954 0.107824 0.394421 0.051382 0.310497 0.243700 0.003669 0.933219 0.054795 0.008317 0.061719 0.812148 0.002939 0.123194 0.536555 0.007360 0.305937 0.150147 0.012039 0.028993 0.954791 0.004177 Consensus sequence: CCAGYYHVADCCRG Reverse complement motif 0.012039 0.954791 0.028993 0.004177 0.150147 0.007360 0.305937 0.536555 0.061719 0.002939 0.812148 0.123194 0.003669 0.054795 0.933219 0.008317 0.243700 0.051382 0.310497 0.394421 0.107824 0.069682 0.190954 0.631540 0.165526 0.224939 0.252323 0.357213 0.173924 0.151174 0.397260 0.277642 0.550171 0.289280 0.062163 0.098385 0.462555 0.336270 0.025698 0.175477 0.005884 0.967149 0.023780 0.003187 0.124540 0.005148 0.275803 0.594508 0.069973 0.005401 0.807513 0.117113 0.001968 0.062715 0.925480 0.009838 Consensus sequence: CKGGDTBDMMCTGG Alignment: CKGGDTBDMMCTGG--- -----BBSGGCGGGGBS ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 6 Mycn Original Motif Original Motif Backward 2 9 1.575069 Original motif 0.349315 0.363014 0.143836 0.143836 0.089041 0.388128 0.447489 0.075342 0.015982 0.984018 0.000000 0.000000 0.945205 0.000000 0.041096 0.013699 0.000000 0.961187 0.018265 0.020548 0.070776 0.002283 0.924658 0.002283 0.054795 0.221461 0.004566 0.719178 0.000000 0.000000 0.938356 0.061644 0.061644 0.111872 0.739726 0.086758 0.139269 0.605023 0.091324 0.164384 Consensus sequence: HSCACGTGGC Reverse complement motif 0.139269 0.091324 0.605023 0.164384 0.061644 0.739726 0.111872 0.086758 0.000000 0.938356 0.000000 0.061644 0.719178 0.221461 0.004566 0.054795 0.070776 0.924658 0.002283 0.002283 0.000000 0.018265 0.961187 0.020548 0.013699 0.000000 0.041096 0.945205 0.015982 0.000000 0.984018 0.000000 0.089041 0.447489 0.388128 0.075342 0.349315 0.143836 0.363014 0.143836 Consensus sequence: GCCACGTGSD Alignment: ---HSCACGTGGC SBCCCCGCCSBB- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 8 Myc Reverse Complement Original Motif Forward 2 9 1.577367 Original motif 0.295154 0.422907 0.158590 0.123348 0.149780 0.233480 0.572687 0.044053 0.035242 0.964758 0.000000 0.000000 0.955947 0.017621 0.022026 0.004405 0.000000 0.933921 0.013216 0.052863 0.083700 0.008811 0.898678 0.008811 0.039648 0.193833 0.000000 0.766520 0.000000 0.008811 0.951542 0.039648 0.000000 0.074890 0.806167 0.118943 0.198238 0.471366 0.105727 0.224670 Consensus sequence: VGCACGTGGH Reverse complement motif 0.198238 0.105727 0.471366 0.224670 0.000000 0.806167 0.074890 0.118943 0.000000 0.951542 0.008811 0.039648 0.766520 0.193833 0.000000 0.039648 0.083700 0.898678 0.008811 0.008811 0.000000 0.013216 0.933921 0.052863 0.004405 0.017621 0.022026 0.955947 0.035242 0.000000 0.964758 0.000000 0.149780 0.572687 0.233480 0.044053 0.295154 0.158590 0.422907 0.123348 Consensus sequence: DCCACGTGCV Alignment: VGCACGTGGH--- -BBSGGCGGGGBS ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 2 Motif ID: 29 Motif name: cCGCGGrCACG Original motif 0.000000 0.600000 0.200000 0.200000 0.000000 0.800000 0.000000 0.200000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.600000 0.000000 0.400000 0.000000 0.000000 0.800000 0.200000 0.000000 0.800000 0.000000 0.200000 0.000000 0.000000 0.800000 0.200000 0.000000 0.200000 0.000000 0.800000 0.000000 Consensus sequence: CCGCGGRCACG Reverse complement motif 0.200000 0.800000 0.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.200000 0.800000 0.000000 0.000000 0.000000 0.400000 0.600000 0.000000 0.800000 0.200000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.800000 0.200000 0.000000 0.200000 0.600000 0.200000 Consensus sequence: CGTGKCCGCGG *************************************************************** Best Matches for Top Significant Motif ID 29 (Highest to Lowest) *************************************************************** Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 7 REST Original Motif Original Motif Backward 4 11 0.048444 Original motif 0.132621 0.109365 0.230044 0.527970 0.036318 0.168441 0.091421 0.703820 0.047589 0.855354 0.031309 0.065748 0.906367 0.018727 0.058677 0.016230 0.021197 0.027431 0.945137 0.006234 0.076012 0.609346 0.201246 0.113396 0.980697 0.004359 0.007472 0.007472 0.001868 0.987547 0.007472 0.003113 0.021793 0.922167 0.012453 0.043587 0.568847 0.125234 0.100935 0.204984 0.136534 0.233791 0.077307 0.552369 0.024314 0.004364 0.966958 0.004364 0.012469 0.003117 0.983167 0.001247 0.877105 0.069869 0.021210 0.031815 0.008125 0.800000 0.145625 0.046250 0.983750 0.005625 0.004375 0.006250 0.026349 0.008156 0.959849 0.005646 0.128688 0.632141 0.114878 0.124294 0.229899 0.019472 0.432161 0.318467 0.133962 0.586792 0.200629 0.078616 0.112579 0.700629 0.023270 0.163522 Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif 0.112579 0.023270 0.700629 0.163522 0.133962 0.200629 0.586792 0.078616 0.229899 0.432161 0.019472 0.318467 0.128688 0.114878 0.632141 0.124294 0.026349 0.959849 0.008156 0.005646 0.006250 0.005625 0.004375 0.983750 0.008125 0.145625 0.800000 0.046250 0.031815 0.069869 0.021210 0.877105 0.012469 0.983167 0.003117 0.001247 0.024314 0.966958 0.004364 0.004364 0.552369 0.233791 0.077307 0.136534 0.204984 0.125234 0.100935 0.568847 0.021793 0.012453 0.922167 0.043587 0.001868 0.007472 0.987547 0.003113 0.007472 0.004359 0.007472 0.980697 0.076012 0.201246 0.609346 0.113396 0.021197 0.945137 0.027431 0.006234 0.016230 0.018727 0.058677 0.906367 0.047589 0.031309 0.855354 0.065748 0.703820 0.168441 0.091421 0.036318 0.527970 0.109365 0.230044 0.132621 Consensus sequence: GGYGCTGTCCATGGTGCTGAA Alignment: TTCAGCACCATGGACAGCKCC -------CCGCGGRCACG--- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 3 ESR1 Reverse Complement Reverse Complement Backward 3 11 0.048658 Original motif 0.261242 0.256959 0.329764 0.152034 0.228632 0.170940 0.350427 0.250000 0.136752 0.369658 0.318376 0.175214 0.176596 0.487234 0.138298 0.197872 0.285106 0.493617 0.100000 0.121277 0.651163 0.059197 0.188161 0.101480 0.075949 0.016878 0.816456 0.090717 0.040000 0.037895 0.884211 0.037895 0.069474 0.086316 0.191579 0.652632 0.008421 0.829474 0.111579 0.050526 0.837895 0.027368 0.056842 0.077895 0.122105 0.526316 0.225263 0.126316 0.132632 0.581053 0.111579 0.174737 0.134737 0.543158 0.204211 0.117895 0.067368 0.040000 0.016842 0.875789 0.044211 0.046316 0.896842 0.012632 0.642105 0.223158 0.065263 0.069474 0.021053 0.917895 0.025263 0.035789 0.124211 0.743158 0.004211 0.128421 0.054737 0.347368 0.046316 0.551579 Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif 0.551579 0.347368 0.046316 0.054737 0.124211 0.004211 0.743158 0.128421 0.021053 0.025263 0.917895 0.035789 0.069474 0.223158 0.065263 0.642105 0.044211 0.896842 0.046316 0.012632 0.875789 0.040000 0.016842 0.067368 0.134737 0.204211 0.543158 0.117895 0.132632 0.111579 0.581053 0.174737 0.122105 0.225263 0.526316 0.126316 0.077895 0.027368 0.056842 0.837895 0.008421 0.111579 0.829474 0.050526 0.652632 0.086316 0.191579 0.069474 0.040000 0.884211 0.037895 0.037895 0.075949 0.816456 0.016878 0.090717 0.101480 0.059197 0.188161 0.651163 0.285106 0.100000 0.493617 0.121277 0.176596 0.138298 0.487234 0.197872 0.136752 0.318376 0.369658 0.175214 0.228632 0.350427 0.170940 0.250000 0.261242 0.329764 0.256959 0.152034 Consensus sequence: MGGTCAGGGTGACCTRDBHV Alignment: MGGTCAGGGTGACCTRDBHV -------CGTGKCCGCGG-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 16 CTCF Original Motif Original Motif Backward 2 11 0.058866 Original motif 0.095290 0.318729 0.083242 0.502738 0.182913 0.158817 0.453450 0.204819 0.307777 0.053669 0.491785 0.146769 0.061336 0.876232 0.023001 0.039430 0.008762 0.989047 0.000000 0.002191 0.814896 0.014239 0.071194 0.099671 0.043812 0.578313 0.365827 0.012048 0.117325 0.474781 0.052632 0.355263 0.933114 0.012061 0.035088 0.019737 0.005488 0.000000 0.991218 0.003293 0.365532 0.003293 0.621295 0.009879 0.059276 0.013172 0.553238 0.374314 0.013187 0.000000 0.978022 0.008791 0.061538 0.008791 0.851648 0.078022 0.114411 0.806381 0.005501 0.073707 0.409241 0.014301 0.557756 0.018702 0.090308 0.530837 0.338106 0.040749 0.128855 0.354626 0.080396 0.436123 0.442731 0.199339 0.292952 0.064978 Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif 0.064978 0.199339 0.292952 0.442731 0.436123 0.354626 0.080396 0.128855 0.090308 0.338106 0.530837 0.040749 0.409241 0.557756 0.014301 0.018702 0.114411 0.005501 0.806381 0.073707 0.061538 0.851648 0.008791 0.078022 0.013187 0.978022 0.000000 0.008791 0.059276 0.553238 0.013172 0.374314 0.365532 0.621295 0.003293 0.009879 0.005488 0.991218 0.000000 0.003293 0.019737 0.012061 0.035088 0.933114 0.117325 0.052632 0.474781 0.355263 0.043812 0.365827 0.578313 0.012048 0.099671 0.014239 0.071194 0.814896 0.008762 0.000000 0.989047 0.002191 0.061336 0.023001 0.876232 0.039430 0.307777 0.491785 0.053669 0.146769 0.182913 0.453450 0.158817 0.204819 0.502738 0.318729 0.083242 0.095290 Consensus sequence: BMSMGCCYMCTKSTGGMHM Alignment: YDRCCASYAGRKGGCRSYV -------CCGCGGRCACG- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 14 PPARGRXRA Reverse Complement Reverse Complement Forward 4 11 0.062948 Original motif 0.109685 0.369895 0.373396 0.147025 0.117716 0.193473 0.148019 0.540793 0.453488 0.026744 0.427907 0.091860 0.116144 0.003484 0.779326 0.101045 0.161253 0.017401 0.781903 0.039443 0.168213 0.149652 0.458237 0.223898 0.082271 0.633835 0.207416 0.076477 0.949015 0.024334 0.017381 0.009270 0.604867 0.055620 0.312862 0.026651 0.825231 0.005787 0.158565 0.010417 0.095017 0.002317 0.888760 0.013905 0.047509 0.010429 0.803013 0.139050 0.025492 0.114716 0.304751 0.555041 0.062645 0.643852 0.167053 0.126450 0.784223 0.067285 0.054524 0.093968 Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif 0.093968 0.067285 0.054524 0.784223 0.062645 0.167053 0.643852 0.126450 0.555041 0.114716 0.304751 0.025492 0.047509 0.803013 0.010429 0.139050 0.095017 0.888760 0.002317 0.013905 0.010417 0.005787 0.158565 0.825231 0.026651 0.055620 0.312862 0.604867 0.009270 0.024334 0.017381 0.949015 0.082271 0.207416 0.633835 0.076477 0.168213 0.458237 0.149652 0.223898 0.161253 0.781903 0.017401 0.039443 0.116144 0.779326 0.003484 0.101045 0.091860 0.026744 0.427907 0.453488 0.540793 0.193473 0.148019 0.117716 0.109685 0.373396 0.369895 0.147025 Consensus sequence: TGRCCTKTGHCCKAB Alignment: TGRCCTKTGHCCKAB ---CGTGKCCGCGG- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 9 ESR2 Reverse Complement Reverse Complement Forward 9 10 0.551597 Original motif 0.218487 0.450980 0.176471 0.154062 0.442577 0.142857 0.114846 0.299720 0.521008 0.042017 0.431373 0.005602 0.075630 0.000000 0.770308 0.154062 0.050420 0.056022 0.893557 0.000000 0.036415 0.053221 0.092437 0.817927 0.000000 1.000000 0.000000 0.000000 0.943978 0.002801 0.000000 0.053221 0.137255 0.344538 0.316527 0.201681 0.179272 0.176471 0.417367 0.226891 0.145658 0.170868 0.411765 0.271709 0.058824 0.092437 0.067227 0.781513 0.176471 0.070028 0.742297 0.011204 0.498599 0.277311 0.053221 0.170868 0.095238 0.750700 0.005602 0.148459 0.128852 0.809524 0.000000 0.061625 0.075630 0.252101 0.000000 0.672269 0.168067 0.263305 0.380952 0.187675 Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif 0.168067 0.380952 0.263305 0.187675 0.672269 0.252101 0.000000 0.075630 0.128852 0.000000 0.809524 0.061625 0.095238 0.005602 0.750700 0.148459 0.170868 0.277311 0.053221 0.498599 0.176471 0.742297 0.070028 0.011204 0.781513 0.092437 0.067227 0.058824 0.145658 0.411765 0.170868 0.271709 0.179272 0.417367 0.176471 0.226891 0.137255 0.316527 0.344538 0.201681 0.053221 0.002801 0.000000 0.943978 0.000000 0.000000 1.000000 0.000000 0.817927 0.053221 0.092437 0.036415 0.050420 0.893557 0.056022 0.000000 0.075630 0.770308 0.000000 0.154062 0.005602 0.042017 0.431373 0.521008 0.299720 0.142857 0.114846 0.442577 0.218487 0.176471 0.450980 0.154062 Consensus sequence: BAGGYCABHBTGACCKHV Alignment: BAGGYCABHBTGACCKHV- --------CGTGKCCGCGG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 8 Myc Reverse Complement Original Motif Forward 2 9 1.048798 Original motif 0.295154 0.422907 0.158590 0.123348 0.149780 0.233480 0.572687 0.044053 0.035242 0.964758 0.000000 0.000000 0.955947 0.017621 0.022026 0.004405 0.000000 0.933921 0.013216 0.052863 0.083700 0.008811 0.898678 0.008811 0.039648 0.193833 0.000000 0.766520 0.000000 0.008811 0.951542 0.039648 0.000000 0.074890 0.806167 0.118943 0.198238 0.471366 0.105727 0.224670 Consensus sequence: VGCACGTGGH Reverse complement motif 0.198238 0.105727 0.471366 0.224670 0.000000 0.806167 0.074890 0.118943 0.000000 0.951542 0.008811 0.039648 0.766520 0.193833 0.000000 0.039648 0.083700 0.898678 0.008811 0.008811 0.000000 0.013216 0.933921 0.052863 0.004405 0.017621 0.022026 0.955947 0.035242 0.000000 0.964758 0.000000 0.149780 0.572687 0.233480 0.044053 0.295154 0.158590 0.422907 0.123348 Consensus sequence: DCCACGTGCV Alignment: VGCACGTGGH-- -CGTGKCCGCGG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 6 Mycn Reverse Complement Original Motif Forward 2 9 1.048916 Original motif 0.349315 0.363014 0.143836 0.143836 0.089041 0.388128 0.447489 0.075342 0.015982 0.984018 0.000000 0.000000 0.945205 0.000000 0.041096 0.013699 0.000000 0.961187 0.018265 0.020548 0.070776 0.002283 0.924658 0.002283 0.054795 0.221461 0.004566 0.719178 0.000000 0.000000 0.938356 0.061644 0.061644 0.111872 0.739726 0.086758 0.139269 0.605023 0.091324 0.164384 Consensus sequence: HSCACGTGGC Reverse complement motif 0.139269 0.091324 0.605023 0.164384 0.061644 0.739726 0.111872 0.086758 0.000000 0.938356 0.000000 0.061644 0.719178 0.221461 0.004566 0.054795 0.070776 0.924658 0.002283 0.002283 0.000000 0.018265 0.961187 0.020548 0.013699 0.000000 0.041096 0.945205 0.015982 0.000000 0.984018 0.000000 0.089041 0.447489 0.388128 0.075342 0.349315 0.143836 0.363014 0.143836 Consensus sequence: GCCACGTGSD Alignment: HSCACGTGGC-- -CGTGKCCGCGG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 13 MIZF Reverse Complement Original Motif Backward 2 9 1.049043 Original motif 0.100000 0.300000 0.250000 0.350000 0.650000 0.050000 0.000000 0.300000 1.000000 0.000000 0.000000 0.000000 0.100000 0.850000 0.050000 0.000000 0.000000 0.000000 0.950000 0.050000 0.000000 0.050000 0.000000 0.950000 0.000000 0.950000 0.000000 0.050000 0.000000 0.900000 0.100000 0.000000 0.000000 0.000000 0.950000 0.050000 0.100000 0.650000 0.050000 0.200000 Consensus sequence: BAACGTCCGC Reverse complement motif 0.100000 0.050000 0.650000 0.200000 0.000000 0.950000 0.000000 0.050000 0.000000 0.100000 0.900000 0.000000 0.000000 0.000000 0.950000 0.050000 0.950000 0.050000 0.000000 0.000000 0.000000 0.950000 0.000000 0.050000 0.100000 0.050000 0.850000 0.000000 0.000000 0.000000 0.000000 1.000000 0.300000 0.050000 0.000000 0.650000 0.350000 0.300000 0.250000 0.100000 Consensus sequence: GCGGACGTTV Alignment: --BAACGTCCGC CGTGKCCGCGG- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 4 Esrrb Original Motif Original Motif Forward 4 9 1.052910 Original motif 0.290198 0.220264 0.271200 0.218337 0.184941 0.227810 0.376477 0.210772 0.115226 0.332236 0.331687 0.220850 0.070959 0.342466 0.122740 0.463836 0.084862 0.729264 0.171640 0.014235 0.909737 0.008753 0.067834 0.013676 0.975656 0.000547 0.016411 0.007385 0.008758 0.001368 0.981390 0.008484 0.005750 0.003286 0.986309 0.004655 0.049904 0.012613 0.066904 0.870579 0.002473 0.927473 0.046703 0.023352 0.951569 0.005504 0.035498 0.007430 Consensus sequence: VBBYCAAGGTCA Reverse complement motif 0.007430 0.005504 0.035498 0.951569 0.002473 0.046703 0.927473 0.023352 0.870579 0.012613 0.066904 0.049904 0.005750 0.986309 0.003286 0.004655 0.008758 0.981390 0.001368 0.008484 0.007385 0.000547 0.016411 0.975656 0.013676 0.008753 0.067834 0.909737 0.084862 0.171640 0.729264 0.014235 0.463836 0.342466 0.122740 0.070959 0.115226 0.331687 0.332236 0.220850 0.184941 0.376477 0.227810 0.210772 0.218337 0.220264 0.271200 0.290198 Consensus sequence: TGACCTTGMBBB Alignment: VBBYCAAGGTCA-- ---CCGCGGRCACG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 1 1 HNF4A Reverse Complement Reverse Complement Forward 6 8 1.557946 Original motif 0.417910 0.104478 0.402985 0.074627 0.029851 0.029851 0.835821 0.104478 0.179104 0.059701 0.522388 0.238806 0.074627 0.343284 0.298507 0.283582 0.044776 0.761194 0.059701 0.134328 0.880597 0.014925 0.044776 0.059701 0.791045 0.029851 0.149254 0.029851 0.835821 0.014925 0.119403 0.029851 0.059701 0.059701 0.865672 0.014925 0.089552 0.029851 0.492537 0.388060 0.044776 0.328358 0.164179 0.462687 0.059701 0.731343 0.074627 0.134328 0.626866 0.104478 0.149254 0.119403 Consensus sequence: RGGBCAAAGKYCA Reverse complement motif 0.119403 0.104478 0.149254 0.626866 0.059701 0.074627 0.731343 0.134328 0.462687 0.328358 0.164179 0.044776 0.089552 0.492537 0.029851 0.388060 0.059701 0.865672 0.059701 0.014925 0.029851 0.014925 0.119403 0.835821 0.029851 0.029851 0.149254 0.791045 0.059701 0.014925 0.044776 0.880597 0.044776 0.059701 0.761194 0.134328 0.074627 0.298507 0.343284 0.283582 0.179104 0.522388 0.059701 0.238806 0.029851 0.835821 0.029851 0.104478 0.074627 0.104478 0.402985 0.417910 Consensus sequence: TGMYCTTTGBCCK Alignment: TGMYCTTTGBCCK--- -----CGTGKCCGCGG ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 4 Motif name: Esrrb Original motif 0.290198 0.220264 0.271200 0.218337 0.184941 0.227810 0.376477 0.210772 0.115226 0.332236 0.331687 0.220850 0.070959 0.342466 0.122740 0.463836 0.084862 0.729264 0.171640 0.014235 0.909737 0.008753 0.067834 0.013676 0.975656 0.000547 0.016411 0.007385 0.008758 0.001368 0.981390 0.008484 0.005750 0.003286 0.986309 0.004655 0.049904 0.012613 0.066904 0.870579 0.002473 0.927473 0.046703 0.023352 0.951569 0.005504 0.035498 0.007430 Consensus sequence: VBBYCAAGGTCA Reverse complement motif 0.007430 0.005504 0.035498 0.951569 0.002473 0.046703 0.927473 0.023352 0.870579 0.012613 0.066904 0.049904 0.005750 0.986309 0.003286 0.004655 0.008758 0.981390 0.001368 0.008484 0.007385 0.000547 0.016411 0.975656 0.013676 0.008753 0.067834 0.909737 0.084862 0.171640 0.729264 0.014235 0.463836 0.342466 0.122740 0.070959 0.115226 0.331687 0.332236 0.220850 0.184941 0.376477 0.227810 0.210772 0.218337 0.220264 0.271200 0.290198 Consensus sequence: TGACCTTGMBBB *************************************************************** Best Matches for Top Significant Motif ID 4 (Highest to Lowest) *************************************************************** Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 17 TgTGgTGTCACAGTGCTCC Reverse Complement Original Motif Backward 1 12 0.077256 Original motif 0.111111 0.083333 0.055556 0.750000 0.125000 0.097222 0.652778 0.125000 0.041667 0.097222 0.027778 0.833333 0.027778 0.027778 0.791667 0.152778 0.055556 0.166667 0.652778 0.125000 0.000000 0.041667 0.013889 0.944444 0.041667 0.000000 0.888889 0.069444 0.027778 0.027778 0.000000 0.944444 0.041667 0.944444 0.013889 0.000000 0.916667 0.027778 0.000000 0.055556 0.069444 0.875000 0.000000 0.055556 0.833333 0.013889 0.013889 0.138889 0.041667 0.069444 0.819444 0.069444 0.027778 0.027778 0.027778 0.916667 0.069444 0.013889 0.847222 0.069444 0.069444 0.777778 0.027778 0.125000 0.055556 0.041667 0.027778 0.875000 0.041667 0.708333 0.125000 0.125000 0.111111 0.819444 0.055556 0.013889 Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif 0.111111 0.055556 0.819444 0.013889 0.041667 0.125000 0.708333 0.125000 0.875000 0.041667 0.027778 0.055556 0.069444 0.027778 0.777778 0.125000 0.069444 0.847222 0.013889 0.069444 0.916667 0.027778 0.027778 0.027778 0.041667 0.819444 0.069444 0.069444 0.138889 0.013889 0.013889 0.833333 0.069444 0.000000 0.875000 0.055556 0.055556 0.027778 0.000000 0.916667 0.041667 0.013889 0.944444 0.000000 0.944444 0.027778 0.000000 0.027778 0.041667 0.888889 0.000000 0.069444 0.944444 0.041667 0.013889 0.000000 0.055556 0.652778 0.166667 0.125000 0.027778 0.791667 0.027778 0.152778 0.833333 0.097222 0.027778 0.041667 0.125000 0.652778 0.097222 0.125000 0.750000 0.083333 0.055556 0.111111 Consensus sequence: GGAGCACTGTGACACCACA Alignment: TGTGGTGTCACAGTGCTCC -------TGACCTTGMBBB ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 23 TGGAGCACTGTGACAcCACAGTGg Reverse Complement Reverse Complement Forward 12 12 0.078539 Original motif 0.054054 0.040541 0.054054 0.851351 0.040541 0.013514 0.824324 0.121622 0.094595 0.135135 0.756757 0.013514 0.891892 0.000000 0.000000 0.108108 0.040541 0.094595 0.810811 0.054054 0.081081 0.797297 0.054054 0.067568 0.932432 0.027027 0.000000 0.040541 0.054054 0.756757 0.135135 0.054054 0.108108 0.027027 0.013514 0.851351 0.108108 0.000000 0.851351 0.040541 0.013514 0.000000 0.027027 0.959459 0.000000 0.013514 0.945946 0.040541 0.905405 0.000000 0.067568 0.027027 0.054054 0.837838 0.000000 0.108108 0.945946 0.013514 0.040541 0.000000 0.162162 0.500000 0.189189 0.148649 0.108108 0.824324 0.000000 0.067568 0.945946 0.000000 0.040541 0.013514 0.081081 0.837838 0.027027 0.054054 0.945946 0.000000 0.013514 0.040541 0.054054 0.067568 0.783784 0.094595 0.054054 0.027027 0.000000 0.918919 0.040541 0.013514 0.864865 0.081081 0.148649 0.121622 0.675676 0.054054 Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif 0.148649 0.675676 0.121622 0.054054 0.040541 0.864865 0.013514 0.081081 0.918919 0.027027 0.000000 0.054054 0.054054 0.783784 0.067568 0.094595 0.040541 0.000000 0.013514 0.945946 0.081081 0.027027 0.837838 0.054054 0.013514 0.000000 0.040541 0.945946 0.108108 0.000000 0.824324 0.067568 0.162162 0.189189 0.500000 0.148649 0.000000 0.013514 0.040541 0.945946 0.054054 0.000000 0.837838 0.108108 0.027027 0.000000 0.067568 0.905405 0.000000 0.945946 0.013514 0.040541 0.959459 0.000000 0.027027 0.013514 0.108108 0.851351 0.000000 0.040541 0.851351 0.027027 0.013514 0.108108 0.054054 0.135135 0.756757 0.054054 0.040541 0.027027 0.000000 0.932432 0.081081 0.054054 0.797297 0.067568 0.040541 0.810811 0.094595 0.054054 0.108108 0.000000 0.000000 0.891892 0.094595 0.756757 0.135135 0.013514 0.040541 0.824324 0.013514 0.121622 0.851351 0.040541 0.054054 0.054054 Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA Alignment: CCACTGTGVTGTCACAGTGCTCCA -----------TGACCTTGMBBB- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 22 CACTGTGrYrtCACAGTGswsCAcT Original Motif Reverse Complement Backward 11 12 0.083272 Original motif 0.111111 0.746032 0.063492 0.079365 0.857143 0.047619 0.047619 0.047619 0.047619 0.857143 0.079365 0.015873 0.031746 0.000000 0.000000 0.968254 0.031746 0.015873 0.904762 0.047619 0.000000 0.000000 0.000000 1.000000 0.031746 0.000000 0.857143 0.111111 0.396825 0.111111 0.412698 0.079365 0.031746 0.253968 0.015873 0.698413 0.365079 0.000000 0.634921 0.000000 0.079365 0.206349 0.047619 0.666667 0.047619 0.936508 0.015873 0.000000 0.952381 0.000000 0.015873 0.031746 0.015873 0.920635 0.000000 0.063492 0.920635 0.000000 0.000000 0.079365 0.063492 0.047619 0.841270 0.047619 0.000000 0.000000 0.015873 0.984127 0.047619 0.015873 0.904762 0.031746 0.015873 0.603175 0.317460 0.063492 0.396825 0.000000 0.015873 0.587302 0.015873 0.476190 0.428571 0.079365 0.063492 0.920635 0.000000 0.015873 0.920635 0.015873 0.047619 0.015873 0.095238 0.682540 0.095238 0.126984 0.047619 0.015873 0.095238 0.841270 Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif 0.841270 0.015873 0.095238 0.047619 0.095238 0.095238 0.682540 0.126984 0.015873 0.015873 0.047619 0.920635 0.063492 0.000000 0.920635 0.015873 0.015873 0.428571 0.476190 0.079365 0.587302 0.000000 0.015873 0.396825 0.015873 0.317460 0.603175 0.063492 0.047619 0.904762 0.015873 0.031746 0.984127 0.000000 0.015873 0.000000 0.063492 0.841270 0.047619 0.047619 0.079365 0.000000 0.000000 0.920635 0.015873 0.000000 0.920635 0.063492 0.031746 0.000000 0.015873 0.952381 0.047619 0.015873 0.936508 0.000000 0.666667 0.206349 0.047619 0.079365 0.365079 0.634921 0.000000 0.000000 0.698413 0.253968 0.015873 0.031746 0.396825 0.412698 0.111111 0.079365 0.031746 0.857143 0.000000 0.111111 1.000000 0.000000 0.000000 0.000000 0.031746 0.904762 0.015873 0.047619 0.968254 0.000000 0.000000 0.031746 0.047619 0.079365 0.857143 0.015873 0.047619 0.047619 0.047619 0.857143 0.111111 0.063492 0.746032 0.079365 Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG Alignment: AGTGSWSCACTGTGAMAMCACAGTG ---VBBYCAAGGTCA---------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 25 wwCCAmAGTCmt Original Motif Original Motif Backward 2 11 0.558919 Original motif 0.454545 0.045455 0.227273 0.272727 0.363636 0.136364 0.136364 0.363636 0.000000 1.000000 0.000000 0.000000 0.000000 0.954545 0.045455 0.000000 1.000000 0.000000 0.000000 0.000000 0.409091 0.590909 0.000000 0.000000 0.909091 0.045455 0.045455 0.000000 0.000000 0.000000 1.000000 0.000000 0.045455 0.000000 0.000000 0.954545 0.045455 0.909091 0.000000 0.045455 0.272727 0.318182 0.181818 0.227273 0.181818 0.227273 0.227273 0.363636 Consensus sequence: DDCCAMAGTCHB Reverse complement motif 0.363636 0.227273 0.227273 0.181818 0.272727 0.181818 0.318182 0.227273 0.045455 0.000000 0.909091 0.045455 0.954545 0.000000 0.000000 0.045455 0.000000 1.000000 0.000000 0.000000 0.000000 0.045455 0.045455 0.909091 0.409091 0.000000 0.590909 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.045455 0.954545 0.000000 0.000000 0.000000 1.000000 0.000000 0.363636 0.136364 0.136364 0.363636 0.272727 0.045455 0.227273 0.454545 Consensus sequence: VDGACTRTGGDD Alignment: -DDCCAMAGTCHB VBBYCAAGGTCA- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 28 ssGCkTGCssk Reverse Complement Original Motif Backward 1 11 0.581406 Original motif 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 0.500000 0.500000 Consensus sequence: SSGCKTGCSSK Reverse complement motif 0.000000 0.500000 0.000000 0.500000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.000000 0.500000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 Consensus sequence: YSSGCAYGCSS Alignment: -SSGCKTGCSSK TGACCTTGMBBB ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 24 ssCCCCGCSssk Reverse Complement Original Motif Backward 2 11 0.583683 Original motif 0.000000 0.444444 0.370370 0.185185 0.111111 0.407407 0.333333 0.148148 0.000000 0.888889 0.037037 0.074074 0.000000 0.888889 0.074074 0.037037 0.000000 0.777778 0.222222 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.037037 0.888889 0.000000 0.074074 0.000000 0.703704 0.296296 0.000000 0.000000 0.518519 0.370370 0.111111 0.111111 0.407407 0.259259 0.222222 0.074074 0.222222 0.407407 0.296296 Consensus sequence: SBCCCCGCCSBB Reverse complement motif 0.074074 0.407407 0.222222 0.296296 0.111111 0.259259 0.407407 0.222222 0.000000 0.370370 0.518519 0.111111 0.000000 0.296296 0.703704 0.000000 0.037037 0.000000 0.888889 0.074074 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.222222 0.777778 0.000000 0.000000 0.074074 0.888889 0.037037 0.000000 0.037037 0.888889 0.074074 0.111111 0.333333 0.407407 0.148148 0.000000 0.370370 0.444444 0.185185 Consensus sequence: BBSGGCGGGGBS Alignment: -SBCCCCGCCSBB TGACCTTGMBBB- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 27 AgTGCTCCACTGTGgTGTCACAgT Original Motif Original Motif Forward 15 10 1.086832 Original motif 0.690141 0.126761 0.042254 0.140845 0.169014 0.098592 0.676056 0.056338 0.042254 0.028169 0.028169 0.901408 0.056338 0.000000 0.774648 0.169014 0.042254 0.887324 0.042254 0.028169 0.000000 0.014085 0.000000 0.985915 0.056338 0.830986 0.042254 0.070423 0.028169 0.957746 0.014085 0.000000 0.957746 0.000000 0.014085 0.028169 0.084507 0.845070 0.014085 0.056338 0.028169 0.014085 0.000000 0.957746 0.140845 0.028169 0.802817 0.028169 0.014085 0.014085 0.014085 0.957746 0.014085 0.000000 0.929577 0.056338 0.056338 0.154930 0.619718 0.169014 0.014085 0.028169 0.000000 0.957746 0.056338 0.014085 0.873239 0.056338 0.014085 0.000000 0.000000 0.985915 0.042254 0.929577 0.000000 0.028169 0.957746 0.028169 0.000000 0.014085 0.028169 0.845070 0.028169 0.098592 0.873239 0.014085 0.042254 0.070423 0.098592 0.154930 0.563380 0.183099 0.070423 0.014085 0.112676 0.802817 Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif 0.802817 0.014085 0.112676 0.070423 0.098592 0.563380 0.154930 0.183099 0.070423 0.014085 0.042254 0.873239 0.028169 0.028169 0.845070 0.098592 0.014085 0.028169 0.000000 0.957746 0.042254 0.000000 0.929577 0.028169 0.985915 0.000000 0.000000 0.014085 0.056338 0.873239 0.014085 0.056338 0.957746 0.028169 0.000000 0.014085 0.056338 0.619718 0.154930 0.169014 0.014085 0.929577 0.000000 0.056338 0.957746 0.014085 0.014085 0.014085 0.140845 0.802817 0.028169 0.028169 0.957746 0.014085 0.000000 0.028169 0.084507 0.014085 0.845070 0.056338 0.028169 0.000000 0.014085 0.957746 0.028169 0.014085 0.957746 0.000000 0.056338 0.042254 0.830986 0.070423 0.985915 0.014085 0.000000 0.000000 0.042254 0.042254 0.887324 0.028169 0.056338 0.774648 0.000000 0.169014 0.901408 0.028169 0.028169 0.042254 0.169014 0.676056 0.098592 0.056338 0.140845 0.126761 0.042254 0.690141 Consensus sequence: ACTGTGACACCACAGTGGAGCACT Alignment: AGTGCTCCACTGTGGTGTCACAGT-- --------------VBBYCAAGGTCA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 19 atactttggc Original Motif Reverse Complement Backward 1 10 1.087261 Original motif 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 Consensus sequence: ATACTTTGGC Reverse complement motif 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 Consensus sequence: GCCAAAGTAT Alignment: --GCCAAAGTAT VBBYCAAGGTCA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 29 cCGCGGrCACG Original Motif Original Motif Backward 3 9 1.575793 Original motif 0.000000 0.600000 0.200000 0.200000 0.000000 0.800000 0.000000 0.200000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.600000 0.000000 0.400000 0.000000 0.000000 0.800000 0.200000 0.000000 0.800000 0.000000 0.200000 0.000000 0.000000 0.800000 0.200000 0.000000 0.200000 0.000000 0.800000 0.000000 Consensus sequence: CCGCGGRCACG Reverse complement motif 0.200000 0.800000 0.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.200000 0.800000 0.000000 0.000000 0.000000 0.400000 0.600000 0.000000 0.800000 0.200000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.800000 0.200000 0.000000 0.200000 0.600000 0.200000 Consensus sequence: CGTGKCCGCGG Alignment: ---CCGCGGRCACG VBBYCAAGGTCA-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 21 AmTGTGACACCACAGT Original Motif Original Motif Backward 10 7 2.575947 Original motif 0.703125 0.187500 0.015625 0.093750 0.265625 0.500000 0.125000 0.109375 0.015625 0.046875 0.031250 0.906250 0.078125 0.015625 0.890625 0.015625 0.000000 0.000000 0.000000 1.000000 0.000000 0.031250 0.906250 0.062500 0.953125 0.000000 0.015625 0.031250 0.046875 0.890625 0.000000 0.062500 0.968750 0.000000 0.015625 0.015625 0.109375 0.781250 0.062500 0.046875 0.062500 0.890625 0.000000 0.046875 0.953125 0.000000 0.031250 0.015625 0.031250 0.781250 0.046875 0.140625 0.937500 0.015625 0.031250 0.015625 0.093750 0.078125 0.734375 0.093750 0.031250 0.078125 0.000000 0.890625 Consensus sequence: AMTGTGACACCACAGT Reverse complement motif 0.890625 0.078125 0.000000 0.031250 0.093750 0.734375 0.078125 0.093750 0.015625 0.015625 0.031250 0.937500 0.031250 0.046875 0.781250 0.140625 0.015625 0.000000 0.031250 0.953125 0.062500 0.000000 0.890625 0.046875 0.109375 0.062500 0.781250 0.046875 0.015625 0.000000 0.015625 0.968750 0.046875 0.000000 0.890625 0.062500 0.031250 0.000000 0.015625 0.953125 0.000000 0.906250 0.031250 0.062500 1.000000 0.000000 0.000000 0.000000 0.078125 0.890625 0.015625 0.015625 0.906250 0.046875 0.031250 0.015625 0.265625 0.125000 0.500000 0.109375 0.093750 0.187500 0.015625 0.703125 Consensus sequence: ACTGTGGTGTCACART Alignment: -----AMTGTGACACCACAGT VBBYCAAGGTCA--------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset #: 1 Motif ID: 13 Motif name: MIZF Original motif 0.100000 0.300000 0.250000 0.350000 0.650000 0.050000 0.000000 0.300000 1.000000 0.000000 0.000000 0.000000 0.100000 0.850000 0.050000 0.000000 0.000000 0.000000 0.950000 0.050000 0.000000 0.050000 0.000000 0.950000 0.000000 0.950000 0.000000 0.050000 0.000000 0.900000 0.100000 0.000000 0.000000 0.000000 0.950000 0.050000 0.100000 0.650000 0.050000 0.200000 Consensus sequence: BAACGTCCGC Reverse complement motif 0.100000 0.050000 0.650000 0.200000 0.000000 0.950000 0.000000 0.050000 0.000000 0.100000 0.900000 0.000000 0.000000 0.000000 0.950000 0.050000 0.950000 0.050000 0.000000 0.000000 0.000000 0.950000 0.000000 0.050000 0.100000 0.050000 0.850000 0.000000 0.000000 0.000000 0.000000 1.000000 0.300000 0.050000 0.000000 0.650000 0.350000 0.300000 0.250000 0.100000 Consensus sequence: GCGGACGTTV *************************************************************** Best Matches for Top Significant Motif ID 13 (Highest to Lowest) *************************************************************** Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 32 gCGCGCsCgsG Original Motif Original Motif Forward 1 10 0.065160 Original motif 0.105263 0.210526 0.526316 0.157895 0.000000 0.736842 0.105263 0.157895 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.368421 0.631579 0.000000 0.000000 0.894737 0.105263 0.000000 0.157895 0.157895 0.631579 0.052632 0.052632 0.631579 0.263158 0.052632 0.105263 0.052632 0.789474 0.052632 Consensus sequence: GCGCGCSCGCG Reverse complement motif 0.105263 0.789474 0.052632 0.052632 0.052632 0.263158 0.631579 0.052632 0.157895 0.631579 0.157895 0.052632 0.000000 0.105263 0.894737 0.000000 0.000000 0.631579 0.368421 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.105263 0.736842 0.157895 0.105263 0.526316 0.210526 0.157895 Consensus sequence: CGCGSGCGCGC Alignment: GCGCGCSCGCG BAACGTCCGC- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 19 atactttggc Original Motif Original Motif Backward 1 10 0.080357 Original motif 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 Consensus sequence: ATACTTTGGC Reverse complement motif 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 Consensus sequence: GCCAAAGTAT Alignment: ATACTTTGGC BAACGTCCGC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 29 cCGCGGrCACG Reverse Complement Original Motif Forward 3 9 0.560913 Original motif 0.000000 0.600000 0.200000 0.200000 0.000000 0.800000 0.000000 0.200000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.600000 0.000000 0.400000 0.000000 0.000000 0.800000 0.200000 0.000000 0.800000 0.000000 0.200000 0.000000 0.000000 0.800000 0.200000 0.000000 0.200000 0.000000 0.800000 0.000000 Consensus sequence: CCGCGGRCACG Reverse complement motif 0.200000 0.800000 0.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.000000 0.000000 0.200000 0.800000 0.000000 0.200000 0.800000 0.000000 0.000000 0.000000 0.400000 0.600000 0.000000 0.800000 0.200000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.800000 0.200000 0.000000 0.200000 0.600000 0.200000 Consensus sequence: CGTGKCCGCGG Alignment: CCGCGGRCACG- --GCGGACGTTV ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 31 ctatacggacg Reverse Complement Reverse Complement Backward 3 9 0.562302 Original motif 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 Consensus sequence: CTATACGGACG Reverse complement motif 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 Consensus sequence: CGTCCGTATAG Alignment: -CGTCCGTATAG GCGGACGTTV-- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 25 wwCCAmAGTCmt Original Motif Original Motif Forward 4 9 0.562428 Original motif 0.454545 0.045455 0.227273 0.272727 0.363636 0.136364 0.136364 0.363636 0.000000 1.000000 0.000000 0.000000 0.000000 0.954545 0.045455 0.000000 1.000000 0.000000 0.000000 0.000000 0.409091 0.590909 0.000000 0.000000 0.909091 0.045455 0.045455 0.000000 0.000000 0.000000 1.000000 0.000000 0.045455 0.000000 0.000000 0.954545 0.045455 0.909091 0.000000 0.045455 0.272727 0.318182 0.181818 0.227273 0.181818 0.227273 0.227273 0.363636 Consensus sequence: DDCCAMAGTCHB Reverse complement motif 0.363636 0.227273 0.227273 0.181818 0.272727 0.181818 0.318182 0.227273 0.045455 0.000000 0.909091 0.045455 0.954545 0.000000 0.000000 0.045455 0.000000 1.000000 0.000000 0.000000 0.000000 0.045455 0.045455 0.909091 0.409091 0.000000 0.590909 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.045455 0.954545 0.000000 0.000000 0.000000 1.000000 0.000000 0.363636 0.136364 0.136364 0.363636 0.272727 0.045455 0.227273 0.454545 Consensus sequence: VDGACTRTGGDD Alignment: DDCCAMAGTCHB- ---BAACGTCCGC ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 18 sscCCCGCGcs Reverse Complement Reverse Complement Forward 4 8 1.064456 Original motif 0.147059 0.441176 0.264706 0.147059 0.117647 0.529412 0.294118 0.058824 0.000000 0.676471 0.235294 0.088235 0.029412 0.852941 0.117647 0.000000 0.000000 0.823529 0.176471 0.000000 0.000000 0.794118 0.205882 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.058824 0.941176 0.000000 0.117647 0.470588 0.235294 0.176471 0.000000 0.323529 0.529412 0.147059 Consensus sequence: BSCCCCGCGBS Reverse complement motif 0.000000 0.529412 0.323529 0.147059 0.117647 0.235294 0.470588 0.176471 0.000000 0.941176 0.058824 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.205882 0.794118 0.000000 0.000000 0.176471 0.823529 0.000000 0.029412 0.117647 0.852941 0.000000 0.000000 0.235294 0.676471 0.088235 0.117647 0.294118 0.529412 0.058824 0.147059 0.264706 0.441176 0.147059 Consensus sequence: SBCGCGGGGSB Alignment: SBCGCGGGGSB-- ---GCGGACGTTV ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 24 ssCCCCGCSssk Reverse Complement Reverse Complement Forward 5 8 1.071966 Original motif 0.000000 0.444444 0.370370 0.185185 0.111111 0.407407 0.333333 0.148148 0.000000 0.888889 0.037037 0.074074 0.000000 0.888889 0.074074 0.037037 0.000000 0.777778 0.222222 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.037037 0.888889 0.000000 0.074074 0.000000 0.703704 0.296296 0.000000 0.000000 0.518519 0.370370 0.111111 0.111111 0.407407 0.259259 0.222222 0.074074 0.222222 0.407407 0.296296 Consensus sequence: SBCCCCGCCSBB Reverse complement motif 0.074074 0.407407 0.222222 0.296296 0.111111 0.259259 0.407407 0.222222 0.000000 0.370370 0.518519 0.111111 0.000000 0.296296 0.703704 0.000000 0.037037 0.000000 0.888889 0.074074 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.222222 0.777778 0.000000 0.000000 0.074074 0.888889 0.037037 0.000000 0.037037 0.888889 0.074074 0.111111 0.333333 0.407407 0.148148 0.000000 0.370370 0.444444 0.185185 Consensus sequence: BBSGGCGGGGBS Alignment: BBSGGCGGGGBS-- ----GCGGACGTTV ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 33 srACyCCGAyr Reverse Complement Original Motif Forward 5 7 1.550000 Original motif 0.000000 0.500000 0.500000 0.000000 0.500000 0.000000 0.500000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.000000 0.500000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 0.500000 0.000000 0.500000 0.500000 0.000000 0.500000 0.000000 Consensus sequence: SRACYCCGAYR Reverse complement motif 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 0.000000 1.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.500000 0.500000 0.000000 0.500000 0.500000 0.000000 Consensus sequence: KKTCGGKGTKS Alignment: SRACYCCGAYR--- ----GCGGACGTTV ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 27 AgTGCTCCACTGTGgTGTCACAgT Original Motif Original Motif Backward 18 7 1.570599 Original motif 0.690141 0.126761 0.042254 0.140845 0.169014 0.098592 0.676056 0.056338 0.042254 0.028169 0.028169 0.901408 0.056338 0.000000 0.774648 0.169014 0.042254 0.887324 0.042254 0.028169 0.000000 0.014085 0.000000 0.985915 0.056338 0.830986 0.042254 0.070423 0.028169 0.957746 0.014085 0.000000 0.957746 0.000000 0.014085 0.028169 0.084507 0.845070 0.014085 0.056338 0.028169 0.014085 0.000000 0.957746 0.140845 0.028169 0.802817 0.028169 0.014085 0.014085 0.014085 0.957746 0.014085 0.000000 0.929577 0.056338 0.056338 0.154930 0.619718 0.169014 0.014085 0.028169 0.000000 0.957746 0.056338 0.014085 0.873239 0.056338 0.014085 0.000000 0.000000 0.985915 0.042254 0.929577 0.000000 0.028169 0.957746 0.028169 0.000000 0.014085 0.028169 0.845070 0.028169 0.098592 0.873239 0.014085 0.042254 0.070423 0.098592 0.154930 0.563380 0.183099 0.070423 0.014085 0.112676 0.802817 Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif 0.802817 0.014085 0.112676 0.070423 0.098592 0.563380 0.154930 0.183099 0.070423 0.014085 0.042254 0.873239 0.028169 0.028169 0.845070 0.098592 0.014085 0.028169 0.000000 0.957746 0.042254 0.000000 0.929577 0.028169 0.985915 0.000000 0.000000 0.014085 0.056338 0.873239 0.014085 0.056338 0.957746 0.028169 0.000000 0.014085 0.056338 0.619718 0.154930 0.169014 0.014085 0.929577 0.000000 0.056338 0.957746 0.014085 0.014085 0.014085 0.140845 0.802817 0.028169 0.028169 0.957746 0.014085 0.000000 0.028169 0.084507 0.014085 0.845070 0.056338 0.028169 0.000000 0.014085 0.957746 0.028169 0.014085 0.957746 0.000000 0.056338 0.042254 0.830986 0.070423 0.985915 0.014085 0.000000 0.000000 0.042254 0.042254 0.887324 0.028169 0.056338 0.774648 0.000000 0.169014 0.901408 0.028169 0.028169 0.042254 0.169014 0.676056 0.098592 0.056338 0.140845 0.126761 0.042254 0.690141 Consensus sequence: ACTGTGACACCACAGTGGAGCACT Alignment: ---AGTGCTCCACTGTGGTGTCACAGT BAACGTCCGC----------------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dataset # Motif ID Motif name Matching format of first motif Matching format of second motif Direction Position # # of overlap Similarity score 2 26 CAcCACAGTGGAGCAct Reverse Complement Original Motif Forward 11 7 1.571763 Original motif 0.078125 0.734375 0.046875 0.140625 0.828125 0.046875 0.078125 0.046875 0.203125 0.484375 0.156250 0.156250 0.015625 0.984375 0.000000 0.000000 0.968750 0.015625 0.015625 0.000000 0.000000 0.906250 0.015625 0.078125 0.859375 0.000000 0.000000 0.140625 0.031250 0.000000 0.906250 0.062500 0.000000 0.015625 0.000000 0.984375 0.000000 0.000000 0.968750 0.031250 0.046875 0.062500 0.812500 0.078125 0.937500 0.015625 0.015625 0.031250 0.015625 0.031250 0.921875 0.031250 0.125000 0.796875 0.000000 0.078125 0.875000 0.046875 0.046875 0.031250 0.093750 0.656250 0.093750 0.156250 0.156250 0.078125 0.109375 0.656250 Consensus sequence: CAHCACAGTGGAGCACT Reverse complement motif 0.656250 0.078125 0.109375 0.156250 0.093750 0.093750 0.656250 0.156250 0.031250 0.046875 0.046875 0.875000 0.125000 0.000000 0.796875 0.078125 0.015625 0.921875 0.031250 0.031250 0.031250 0.015625 0.015625 0.937500 0.046875 0.812500 0.062500 0.078125 0.000000 0.968750 0.000000 0.031250 0.984375 0.015625 0.000000 0.000000 0.031250 0.906250 0.000000 0.062500 0.140625 0.000000 0.000000 0.859375 0.000000 0.015625 0.906250 0.078125 0.000000 0.015625 0.015625 0.968750 0.015625 0.000000 0.984375 0.000000 0.203125 0.156250 0.484375 0.156250 0.046875 0.046875 0.078125 0.828125 0.078125 0.046875 0.734375 0.140625 Consensus sequence: AGTGCTCCACTGTGDTG Alignment: CAHCACAGTGGAGCACT--- ----------GCGGACGTTV ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Results created by MOTIFSIM on 06-18-2018 13:12:37 Runtime: 641.553922 seconds MOTIFSIM is written by Ngoc Tam L. Tran