MOTIFSIM - MOTIF SIMilarity Detection Tool

Version 2.0

INPUT

Input Parameters
Number of files: 2
Number of top significant motifs: 10
Number of best matches: 10
Similarity cutoff >= 0.75
Output file type: All
Output file format: All

Input files and motif counts
File name Count of motifs Dataset number
PScanChIP_DM05.txt 16 1
RSAT_peak-motifs_DM05.txt 17 2

RESULTS

Top 10 Significant Motifs - Global Matching (Highest to Lowest)

Dataset #: 1 Motif ID: 5 Motif name: ZEB1

Original motif     Consensus sequence: CACCTD Reverse complement motif     Consensus sequence: HAGGTG

Best Matches for Top Significant Motif ID 5 (Highest to Lowest)

Dataset #: 2
Motif ID: 21
Motif name: AmTGTGACACCACAGT
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 4
Number of overlap: 6
Similarity score: 0.0349782

Alignment:
AMTGTGACACCACAGT
-------CACCTD---

Original motif     Consensus sequence: AMTGTGACACCACAGT Reverse complement motif     Consensus sequence: ACTGTGGTGTCACART


Dataset #: 2
Motif ID: 17
Motif name: TgTGgTGTCACAGTGCTCC
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 6
Similarity score: 0.0362768

Alignment:
TGTGGTGTCACAGTGCTCC
-HAGGTG------------

Original motif     Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif     Consensus sequence: GGAGCACTGTGACACCACA


Dataset #: 2
Motif ID: 27
Motif name: AgTGCTCCACTGTGgTGTCACAgT
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 12
Number of overlap: 6
Similarity score: 0.0409613

Alignment:
AGTGCTCCACTGTGGTGTCACAGT
-----------HAGGTG-------

Original motif     Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif     Consensus sequence: ACTGTGACACCACAGTGGAGCACT


Dataset #: 2
Motif ID: 33
Motif name: srACyCCGAyr
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 3
Number of overlap: 6
Similarity score: 0.0426002

Alignment:
KKTCGGKGTKS
--HAGGTG---

Original motif     Consensus sequence: SRACYCCGAYR Reverse complement motif     Consensus sequence: KKTCGGKGTKS


Dataset #: 2
Motif ID: 23
Motif name: TGGAGCACTGTGACAcCACAGTGg
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 6
Number of overlap: 6
Similarity score: 0.0496179

Alignment:
TGGAGCACTGTGACAVCACAGTGG
-------------CACCTD-----

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA


Dataset #: 2
Motif ID: 26
Motif name: CAcCACAGTGGAGCAct
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 6
Similarity score: 0.0538743

Alignment:
CAHCACAGTGGAGCACT
CACCTD-----------

Original motif     Consensus sequence: CAHCACAGTGGAGCACT Reverse complement motif     Consensus sequence: AGTGCTCCACTGTGDTG


Dataset #: 2
Motif ID: 19
Motif name: atactttggc
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 6
Similarity score: 0.0553034

Alignment:
ATACTTTGGC
-CACCTD---

Original motif     Consensus sequence: ATACTTTGGC Reverse complement motif     Consensus sequence: GCCAAAGTAT


Dataset #: 2
Motif ID: 22
Motif name: CACTGTGrYrtCACAGTGswsCAcT
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 2
Number of overlap: 6
Similarity score: 0.0564649

Alignment:
AGTGSWSCACTGTGAMAMCACAGTG
------------------CACCTD-

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG


Dataset #: 2
Motif ID: 24
Motif name: ssCCCCGCSssk
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 2
Number of overlap: 6
Similarity score: 0.0571854

Alignment:
SBCCCCGCCSBB
-----CACCTD-

Original motif     Consensus sequence: SBCCCCGCCSBB Reverse complement motif     Consensus sequence: BBSGGCGGGGBS


Dataset #: 2
Motif ID: 20
Motif name: CagTGCTCCACTGTGgT
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 8
Number of overlap: 6
Similarity score: 0.0594701

Alignment:
ABCACAGTGGAGCACTG
----HAGGTG-------

Original motif     Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif     Consensus sequence: ABCACAGTGGAGCACTG


Dataset #: 1 Motif ID: 6 Motif name: Mycn

Original motif     Consensus sequence: HSCACGTGGC Reverse complement motif     Consensus sequence: GCCACGTGSD

Best Matches for Top Significant Motif ID 6 (Highest to Lowest)

Dataset #: 2
Motif ID: 18
Motif name: sscCCCGCGcs
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 10
Similarity score: 0.0654819

Alignment:
BSCCCCGCGBS
-GCCACGTGSD

Original motif     Consensus sequence: BSCCCCGCGBS Reverse complement motif     Consensus sequence: SBCGCGGGGSB


Dataset #: 2
Motif ID: 24
Motif name: ssCCCCGCSssk
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 10
Similarity score: 0.0704988

Alignment:
BBSGGCGGGGBS
-HSCACGTGGC-

Original motif     Consensus sequence: SBCCCCGCCSBB Reverse complement motif     Consensus sequence: BBSGGCGGGGBS


Dataset #: 2
Motif ID: 22
Motif name: CACTGTGrYrtCACAGTGswsCAcT
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 10
Number of overlap: 10
Similarity score: 0.0883224

Alignment:
AGTGSWSCACTGTGAMAMCACAGTG
------GCCACGTGSD---------

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG


Dataset #: 2
Motif ID: 20
Motif name: CagTGCTCCACTGTGgT
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 7
Number of overlap: 10
Similarity score: 0.0943014

Alignment:
ABCACAGTGGAGCACTG
-GCCACGTGSD------

Original motif     Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif     Consensus sequence: ABCACAGTGGAGCACTG


Dataset #: 2
Motif ID: 27
Motif name: AgTGCTCCACTGTGgTGTCACAgT
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 6
Number of overlap: 10
Similarity score: 0.0949359

Alignment:
ACTGTGACACCACAGTGGAGCACT
---------GCCACGTGSD-----

Original motif     Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif     Consensus sequence: ACTGTGACACCACAGTGGAGCACT


Dataset #: 2
Motif ID: 23
Motif name: TGGAGCACTGTGACAcCACAGTGg
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 10
Similarity score: 0.0955115

Alignment:
TGGAGCACTGTGACAVCACAGTGG
--------------HSCACGTGGC

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA


Dataset #: 2
Motif ID: 26
Motif name: CAcCACAGTGGAGCAct
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 6
Number of overlap: 10
Similarity score: 0.0959628

Alignment:
CAHCACAGTGGAGCACT
--GCCACGTGSD-----

Original motif     Consensus sequence: CAHCACAGTGGAGCACT Reverse complement motif     Consensus sequence: AGTGCTCCACTGTGDTG


Dataset #: 2
Motif ID: 32
Motif name: gCGCGCsCgsG
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 10
Similarity score: 0.0989932

Alignment:
GCGCGCSCGCG
-HSCACGTGGC

Original motif     Consensus sequence: GCGCGCSCGCG Reverse complement motif     Consensus sequence: CGCGSGCGCGC


Dataset #: 2
Motif ID: 17
Motif name: TgTGgTGTCACAGTGCTCC
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 4
Number of overlap: 10
Similarity score: 0.0991692

Alignment:
GGAGCACTGTGACACCACA
---GCCACGTGSD------

Original motif     Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif     Consensus sequence: GGAGCACTGTGACACCACA


Dataset #: 2
Motif ID: 28
Motif name: ssGCkTGCssk
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 1
Number of overlap: 10
Similarity score: 0.101333

Alignment:
YSSGCAYGCSS
HSCACGTGGC-

Original motif     Consensus sequence: SSGCKTGCSSK Reverse complement motif     Consensus sequence: YSSGCAYGCSS


Dataset #: 1 Motif ID: 8 Motif name: Myc

Original motif     Consensus sequence: VGCACGTGGH Reverse complement motif     Consensus sequence: DCCACGTGCV

Best Matches for Top Significant Motif ID 8 (Highest to Lowest)

Dataset #: 2
Motif ID: 18
Motif name: sscCCCGCGcs
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 10
Similarity score: 0.064853

Alignment:
BSCCCCGCGBS
-DCCACGTGCV

Original motif     Consensus sequence: BSCCCCGCGBS Reverse complement motif     Consensus sequence: SBCGCGGGGSB


Dataset #: 2
Motif ID: 24
Motif name: ssCCCCGCSssk
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 2
Number of overlap: 10
Similarity score: 0.0728588

Alignment:
SBCCCCGCCSBB
-DCCACGTGCV-

Original motif     Consensus sequence: SBCCCCGCCSBB Reverse complement motif     Consensus sequence: BBSGGCGGGGBS


Dataset #: 2
Motif ID: 22
Motif name: CACTGTGrYrtCACAGTGswsCAcT
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 6
Number of overlap: 10
Similarity score: 0.0888909

Alignment:
CACTGTGRTRTCACAGTGSWSCACT
----------DCCACGTGCV-----

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG


Dataset #: 2
Motif ID: 20
Motif name: CagTGCTCCACTGTGgT
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 7
Number of overlap: 10
Similarity score: 0.0955234

Alignment:
ABCACAGTGGAGCACTG
-DCCACGTGCV------

Original motif     Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif     Consensus sequence: ABCACAGTGGAGCACTG


Dataset #: 2
Motif ID: 23
Motif name: TGGAGCACTGTGACAcCACAGTGg
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 11
Number of overlap: 10
Similarity score: 0.0971125

Alignment:
TGGAGCACTGTGACAVCACAGTGG
----DCCACGTGCV----------

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA


Dataset #: 2
Motif ID: 25
Motif name: wwCCAmAGTCmt
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 10
Similarity score: 0.0974038

Alignment:
VDGACTRTGGDD
-VGCACGTGGH-

Original motif     Consensus sequence: DDCCAMAGTCHB Reverse complement motif     Consensus sequence: VDGACTRTGGDD


Dataset #: 2
Motif ID: 26
Motif name: CAcCACAGTGGAGCAct
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 3
Number of overlap: 10
Similarity score: 0.0979703

Alignment:
CAHCACAGTGGAGCACT
--DCCACGTGCV-----

Original motif     Consensus sequence: CAHCACAGTGGAGCACT Reverse complement motif     Consensus sequence: AGTGCTCCACTGTGDTG


Dataset #: 2
Motif ID: 27
Motif name: AgTGCTCCACTGTGgTGTCACAgT
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 6
Number of overlap: 10
Similarity score: 0.0980018

Alignment:
ACTGTGACACCACAGTGGAGCACT
---------DCCACGTGCV-----

Original motif     Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif     Consensus sequence: ACTGTGACACCACAGTGGAGCACT


Dataset #: 2
Motif ID: 32
Motif name: gCGCGCsCgsG
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 1
Number of overlap: 10
Similarity score: 0.0989125

Alignment:
CGCGSGCGCGC
VGCACGTGGH-

Original motif     Consensus sequence: GCGCGCSCGCG Reverse complement motif     Consensus sequence: CGCGSGCGCGC


Dataset #: 2
Motif ID: 17
Motif name: TgTGgTGTCACAGTGCTCC
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 7
Number of overlap: 10
Similarity score: 0.0993196

Alignment:
GGAGCACTGTGACACCACA
---DCCACGTGCV------

Original motif     Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif     Consensus sequence: GGAGCACTGTGACACCACA


Dataset #: 1 Motif ID: 11 Motif name: NR4A2

Original motif     Consensus sequence: AAGGTCAC Reverse complement motif     Consensus sequence: GTGACCTT

Best Matches for Top Significant Motif ID 11 (Highest to Lowest)

Dataset #: 2
Motif ID: 22
Motif name: CACTGTGrYrtCACAGTGswsCAcT
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 7
Number of overlap: 8
Similarity score: 0.0557243

Alignment:
CACTGTGRTRTCACAGTGSWSCACT
------AAGGTCAC-----------

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG


Dataset #: 2
Motif ID: 23
Motif name: TGGAGCACTGTGACAcCACAGTGg
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 8
Number of overlap: 8
Similarity score: 0.060729

Alignment:
CCACTGTGVTGTCACAGTGCTCCA
-------AAGGTCAC---------

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA


Dataset #: 2
Motif ID: 21
Motif name: AmTGTGACACCACAGT
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 4
Number of overlap: 8
Similarity score: 0.0645146

Alignment:
ACTGTGGTGTCACART
-----AAGGTCAC---

Original motif     Consensus sequence: AMTGTGACACCACAGT Reverse complement motif     Consensus sequence: ACTGTGGTGTCACART


Dataset #: 2
Motif ID: 17
Motif name: TgTGgTGTCACAGTGCTCC
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 9
Number of overlap: 8
Similarity score: 0.0695512

Alignment:
TGTGGTGTCACAGTGCTCC
---AAGGTCAC--------

Original motif     Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif     Consensus sequence: GGAGCACTGTGACACCACA


Dataset #: 2
Motif ID: 27
Motif name: AgTGCTCCACTGTGgTGTCACAgT
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 4
Number of overlap: 8
Similarity score: 0.0709831

Alignment:
AGTGCTCCACTGTGGTGTCACAGT
-------------AAGGTCAC---

Original motif     Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif     Consensus sequence: ACTGTGACACCACAGTGGAGCACT


Dataset #: 2
Motif ID: 29
Motif name: cCGCGGrCACG
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 3
Number of overlap: 8
Similarity score: 0.0772292

Alignment:
CCGCGGRCACG
--AAGGTCAC-

Original motif     Consensus sequence: CCGCGGRCACG Reverse complement motif     Consensus sequence: CGTGKCCGCGG


Dataset #: 2
Motif ID: 25
Motif name: wwCCAmAGTCmt
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 5
Number of overlap: 8
Similarity score: 0.0788401

Alignment:
DDCCAMAGTCHB
----AAGGTCAC

Original motif     Consensus sequence: DDCCAMAGTCHB Reverse complement motif     Consensus sequence: VDGACTRTGGDD


Dataset #: 2
Motif ID: 20
Motif name: CagTGCTCCACTGTGgT
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 10
Number of overlap: 8
Similarity score: 0.0864039

Alignment:
ABCACAGTGGAGCACTG
---------GTGACCTT

Original motif     Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif     Consensus sequence: ABCACAGTGGAGCACTG


Dataset #: 2
Motif ID: 28
Motif name: ssGCkTGCssk
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 5
Number of overlap: 7
Similarity score: 0.568556

Alignment:
SSGCKTGCSSK-
----GTGACCTT

Original motif     Consensus sequence: SSGCKTGCSSK Reverse complement motif     Consensus sequence: YSSGCAYGCSS


Dataset #: 2
Motif ID: 26
Motif name: CAcCACAGTGGAGCAct
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 11
Number of overlap: 7
Similarity score: 0.581814

Alignment:
CAHCACAGTGGAGCACT-
----------GTGACCTT

Original motif     Consensus sequence: CAHCACAGTGGAGCACT Reverse complement motif     Consensus sequence: AGTGCTCCACTGTGDTG


Dataset #: 2 Motif ID: 25 Motif name: wwCCAmAGTCmt

Original motif     Consensus sequence: DDCCAMAGTCHB Reverse complement motif     Consensus sequence: VDGACTRTGGDD

Best Matches for Top Significant Motif ID 25 (Highest to Lowest)

Dataset #: 1
Motif ID: 1
Motif name: HNF4A
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 12
Similarity score: 0.032442

Alignment:
RGGBCAAAGKYCA
-DDCCAMAGTCHB

Original motif     Consensus sequence: RGGBCAAAGKYCA Reverse complement motif     Consensus sequence: TGMYCTTTGBCCK


Dataset #: 1
Motif ID: 7
Motif name: REST
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 4
Number of overlap: 12
Similarity score: 0.0391228

Alignment:
GGYGCTGTCCATGGTGCTGAA
---DDCCAMAGTCHB------

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 1
Motif ID: 3
Motif name: ESR1
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 12
Similarity score: 0.0407304

Alignment:
VDBHMAGGTCACCCTGACCY
DDCCAMAGTCHB--------

Original motif     Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif     Consensus sequence: MGGTCAGGGTGACCTRDBHV


Dataset #: 1
Motif ID: 10
Motif name: NR1H2RXRA
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 2
Number of overlap: 12
Similarity score: 0.0463384

Alignment:
AAAGGTCAAAGGTCAAC
----DDCCAMAGTCHB-

Original motif     Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif     Consensus sequence: GTTGACCTTTGACCTTT


Dataset #: 1
Motif ID: 14
Motif name: PPARGRXRA
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 3
Number of overlap: 12
Similarity score: 0.0480406

Alignment:
TGRCCTKTGHCCKAB
--DDCCAMAGTCHB-

Original motif     Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif     Consensus sequence: TGRCCTKTGHCCKAB


Dataset #: 1
Motif ID: 2
Motif name: NR2F1
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 3
Number of overlap: 12
Similarity score: 0.0506507

Alignment:
TGAMCTTTGMMCYT
--VDGACTRTGGDD

Original motif     Consensus sequence: TGAMCTTTGMMCYT Reverse complement motif     Consensus sequence: AKGYYCAAAGRTCA


Dataset #: 1
Motif ID: 16
Motif name: CTCF
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 8
Number of overlap: 12
Similarity score: 0.0523578

Alignment:
BMSMGCCYMCTKSTGGMHM
DDCCAMAGTCHB-------

Original motif     Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif     Consensus sequence: BMSMGCCYMCTKSTGGMHM


Dataset #: 1
Motif ID: 9
Motif name: ESR2
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 4
Number of overlap: 12
Similarity score: 0.0576723

Alignment:
VHRGGTCABDBTGMCCTB
---DDCCAMAGTCHB---

Original motif     Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif     Consensus sequence: BAGGYCABHBTGACCKHV


Dataset #: 1
Motif ID: 4
Motif name: Esrrb
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 11
Similarity score: 0.525631

Alignment:
VBBYCAAGGTCA-
-DDCCAMAGTCHB

Original motif     Consensus sequence: VBBYCAAGGTCA Reverse complement motif     Consensus sequence: TGACCTTGMBBB


Dataset #: 1
Motif ID: 8
Motif name: Myc
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 10
Similarity score: 1.0578

Alignment:
--VGCACGTGGH
VDGACTRTGGDD

Original motif     Consensus sequence: VGCACGTGGH Reverse complement motif     Consensus sequence: DCCACGTGCV


Dataset #: 2 Motif ID: 28 Motif name: ssGCkTGCssk

Original motif     Consensus sequence: SSGCKTGCSSK Reverse complement motif     Consensus sequence: YSSGCAYGCSS

Best Matches for Top Significant Motif ID 28 (Highest to Lowest)

Dataset #: 1
Motif ID: 16
Motif name: CTCF
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 8
Number of overlap: 11
Similarity score: 0.0349439

Alignment:
YDRCCASYAGRKGGCRSYV
-------SSGCKTGCSSK-

Original motif     Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif     Consensus sequence: BMSMGCCYMCTKSTGGMHM


Dataset #: 1
Motif ID: 4
Motif name: Esrrb
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 11
Similarity score: 0.0358701

Alignment:
VBBYCAAGGTCA
-YSSGCAYGCSS

Original motif     Consensus sequence: VBBYCAAGGTCA Reverse complement motif     Consensus sequence: TGACCTTGMBBB


Dataset #: 1
Motif ID: 9
Motif name: ESR2
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 3
Number of overlap: 11
Similarity score: 0.0379074

Alignment:
VHRGGTCABDBTGMCCTB
-----YSSGCAYGCSS--

Original motif     Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif     Consensus sequence: BAGGYCABHBTGACCKHV


Dataset #: 1
Motif ID: 7
Motif name: REST
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 10
Number of overlap: 11
Similarity score: 0.0409322

Alignment:
TTCAGCACCATGGACAGCKCC
-YSSGCAYGCSS---------

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 1
Motif ID: 14
Motif name: PPARGRXRA
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 3
Number of overlap: 11
Similarity score: 0.041419

Alignment:
BTRGGDCARAGGKCA
--YSSGCAYGCSS--

Original motif     Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif     Consensus sequence: TGRCCTKTGHCCKAB


Dataset #: 1
Motif ID: 1
Motif name: HNF4A
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 3
Number of overlap: 11
Similarity score: 0.0437981

Alignment:
RGGBCAAAGKYCA
--YSSGCAYGCSS

Original motif     Consensus sequence: RGGBCAAAGKYCA Reverse complement motif     Consensus sequence: TGMYCTTTGBCCK


Dataset #: 1
Motif ID: 6
Motif name: Mycn
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 1
Number of overlap: 10
Similarity score: 0.53887

Alignment:
GCCACGTGSD-
SSGCKTGCSSK

Original motif     Consensus sequence: HSCACGTGGC Reverse complement motif     Consensus sequence: GCCACGTGSD


Dataset #: 1
Motif ID: 8
Motif name: Myc
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 1
Number of overlap: 10
Similarity score: 0.542915

Alignment:
DCCACGTGCV-
SSGCKTGCSSK

Original motif     Consensus sequence: VGCACGTGGH Reverse complement motif     Consensus sequence: DCCACGTGCV


Dataset #: 1
Motif ID: 10
Motif name: NR1H2RXRA
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 10
Number of overlap: 8
Similarity score: 1.53583

Alignment:
---AAAGGTCAAAGGTCAAC
YSSGCAYGCSS---------

Original motif     Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif     Consensus sequence: GTTGACCTTTGACCTTT


Dataset #: 1
Motif ID: 15
Motif name: Tcfcp2l1
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 7
Number of overlap: 8
Similarity score: 1.53704

Alignment:
---CCAGYYHVADCCRG
YSSGCAYGCSS------

Original motif     Consensus sequence: CCAGYYHVADCCRG Reverse complement motif     Consensus sequence: CKGGDTBDMMCTGG


Dataset #: 2 Motif ID: 24 Motif name: ssCCCCGCSssk

Original motif     Consensus sequence: SBCCCCGCCSBB Reverse complement motif     Consensus sequence: BBSGGCGGGGBS

Best Matches for Top Significant Motif ID 24 (Highest to Lowest)

Dataset #: 1
Motif ID: 3
Motif name: ESR1
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 2
Number of overlap: 12
Similarity score: 0.063076

Alignment:
MGGTCAGGGTGACCTRDBHV
-------BBSGGCGGGGBS-

Original motif     Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif     Consensus sequence: MGGTCAGGGTGACCTRDBHV


Dataset #: 1
Motif ID: 16
Motif name: CTCF
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 12
Similarity score: 0.0642087

Alignment:
YDRCCASYAGRKGGCRSYV
-BBSGGCGGGGBS------

Original motif     Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif     Consensus sequence: BMSMGCCYMCTKSTGGMHM


Dataset #: 1
Motif ID: 14
Motif name: PPARGRXRA
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 3
Number of overlap: 12
Similarity score: 0.0671548

Alignment:
TGRCCTKTGHCCKAB
-SBCCCCGCCSBB--

Original motif     Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif     Consensus sequence: TGRCCTKTGHCCKAB


Dataset #: 1
Motif ID: 9
Motif name: ESR2
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 12
Similarity score: 0.0734481

Alignment:
BAGGYCABHBTGACCKHV
-SBCCCCGCCSBB-----

Original motif     Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif     Consensus sequence: BAGGYCABHBTGACCKHV


Dataset #: 1
Motif ID: 7
Motif name: REST
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 10
Number of overlap: 12
Similarity score: 0.0751084

Alignment:
TTCAGCACCATGGACAGCKCC
BBSGGCGGGGBS---------

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 1
Motif ID: 4
Motif name: Esrrb
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 11
Similarity score: 0.571364

Alignment:
VBBYCAAGGTCA-
-BBSGGCGGGGBS

Original motif     Consensus sequence: VBBYCAAGGTCA Reverse complement motif     Consensus sequence: TGACCTTGMBBB


Dataset #: 1
Motif ID: 1
Motif name: HNF4A
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 3
Number of overlap: 11
Similarity score: 0.573202

Alignment:
-TGMYCTTTGBCCK
SBCCCCGCCSBB--

Original motif     Consensus sequence: RGGBCAAAGKYCA Reverse complement motif     Consensus sequence: TGMYCTTTGBCCK


Dataset #: 1
Motif ID: 15
Motif name: Tcfcp2l1
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 6
Number of overlap: 9
Similarity score: 1.54913

Alignment:
CKGGDTBDMMCTGG---
-----BBSGGCGGGGBS

Original motif     Consensus sequence: CCAGYYHVADCCRG Reverse complement motif     Consensus sequence: CKGGDTBDMMCTGG


Dataset #: 1
Motif ID: 6
Motif name: Mycn
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 2
Number of overlap: 9
Similarity score: 1.57507

Alignment:
---HSCACGTGGC
SBCCCCGCCSBB-

Original motif     Consensus sequence: HSCACGTGGC Reverse complement motif     Consensus sequence: GCCACGTGSD


Dataset #: 1
Motif ID: 8
Motif name: Myc
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 9
Similarity score: 1.57737

Alignment:
VGCACGTGGH---
-BBSGGCGGGGBS

Original motif     Consensus sequence: VGCACGTGGH Reverse complement motif     Consensus sequence: DCCACGTGCV


Dataset #: 2 Motif ID: 29 Motif name: cCGCGGrCACG

Original motif     Consensus sequence: CCGCGGRCACG Reverse complement motif     Consensus sequence: CGTGKCCGCGG

Best Matches for Top Significant Motif ID 29 (Highest to Lowest)

Dataset #: 1
Motif ID: 7
Motif name: REST
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 4
Number of overlap: 11
Similarity score: 0.0484441

Alignment:
TTCAGCACCATGGACAGCKCC
-------CCGCGGRCACG---

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 1
Motif ID: 3
Motif name: ESR1
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 3
Number of overlap: 11
Similarity score: 0.0486581

Alignment:
MGGTCAGGGTGACCTRDBHV
-------CGTGKCCGCGG--

Original motif     Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif     Consensus sequence: MGGTCAGGGTGACCTRDBHV


Dataset #: 1
Motif ID: 16
Motif name: CTCF
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 2
Number of overlap: 11
Similarity score: 0.0588663

Alignment:
YDRCCASYAGRKGGCRSYV
-------CCGCGGRCACG-

Original motif     Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif     Consensus sequence: BMSMGCCYMCTKSTGGMHM


Dataset #: 1
Motif ID: 14
Motif name: PPARGRXRA
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 2
Number of overlap: 11
Similarity score: 0.0629476

Alignment:
TGRCCTKTGHCCKAB
---CGTGKCCGCGG-

Original motif     Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif     Consensus sequence: TGRCCTKTGHCCKAB


Dataset #: 1
Motif ID: 9
Motif name: ESR2
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 9
Number of overlap: 10
Similarity score: 0.551597

Alignment:
BAGGYCABHBTGACCKHV-
--------CGTGKCCGCGG

Original motif     Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif     Consensus sequence: BAGGYCABHBTGACCKHV


Dataset #: 1
Motif ID: 8
Motif name: Myc
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 9
Similarity score: 1.0488

Alignment:
VGCACGTGGH--
-CGTGKCCGCGG

Original motif     Consensus sequence: VGCACGTGGH Reverse complement motif     Consensus sequence: DCCACGTGCV


Dataset #: 1
Motif ID: 6
Motif name: Mycn
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 9
Similarity score: 1.04892

Alignment:
HSCACGTGGC--
-CGTGKCCGCGG

Original motif     Consensus sequence: HSCACGTGGC Reverse complement motif     Consensus sequence: GCCACGTGSD


Dataset #: 1
Motif ID: 13
Motif name: MIZF
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 2
Number of overlap: 9
Similarity score: 1.04904

Alignment:
--BAACGTCCGC
CGTGKCCGCGG-

Original motif     Consensus sequence: BAACGTCCGC Reverse complement motif     Consensus sequence: GCGGACGTTV


Dataset #: 1
Motif ID: 4
Motif name: Esrrb
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 4
Number of overlap: 9
Similarity score: 1.05291

Alignment:
VBBYCAAGGTCA--
---CCGCGGRCACG

Original motif     Consensus sequence: VBBYCAAGGTCA Reverse complement motif     Consensus sequence: TGACCTTGMBBB


Dataset #: 1
Motif ID: 1
Motif name: HNF4A
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 6
Number of overlap: 8
Similarity score: 1.55795

Alignment:
TGMYCTTTGBCCK---
-----CGTGKCCGCGG

Original motif     Consensus sequence: RGGBCAAAGKYCA Reverse complement motif     Consensus sequence: TGMYCTTTGBCCK


Dataset #: 1 Motif ID: 4 Motif name: Esrrb

Original motif     Consensus sequence: VBBYCAAGGTCA Reverse complement motif     Consensus sequence: TGACCTTGMBBB

Best Matches for Top Significant Motif ID 4 (Highest to Lowest)

Dataset #: 2
Motif ID: 17
Motif name: TgTGgTGTCACAGTGCTCC
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 12
Similarity score: 0.0772556

Alignment:
TGTGGTGTCACAGTGCTCC
-------TGACCTTGMBBB

Original motif     Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif     Consensus sequence: GGAGCACTGTGACACCACA


Dataset #: 2
Motif ID: 23
Motif name: TGGAGCACTGTGACAcCACAGTGg
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 12
Number of overlap: 12
Similarity score: 0.0785385

Alignment:
CCACTGTGVTGTCACAGTGCTCCA
-----------TGACCTTGMBBB-

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA


Dataset #: 2
Motif ID: 22
Motif name: CACTGTGrYrtCACAGTGswsCAcT
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 11
Number of overlap: 12
Similarity score: 0.0832722

Alignment:
AGTGSWSCACTGTGAMAMCACAGTG
---VBBYCAAGGTCA----------

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG


Dataset #: 2
Motif ID: 25
Motif name: wwCCAmAGTCmt
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 2
Number of overlap: 11
Similarity score: 0.558919

Alignment:
-DDCCAMAGTCHB
VBBYCAAGGTCA-

Original motif     Consensus sequence: DDCCAMAGTCHB Reverse complement motif     Consensus sequence: VDGACTRTGGDD


Dataset #: 2
Motif ID: 28
Motif name: ssGCkTGCssk
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0.581406

Alignment:
-SSGCKTGCSSK
TGACCTTGMBBB

Original motif     Consensus sequence: SSGCKTGCSSK Reverse complement motif     Consensus sequence: YSSGCAYGCSS


Dataset #: 2
Motif ID: 24
Motif name: ssCCCCGCSssk
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 2
Number of overlap: 11
Similarity score: 0.583683

Alignment:
-SBCCCCGCCSBB
TGACCTTGMBBB-

Original motif     Consensus sequence: SBCCCCGCCSBB Reverse complement motif     Consensus sequence: BBSGGCGGGGBS


Dataset #: 2
Motif ID: 27
Motif name: AgTGCTCCACTGTGgTGTCACAgT
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 15
Number of overlap: 10
Similarity score: 1.08683

Alignment:
AGTGCTCCACTGTGGTGTCACAGT--
--------------VBBYCAAGGTCA

Original motif     Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif     Consensus sequence: ACTGTGACACCACAGTGGAGCACT


Dataset #: 2
Motif ID: 19
Motif name: atactttggc
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 10
Similarity score: 1.08726

Alignment:
--GCCAAAGTAT
VBBYCAAGGTCA

Original motif     Consensus sequence: ATACTTTGGC Reverse complement motif     Consensus sequence: GCCAAAGTAT


Dataset #: 2
Motif ID: 29
Motif name: cCGCGGrCACG
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 3
Number of overlap: 9
Similarity score: 1.57579

Alignment:
---CCGCGGRCACG
VBBYCAAGGTCA--

Original motif     Consensus sequence: CCGCGGRCACG Reverse complement motif     Consensus sequence: CGTGKCCGCGG


Dataset #: 2
Motif ID: 21
Motif name: AmTGTGACACCACAGT
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 10
Number of overlap: 7
Similarity score: 2.57595

Alignment:
-----AMTGTGACACCACAGT
VBBYCAAGGTCA---------

Original motif     Consensus sequence: AMTGTGACACCACAGT Reverse complement motif     Consensus sequence: ACTGTGGTGTCACART


Dataset #: 1 Motif ID: 13 Motif name: MIZF

Original motif     Consensus sequence: BAACGTCCGC Reverse complement motif     Consensus sequence: GCGGACGTTV

Best Matches for Top Significant Motif ID 13 (Highest to Lowest)

Dataset #: 2
Motif ID: 32
Motif name: gCGCGCsCgsG
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 10
Similarity score: 0.0651598

Alignment:
GCGCGCSCGCG
BAACGTCCGC-

Original motif     Consensus sequence: GCGCGCSCGCG Reverse complement motif     Consensus sequence: CGCGSGCGCGC


Dataset #: 2
Motif ID: 19
Motif name: atactttggc
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 10
Similarity score: 0.0803571

Alignment:
ATACTTTGGC
BAACGTCCGC

Original motif     Consensus sequence: ATACTTTGGC Reverse complement motif     Consensus sequence: GCCAAAGTAT


Dataset #: 2
Motif ID: 29
Motif name: cCGCGGrCACG
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 3
Number of overlap: 9
Similarity score: 0.560913

Alignment:
CCGCGGRCACG-
--GCGGACGTTV

Original motif     Consensus sequence: CCGCGGRCACG Reverse complement motif     Consensus sequence: CGTGKCCGCGG


Dataset #: 2
Motif ID: 31
Motif name: ctatacggacg
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 3
Number of overlap: 9
Similarity score: 0.562302

Alignment:
-CGTCCGTATAG
GCGGACGTTV--

Original motif     Consensus sequence: CTATACGGACG Reverse complement motif     Consensus sequence: CGTCCGTATAG


Dataset #: 2
Motif ID: 25
Motif name: wwCCAmAGTCmt
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 4
Number of overlap: 9
Similarity score: 0.562428

Alignment:
DDCCAMAGTCHB-
---BAACGTCCGC

Original motif     Consensus sequence: DDCCAMAGTCHB Reverse complement motif     Consensus sequence: VDGACTRTGGDD


Dataset #: 2
Motif ID: 18
Motif name: sscCCCGCGcs
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 4
Number of overlap: 8
Similarity score: 1.06446

Alignment:
SBCGCGGGGSB--
---GCGGACGTTV

Original motif     Consensus sequence: BSCCCCGCGBS Reverse complement motif     Consensus sequence: SBCGCGGGGSB


Dataset #: 2
Motif ID: 24
Motif name: ssCCCCGCSssk
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 5
Number of overlap: 8
Similarity score: 1.07197

Alignment:
BBSGGCGGGGBS--
----GCGGACGTTV

Original motif     Consensus sequence: SBCCCCGCCSBB Reverse complement motif     Consensus sequence: BBSGGCGGGGBS


Dataset #: 2
Motif ID: 33
Motif name: srACyCCGAyr
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 5
Number of overlap: 7
Similarity score: 1.55

Alignment:
SRACYCCGAYR---
----GCGGACGTTV

Original motif     Consensus sequence: SRACYCCGAYR Reverse complement motif     Consensus sequence: KKTCGGKGTKS


Dataset #: 2
Motif ID: 27
Motif name: AgTGCTCCACTGTGgTGTCACAgT
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 18
Number of overlap: 7
Similarity score: 1.5706

Alignment:
---AGTGCTCCACTGTGGTGTCACAGT
BAACGTCCGC-----------------

Original motif     Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif     Consensus sequence: ACTGTGACACCACAGTGGAGCACT


Dataset #: 2
Motif ID: 26
Motif name: CAcCACAGTGGAGCAct
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 11
Number of overlap: 7
Similarity score: 1.57176

Alignment:
CAHCACAGTGGAGCACT---
----------GCGGACGTTV

Original motif     Consensus sequence: CAHCACAGTGGAGCACT Reverse complement motif     Consensus sequence: AGTGCTCCACTGTGDTG



Significant Motifs - Global and Local Matching (Highest to Lowest)

Dataset #: 1 Motif ID: 5 Motif name: ZEB1

Original motif     Consensus sequence: CACCTD Reverse complement motif     Consensus sequence: HAGGTG

Best Matches for Significant Motif ID 5 (Highest to Lowest)

Dataset #: 1
Motif ID: 16
Motif name: CTCF
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 8
Number of overlap: 6
Similarity score: 0

Alignment:
YDRCCASYAGRKGGCRSYV
-------HAGGTG------

Original motif     Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif     Consensus sequence: BMSMGCCYMCTKSTGGMHM


Dataset #: 1
Motif ID: 12
Motif name: RORA_1
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 4
Number of overlap: 6
Similarity score: 0.00688881

Alignment:
TGACCTDVWT
-CACCTD---

Original motif     Consensus sequence: AWVDAGGTCA Reverse complement motif     Consensus sequence: TGACCTDVWT


Dataset #: 1
Motif ID: 7
Motif name: REST
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 6
Number of overlap: 6
Similarity score: 0.00707323

Alignment:
GGYGCTGTCCATGGTGCTGAA
----------HAGGTG-----

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 1
Motif ID: 4
Motif name: Esrrb
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 6
Similarity score: 0.013046

Alignment:
VBBYCAAGGTCA
-HAGGTG-----

Original motif     Consensus sequence: VBBYCAAGGTCA Reverse complement motif     Consensus sequence: TGACCTTGMBBB


Dataset #: 1
Motif ID: 10
Motif name: NR1H2RXRA
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 2
Number of overlap: 6
Similarity score: 0.0160352

Alignment:
GTTGACCTTTGACCTTT
----------CACCTD-

Original motif     Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif     Consensus sequence: GTTGACCTTTGACCTTT


Dataset #: 1
Motif ID: 14
Motif name: PPARGRXRA
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 9
Number of overlap: 6
Similarity score: 0.0192435

Alignment:
TGRCCTKTGHCCKAB
-CACCTD--------

Original motif     Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif     Consensus sequence: TGRCCTKTGHCCKAB


Dataset #: 1
Motif ID: 11
Motif name: NR4A2
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 6
Similarity score: 0.0216496

Alignment:
GTGACCTT
--CACCTD

Original motif     Consensus sequence: AAGGTCAC Reverse complement motif     Consensus sequence: GTGACCTT


Dataset #: 1
Motif ID: 3
Motif name: ESR1
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 5
Number of overlap: 6
Similarity score: 0.022947

Alignment:
MGGTCAGGGTGACCTRDBHV
----CACCTD----------

Original motif     Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif     Consensus sequence: MGGTCAGGGTGACCTRDBHV


Dataset #: 1
Motif ID: 6
Motif name: Mycn
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 3
Number of overlap: 6
Similarity score: 0.0246463

Alignment:
HSCACGTGGC
--CACCTD--

Original motif     Consensus sequence: HSCACGTGGC Reverse complement motif     Consensus sequence: GCCACGTGSD


Dataset #: 1
Motif ID: 8
Motif name: Myc
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 3
Number of overlap: 6
Similarity score: 0.025129

Alignment:
DCCACGTGCV
--HAGGTG--

Original motif     Consensus sequence: VGCACGTGGH Reverse complement motif     Consensus sequence: DCCACGTGCV


Dataset #: 2 Motif ID: 28 Motif name: ssGCkTGCssk

Original motif     Consensus sequence: SSGCKTGCSSK Reverse complement motif     Consensus sequence: YSSGCAYGCSS

Best Matches for Significant Motif ID 28 (Highest to Lowest)

Dataset #: 2
Motif ID: 32
Motif name: gCGCGCsCgsG
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0.00456539

Alignment:
GCGCGCSCGCG
SSGCKTGCSSK

Original motif     Consensus sequence: GCGCGCSCGCG Reverse complement motif     Consensus sequence: CGCGSGCGCGC


Dataset #: 2
Motif ID: 24
Motif name: ssCCCCGCSssk
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 11
Similarity score: 0.0176347

Alignment:
BBSGGCGGGGBS
-YSSGCAYGCSS

Original motif     Consensus sequence: SBCCCCGCCSBB Reverse complement motif     Consensus sequence: BBSGGCGGGGBS


Dataset #: 2
Motif ID: 18
Motif name: sscCCCGCGcs
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0.0190954

Alignment:
SBCGCGGGGSB
YSSGCAYGCSS

Original motif     Consensus sequence: BSCCCCGCGBS Reverse complement motif     Consensus sequence: SBCGCGGGGSB


Dataset #: 2
Motif ID: 29
Motif name: cCGCGGrCACG
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0.0276515

Alignment:
CCGCGGRCACG
SSGCKTGCSSK

Original motif     Consensus sequence: CCGCGGRCACG Reverse complement motif     Consensus sequence: CGTGKCCGCGG


Dataset #: 1
Motif ID: 16
Motif name: CTCF
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 8
Number of overlap: 11
Similarity score: 0.0349439

Alignment:
YDRCCASYAGRKGGCRSYV
-------SSGCKTGCSSK-

Original motif     Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif     Consensus sequence: BMSMGCCYMCTKSTGGMHM


Dataset #: 1
Motif ID: 4
Motif name: Esrrb
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0.0358701

Alignment:
VBBYCAAGGTCA
-YSSGCAYGCSS

Original motif     Consensus sequence: VBBYCAAGGTCA Reverse complement motif     Consensus sequence: TGACCTTGMBBB


Dataset #: 1
Motif ID: 9
Motif name: ESR2
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 3
Number of overlap: 11
Similarity score: 0.0379074

Alignment:
VHRGGTCABDBTGMCCTB
-----YSSGCAYGCSS--

Original motif     Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif     Consensus sequence: BAGGYCABHBTGACCKHV


Dataset #: 1
Motif ID: 7
Motif name: REST
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 10
Number of overlap: 11
Similarity score: 0.0409322

Alignment:
TTCAGCACCATGGACAGCKCC
-YSSGCAYGCSS---------

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 1
Motif ID: 14
Motif name: PPARGRXRA
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 3
Number of overlap: 11
Similarity score: 0.041419

Alignment:
BTRGGDCARAGGKCA
--YSSGCAYGCSS--

Original motif     Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif     Consensus sequence: TGRCCTKTGHCCKAB


Dataset #: 1
Motif ID: 1
Motif name: HNF4A
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0.0437981

Alignment:
RGGBCAAAGKYCA
--YSSGCAYGCSS

Original motif     Consensus sequence: RGGBCAAAGKYCA Reverse complement motif     Consensus sequence: TGMYCTTTGBCCK


Dataset #: 2 Motif ID: 25 Motif name: wwCCAmAGTCmt

Original motif     Consensus sequence: DDCCAMAGTCHB Reverse complement motif     Consensus sequence: VDGACTRTGGDD

Best Matches for Significant Motif ID 25 (Highest to Lowest)

Dataset #: 2
Motif ID: 22
Motif name: CACTGTGrYrtCACAGTGswsCAcT
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 9
Number of overlap: 12
Similarity score: 0.0263648

Alignment:
CACTGTGRTRTCACAGTGSWSCACT
--------DDCCAMAGTCHB-----

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG


Dataset #: 2
Motif ID: 20
Motif name: CagTGCTCCACTGTGgT
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 6
Number of overlap: 12
Similarity score: 0.0282828

Alignment:
ABCACAGTGGAGCACTG
VDGACTRTGGDD-----

Original motif     Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif     Consensus sequence: ABCACAGTGGAGCACTG


Dataset #: 2
Motif ID: 26
Motif name: CAcCACAGTGGAGCAct
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 6
Number of overlap: 12
Similarity score: 0.0291095

Alignment:
AGTGCTCCACTGTGDTG
-----VDGACTRTGGDD

Original motif     Consensus sequence: CAHCACAGTGGAGCACT Reverse complement motif     Consensus sequence: AGTGCTCCACTGTGDTG


Dataset #: 2
Motif ID: 27
Motif name: AgTGCTCCACTGTGgTGTCACAgT
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 6
Number of overlap: 12
Similarity score: 0.0301919

Alignment:
AGTGCTCCACTGTGGTGTCACAGT
-----VDGACTRTGGDD-------

Original motif     Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif     Consensus sequence: ACTGTGACACCACAGTGGAGCACT


Dataset #: 1
Motif ID: 1
Motif name: HNF4A
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 12
Similarity score: 0.032442

Alignment:
RGGBCAAAGKYCA
-DDCCAMAGTCHB

Original motif     Consensus sequence: RGGBCAAAGKYCA Reverse complement motif     Consensus sequence: TGMYCTTTGBCCK


Dataset #: 2
Motif ID: 23
Motif name: TGGAGCACTGTGACAcCACAGTGg
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 4
Number of overlap: 12
Similarity score: 0.0360702

Alignment:
CCACTGTGVTGTCACAGTGCTCCA
---DDCCAMAGTCHB---------

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA


Dataset #: 1
Motif ID: 7
Motif name: REST
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 4
Number of overlap: 12
Similarity score: 0.0391228

Alignment:
GGYGCTGTCCATGGTGCTGAA
---DDCCAMAGTCHB------

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 2
Motif ID: 17
Motif name: TgTGgTGTCACAGTGCTCC
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 3
Number of overlap: 12
Similarity score: 0.0393782

Alignment:
TGTGGTGTCACAGTGCTCC
-----DDCCAMAGTCHB--

Original motif     Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif     Consensus sequence: GGAGCACTGTGACACCACA


Dataset #: 1
Motif ID: 3
Motif name: ESR1
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 12
Similarity score: 0.0407304

Alignment:
VDBHMAGGTCACCCTGACCY
DDCCAMAGTCHB--------

Original motif     Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif     Consensus sequence: MGGTCAGGGTGACCTRDBHV


Dataset #: 1
Motif ID: 10
Motif name: NR1H2RXRA
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 2
Number of overlap: 12
Similarity score: 0.0463384

Alignment:
AAAGGTCAAAGGTCAAC
----DDCCAMAGTCHB-

Original motif     Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif     Consensus sequence: GTTGACCTTTGACCTTT


Dataset #: 2 Motif ID: 19 Motif name: atactttggc

Original motif     Consensus sequence: ATACTTTGGC Reverse complement motif     Consensus sequence: GCCAAAGTAT

Best Matches for Significant Motif ID 19 (Highest to Lowest)

Dataset #: 2
Motif ID: 25
Motif name: wwCCAmAGTCmt
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 10
Similarity score: 0.0215909

Alignment:
DDCCAMAGTCHB
-GCCAAAGTAT-

Original motif     Consensus sequence: DDCCAMAGTCHB Reverse complement motif     Consensus sequence: VDGACTRTGGDD


Dataset #: 2
Motif ID: 30
Motif name: taaacgatgcc
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 2
Number of overlap: 10
Similarity score: 0.0375

Alignment:
GGCATCGTTTA
GCCAAAGTAT-

Original motif     Consensus sequence: TAAACGATGCC Reverse complement motif     Consensus sequence: GGCATCGTTTA


Dataset #: 1
Motif ID: 10
Motif name: NR1H2RXRA
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 5
Number of overlap: 10
Similarity score: 0.0395

Alignment:
AAAGGTCAAAGGTCAAC
---GCCAAAGTAT----

Original motif     Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif     Consensus sequence: GTTGACCTTTGACCTTT


Dataset #: 2
Motif ID: 17
Motif name: TgTGgTGTCACAGTGCTCC
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 4
Number of overlap: 10
Similarity score: 0.0472222

Alignment:
GGAGCACTGTGACACCACA
------ATACTTTGGC---

Original motif     Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif     Consensus sequence: GGAGCACTGTGACACCACA


Dataset #: 2
Motif ID: 22
Motif name: CACTGTGrYrtCACAGTGswsCAcT
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 10
Number of overlap: 10
Similarity score: 0.0474206

Alignment:
CACTGTGRTRTCACAGTGSWSCACT
---------GCCAAAGTAT------

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG


Dataset #: 1
Motif ID: 1
Motif name: HNF4A
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 3
Number of overlap: 10
Similarity score: 0.0483209

Alignment:
TGMYCTTTGBCCK
--ATACTTTGGC-

Original motif     Consensus sequence: RGGBCAAAGKYCA Reverse complement motif     Consensus sequence: TGMYCTTTGBCCK


Dataset #: 1
Motif ID: 2
Motif name: NR2F1
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 10
Similarity score: 0.0490385

Alignment:
TGAMCTTTGMMCYT
-ATACTTTGGC---

Original motif     Consensus sequence: TGAMCTTTGMMCYT Reverse complement motif     Consensus sequence: AKGYYCAAAGRTCA


Dataset #: 2
Motif ID: 23
Motif name: TGGAGCACTGTGACAcCACAGTGg
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 11
Number of overlap: 10
Similarity score: 0.0493243

Alignment:
CCACTGTGVTGTCACAGTGCTCCA
----------GCCAAAGTAT----

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA


Dataset #: 2
Motif ID: 27
Motif name: AgTGCTCCACTGTGgTGTCACAgT
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 9
Number of overlap: 10
Similarity score: 0.0498239

Alignment:
ACTGTGACACCACAGTGGAGCACT
--------GCCAAAGTAT------

Original motif     Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif     Consensus sequence: ACTGTGACACCACAGTGGAGCACT


Dataset #: 2
Motif ID: 26
Motif name: CAcCACAGTGGAGCAct
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 2
Number of overlap: 10
Similarity score: 0.0527344

Alignment:
AGTGCTCCACTGTGDTG
------ATACTTTGGC-

Original motif     Consensus sequence: CAHCACAGTGGAGCACT Reverse complement motif     Consensus sequence: AGTGCTCCACTGTGDTG


Dataset #: 1 Motif ID: 11 Motif name: NR4A2

Original motif     Consensus sequence: AAGGTCAC Reverse complement motif     Consensus sequence: GTGACCTT

Best Matches for Significant Motif ID 11 (Highest to Lowest)

Dataset #: 1
Motif ID: 10
Motif name: NR1H2RXRA
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 9
Number of overlap: 8
Similarity score: 0.0167759

Alignment:
AAAGGTCAAAGGTCAAC
-AAGGTCAC--------

Original motif     Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif     Consensus sequence: GTTGACCTTTGACCTTT


Dataset #: 1
Motif ID: 3
Motif name: ESR1
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 5
Number of overlap: 8
Similarity score: 0.0195235

Alignment:
VDBHMAGGTCACCCTGACCY
----AAGGTCAC--------

Original motif     Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif     Consensus sequence: MGGTCAGGGTGACCTRDBHV


Dataset #: 1
Motif ID: 9
Motif name: ESR2
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 10
Number of overlap: 8
Similarity score: 0.0198372

Alignment:
BAGGYCABHBTGACCKHV
---------GTGACCTT-

Original motif     Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif     Consensus sequence: BAGGYCABHBTGACCKHV


Dataset #: 1
Motif ID: 14
Motif name: PPARGRXRA
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 7
Number of overlap: 8
Similarity score: 0.0495607

Alignment:
BTRGGDCARAGGKCA
-AAGGTCAC------

Original motif     Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif     Consensus sequence: TGRCCTKTGHCCKAB


Dataset #: 2
Motif ID: 22
Motif name: CACTGTGrYrtCACAGTGswsCAcT
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 7
Number of overlap: 8
Similarity score: 0.0557243

Alignment:
CACTGTGRTRTCACAGTGSWSCACT
------AAGGTCAC-----------

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG


Dataset #: 1
Motif ID: 2
Motif name: NR2F1
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 7
Number of overlap: 8
Similarity score: 0.0564874

Alignment:
AKGYYCAAAGRTCA
------AAGGTCAC

Original motif     Consensus sequence: TGAMCTTTGMMCYT Reverse complement motif     Consensus sequence: AKGYYCAAAGRTCA


Dataset #: 1
Motif ID: 7
Motif name: REST
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 5
Number of overlap: 8
Similarity score: 0.0594649

Alignment:
GGYGCTGTCCATGGTGCTGAA
----GTGACCTT---------

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 2
Motif ID: 23
Motif name: TGGAGCACTGTGACAcCACAGTGg
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 8
Number of overlap: 8
Similarity score: 0.060729

Alignment:
CCACTGTGVTGTCACAGTGCTCCA
-------AAGGTCAC---------

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA


Dataset #: 2
Motif ID: 21
Motif name: AmTGTGACACCACAGT
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 6
Number of overlap: 8
Similarity score: 0.0645146

Alignment:
ACTGTGGTGTCACART
-----AAGGTCAC---

Original motif     Consensus sequence: AMTGTGACACCACAGT Reverse complement motif     Consensus sequence: ACTGTGGTGTCACART


Dataset #: 2
Motif ID: 17
Motif name: TgTGgTGTCACAGTGCTCC
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 9
Number of overlap: 8
Similarity score: 0.0695512

Alignment:
TGTGGTGTCACAGTGCTCC
---AAGGTCAC--------

Original motif     Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif     Consensus sequence: GGAGCACTGTGACACCACA


Dataset #: 1 Motif ID: 4 Motif name: Esrrb

Original motif     Consensus sequence: VBBYCAAGGTCA Reverse complement motif     Consensus sequence: TGACCTTGMBBB

Best Matches for Significant Motif ID 4 (Highest to Lowest)

Dataset #: 1
Motif ID: 2
Motif name: NR2F1
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 12
Similarity score: 0.0442611

Alignment:
TGAMCTTTGMMCYT
--TGACCTTGMBBB

Original motif     Consensus sequence: TGAMCTTTGMMCYT Reverse complement motif     Consensus sequence: AKGYYCAAAGRTCA


Dataset #: 1
Motif ID: 14
Motif name: PPARGRXRA
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 4
Number of overlap: 12
Similarity score: 0.04699

Alignment:
BTRGGDCARAGGKCA
---VBBYCAAGGTCA

Original motif     Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif     Consensus sequence: TGRCCTKTGHCCKAB


Dataset #: 1
Motif ID: 1
Motif name: HNF4A
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 12
Similarity score: 0.0470808

Alignment:
RGGBCAAAGKYCA
-VBBYCAAGGTCA

Original motif     Consensus sequence: RGGBCAAAGKYCA Reverse complement motif     Consensus sequence: TGMYCTTTGBCCK


Dataset #: 1
Motif ID: 10
Motif name: NR1H2RXRA
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 3
Number of overlap: 12
Similarity score: 0.0506977

Alignment:
AAAGGTCAAAGGTCAAC
---VBBYCAAGGTCA--

Original motif     Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif     Consensus sequence: GTTGACCTTTGACCTTT


Dataset #: 1
Motif ID: 3
Motif name: ESR1
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 9
Number of overlap: 12
Similarity score: 0.0628484

Alignment:
VDBHMAGGTCACCCTGACCY
TGACCTTGMBBB--------

Original motif     Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif     Consensus sequence: MGGTCAGGGTGACCTRDBHV


Dataset #: 1
Motif ID: 9
Motif name: ESR2
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 6
Number of overlap: 12
Similarity score: 0.0694613

Alignment:
VHRGGTCABDBTGMCCTB
-----TGACCTTGMBBB-

Original motif     Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif     Consensus sequence: BAGGYCABHBTGACCKHV


Dataset #: 1
Motif ID: 7
Motif name: REST
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 5
Number of overlap: 12
Similarity score: 0.0713236

Alignment:
TTCAGCACCATGGACAGCKCC
----VBBYCAAGGTCA-----

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 2
Motif ID: 17
Motif name: TgTGgTGTCACAGTGCTCC
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 12
Similarity score: 0.0772556

Alignment:
TGTGGTGTCACAGTGCTCC
-------TGACCTTGMBBB

Original motif     Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif     Consensus sequence: GGAGCACTGTGACACCACA


Dataset #: 2
Motif ID: 23
Motif name: TGGAGCACTGTGACAcCACAGTGg
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 12
Number of overlap: 12
Similarity score: 0.0785385

Alignment:
CCACTGTGVTGTCACAGTGCTCCA
-----------TGACCTTGMBBB-

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA


Dataset #: 2
Motif ID: 22
Motif name: CACTGTGrYrtCACAGTGswsCAcT
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 4
Number of overlap: 12
Similarity score: 0.0832722

Alignment:
AGTGSWSCACTGTGAMAMCACAGTG
---VBBYCAAGGTCA----------

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG


Dataset #: 1 Motif ID: 1 Motif name: HNF4A

Original motif     Consensus sequence: RGGBCAAAGKYCA Reverse complement motif     Consensus sequence: TGMYCTTTGBCCK

Best Matches for Significant Motif ID 1 (Highest to Lowest)

Dataset #: 1
Motif ID: 14
Motif name: PPARGRXRA
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 3
Number of overlap: 13
Similarity score: 0

Alignment:
BTRGGDCARAGGKCA
--RGGBCAAAGKYCA

Original motif     Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif     Consensus sequence: TGRCCTKTGHCCKAB


Dataset #: 1
Motif ID: 2
Motif name: NR2F1
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 13
Similarity score: 0.0227413

Alignment:
AKGYYCAAAGRTCA
-RGGBCAAAGKYCA

Original motif     Consensus sequence: TGAMCTTTGMMCYT Reverse complement motif     Consensus sequence: AKGYYCAAAGRTCA


Dataset #: 1
Motif ID: 10
Motif name: NR1H2RXRA
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 3
Number of overlap: 13
Similarity score: 0.0423023

Alignment:
AAAGGTCAAAGGTCAAC
--RGGBCAAAGKYCA--

Original motif     Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif     Consensus sequence: GTTGACCTTTGACCTTT


Dataset #: 2
Motif ID: 22
Motif name: CACTGTGrYrtCACAGTGswsCAcT
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 6
Number of overlap: 13
Similarity score: 0.0557654

Alignment:
CACTGTGRTRTCACAGTGSWSCACT
-------RGGBCAAAGKYCA-----

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG


Dataset #: 2
Motif ID: 23
Motif name: TGGAGCACTGTGACAcCACAGTGg
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 4
Number of overlap: 13
Similarity score: 0.0656443

Alignment:
CCACTGTGVTGTCACAGTGCTCCA
--------RGGBCAAAGKYCA---

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA


Dataset #: 1
Motif ID: 9
Motif name: ESR2
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 3
Number of overlap: 13
Similarity score: 0.0671615

Alignment:
VHRGGTCABDBTGMCCTB
--RGGBCAAAGKYCA---

Original motif     Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif     Consensus sequence: BAGGYCABHBTGACCKHV


Dataset #: 2
Motif ID: 17
Motif name: TgTGgTGTCACAGTGCTCC
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 3
Number of overlap: 13
Similarity score: 0.0681338

Alignment:
TGTGGTGTCACAGTGCTCC
----RGGBCAAAGKYCA--

Original motif     Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif     Consensus sequence: GGAGCACTGTGACACCACA


Dataset #: 1
Motif ID: 3
Motif name: ESR1
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 1
Number of overlap: 13
Similarity score: 0.0711137

Alignment:
MGGTCAGGGTGACCTRDBHV
RGGBCAAAGKYCA-------

Original motif     Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif     Consensus sequence: MGGTCAGGGTGACCTRDBHV


Dataset #: 1
Motif ID: 7
Motif name: REST
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 6
Number of overlap: 13
Similarity score: 0.0741922

Alignment:
GGYGCTGTCCATGGTGCTGAA
-----TGMYCTTTGBCCK---

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 2
Motif ID: 27
Motif name: AgTGCTCCACTGTGgTGTCACAgT
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 6
Number of overlap: 13
Similarity score: 0.0799096

Alignment:
ACTGTGACACCACAGTGGAGCACT
------RGGBCAAAGKYCA-----

Original motif     Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif     Consensus sequence: ACTGTGACACCACAGTGGAGCACT


Dataset #: 1
Motif ID: 16
Motif name: CTCF
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 4
Number of overlap: 13
Similarity score: 0.0850642

Alignment:
YDRCCASYAGRKGGCRSYV
---RGGBCAAAGKYCA---

Original motif     Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif     Consensus sequence: BMSMGCCYMCTKSTGGMHM


Dataset #: 1 Motif ID: 12 Motif name: RORA_1

Original motif     Consensus sequence: AWVDAGGTCA Reverse complement motif     Consensus sequence: TGACCTDVWT

Best Matches for Significant Motif ID 12 (Highest to Lowest)

Dataset #: 1
Motif ID: 4
Motif name: Esrrb
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 10
Similarity score: 0.029401

Alignment:
VBBYCAAGGTCA
--AWVDAGGTCA

Original motif     Consensus sequence: VBBYCAAGGTCA Reverse complement motif     Consensus sequence: TGACCTTGMBBB


Dataset #: 1
Motif ID: 3
Motif name: ESR1
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 2
Number of overlap: 10
Similarity score: 0.0417851

Alignment:
MGGTCAGGGTGACCTRDBHV
---------TGACCTDVWT-

Original motif     Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif     Consensus sequence: MGGTCAGGGTGACCTRDBHV


Dataset #: 1
Motif ID: 10
Motif name: NR1H2RXRA
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 6
Number of overlap: 10
Similarity score: 0.05425

Alignment:
AAAGGTCAAAGGTCAAC
-----AWVDAGGTCA--

Original motif     Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif     Consensus sequence: GTTGACCTTTGACCTTT


Dataset #: 1
Motif ID: 2
Motif name: NR2F1
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 5
Number of overlap: 10
Similarity score: 0.0654808

Alignment:
TGAMCTTTGMMCYT
----TGACCTDVWT

Original motif     Consensus sequence: TGAMCTTTGMMCYT Reverse complement motif     Consensus sequence: AKGYYCAAAGRTCA


Dataset #: 1
Motif ID: 14
Motif name: PPARGRXRA
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 10
Similarity score: 0.06668

Alignment:
BTRGGDCARAGGKCA
-----AWVDAGGTCA

Original motif     Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif     Consensus sequence: TGRCCTKTGHCCKAB


Dataset #: 1
Motif ID: 7
Motif name: REST
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 7
Number of overlap: 10
Similarity score: 0.0755608

Alignment:
TTCAGCACCATGGACAGCKCC
------AWVDAGGTCA-----

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 1
Motif ID: 1
Motif name: HNF4A
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 4
Number of overlap: 10
Similarity score: 0.0803396

Alignment:
RGGBCAAAGKYCA
---AWVDAGGTCA

Original motif     Consensus sequence: RGGBCAAAGKYCA Reverse complement motif     Consensus sequence: TGMYCTTTGBCCK


Dataset #: 2
Motif ID: 17
Motif name: TgTGgTGTCACAGTGCTCC
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 10
Number of overlap: 10
Similarity score: 0.0889306

Alignment:
GGAGCACTGTGACACCACA
---------TGACCTDVWT

Original motif     Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif     Consensus sequence: GGAGCACTGTGACACCACA


Dataset #: 2
Motif ID: 25
Motif name: wwCCAmAGTCmt
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 2
Number of overlap: 10
Similarity score: 0.09225

Alignment:
DDCCAMAGTCHB
-AWVDAGGTCA-

Original motif     Consensus sequence: DDCCAMAGTCHB Reverse complement motif     Consensus sequence: VDGACTRTGGDD


Dataset #: 1
Motif ID: 9
Motif name: ESR2
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 4
Number of overlap: 10
Similarity score: 0.0988214

Alignment:
BAGGYCABHBTGACCKHV
-----AWVDAGGTCA---

Original motif     Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif     Consensus sequence: BAGGYCABHBTGACCKHV


Dataset #: 1 Motif ID: 6 Motif name: Mycn

Original motif     Consensus sequence: HSCACGTGGC Reverse complement motif     Consensus sequence: GCCACGTGSD

Best Matches for Significant Motif ID 6 (Highest to Lowest)

Dataset #: 1
Motif ID: 8
Motif name: Myc
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 1
Number of overlap: 10
Similarity score: 0

Alignment:
DCCACGTGCV
GCCACGTGSD

Original motif     Consensus sequence: VGCACGTGGH Reverse complement motif     Consensus sequence: DCCACGTGCV


Dataset #: 2
Motif ID: 18
Motif name: sscCCCGCGcs
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 10
Similarity score: 0.0654819

Alignment:
BSCCCCGCGBS
-GCCACGTGSD

Original motif     Consensus sequence: BSCCCCGCGBS Reverse complement motif     Consensus sequence: SBCGCGGGGSB


Dataset #: 1
Motif ID: 16
Motif name: CTCF
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 6
Number of overlap: 10
Similarity score: 0.0679017

Alignment:
YDRCCASYAGRKGGCRSYV
-----HSCACGTGGC----

Original motif     Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif     Consensus sequence: BMSMGCCYMCTKSTGGMHM


Dataset #: 2
Motif ID: 24
Motif name: ssCCCCGCSssk
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 10
Similarity score: 0.0704988

Alignment:
BBSGGCGGGGBS
-HSCACGTGGC-

Original motif     Consensus sequence: SBCCCCGCCSBB Reverse complement motif     Consensus sequence: BBSGGCGGGGBS


Dataset #: 2
Motif ID: 22
Motif name: CACTGTGrYrtCACAGTGswsCAcT
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 10
Number of overlap: 10
Similarity score: 0.0883224

Alignment:
AGTGSWSCACTGTGAMAMCACAGTG
------GCCACGTGSD---------

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG


Dataset #: 1
Motif ID: 3
Motif name: ESR1
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 3
Number of overlap: 10
Similarity score: 0.089863

Alignment:
MGGTCAGGGTGACCTRDBHV
--------GCCACGTGSD--

Original motif     Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif     Consensus sequence: MGGTCAGGGTGACCTRDBHV


Dataset #: 2
Motif ID: 20
Motif name: CagTGCTCCACTGTGgT
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 7
Number of overlap: 10
Similarity score: 0.0943014

Alignment:
ABCACAGTGGAGCACTG
-GCCACGTGSD------

Original motif     Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif     Consensus sequence: ABCACAGTGGAGCACTG


Dataset #: 1
Motif ID: 1
Motif name: HNF4A
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 10
Similarity score: 0.0947124

Alignment:
TGMYCTTTGBCCK
-GCCACGTGSD--

Original motif     Consensus sequence: RGGBCAAAGKYCA Reverse complement motif     Consensus sequence: TGMYCTTTGBCCK


Dataset #: 2
Motif ID: 27
Motif name: AgTGCTCCACTGTGgTGTCACAgT
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 6
Number of overlap: 10
Similarity score: 0.0949359

Alignment:
ACTGTGACACCACAGTGGAGCACT
---------GCCACGTGSD-----

Original motif     Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif     Consensus sequence: ACTGTGACACCACAGTGGAGCACT


Dataset #: 1
Motif ID: 14
Motif name: PPARGRXRA
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 5
Number of overlap: 10
Similarity score: 0.0954444

Alignment:
TGRCCTKTGHCCKAB
-GCCACGTGSD----

Original motif     Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif     Consensus sequence: TGRCCTKTGHCCKAB


Dataset #: 1 Motif ID: 8 Motif name: Myc

Original motif     Consensus sequence: VGCACGTGGH Reverse complement motif     Consensus sequence: DCCACGTGCV

Best Matches for Significant Motif ID 8 (Highest to Lowest)

Dataset #: 1
Motif ID: 6
Motif name: Mycn
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 10
Similarity score: 0

Alignment:
HSCACGTGGC
VGCACGTGGH

Original motif     Consensus sequence: HSCACGTGGC Reverse complement motif     Consensus sequence: GCCACGTGSD


Dataset #: 2
Motif ID: 18
Motif name: sscCCCGCGcs
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 10
Similarity score: 0.064853

Alignment:
BSCCCCGCGBS
-DCCACGTGCV

Original motif     Consensus sequence: BSCCCCGCGBS Reverse complement motif     Consensus sequence: SBCGCGGGGSB


Dataset #: 2
Motif ID: 24
Motif name: ssCCCCGCSssk
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 2
Number of overlap: 10
Similarity score: 0.0728588

Alignment:
SBCCCCGCCSBB
-DCCACGTGCV-

Original motif     Consensus sequence: SBCCCCGCCSBB Reverse complement motif     Consensus sequence: BBSGGCGGGGBS


Dataset #: 1
Motif ID: 16
Motif name: CTCF
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 8
Number of overlap: 10
Similarity score: 0.0754257

Alignment:
YDRCCASYAGRKGGCRSYV
--DCCACGTGCV-------

Original motif     Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif     Consensus sequence: BMSMGCCYMCTKSTGGMHM


Dataset #: 2
Motif ID: 22
Motif name: CACTGTGrYrtCACAGTGswsCAcT
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 6
Number of overlap: 10
Similarity score: 0.0888909

Alignment:
CACTGTGRTRTCACAGTGSWSCACT
----------DCCACGTGCV-----

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG


Dataset #: 1
Motif ID: 1
Motif name: HNF4A
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 10
Similarity score: 0.0934488

Alignment:
TGMYCTTTGBCCK
---VGCACGTGGH

Original motif     Consensus sequence: RGGBCAAAGKYCA Reverse complement motif     Consensus sequence: TGMYCTTTGBCCK


Dataset #: 1
Motif ID: 3
Motif name: ESR1
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 9
Number of overlap: 10
Similarity score: 0.0940438

Alignment:
MGGTCAGGGTGACCTRDBHV
--------DCCACGTGCV--

Original motif     Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif     Consensus sequence: MGGTCAGGGTGACCTRDBHV


Dataset #: 2
Motif ID: 20
Motif name: CagTGCTCCACTGTGgT
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 7
Number of overlap: 10
Similarity score: 0.0955234

Alignment:
ABCACAGTGGAGCACTG
-DCCACGTGCV------

Original motif     Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif     Consensus sequence: ABCACAGTGGAGCACTG


Dataset #: 1
Motif ID: 9
Motif name: ESR2
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 5
Number of overlap: 10
Similarity score: 0.0968598

Alignment:
VHRGGTCABDBTGMCCTB
----VGCACGTGGH----

Original motif     Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif     Consensus sequence: BAGGYCABHBTGACCKHV


Dataset #: 2
Motif ID: 23
Motif name: TGGAGCACTGTGACAcCACAGTGg
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 11
Number of overlap: 10
Similarity score: 0.0971125

Alignment:
TGGAGCACTGTGACAVCACAGTGG
----DCCACGTGCV----------

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA



Best Matches for Each Motif (Highest to Lowest)

Dataset #: 1 Motif ID: 1 Motif name: HNF4A

Original motif     Consensus sequence: RGGBCAAAGKYCA Reverse complement motif     Consensus sequence: TGMYCTTTGBCCK

Best Matches for Motif ID 1 (Highest to Lowest)

Dataset #: 1
Motif ID: 14
Motif name: PPARGRXRA
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 3
Number of overlap: 13
Similarity score: 0

Alignment:
BTRGGDCARAGGKCA
--RGGBCAAAGKYCA

Original motif     Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif     Consensus sequence: TGRCCTKTGHCCKAB


Dataset #: 1
Motif ID: 2
Motif name: NR2F1
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 13
Similarity score: 0.0227413

Alignment:
AKGYYCAAAGRTCA
-RGGBCAAAGKYCA

Original motif     Consensus sequence: TGAMCTTTGMMCYT Reverse complement motif     Consensus sequence: AKGYYCAAAGRTCA


Dataset #: 1
Motif ID: 10
Motif name: NR1H2RXRA
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 3
Number of overlap: 13
Similarity score: 0.0423023

Alignment:
AAAGGTCAAAGGTCAAC
--RGGBCAAAGKYCA--

Original motif     Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif     Consensus sequence: GTTGACCTTTGACCTTT


Dataset #: 2
Motif ID: 22
Motif name: CACTGTGrYrtCACAGTGswsCAcT
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 6
Number of overlap: 13
Similarity score: 0.0557654

Alignment:
CACTGTGRTRTCACAGTGSWSCACT
-------RGGBCAAAGKYCA-----

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG


Dataset #: 2
Motif ID: 23
Motif name: TGGAGCACTGTGACAcCACAGTGg
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 4
Number of overlap: 13
Similarity score: 0.0656443

Alignment:
CCACTGTGVTGTCACAGTGCTCCA
--------RGGBCAAAGKYCA---

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA


Dataset #: 1
Motif ID: 9
Motif name: ESR2
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 3
Number of overlap: 13
Similarity score: 0.0671615

Alignment:
VHRGGTCABDBTGMCCTB
--RGGBCAAAGKYCA---

Original motif     Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif     Consensus sequence: BAGGYCABHBTGACCKHV


Dataset #: 2
Motif ID: 17
Motif name: TgTGgTGTCACAGTGCTCC
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 3
Number of overlap: 13
Similarity score: 0.0681338

Alignment:
TGTGGTGTCACAGTGCTCC
----RGGBCAAAGKYCA--

Original motif     Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif     Consensus sequence: GGAGCACTGTGACACCACA


Dataset #: 1
Motif ID: 3
Motif name: ESR1
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 1
Number of overlap: 13
Similarity score: 0.0711137

Alignment:
MGGTCAGGGTGACCTRDBHV
RGGBCAAAGKYCA-------

Original motif     Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif     Consensus sequence: MGGTCAGGGTGACCTRDBHV


Dataset #: 1
Motif ID: 7
Motif name: REST
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 6
Number of overlap: 13
Similarity score: 0.0741922

Alignment:
GGYGCTGTCCATGGTGCTGAA
-----TGMYCTTTGBCCK---

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 2
Motif ID: 27
Motif name: AgTGCTCCACTGTGgTGTCACAgT
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 6
Number of overlap: 13
Similarity score: 0.0799096

Alignment:
ACTGTGACACCACAGTGGAGCACT
------RGGBCAAAGKYCA-----

Original motif     Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif     Consensus sequence: ACTGTGACACCACAGTGGAGCACT


Dataset #: 1
Motif ID: 16
Motif name: CTCF
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 4
Number of overlap: 13
Similarity score: 0.0850642

Alignment:
YDRCCASYAGRKGGCRSYV
---RGGBCAAAGKYCA---

Original motif     Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif     Consensus sequence: BMSMGCCYMCTKSTGGMHM


Dataset #: 1 Motif ID: 2 Motif name: NR2F1

Original motif     Consensus sequence: TGAMCTTTGMMCYT Reverse complement motif     Consensus sequence: AKGYYCAAAGRTCA

Best Matches for Motif ID 2 (Highest to Lowest)

Dataset #: 1
Motif ID: 10
Motif name: NR1H2RXRA
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 2
Number of overlap: 14
Similarity score: 0.0174588

Alignment:
GTTGACCTTTGACCTTT
--TGAMCTTTGMMCYT-

Original motif     Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif     Consensus sequence: GTTGACCTTTGACCTTT


Dataset #: 1
Motif ID: 14
Motif name: PPARGRXRA
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 2
Number of overlap: 14
Similarity score: 0.0278283

Alignment:
TGRCCTKTGHCCKAB
TGAMCTTTGMMCYT-

Original motif     Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif     Consensus sequence: TGRCCTKTGHCCKAB


Dataset #: 2
Motif ID: 22
Motif name: CACTGTGrYrtCACAGTGswsCAcT
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 7
Number of overlap: 14
Similarity score: 0.0597647

Alignment:
AGTGSWSCACTGTGAMAMCACAGTG
-----TGAMCTTTGMMCYT------

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG


Dataset #: 1
Motif ID: 9
Motif name: ESR2
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 2
Number of overlap: 14
Similarity score: 0.0710475

Alignment:
BAGGYCABHBTGACCKHV
---TGAMCTTTGMMCYT-

Original motif     Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif     Consensus sequence: BAGGYCABHBTGACCKHV


Dataset #: 1
Motif ID: 7
Motif name: REST
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 6
Number of overlap: 14
Similarity score: 0.071796

Alignment:
TTCAGCACCATGGACAGCKCC
--AKGYYCAAAGRTCA-----

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 2
Motif ID: 23
Motif name: TGGAGCACTGTGACAcCACAGTGg
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 8
Number of overlap: 14
Similarity score: 0.0737285

Alignment:
TGGAGCACTGTGACAVCACAGTGG
---TGAMCTTTGMMCYT-------

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA


Dataset #: 2
Motif ID: 17
Motif name: TgTGgTGTCACAGTGCTCC
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 4
Number of overlap: 14
Similarity score: 0.0739698

Alignment:
GGAGCACTGTGACACCACA
--TGAMCTTTGMMCYT---

Original motif     Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif     Consensus sequence: GGAGCACTGTGACACCACA


Dataset #: 1
Motif ID: 1
Motif name: HNF4A
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 13
Similarity score: 0.514048

Alignment:
-TGMYCTTTGBCCK
TGAMCTTTGMMCYT

Original motif     Consensus sequence: RGGBCAAAGKYCA Reverse complement motif     Consensus sequence: TGMYCTTTGBCCK


Dataset #: 1
Motif ID: 3
Motif name: ESR1
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 8
Number of overlap: 13
Similarity score: 0.569869

Alignment:
VDBHMAGGTCACCCTGACCY-
-------TGAMCTTTGMMCYT

Original motif     Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif     Consensus sequence: MGGTCAGGGTGACCTRDBHV


Dataset #: 1
Motif ID: 4
Motif name: Esrrb
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 12
Similarity score: 1.0303

Alignment:
--VBBYCAAGGTCA
AKGYYCAAAGRTCA

Original motif     Consensus sequence: VBBYCAAGGTCA Reverse complement motif     Consensus sequence: TGACCTTGMBBB


Dataset #: 1 Motif ID: 3 Motif name: ESR1

Original motif     Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif     Consensus sequence: MGGTCAGGGTGACCTRDBHV

Best Matches for Motif ID 3 (Highest to Lowest)

Dataset #: 2
Motif ID: 23
Motif name: TGGAGCACTGTGACAcCACAGTGg
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 2
Number of overlap: 20
Similarity score: 0.0722586

Alignment:
CCACTGTGVTGTCACAGTGCTCCA
---VDBHMAGGTCACCCTGACCY-

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA


Dataset #: 2
Motif ID: 22
Motif name: CACTGTGrYrtCACAGTGswsCAcT
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 3
Number of overlap: 20
Similarity score: 0.0818971

Alignment:
CACTGTGRTRTCACAGTGSWSCACT
--VDBHMAGGTCACCCTGACCY---

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG


Dataset #: 2
Motif ID: 17
Motif name: TgTGgTGTCACAGTGCTCC
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 19
Similarity score: 0.566376

Alignment:
-TGTGGTGTCACAGTGCTCC
VDBHMAGGTCACCCTGACCY

Original motif     Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif     Consensus sequence: GGAGCACTGTGACACCACA


Dataset #: 1
Motif ID: 16
Motif name: CTCF
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 19
Similarity score: 0.579928

Alignment:
-BMSMGCCYMCTKSTGGMHM
VDBHMAGGTCACCCTGACCY

Original motif     Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif     Consensus sequence: BMSMGCCYMCTKSTGGMHM


Dataset #: 1
Motif ID: 9
Motif name: ESR2
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 2
Number of overlap: 17
Similarity score: 1.50287

Alignment:
---VHRGGTCABDBTGMCCTB
VDBHMAGGTCACCCTGACCY-

Original motif     Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif     Consensus sequence: BAGGYCABHBTGACCKHV


Dataset #: 1
Motif ID: 7
Motif name: REST
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 6
Number of overlap: 16
Similarity score: 2.07409

Alignment:
TTCAGCACCATGGACAGCKCC----
-----VDBHMAGGTCACCCTGACCY

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 2
Motif ID: 21
Motif name: AmTGTGACACCACAGT
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 15
Similarity score: 2.57517

Alignment:
ACTGTGGTGTCACART-----
-VDBHMAGGTCACCCTGACCY

Original motif     Consensus sequence: AMTGTGACACCACAGT Reverse complement motif     Consensus sequence: ACTGTGGTGTCACART


Dataset #: 2
Motif ID: 27
Motif name: AgTGCTCCACTGTGgTGTCACAgT
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 10
Number of overlap: 15
Similarity score: 2.57594

Alignment:
-----ACTGTGACACCACAGTGGAGCACT
MGGTCAGGGTGACCTRDBHV---------

Original motif     Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif     Consensus sequence: ACTGTGACACCACAGTGGAGCACT


Dataset #: 1
Motif ID: 14
Motif name: PPARGRXRA
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 2
Number of overlap: 14
Similarity score: 3.07055

Alignment:
------BTRGGDCARAGGKCA
MGGTCAGGGTGACCTRDBHV-

Original motif     Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif     Consensus sequence: TGRCCTKTGHCCKAB


Dataset #: 1
Motif ID: 10
Motif name: NR1H2RXRA
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 5
Number of overlap: 13
Similarity score: 3.5678

Alignment:
AAAGGTCAAAGGTCAAC-------
----VDBHMAGGTCACCCTGACCY

Original motif     Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif     Consensus sequence: GTTGACCTTTGACCTTT


Dataset #: 1 Motif ID: 4 Motif name: Esrrb

Original motif     Consensus sequence: VBBYCAAGGTCA Reverse complement motif     Consensus sequence: TGACCTTGMBBB

Best Matches for Motif ID 4 (Highest to Lowest)

Dataset #: 1
Motif ID: 2
Motif name: NR2F1
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 12
Similarity score: 0.0442611

Alignment:
TGAMCTTTGMMCYT
--TGACCTTGMBBB

Original motif     Consensus sequence: TGAMCTTTGMMCYT Reverse complement motif     Consensus sequence: AKGYYCAAAGRTCA


Dataset #: 1
Motif ID: 14
Motif name: PPARGRXRA
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 4
Number of overlap: 12
Similarity score: 0.04699

Alignment:
BTRGGDCARAGGKCA
---VBBYCAAGGTCA

Original motif     Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif     Consensus sequence: TGRCCTKTGHCCKAB


Dataset #: 1
Motif ID: 1
Motif name: HNF4A
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 12
Similarity score: 0.0470808

Alignment:
RGGBCAAAGKYCA
-VBBYCAAGGTCA

Original motif     Consensus sequence: RGGBCAAAGKYCA Reverse complement motif     Consensus sequence: TGMYCTTTGBCCK


Dataset #: 1
Motif ID: 10
Motif name: NR1H2RXRA
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 3
Number of overlap: 12
Similarity score: 0.0506977

Alignment:
AAAGGTCAAAGGTCAAC
---VBBYCAAGGTCA--

Original motif     Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif     Consensus sequence: GTTGACCTTTGACCTTT


Dataset #: 1
Motif ID: 3
Motif name: ESR1
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 9
Number of overlap: 12
Similarity score: 0.0628484

Alignment:
VDBHMAGGTCACCCTGACCY
TGACCTTGMBBB--------

Original motif     Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif     Consensus sequence: MGGTCAGGGTGACCTRDBHV


Dataset #: 1
Motif ID: 9
Motif name: ESR2
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 6
Number of overlap: 12
Similarity score: 0.0694613

Alignment:
VHRGGTCABDBTGMCCTB
-----TGACCTTGMBBB-

Original motif     Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif     Consensus sequence: BAGGYCABHBTGACCKHV


Dataset #: 1
Motif ID: 7
Motif name: REST
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 5
Number of overlap: 12
Similarity score: 0.0713236

Alignment:
TTCAGCACCATGGACAGCKCC
----VBBYCAAGGTCA-----

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 2
Motif ID: 17
Motif name: TgTGgTGTCACAGTGCTCC
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 12
Similarity score: 0.0772556

Alignment:
TGTGGTGTCACAGTGCTCC
-------TGACCTTGMBBB

Original motif     Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif     Consensus sequence: GGAGCACTGTGACACCACA


Dataset #: 2
Motif ID: 23
Motif name: TGGAGCACTGTGACAcCACAGTGg
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 12
Number of overlap: 12
Similarity score: 0.0785385

Alignment:
CCACTGTGVTGTCACAGTGCTCCA
-----------TGACCTTGMBBB-

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA


Dataset #: 2
Motif ID: 22
Motif name: CACTGTGrYrtCACAGTGswsCAcT
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 4
Number of overlap: 12
Similarity score: 0.0832722

Alignment:
AGTGSWSCACTGTGAMAMCACAGTG
---VBBYCAAGGTCA----------

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG


Dataset #: 1 Motif ID: 5 Motif name: ZEB1

Original motif     Consensus sequence: CACCTD Reverse complement motif     Consensus sequence: HAGGTG

Best Matches for Motif ID 5 (Highest to Lowest)

Dataset #: 1
Motif ID: 16
Motif name: CTCF
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 8
Number of overlap: 6
Similarity score: 0

Alignment:
YDRCCASYAGRKGGCRSYV
-------HAGGTG------

Original motif     Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif     Consensus sequence: BMSMGCCYMCTKSTGGMHM


Dataset #: 1
Motif ID: 12
Motif name: RORA_1
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 4
Number of overlap: 6
Similarity score: 0.00688881

Alignment:
TGACCTDVWT
-CACCTD---

Original motif     Consensus sequence: AWVDAGGTCA Reverse complement motif     Consensus sequence: TGACCTDVWT


Dataset #: 1
Motif ID: 7
Motif name: REST
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 6
Number of overlap: 6
Similarity score: 0.00707323

Alignment:
GGYGCTGTCCATGGTGCTGAA
----------HAGGTG-----

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 1
Motif ID: 4
Motif name: Esrrb
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 6
Similarity score: 0.013046

Alignment:
VBBYCAAGGTCA
-HAGGTG-----

Original motif     Consensus sequence: VBBYCAAGGTCA Reverse complement motif     Consensus sequence: TGACCTTGMBBB


Dataset #: 1
Motif ID: 10
Motif name: NR1H2RXRA
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 2
Number of overlap: 6
Similarity score: 0.0160352

Alignment:
GTTGACCTTTGACCTTT
----------CACCTD-

Original motif     Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif     Consensus sequence: GTTGACCTTTGACCTTT


Dataset #: 1
Motif ID: 14
Motif name: PPARGRXRA
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 9
Number of overlap: 6
Similarity score: 0.0192435

Alignment:
TGRCCTKTGHCCKAB
-CACCTD--------

Original motif     Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif     Consensus sequence: TGRCCTKTGHCCKAB


Dataset #: 1
Motif ID: 11
Motif name: NR4A2
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 6
Similarity score: 0.0216496

Alignment:
GTGACCTT
--CACCTD

Original motif     Consensus sequence: AAGGTCAC Reverse complement motif     Consensus sequence: GTGACCTT


Dataset #: 1
Motif ID: 3
Motif name: ESR1
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 5
Number of overlap: 6
Similarity score: 0.022947

Alignment:
MGGTCAGGGTGACCTRDBHV
----CACCTD----------

Original motif     Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif     Consensus sequence: MGGTCAGGGTGACCTRDBHV


Dataset #: 1
Motif ID: 6
Motif name: Mycn
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 3
Number of overlap: 6
Similarity score: 0.0246463

Alignment:
HSCACGTGGC
--CACCTD--

Original motif     Consensus sequence: HSCACGTGGC Reverse complement motif     Consensus sequence: GCCACGTGSD


Dataset #: 1
Motif ID: 8
Motif name: Myc
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 3
Number of overlap: 6
Similarity score: 0.025129

Alignment:
DCCACGTGCV
--HAGGTG--

Original motif     Consensus sequence: VGCACGTGGH Reverse complement motif     Consensus sequence: DCCACGTGCV


Dataset #: 1 Motif ID: 6 Motif name: Mycn

Original motif     Consensus sequence: HSCACGTGGC Reverse complement motif     Consensus sequence: GCCACGTGSD

Best Matches for Motif ID 6 (Highest to Lowest)

Dataset #: 1
Motif ID: 8
Motif name: Myc
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 1
Number of overlap: 10
Similarity score: 0

Alignment:
DCCACGTGCV
GCCACGTGSD

Original motif     Consensus sequence: VGCACGTGGH Reverse complement motif     Consensus sequence: DCCACGTGCV


Dataset #: 2
Motif ID: 18
Motif name: sscCCCGCGcs
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 10
Similarity score: 0.0654819

Alignment:
BSCCCCGCGBS
-GCCACGTGSD

Original motif     Consensus sequence: BSCCCCGCGBS Reverse complement motif     Consensus sequence: SBCGCGGGGSB


Dataset #: 1
Motif ID: 16
Motif name: CTCF
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 6
Number of overlap: 10
Similarity score: 0.0679017

Alignment:
YDRCCASYAGRKGGCRSYV
-----HSCACGTGGC----

Original motif     Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif     Consensus sequence: BMSMGCCYMCTKSTGGMHM


Dataset #: 2
Motif ID: 24
Motif name: ssCCCCGCSssk
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 10
Similarity score: 0.0704988

Alignment:
BBSGGCGGGGBS
-HSCACGTGGC-

Original motif     Consensus sequence: SBCCCCGCCSBB Reverse complement motif     Consensus sequence: BBSGGCGGGGBS


Dataset #: 2
Motif ID: 22
Motif name: CACTGTGrYrtCACAGTGswsCAcT
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 10
Number of overlap: 10
Similarity score: 0.0883224

Alignment:
AGTGSWSCACTGTGAMAMCACAGTG
------GCCACGTGSD---------

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG


Dataset #: 1
Motif ID: 3
Motif name: ESR1
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 3
Number of overlap: 10
Similarity score: 0.089863

Alignment:
MGGTCAGGGTGACCTRDBHV
--------GCCACGTGSD--

Original motif     Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif     Consensus sequence: MGGTCAGGGTGACCTRDBHV


Dataset #: 2
Motif ID: 20
Motif name: CagTGCTCCACTGTGgT
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 7
Number of overlap: 10
Similarity score: 0.0943014

Alignment:
ABCACAGTGGAGCACTG
-GCCACGTGSD------

Original motif     Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif     Consensus sequence: ABCACAGTGGAGCACTG


Dataset #: 1
Motif ID: 1
Motif name: HNF4A
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 10
Similarity score: 0.0947124

Alignment:
TGMYCTTTGBCCK
-GCCACGTGSD--

Original motif     Consensus sequence: RGGBCAAAGKYCA Reverse complement motif     Consensus sequence: TGMYCTTTGBCCK


Dataset #: 2
Motif ID: 27
Motif name: AgTGCTCCACTGTGgTGTCACAgT
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 6
Number of overlap: 10
Similarity score: 0.0949359

Alignment:
ACTGTGACACCACAGTGGAGCACT
---------GCCACGTGSD-----

Original motif     Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif     Consensus sequence: ACTGTGACACCACAGTGGAGCACT


Dataset #: 1
Motif ID: 14
Motif name: PPARGRXRA
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 5
Number of overlap: 10
Similarity score: 0.0954444

Alignment:
TGRCCTKTGHCCKAB
-GCCACGTGSD----

Original motif     Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif     Consensus sequence: TGRCCTKTGHCCKAB


Dataset #: 1 Motif ID: 7 Motif name: REST

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA

Best Matches for Motif ID 7 (Highest to Lowest)

Dataset #: 2
Motif ID: 27
Motif name: AgTGCTCCACTGTGgTGTCACAgT
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 6
Number of overlap: 19
Similarity score: 0.0605225

Alignment:
--AGTGCTCCACTGTGGTGTCACAGT
GGYGCTGTCCATGGTGCTGAA-----

Original motif     Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif     Consensus sequence: ACTGTGACACCACAGTGGAGCACT


Dataset #: 1
Motif ID: 3
Motif name: ESR1
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 5
Number of overlap: 16
Similarity score: 1.56264

Alignment:
-----VDBHMAGGTCACCCTGACCY
TTCAGCACCATGGACAGCKCC----

Original motif     Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif     Consensus sequence: MGGTCAGGGTGACCTRDBHV


Dataset #: 2
Motif ID: 20
Motif name: CagTGCTCCACTGTGgT
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 4
Number of overlap: 14
Similarity score: 2.57032

Alignment:
-------ABCACAGTGGAGCACTG
GGYGCTGTCCATGGTGCTGAA---

Original motif     Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif     Consensus sequence: ABCACAGTGGAGCACTG


Dataset #: 2
Motif ID: 21
Motif name: AmTGTGACACCACAGT
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 3
Number of overlap: 14
Similarity score: 2.57054

Alignment:
ACTGTGGTGTCACART-------
--GGYGCTGTCCATGGTGCTGAA

Original motif     Consensus sequence: AMTGTGACACCACAGT Reverse complement motif     Consensus sequence: ACTGTGGTGTCACART


Dataset #: 2
Motif ID: 23
Motif name: TGGAGCACTGTGACAcCACAGTGg
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 12
Number of overlap: 13
Similarity score: 3.04841

Alignment:
TGGAGCACTGTGACAVCACAGTGG--------
-----------TTCAGCACCATGGACAGCKCC

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA


Dataset #: 1
Motif ID: 9
Motif name: ESR2
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 6
Number of overlap: 13
Similarity score: 3.05156

Alignment:
BAGGYCABHBTGACCKHV--------
-----GGYGCTGTCCATGGTGCTGAA

Original motif     Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif     Consensus sequence: BAGGYCABHBTGACCKHV


Dataset #: 1
Motif ID: 1
Motif name: HNF4A
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 1
Number of overlap: 13
Similarity score: 3.06375

Alignment:
TGMYCTTTGBCCK--------
GGYGCTGTCCATGGTGCTGAA

Original motif     Consensus sequence: RGGBCAAAGKYCA Reverse complement motif     Consensus sequence: TGMYCTTTGBCCK


Dataset #: 1
Motif ID: 14
Motif name: PPARGRXRA
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 3
Number of overlap: 13
Similarity score: 3.06574

Alignment:
--------BTRGGDCARAGGKCA
TTCAGCACCATGGACAGCKCC--

Original motif     Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif     Consensus sequence: TGRCCTKTGHCCKAB


Dataset #: 2
Motif ID: 22
Motif name: CACTGTGrYrtCACAGTGswsCAcT
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 14
Number of overlap: 12
Similarity score: 3.55903

Alignment:
AGTGSWSCACTGTGAMAMCACAGTG---------
-------------TTCAGCACCATGGACAGCKCC

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG


Dataset #: 2
Motif ID: 25
Motif name: wwCCAmAGTCmt
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 1
Number of overlap: 12
Similarity score: 3.56306

Alignment:
VDGACTRTGGDD---------
GGYGCTGTCCATGGTGCTGAA

Original motif     Consensus sequence: DDCCAMAGTCHB Reverse complement motif     Consensus sequence: VDGACTRTGGDD


Dataset #: 1 Motif ID: 8 Motif name: Myc

Original motif     Consensus sequence: VGCACGTGGH Reverse complement motif     Consensus sequence: DCCACGTGCV

Best Matches for Motif ID 8 (Highest to Lowest)

Dataset #: 1
Motif ID: 6
Motif name: Mycn
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 10
Similarity score: 0

Alignment:
HSCACGTGGC
VGCACGTGGH

Original motif     Consensus sequence: HSCACGTGGC Reverse complement motif     Consensus sequence: GCCACGTGSD


Dataset #: 2
Motif ID: 18
Motif name: sscCCCGCGcs
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 10
Similarity score: 0.064853

Alignment:
BSCCCCGCGBS
-DCCACGTGCV

Original motif     Consensus sequence: BSCCCCGCGBS Reverse complement motif     Consensus sequence: SBCGCGGGGSB


Dataset #: 2
Motif ID: 24
Motif name: ssCCCCGCSssk
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 2
Number of overlap: 10
Similarity score: 0.0728588

Alignment:
SBCCCCGCCSBB
-DCCACGTGCV-

Original motif     Consensus sequence: SBCCCCGCCSBB Reverse complement motif     Consensus sequence: BBSGGCGGGGBS


Dataset #: 1
Motif ID: 16
Motif name: CTCF
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 8
Number of overlap: 10
Similarity score: 0.0754257

Alignment:
YDRCCASYAGRKGGCRSYV
--DCCACGTGCV-------

Original motif     Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif     Consensus sequence: BMSMGCCYMCTKSTGGMHM


Dataset #: 2
Motif ID: 22
Motif name: CACTGTGrYrtCACAGTGswsCAcT
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 6
Number of overlap: 10
Similarity score: 0.0888909

Alignment:
CACTGTGRTRTCACAGTGSWSCACT
----------DCCACGTGCV-----

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG


Dataset #: 1
Motif ID: 1
Motif name: HNF4A
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 10
Similarity score: 0.0934488

Alignment:
TGMYCTTTGBCCK
---VGCACGTGGH

Original motif     Consensus sequence: RGGBCAAAGKYCA Reverse complement motif     Consensus sequence: TGMYCTTTGBCCK


Dataset #: 1
Motif ID: 3
Motif name: ESR1
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 9
Number of overlap: 10
Similarity score: 0.0940438

Alignment:
MGGTCAGGGTGACCTRDBHV
--------DCCACGTGCV--

Original motif     Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif     Consensus sequence: MGGTCAGGGTGACCTRDBHV


Dataset #: 2
Motif ID: 20
Motif name: CagTGCTCCACTGTGgT
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 7
Number of overlap: 10
Similarity score: 0.0955234

Alignment:
ABCACAGTGGAGCACTG
-DCCACGTGCV------

Original motif     Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif     Consensus sequence: ABCACAGTGGAGCACTG


Dataset #: 1
Motif ID: 9
Motif name: ESR2
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 5
Number of overlap: 10
Similarity score: 0.0968598

Alignment:
VHRGGTCABDBTGMCCTB
----VGCACGTGGH----

Original motif     Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif     Consensus sequence: BAGGYCABHBTGACCKHV


Dataset #: 2
Motif ID: 23
Motif name: TGGAGCACTGTGACAcCACAGTGg
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 11
Number of overlap: 10
Similarity score: 0.0971125

Alignment:
TGGAGCACTGTGACAVCACAGTGG
----DCCACGTGCV----------

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA


Dataset #: 1 Motif ID: 9 Motif name: ESR2

Original motif     Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif     Consensus sequence: BAGGYCABHBTGACCKHV

Best Matches for Motif ID 9 (Highest to Lowest)

Dataset #: 2
Motif ID: 23
Motif name: TGGAGCACTGTGACAcCACAGTGg
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 7
Number of overlap: 18
Similarity score: 0.0717757

Alignment:
CCACTGTGVTGTCACAGTGCTCCA
------VHRGGTCABDBTGMCCTB

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA


Dataset #: 2
Motif ID: 22
Motif name: CACTGTGrYrtCACAGTGswsCAcT
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 7
Number of overlap: 18
Similarity score: 0.0815903

Alignment:
AGTGSWSCACTGTGAMAMCACAGTG
-VHRGGTCABDBTGMCCTB------

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG


Dataset #: 1
Motif ID: 7
Motif name: REST
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 3
Number of overlap: 18
Similarity score: 0.0916961

Alignment:
GGYGCTGTCCATGGTGCTGAA
-VHRGGTCABDBTGMCCTB--

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 1
Motif ID: 3
Motif name: ESR1
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 4
Number of overlap: 17
Similarity score: 0.511812

Alignment:
VDBHMAGGTCACCCTGACCY-
---VHRGGTCABDBTGMCCTB

Original motif     Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif     Consensus sequence: MGGTCAGGGTGACCTRDBHV


Dataset #: 2
Motif ID: 17
Motif name: TgTGgTGTCACAGTGCTCC
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 3
Number of overlap: 17
Similarity score: 0.569595

Alignment:
TGTGGTGTCACAGTGCTCC-
--VHRGGTCABDBTGMCCTB

Original motif     Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif     Consensus sequence: GGAGCACTGTGACACCACA


Dataset #: 1
Motif ID: 14
Motif name: PPARGRXRA
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 15
Similarity score: 1.56699

Alignment:
BTRGGDCARAGGKCA---
VHRGGTCABDBTGMCCTB

Original motif     Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif     Consensus sequence: TGRCCTKTGHCCKAB


Dataset #: 1
Motif ID: 2
Motif name: NR2F1
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 14
Similarity score: 2.08921

Alignment:
----TGAMCTTTGMMCYT
VHRGGTCABDBTGMCCTB

Original motif     Consensus sequence: TGAMCTTTGMMCYT Reverse complement motif     Consensus sequence: AKGYYCAAAGRTCA


Dataset #: 1
Motif ID: 15
Motif name: Tcfcp2l1
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 14
Similarity score: 2.09109

Alignment:
----CCAGYYHVADCCRG
BAGGYCABHBTGACCKHV

Original motif     Consensus sequence: CCAGYYHVADCCRG Reverse complement motif     Consensus sequence: CKGGDTBDMMCTGG


Dataset #: 1
Motif ID: 16
Motif name: CTCF
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 7
Number of overlap: 13
Similarity score: 2.58379

Alignment:
YDRCCASYAGRKGGCRSYV-----
------VHRGGTCABDBTGMCCTB

Original motif     Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif     Consensus sequence: BMSMGCCYMCTKSTGGMHM


Dataset #: 1
Motif ID: 1
Motif name: HNF4A
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 13
Similarity score: 2.59263

Alignment:
-----RGGBCAAAGKYCA
BAGGYCABHBTGACCKHV

Original motif     Consensus sequence: RGGBCAAAGKYCA Reverse complement motif     Consensus sequence: TGMYCTTTGBCCK


Dataset #: 1 Motif ID: 10 Motif name: NR1H2RXRA

Original motif     Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif     Consensus sequence: GTTGACCTTTGACCTTT

Best Matches for Motif ID 10 (Highest to Lowest)

Dataset #: 1
Motif ID: 7
Motif name: REST
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 4
Number of overlap: 17
Similarity score: 0.0911991

Alignment:
GGYGCTGTCCATGGTGCTGAA
---GTTGACCTTTGACCTTT-

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 1
Motif ID: 14
Motif name: PPARGRXRA
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 15
Similarity score: 1.05945

Alignment:
BTRGGDCARAGGKCA--
AAAGGTCAAAGGTCAAC

Original motif     Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif     Consensus sequence: TGRCCTKTGHCCKAB


Dataset #: 1
Motif ID: 3
Motif name: ESR1
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 8
Number of overlap: 13
Similarity score: 2.08514

Alignment:
----VDBHMAGGTCACCCTGACCY
AAAGGTCAAAGGTCAAC-------

Original motif     Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif     Consensus sequence: MGGTCAGGGTGACCTRDBHV


Dataset #: 2
Motif ID: 27
Motif name: AgTGCTCCACTGTGgTGTCACAgT
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 13
Number of overlap: 12
Similarity score: 2.59961

Alignment:
AGTGCTCCACTGTGGTGTCACAGT-----
------------AAAGGTCAAAGGTCAAC

Original motif     Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif     Consensus sequence: ACTGTGACACCACAGTGGAGCACT


Dataset #: 2
Motif ID: 21
Motif name: AmTGTGACACCACAGT
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 5
Number of overlap: 12
Similarity score: 2.59967

Alignment:
ACTGTGGTGTCACART-----
----AAAGGTCAAAGGTCAAC

Original motif     Consensus sequence: AMTGTGACACCACAGT Reverse complement motif     Consensus sequence: ACTGTGGTGTCACART


Dataset #: 2
Motif ID: 20
Motif name: CagTGCTCCACTGTGgT
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 7
Number of overlap: 11
Similarity score: 3.09731

Alignment:
------CAGTGCTCCACTGTGBT
AAAGGTCAAAGGTCAAC------

Original motif     Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif     Consensus sequence: ABCACAGTGGAGCACTG


Dataset #: 1
Motif ID: 9
Motif name: ESR2
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 9
Number of overlap: 10
Similarity score: 3.56221

Alignment:
BAGGYCABHBTGACCKHV-------
--------GTTGACCTTTGACCTTT

Original motif     Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif     Consensus sequence: BAGGYCABHBTGACCKHV


Dataset #: 1
Motif ID: 13
Motif name: MIZF
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 10
Similarity score: 3.5855

Alignment:
-------BAACGTCCGC
AAAGGTCAAAGGTCAAC

Original motif     Consensus sequence: BAACGTCCGC Reverse complement motif     Consensus sequence: GCGGACGTTV


Dataset #: 1
Motif ID: 2
Motif name: NR2F1
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 6
Number of overlap: 9
Similarity score: 4.07454

Alignment:
AKGYYCAAAGRTCA--------
-----AAAGGTCAAAGGTCAAC

Original motif     Consensus sequence: TGAMCTTTGMMCYT Reverse complement motif     Consensus sequence: AKGYYCAAAGRTCA


Dataset #: 2
Motif ID: 23
Motif name: TGGAGCACTGTGACAcCACAGTGg
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 16
Number of overlap: 9
Similarity score: 4.09479

Alignment:
--------TGGAGCACTGTGACAVCACAGTGG
GTTGACCTTTGACCTTT---------------

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA


Dataset #: 1 Motif ID: 11 Motif name: NR4A2

Original motif     Consensus sequence: AAGGTCAC Reverse complement motif     Consensus sequence: GTGACCTT

Best Matches for Motif ID 11 (Highest to Lowest)

Dataset #: 1
Motif ID: 10
Motif name: NR1H2RXRA
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 9
Number of overlap: 8
Similarity score: 0.0167759

Alignment:
AAAGGTCAAAGGTCAAC
-AAGGTCAC--------

Original motif     Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif     Consensus sequence: GTTGACCTTTGACCTTT


Dataset #: 1
Motif ID: 3
Motif name: ESR1
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 5
Number of overlap: 8
Similarity score: 0.0195235

Alignment:
VDBHMAGGTCACCCTGACCY
----AAGGTCAC--------

Original motif     Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif     Consensus sequence: MGGTCAGGGTGACCTRDBHV


Dataset #: 1
Motif ID: 9
Motif name: ESR2
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 10
Number of overlap: 8
Similarity score: 0.0198372

Alignment:
BAGGYCABHBTGACCKHV
---------GTGACCTT-

Original motif     Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif     Consensus sequence: BAGGYCABHBTGACCKHV


Dataset #: 1
Motif ID: 14
Motif name: PPARGRXRA
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 7
Number of overlap: 8
Similarity score: 0.0495607

Alignment:
BTRGGDCARAGGKCA
-AAGGTCAC------

Original motif     Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif     Consensus sequence: TGRCCTKTGHCCKAB


Dataset #: 2
Motif ID: 22
Motif name: CACTGTGrYrtCACAGTGswsCAcT
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 7
Number of overlap: 8
Similarity score: 0.0557243

Alignment:
CACTGTGRTRTCACAGTGSWSCACT
------AAGGTCAC-----------

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG


Dataset #: 1
Motif ID: 2
Motif name: NR2F1
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 7
Number of overlap: 8
Similarity score: 0.0564874

Alignment:
AKGYYCAAAGRTCA
------AAGGTCAC

Original motif     Consensus sequence: TGAMCTTTGMMCYT Reverse complement motif     Consensus sequence: AKGYYCAAAGRTCA


Dataset #: 1
Motif ID: 7
Motif name: REST
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 5
Number of overlap: 8
Similarity score: 0.0594649

Alignment:
GGYGCTGTCCATGGTGCTGAA
----GTGACCTT---------

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 2
Motif ID: 23
Motif name: TGGAGCACTGTGACAcCACAGTGg
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 8
Number of overlap: 8
Similarity score: 0.060729

Alignment:
CCACTGTGVTGTCACAGTGCTCCA
-------AAGGTCAC---------

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA


Dataset #: 2
Motif ID: 21
Motif name: AmTGTGACACCACAGT
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 6
Number of overlap: 8
Similarity score: 0.0645146

Alignment:
ACTGTGGTGTCACART
-----AAGGTCAC---

Original motif     Consensus sequence: AMTGTGACACCACAGT Reverse complement motif     Consensus sequence: ACTGTGGTGTCACART


Dataset #: 2
Motif ID: 17
Motif name: TgTGgTGTCACAGTGCTCC
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 9
Number of overlap: 8
Similarity score: 0.0695512

Alignment:
TGTGGTGTCACAGTGCTCC
---AAGGTCAC--------

Original motif     Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif     Consensus sequence: GGAGCACTGTGACACCACA


Dataset #: 1 Motif ID: 12 Motif name: RORA_1

Original motif     Consensus sequence: AWVDAGGTCA Reverse complement motif     Consensus sequence: TGACCTDVWT

Best Matches for Motif ID 12 (Highest to Lowest)

Dataset #: 1
Motif ID: 4
Motif name: Esrrb
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 10
Similarity score: 0.029401

Alignment:
VBBYCAAGGTCA
--AWVDAGGTCA

Original motif     Consensus sequence: VBBYCAAGGTCA Reverse complement motif     Consensus sequence: TGACCTTGMBBB


Dataset #: 1
Motif ID: 3
Motif name: ESR1
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 2
Number of overlap: 10
Similarity score: 0.0417851

Alignment:
MGGTCAGGGTGACCTRDBHV
---------TGACCTDVWT-

Original motif     Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif     Consensus sequence: MGGTCAGGGTGACCTRDBHV


Dataset #: 1
Motif ID: 10
Motif name: NR1H2RXRA
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 6
Number of overlap: 10
Similarity score: 0.05425

Alignment:
AAAGGTCAAAGGTCAAC
-----AWVDAGGTCA--

Original motif     Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif     Consensus sequence: GTTGACCTTTGACCTTT


Dataset #: 1
Motif ID: 2
Motif name: NR2F1
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 5
Number of overlap: 10
Similarity score: 0.0654808

Alignment:
TGAMCTTTGMMCYT
----TGACCTDVWT

Original motif     Consensus sequence: TGAMCTTTGMMCYT Reverse complement motif     Consensus sequence: AKGYYCAAAGRTCA


Dataset #: 1
Motif ID: 14
Motif name: PPARGRXRA
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 10
Similarity score: 0.06668

Alignment:
BTRGGDCARAGGKCA
-----AWVDAGGTCA

Original motif     Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif     Consensus sequence: TGRCCTKTGHCCKAB


Dataset #: 1
Motif ID: 7
Motif name: REST
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 7
Number of overlap: 10
Similarity score: 0.0755608

Alignment:
TTCAGCACCATGGACAGCKCC
------AWVDAGGTCA-----

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 1
Motif ID: 1
Motif name: HNF4A
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 4
Number of overlap: 10
Similarity score: 0.0803396

Alignment:
RGGBCAAAGKYCA
---AWVDAGGTCA

Original motif     Consensus sequence: RGGBCAAAGKYCA Reverse complement motif     Consensus sequence: TGMYCTTTGBCCK


Dataset #: 2
Motif ID: 17
Motif name: TgTGgTGTCACAGTGCTCC
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 10
Number of overlap: 10
Similarity score: 0.0889306

Alignment:
GGAGCACTGTGACACCACA
---------TGACCTDVWT

Original motif     Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif     Consensus sequence: GGAGCACTGTGACACCACA


Dataset #: 2
Motif ID: 25
Motif name: wwCCAmAGTCmt
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 2
Number of overlap: 10
Similarity score: 0.09225

Alignment:
DDCCAMAGTCHB
-AWVDAGGTCA-

Original motif     Consensus sequence: DDCCAMAGTCHB Reverse complement motif     Consensus sequence: VDGACTRTGGDD


Dataset #: 1
Motif ID: 9
Motif name: ESR2
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 4
Number of overlap: 10
Similarity score: 0.0988214

Alignment:
BAGGYCABHBTGACCKHV
-----AWVDAGGTCA---

Original motif     Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif     Consensus sequence: BAGGYCABHBTGACCKHV


Dataset #: 1 Motif ID: 13 Motif name: MIZF

Original motif     Consensus sequence: BAACGTCCGC Reverse complement motif     Consensus sequence: GCGGACGTTV

Best Matches for Motif ID 13 (Highest to Lowest)

Dataset #: 1
Motif ID: 9
Motif name: ESR2
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 10
Similarity score: 0.0605777

Alignment:
BAGGYCABHBTGACCKHV
--------GCGGACGTTV

Original motif     Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif     Consensus sequence: BAGGYCABHBTGACCKHV


Dataset #: 1
Motif ID: 3
Motif name: ESR1
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 8
Number of overlap: 10
Similarity score: 0.0614567

Alignment:
VDBHMAGGTCACCCTGACCY
---BAACGTCCGC-------

Original motif     Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif     Consensus sequence: MGGTCAGGGTGACCTRDBHV


Dataset #: 1
Motif ID: 10
Motif name: NR1H2RXRA
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 10
Similarity score: 0.0646071

Alignment:
AAAGGTCAAAGGTCAAC
-------BAACGTCCGC

Original motif     Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif     Consensus sequence: GTTGACCTTTGACCTTT


Dataset #: 2
Motif ID: 32
Motif name: gCGCGCsCgsG
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 10
Similarity score: 0.0651598

Alignment:
GCGCGCSCGCG
BAACGTCCGC-

Original motif     Consensus sequence: GCGCGCSCGCG Reverse complement motif     Consensus sequence: CGCGSGCGCGC


Dataset #: 1
Motif ID: 16
Motif name: CTCF
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 10
Number of overlap: 10
Similarity score: 0.0697767

Alignment:
BMSMGCCYMCTKSTGGMHM
BAACGTCCGC---------

Original motif     Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif     Consensus sequence: BMSMGCCYMCTKSTGGMHM


Dataset #: 1
Motif ID: 7
Motif name: REST
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 3
Number of overlap: 10
Similarity score: 0.0708149

Alignment:
GGYGCTGTCCATGGTGCTGAA
---------BAACGTCCGC--

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 2
Motif ID: 19
Motif name: atactttggc
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 10
Similarity score: 0.0803571

Alignment:
ATACTTTGGC
BAACGTCCGC

Original motif     Consensus sequence: ATACTTTGGC Reverse complement motif     Consensus sequence: GCCAAAGTAT


Dataset #: 1
Motif ID: 8
Motif name: Myc
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 9
Similarity score: 0.555645

Alignment:
VGCACGTGGH-
-GCGGACGTTV

Original motif     Consensus sequence: VGCACGTGGH Reverse complement motif     Consensus sequence: DCCACGTGCV


Dataset #: 2
Motif ID: 29
Motif name: cCGCGGrCACG
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 3
Number of overlap: 9
Similarity score: 0.560913

Alignment:
CCGCGGRCACG-
--GCGGACGTTV

Original motif     Consensus sequence: CCGCGGRCACG Reverse complement motif     Consensus sequence: CGTGKCCGCGG


Dataset #: 1
Motif ID: 6
Motif name: Mycn
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 9
Similarity score: 0.561179

Alignment:
HSCACGTGGC-
-GCGGACGTTV

Original motif     Consensus sequence: HSCACGTGGC Reverse complement motif     Consensus sequence: GCCACGTGSD


Dataset #: 1 Motif ID: 14 Motif name: PPARGRXRA

Original motif     Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif     Consensus sequence: TGRCCTKTGHCCKAB

Best Matches for Motif ID 14 (Highest to Lowest)

Dataset #: 1
Motif ID: 10
Motif name: NR1H2RXRA
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 3
Number of overlap: 15
Similarity score: 0.0442974

Alignment:
AAAGGTCAAAGGTCAAC
BTRGGDCARAGGKCA--

Original motif     Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif     Consensus sequence: GTTGACCTTTGACCTTT


Dataset #: 1
Motif ID: 9
Motif name: ESR2
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 4
Number of overlap: 15
Similarity score: 0.0602408

Alignment:
VHRGGTCABDBTGMCCTB
BTRGGDCARAGGKCA---

Original motif     Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif     Consensus sequence: BAGGYCABHBTGACCKHV


Dataset #: 1
Motif ID: 3
Motif name: ESR1
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 3
Number of overlap: 15
Similarity score: 0.0723092

Alignment:
VDBHMAGGTCACCCTGACCY
---BTRGGDCARAGGKCA--

Original motif     Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif     Consensus sequence: MGGTCAGGGTGACCTRDBHV


Dataset #: 2
Motif ID: 22
Motif name: CACTGTGrYrtCACAGTGswsCAcT
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 6
Number of overlap: 15
Similarity score: 0.0741352

Alignment:
CACTGTGRTRTCACAGTGSWSCACT
-----BTRGGDCARAGGKCA-----

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG


Dataset #: 1
Motif ID: 16
Motif name: CTCF
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 15
Similarity score: 0.0786357

Alignment:
YDRCCASYAGRKGGCRSYV
-BTRGGDCARAGGKCA---

Original motif     Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif     Consensus sequence: BMSMGCCYMCTKSTGGMHM


Dataset #: 1
Motif ID: 7
Motif name: REST
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 15
Similarity score: 0.0796159

Alignment:
TTCAGCACCATGGACAGCKCC
-BTRGGDCARAGGKCA-----

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 2
Motif ID: 23
Motif name: TGGAGCACTGTGACAcCACAGTGg
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 7
Number of overlap: 15
Similarity score: 0.0813414

Alignment:
CCACTGTGVTGTCACAGTGCTCCA
------BTRGGDCARAGGKCA---

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA


Dataset #: 2
Motif ID: 17
Motif name: TgTGgTGTCACAGTGCTCC
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 3
Number of overlap: 15
Similarity score: 0.0818655

Alignment:
TGTGGTGTCACAGTGCTCC
--BTRGGDCARAGGKCA--

Original motif     Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif     Consensus sequence: GGAGCACTGTGACACCACA


Dataset #: 1
Motif ID: 2
Motif name: NR2F1
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 1
Number of overlap: 14
Similarity score: 0.536521

Alignment:
AKGYYCAAAGRTCA-
BTRGGDCARAGGKCA

Original motif     Consensus sequence: TGAMCTTTGMMCYT Reverse complement motif     Consensus sequence: AKGYYCAAAGRTCA


Dataset #: 1
Motif ID: 15
Motif name: Tcfcp2l1
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 14
Similarity score: 0.584465

Alignment:
-CKGGDTBDMMCTGG
TGRCCTKTGHCCKAB

Original motif     Consensus sequence: CCAGYYHVADCCRG Reverse complement motif     Consensus sequence: CKGGDTBDMMCTGG


Dataset #: 1 Motif ID: 15 Motif name: Tcfcp2l1

Original motif     Consensus sequence: CCAGYYHVADCCRG Reverse complement motif     Consensus sequence: CKGGDTBDMMCTGG

Best Matches for Motif ID 15 (Highest to Lowest)

Dataset #: 1
Motif ID: 3
Motif name: ESR1
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 4
Number of overlap: 14
Similarity score: 0.0453398

Alignment:
MGGTCAGGGTGACCTRDBHV
---CCAGYYHVADCCRG---

Original motif     Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif     Consensus sequence: MGGTCAGGGTGACCTRDBHV


Dataset #: 1
Motif ID: 16
Motif name: CTCF
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 4
Number of overlap: 14
Similarity score: 0.0491111

Alignment:
YDRCCASYAGRKGGCRSYV
---CCAGYYHVADCCRG--

Original motif     Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif     Consensus sequence: BMSMGCCYMCTKSTGGMHM


Dataset #: 1
Motif ID: 9
Motif name: ESR2
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 14
Similarity score: 0.0568174

Alignment:
VHRGGTCABDBTGMCCTB
----CKGGDTBDMMCTGG

Original motif     Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif     Consensus sequence: BAGGYCABHBTGACCKHV


Dataset #: 1
Motif ID: 14
Motif name: PPARGRXRA
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 14
Similarity score: 0.0569399

Alignment:
TGRCCTKTGHCCKAB
-CKGGDTBDMMCTGG

Original motif     Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif     Consensus sequence: TGRCCTKTGHCCKAB


Dataset #: 2
Motif ID: 20
Motif name: CagTGCTCCACTGTGgT
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 5
Number of overlap: 13
Similarity score: 0.551995

Alignment:
ABCACAGTGGAGCACTG-
----CKGGDTBDMMCTGG

Original motif     Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif     Consensus sequence: ABCACAGTGGAGCACTG


Dataset #: 2
Motif ID: 22
Motif name: CACTGTGrYrtCACAGTGswsCAcT
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 14
Number of overlap: 12
Similarity score: 1.05046

Alignment:
CACTGTGRTRTCACAGTGSWSCACT--
-------------CKGGDTBDMMCTGG

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG


Dataset #: 1
Motif ID: 7
Motif name: REST
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 10
Number of overlap: 12
Similarity score: 1.05111

Alignment:
--TTCAGCACCATGGACAGCKCC
CKGGDTBDMMCTGG---------

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 1
Motif ID: 1
Motif name: HNF4A
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 12
Similarity score: 1.05387

Alignment:
TGMYCTTTGBCCK--
-CKGGDTBDMMCTGG

Original motif     Consensus sequence: RGGBCAAAGKYCA Reverse complement motif     Consensus sequence: TGMYCTTTGBCCK


Dataset #: 2
Motif ID: 26
Motif name: CAcCACAGTGGAGCAct
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 6
Number of overlap: 12
Similarity score: 1.05541

Alignment:
CAHCACAGTGGAGCACT--
-----CKGGDTBDMMCTGG

Original motif     Consensus sequence: CAHCACAGTGGAGCACT Reverse complement motif     Consensus sequence: AGTGCTCCACTGTGDTG


Dataset #: 1
Motif ID: 2
Motif name: NR2F1
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 4
Number of overlap: 11
Similarity score: 1.55702

Alignment:
---AKGYYCAAAGRTCA
CKGGDTBDMMCTGG---

Original motif     Consensus sequence: TGAMCTTTGMMCYT Reverse complement motif     Consensus sequence: AKGYYCAAAGRTCA


Dataset #: 1 Motif ID: 16 Motif name: CTCF

Original motif     Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif     Consensus sequence: BMSMGCCYMCTKSTGGMHM

Best Matches for Motif ID 16 (Highest to Lowest)

Dataset #: 1
Motif ID: 3
Motif name: ESR1
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 19
Similarity score: 0.0655511

Alignment:
MGGTCAGGGTGACCTRDBHV
-YDRCCASYAGRKGGCRSYV

Original motif     Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif     Consensus sequence: MGGTCAGGGTGACCTRDBHV


Dataset #: 2
Motif ID: 27
Motif name: AgTGCTCCACTGTGgTGTCACAgT
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 7
Number of overlap: 18
Similarity score: 0.563463

Alignment:
ACTGTGACACCACAGTGGAGCACT-
------YDRCCASYAGRKGGCRSYV

Original motif     Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif     Consensus sequence: ACTGTGACACCACAGTGGAGCACT


Dataset #: 2
Motif ID: 22
Motif name: CACTGTGrYrtCACAGTGswsCAcT
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 8
Number of overlap: 18
Similarity score: 0.566264

Alignment:
-AGTGSWSCACTGTGAMAMCACAGTG
BMSMGCCYMCTKSTGGMHM-------

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG


Dataset #: 2
Motif ID: 20
Motif name: CagTGCTCCACTGTGgT
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 17
Similarity score: 1.05236

Alignment:
--ABCACAGTGGAGCACTG
YDRCCASYAGRKGGCRSYV

Original motif     Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif     Consensus sequence: ABCACAGTGGAGCACTG


Dataset #: 2
Motif ID: 26
Motif name: CAcCACAGTGGAGCAct
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 3
Number of overlap: 15
Similarity score: 2.06184

Alignment:
----CAHCACAGTGGAGCACT
YDRCCASYAGRKGGCRSYV--

Original motif     Consensus sequence: CAHCACAGTGGAGCACT Reverse complement motif     Consensus sequence: AGTGCTCCACTGTGDTG


Dataset #: 2
Motif ID: 23
Motif name: TGGAGCACTGTGACAcCACAGTGg
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 10
Number of overlap: 15
Similarity score: 2.06698

Alignment:
TGGAGCACTGTGACAVCACAGTGG----
---------YDRCCASYAGRKGGCRSYV

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA


Dataset #: 1
Motif ID: 15
Motif name: Tcfcp2l1
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 2
Number of overlap: 13
Similarity score: 3.05613

Alignment:
------CCAGYYHVADCCRG
YDRCCASYAGRKGGCRSYV-

Original motif     Consensus sequence: CCAGYYHVADCCRG Reverse complement motif     Consensus sequence: CKGGDTBDMMCTGG


Dataset #: 1
Motif ID: 9
Motif name: ESR2
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 6
Number of overlap: 13
Similarity score: 3.06048

Alignment:
------VHRGGTCABDBTGMCCTB
YDRCCASYAGRKGGCRSYV-----

Original motif     Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif     Consensus sequence: BAGGYCABHBTGACCKHV


Dataset #: 1
Motif ID: 14
Motif name: PPARGRXRA
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 3
Number of overlap: 13
Similarity score: 3.06565

Alignment:
------BTRGGDCARAGGKCA
YDRCCASYAGRKGGCRSYV--

Original motif     Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif     Consensus sequence: TGRCCTKTGHCCKAB


Dataset #: 2
Motif ID: 24
Motif name: ssCCCCGCSssk
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 12
Similarity score: 3.56185

Alignment:
SBCCCCGCCSBB-------
BMSMGCCYMCTKSTGGMHM

Original motif     Consensus sequence: SBCCCCGCCSBB Reverse complement motif     Consensus sequence: BBSGGCGGGGBS


Dataset #: 2 Motif ID: 17 Motif name: TgTGgTGTCACAGTGCTCC

Original motif     Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif     Consensus sequence: GGAGCACTGTGACACCACA

Best Matches for Motif ID 17 (Highest to Lowest)

Dataset #: 2
Motif ID: 23
Motif name: TGGAGCACTGTGACAcCACAGTGg
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 5
Number of overlap: 19
Similarity score: 0

Alignment:
TGGAGCACTGTGACAVCACAGTGG
-GGAGCACTGTGACACCACA----

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA


Dataset #: 2
Motif ID: 22
Motif name: CACTGTGrYrtCACAGTGswsCAcT
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 4
Number of overlap: 19
Similarity score: 0.0217259

Alignment:
CACTGTGRTRTCACAGTGSWSCACT
---TGTGGTGTCACAGTGCTCC---

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG


Dataset #: 2
Motif ID: 27
Motif name: AgTGCTCCACTGTGgTGTCACAgT
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 3
Number of overlap: 19
Similarity score: 0.074816

Alignment:
ACTGTGACACCACAGTGGAGCACT
--TGTGGTGTCACAGTGCTCC---

Original motif     Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif     Consensus sequence: ACTGTGACACCACAGTGGAGCACT


Dataset #: 1
Motif ID: 3
Motif name: ESR1
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 19
Similarity score: 0.0857262

Alignment:
VDBHMAGGTCACCCTGACCY
-TGTGGTGTCACAGTGCTCC

Original motif     Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif     Consensus sequence: MGGTCAGGGTGACCTRDBHV


Dataset #: 1
Motif ID: 9
Motif name: ESR2
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 2
Number of overlap: 17
Similarity score: 1.08001

Alignment:
--VHRGGTCABDBTGMCCTB
TGTGGTGTCACAGTGCTCC-

Original motif     Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif     Consensus sequence: BAGGYCABHBTGACCKHV


Dataset #: 2
Motif ID: 20
Motif name: CagTGCTCCACTGTGgT
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 17
Similarity score: 1.08847

Alignment:
CAGTGCTCCACTGTGBT--
TGTGGTGTCACAGTGCTCC

Original motif     Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif     Consensus sequence: ABCACAGTGGAGCACTG


Dataset #: 2
Motif ID: 21
Motif name: AmTGTGACACCACAGT
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 1
Number of overlap: 16
Similarity score: 1.59452

Alignment:
ACTGTGGTGTCACART---
GGAGCACTGTGACACCACA

Original motif     Consensus sequence: AMTGTGACACCACAGT Reverse complement motif     Consensus sequence: ACTGTGGTGTCACART


Dataset #: 1
Motif ID: 14
Motif name: PPARGRXRA
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 15
Similarity score: 2.10007

Alignment:
BTRGGDCARAGGKCA----
GGAGCACTGTGACACCACA

Original motif     Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif     Consensus sequence: TGRCCTKTGHCCKAB


Dataset #: 2
Motif ID: 26
Motif name: CAcCACAGTGGAGCAct
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 4
Number of overlap: 14
Similarity score: 2.57554

Alignment:
-----CAHCACAGTGGAGCACT
TGTGGTGTCACAGTGCTCC---

Original motif     Consensus sequence: CAHCACAGTGGAGCACT Reverse complement motif     Consensus sequence: AGTGCTCCACTGTGDTG


Dataset #: 1
Motif ID: 4
Motif name: Esrrb
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 12
Similarity score: 3.58914

Alignment:
-------VBBYCAAGGTCA
GGAGCACTGTGACACCACA

Original motif     Consensus sequence: VBBYCAAGGTCA Reverse complement motif     Consensus sequence: TGACCTTGMBBB


Dataset #: 2 Motif ID: 18 Motif name: sscCCCGCGcs

Original motif     Consensus sequence: BSCCCCGCGBS Reverse complement motif     Consensus sequence: SBCGCGGGGSB

Best Matches for Motif ID 18 (Highest to Lowest)

Dataset #: 2
Motif ID: 24
Motif name: ssCCCCGCSssk
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0

Alignment:
BBSGGCGGGGBS
-SBCGCGGGGSB

Original motif     Consensus sequence: SBCCCCGCCSBB Reverse complement motif     Consensus sequence: BBSGGCGGGGBS


Dataset #: 2
Motif ID: 32
Motif name: gCGCGCsCgsG
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 1
Number of overlap: 11
Similarity score: 0.0417227

Alignment:
CGCGSGCGCGC
SBCGCGGGGSB

Original motif     Consensus sequence: GCGCGCSCGCG Reverse complement motif     Consensus sequence: CGCGSGCGCGC


Dataset #: 2
Motif ID: 28
Motif name: ssGCkTGCssk
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 11
Similarity score: 0.0523123

Alignment:
SSGCKTGCSSK
BSCCCCGCGBS

Original motif     Consensus sequence: SSGCKTGCSSK Reverse complement motif     Consensus sequence: YSSGCAYGCSS


Dataset #: 1
Motif ID: 16
Motif name: CTCF
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 7
Number of overlap: 11
Similarity score: 0.0564004

Alignment:
YDRCCASYAGRKGGCRSYV
--SBCGCGGGGSB------

Original motif     Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif     Consensus sequence: BMSMGCCYMCTKSTGGMHM


Dataset #: 1
Motif ID: 3
Motif name: ESR1
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 1
Number of overlap: 11
Similarity score: 0.0734979

Alignment:
MGGTCAGGGTGACCTRDBHV
BSCCCCGCGBS---------

Original motif     Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif     Consensus sequence: MGGTCAGGGTGACCTRDBHV


Dataset #: 2
Motif ID: 29
Motif name: cCGCGGrCACG
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0.0757081

Alignment:
CCGCGGRCACG
BSCCCCGCGBS

Original motif     Consensus sequence: CCGCGGRCACG Reverse complement motif     Consensus sequence: CGTGKCCGCGG


Dataset #: 1
Motif ID: 7
Motif name: REST
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 11
Number of overlap: 11
Similarity score: 0.0758097

Alignment:
GGYGCTGTCCATGGTGCTGAA
SBCGCGGGGSB----------

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 1
Motif ID: 8
Motif name: Myc
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 10
Similarity score: 0.535606

Alignment:
-VGCACGTGGH
SBCGCGGGGSB

Original motif     Consensus sequence: VGCACGTGGH Reverse complement motif     Consensus sequence: DCCACGTGCV


Dataset #: 1
Motif ID: 6
Motif name: Mycn
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 10
Similarity score: 0.536235

Alignment:
-HSCACGTGGC
SBCGCGGGGSB

Original motif     Consensus sequence: HSCACGTGGC Reverse complement motif     Consensus sequence: GCCACGTGSD


Dataset #: 2
Motif ID: 33
Motif name: srACyCCGAyr
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 10
Similarity score: 0.571697

Alignment:
KKTCGGKGTKS-
-SBCGCGGGGSB

Original motif     Consensus sequence: SRACYCCGAYR Reverse complement motif     Consensus sequence: KKTCGGKGTKS


Dataset #: 2 Motif ID: 19 Motif name: atactttggc

Original motif     Consensus sequence: ATACTTTGGC Reverse complement motif     Consensus sequence: GCCAAAGTAT

Best Matches for Motif ID 19 (Highest to Lowest)

Dataset #: 2
Motif ID: 25
Motif name: wwCCAmAGTCmt
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 10
Similarity score: 0.0215909

Alignment:
DDCCAMAGTCHB
-GCCAAAGTAT-

Original motif     Consensus sequence: DDCCAMAGTCHB Reverse complement motif     Consensus sequence: VDGACTRTGGDD


Dataset #: 2
Motif ID: 30
Motif name: taaacgatgcc
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 2
Number of overlap: 10
Similarity score: 0.0375

Alignment:
GGCATCGTTTA
GCCAAAGTAT-

Original motif     Consensus sequence: TAAACGATGCC Reverse complement motif     Consensus sequence: GGCATCGTTTA


Dataset #: 1
Motif ID: 10
Motif name: NR1H2RXRA
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 5
Number of overlap: 10
Similarity score: 0.0395

Alignment:
AAAGGTCAAAGGTCAAC
---GCCAAAGTAT----

Original motif     Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif     Consensus sequence: GTTGACCTTTGACCTTT


Dataset #: 2
Motif ID: 17
Motif name: TgTGgTGTCACAGTGCTCC
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 4
Number of overlap: 10
Similarity score: 0.0472222

Alignment:
GGAGCACTGTGACACCACA
------ATACTTTGGC---

Original motif     Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif     Consensus sequence: GGAGCACTGTGACACCACA


Dataset #: 2
Motif ID: 22
Motif name: CACTGTGrYrtCACAGTGswsCAcT
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 10
Number of overlap: 10
Similarity score: 0.0474206

Alignment:
CACTGTGRTRTCACAGTGSWSCACT
---------GCCAAAGTAT------

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG


Dataset #: 1
Motif ID: 1
Motif name: HNF4A
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 3
Number of overlap: 10
Similarity score: 0.0483209

Alignment:
TGMYCTTTGBCCK
--ATACTTTGGC-

Original motif     Consensus sequence: RGGBCAAAGKYCA Reverse complement motif     Consensus sequence: TGMYCTTTGBCCK


Dataset #: 1
Motif ID: 2
Motif name: NR2F1
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 10
Similarity score: 0.0490385

Alignment:
TGAMCTTTGMMCYT
-ATACTTTGGC---

Original motif     Consensus sequence: TGAMCTTTGMMCYT Reverse complement motif     Consensus sequence: AKGYYCAAAGRTCA


Dataset #: 2
Motif ID: 23
Motif name: TGGAGCACTGTGACAcCACAGTGg
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 11
Number of overlap: 10
Similarity score: 0.0493243

Alignment:
CCACTGTGVTGTCACAGTGCTCCA
----------GCCAAAGTAT----

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA


Dataset #: 2
Motif ID: 27
Motif name: AgTGCTCCACTGTGgTGTCACAgT
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 9
Number of overlap: 10
Similarity score: 0.0498239

Alignment:
ACTGTGACACCACAGTGGAGCACT
--------GCCAAAGTAT------

Original motif     Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif     Consensus sequence: ACTGTGACACCACAGTGGAGCACT


Dataset #: 2
Motif ID: 26
Motif name: CAcCACAGTGGAGCAct
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 2
Number of overlap: 10
Similarity score: 0.0527344

Alignment:
AGTGCTCCACTGTGDTG
------ATACTTTGGC-

Original motif     Consensus sequence: CAHCACAGTGGAGCACT Reverse complement motif     Consensus sequence: AGTGCTCCACTGTGDTG


Dataset #: 2 Motif ID: 20 Motif name: CagTGCTCCACTGTGgT

Original motif     Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif     Consensus sequence: ABCACAGTGGAGCACTG

Best Matches for Motif ID 20 (Highest to Lowest)

Dataset #: 1
Motif ID: 16
Motif name: CTCF
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 17
Similarity score: 0.0957051

Alignment:
BMSMGCCYMCTKSTGGMHM
--CAGTGCTCCACTGTGBT

Original motif     Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif     Consensus sequence: BMSMGCCYMCTKSTGGMHM


Dataset #: 1
Motif ID: 7
Motif name: REST
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 17
Similarity score: 0.0975871

Alignment:
TTCAGCACCATGGACAGCKCC
-ABCACAGTGGAGCACTG---

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 2
Motif ID: 17
Motif name: TgTGgTGTCACAGTGCTCC
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 3
Number of overlap: 17
Similarity score: 0.0980868

Alignment:
TGTGGTGTCACAGTGCTCC
CAGTGCTCCACTGTGBT--

Original motif     Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif     Consensus sequence: GGAGCACTGTGACACCACA


Dataset #: 2
Motif ID: 27
Motif name: AgTGCTCCACTGTGgTGTCACAgT
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 3
Number of overlap: 17
Similarity score: 0.099784

Alignment:
AGTGCTCCACTGTGGTGTCACAGT
-----ABCACAGTGGAGCACTG--

Original motif     Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif     Consensus sequence: ACTGTGACACCACAGTGGAGCACT


Dataset #: 2
Motif ID: 22
Motif name: CACTGTGrYrtCACAGTGswsCAcT
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 6
Number of overlap: 17
Similarity score: 0.104226

Alignment:
AGTGSWSCACTGTGAMAMCACAGTG
-----ABCACAGTGGAGCACTG---

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG


Dataset #: 2
Motif ID: 23
Motif name: TGGAGCACTGTGACAcCACAGTGg
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 5
Number of overlap: 17
Similarity score: 0.107548

Alignment:
TGGAGCACTGTGACAVCACAGTGG
---ABCACAGTGGAGCACTG----

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA


Dataset #: 2
Motif ID: 26
Motif name: CAcCACAGTGGAGCAct
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 16
Similarity score: 0.5

Alignment:
CAHCACAGTGGAGCACT-
-ABCACAGTGGAGCACTG

Original motif     Consensus sequence: CAHCACAGTGGAGCACT Reverse complement motif     Consensus sequence: AGTGCTCCACTGTGDTG


Dataset #: 2
Motif ID: 21
Motif name: AmTGTGACACCACAGT
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 16
Similarity score: 0.607943

Alignment:
-AMTGTGACACCACAGT
CAGTGCTCCACTGTGBT

Original motif     Consensus sequence: AMTGTGACACCACAGT Reverse complement motif     Consensus sequence: ACTGTGGTGTCACART


Dataset #: 1
Motif ID: 15
Motif name: Tcfcp2l1
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 2
Number of overlap: 13
Similarity score: 2.1063

Alignment:
----CKGGDTBDMMCTGG
ABCACAGTGGAGCACTG-

Original motif     Consensus sequence: CCAGYYHVADCCRG Reverse complement motif     Consensus sequence: CKGGDTBDMMCTGG


Dataset #: 2
Motif ID: 25
Motif name: wwCCAmAGTCmt
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 1
Number of overlap: 12
Similarity score: 2.58308

Alignment:
VDGACTRTGGDD-----
ABCACAGTGGAGCACTG

Original motif     Consensus sequence: DDCCAMAGTCHB Reverse complement motif     Consensus sequence: VDGACTRTGGDD


Dataset #: 2 Motif ID: 21 Motif name: AmTGTGACACCACAGT

Original motif     Consensus sequence: AMTGTGACACCACAGT Reverse complement motif     Consensus sequence: ACTGTGGTGTCACART

Best Matches for Motif ID 21 (Highest to Lowest)

Dataset #: 2
Motif ID: 27
Motif name: AgTGCTCCACTGTGgTGTCACAgT
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 1
Number of overlap: 16
Similarity score: 0

Alignment:
ACTGTGACACCACAGTGGAGCACT
AMTGTGACACCACAGT--------

Original motif     Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif     Consensus sequence: ACTGTGACACCACAGTGGAGCACT


Dataset #: 2
Motif ID: 23
Motif name: TGGAGCACTGTGACAcCACAGTGg
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 3
Number of overlap: 16
Similarity score: 0.00171837

Alignment:
CCACTGTGVTGTCACAGTGCTCCA
--ACTGTGGTGTCACART------

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA


Dataset #: 2
Motif ID: 22
Motif name: CACTGTGrYrtCACAGTGswsCAcT
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 16
Similarity score: 0.0197279

Alignment:
CACTGTGRTRTCACAGTGSWSCACT
-ACTGTGGTGTCACART--------

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG


Dataset #: 2
Motif ID: 17
Motif name: TgTGgTGTCACAGTGCTCC
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 4
Number of overlap: 16
Similarity score: 0.0950937

Alignment:
GGAGCACTGTGACACCACA
ACTGTGGTGTCACART---

Original motif     Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif     Consensus sequence: GGAGCACTGTGACACCACA


Dataset #: 2
Motif ID: 20
Motif name: CagTGCTCCACTGTGgT
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 16
Similarity score: 0.0988969

Alignment:
CAGTGCTCCACTGTGBT
-AMTGTGACACCACAGT

Original motif     Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif     Consensus sequence: ABCACAGTGGAGCACTG


Dataset #: 2
Motif ID: 26
Motif name: CAcCACAGTGGAGCAct
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 2
Number of overlap: 16
Similarity score: 0.101875

Alignment:
AGTGCTCCACTGTGDTG
AMTGTGACACCACAGT-

Original motif     Consensus sequence: CAHCACAGTGGAGCACT Reverse complement motif     Consensus sequence: AGTGCTCCACTGTGDTG


Dataset #: 1
Motif ID: 3
Motif name: ESR1
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 6
Number of overlap: 15
Similarity score: 0.595092

Alignment:
-MGGTCAGGGTGACCTRDBHV
AMTGTGACACCACAGT-----

Original motif     Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif     Consensus sequence: MGGTCAGGGTGACCTRDBHV


Dataset #: 1
Motif ID: 7
Motif name: REST
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 8
Number of overlap: 14
Similarity score: 1.1019

Alignment:
--GGYGCTGTCCATGGTGCTGAA
ACTGTGGTGTCACART-------

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 1
Motif ID: 9
Motif name: ESR2
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 7
Number of overlap: 12
Similarity score: 2.07799

Alignment:
----BAGGYCABHBTGACCKHV
AMTGTGACACCACAGT------

Original motif     Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif     Consensus sequence: BAGGYCABHBTGACCKHV


Dataset #: 1
Motif ID: 10
Motif name: NR1H2RXRA
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 6
Number of overlap: 12
Similarity score: 2.10225

Alignment:
----GTTGACCTTTGACCTTT
AMTGTGACACCACAGT-----

Original motif     Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif     Consensus sequence: GTTGACCTTTGACCTTT


Dataset #: 2 Motif ID: 22 Motif name: CACTGTGrYrtCACAGTGswsCAcT

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG

Best Matches for Motif ID 22 (Highest to Lowest)

Dataset #: 2
Motif ID: 27
Motif name: AgTGCTCCACTGTGgTGTCACAgT
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 24
Similarity score: 0.0247168

Alignment:
-ACTGTGACACCACAGTGGAGCACT
CACTGTGRTRTCACAGTGSWSCACT

Original motif     Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif     Consensus sequence: ACTGTGACACCACAGTGGAGCACT


Dataset #: 2
Motif ID: 23
Motif name: TGGAGCACTGTGACAcCACAGTGg
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 2
Number of overlap: 23
Similarity score: 0.500966

Alignment:
--TGGAGCACTGTGACAVCACAGTGG
AGTGSWSCACTGTGAMAMCACAGTG-

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA


Dataset #: 1
Motif ID: 3
Motif name: ESR1
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 3
Number of overlap: 18
Similarity score: 3.08246

Alignment:
MGGTCAGGGTGACCTRDBHV-------
--CACTGTGRTRTCACAGTGSWSCACT

Original motif     Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif     Consensus sequence: MGGTCAGGGTGACCTRDBHV


Dataset #: 1
Motif ID: 16
Motif name: CTCF
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 18
Similarity score: 3.08842

Alignment:
BMSMGCCYMCTKSTGGMHM-------
-AGTGSWSCACTGTGAMAMCACAGTG

Original motif     Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif     Consensus sequence: BMSMGCCYMCTKSTGGMHM


Dataset #: 2
Motif ID: 17
Motif name: TgTGgTGTCACAGTGCTCC
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 18
Similarity score: 3.08984

Alignment:
GGAGCACTGTGACACCACA-------
-CACTGTGRTRTCACAGTGSWSCACT

Original motif     Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif     Consensus sequence: GGAGCACTGTGACACCACA


Dataset #: 2
Motif ID: 26
Motif name: CAcCACAGTGGAGCAct
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 17
Similarity score: 3.52449

Alignment:
--------CAHCACAGTGGAGCACT
CACTGTGRTRTCACAGTGSWSCACT

Original motif     Consensus sequence: CAHCACAGTGGAGCACT Reverse complement motif     Consensus sequence: AGTGCTCCACTGTGDTG


Dataset #: 2
Motif ID: 20
Motif name: CagTGCTCCACTGTGgT
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 2
Number of overlap: 16
Similarity score: 4.02265

Alignment:
---------CAGTGCTCCACTGTGBT
AGTGSWSCACTGTGAMAMCACAGTG-

Original motif     Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif     Consensus sequence: ABCACAGTGGAGCACTG


Dataset #: 1
Motif ID: 9
Motif name: ESR2
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 6
Number of overlap: 13
Similarity score: 5.58301

Alignment:
VHRGGTCABDBTGMCCTB------------
-----AGTGSWSCACTGTGAMAMCACAGTG

Original motif     Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif     Consensus sequence: BAGGYCABHBTGACCKHV


Dataset #: 2
Motif ID: 21
Motif name: AmTGTGACACCACAGT
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 4
Number of overlap: 13
Similarity score: 5.58597

Alignment:
ACTGTGGTGTCACART------------
---CACTGTGRTRTCACAGTGSWSCACT

Original motif     Consensus sequence: AMTGTGACACCACAGT Reverse complement motif     Consensus sequence: ACTGTGGTGTCACART


Dataset #: 1
Motif ID: 7
Motif name: REST
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 10
Number of overlap: 12
Similarity score: 6.07826

Alignment:
-------------GGYGCTGTCCATGGTGCTGAA
CACTGTGRTRTCACAGTGSWSCACT---------

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 2 Motif ID: 23 Motif name: TGGAGCACTGTGACAcCACAGTGg

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA

Best Matches for Motif ID 23 (Highest to Lowest)

Dataset #: 2
Motif ID: 22
Motif name: CACTGTGrYrtCACAGTGswsCAcT
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 3
Number of overlap: 23
Similarity score: 0.0136536

Alignment:
CACTGTGRTRTCACAGTGSWSCACT-
--CCACTGTGVTGTCACAGTGCTCCA

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG


Dataset #: 2
Motif ID: 27
Motif name: AgTGCTCCACTGTGgTGTCACAgT
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 3
Number of overlap: 22
Similarity score: 0.560082

Alignment:
--ACTGTGACACCACAGTGGAGCACT
CCACTGTGVTGTCACAGTGCTCCA--

Original motif     Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif     Consensus sequence: ACTGTGACACCACAGTGGAGCACT


Dataset #: 1
Motif ID: 9
Motif name: ESR2
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 18
Similarity score: 2.5833

Alignment:
------BAGGYCABHBTGACCKHV
TGGAGCACTGTGACAVCACAGTGG

Original motif     Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif     Consensus sequence: BAGGYCABHBTGACCKHV


Dataset #: 1
Motif ID: 3
Motif name: ESR1
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 4
Number of overlap: 17
Similarity score: 3.10239

Alignment:
MGGTCAGGGTGACCTRDBHV-------
---CCACTGTGVTGTCACAGTGCTCCA

Original motif     Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif     Consensus sequence: MGGTCAGGGTGACCTRDBHV


Dataset #: 2
Motif ID: 17
Motif name: TgTGgTGTCACAGTGCTCC
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 4
Number of overlap: 16
Similarity score: 3.56015

Alignment:
GGAGCACTGTGACACCACA--------
---CCACTGTGVTGTCACAGTGCTCCA

Original motif     Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif     Consensus sequence: GGAGCACTGTGACACCACA


Dataset #: 2
Motif ID: 20
Motif name: CagTGCTCCACTGTGgT
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 16
Similarity score: 3.58845

Alignment:
ABCACAGTGGAGCACTG--------
-CCACTGTGVTGTCACAGTGCTCCA

Original motif     Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif     Consensus sequence: ABCACAGTGGAGCACTG


Dataset #: 2
Motif ID: 26
Motif name: CAcCACAGTGGAGCAct
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 3
Number of overlap: 15
Similarity score: 4.07113

Alignment:
AGTGCTCCACTGTGDTG---------
--TGGAGCACTGTGACAVCACAGTGG

Original motif     Consensus sequence: CAHCACAGTGGAGCACT Reverse complement motif     Consensus sequence: AGTGCTCCACTGTGDTG


Dataset #: 1
Motif ID: 16
Motif name: CTCF
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 5
Number of overlap: 15
Similarity score: 4.10183

Alignment:
---------YDRCCASYAGRKGGCRSYV
TGGAGCACTGTGACAVCACAGTGG----

Original motif     Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif     Consensus sequence: BMSMGCCYMCTKSTGGMHM


Dataset #: 1
Motif ID: 14
Motif name: PPARGRXRA
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 14
Similarity score: 4.60325

Alignment:
BTRGGDCARAGGKCA----------
-TGGAGCACTGTGACAVCACAGTGG

Original motif     Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif     Consensus sequence: TGRCCTKTGHCCKAB


Dataset #: 1
Motif ID: 7
Motif name: REST
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 9
Number of overlap: 13
Similarity score: 5.08033

Alignment:
-----------TTCAGCACCATGGACAGCKCC
TGGAGCACTGTGACAVCACAGTGG--------

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 2 Motif ID: 24 Motif name: ssCCCCGCSssk

Original motif     Consensus sequence: SBCCCCGCCSBB Reverse complement motif     Consensus sequence: BBSGGCGGGGBS

Best Matches for Motif ID 24 (Highest to Lowest)

Dataset #: 1
Motif ID: 3
Motif name: ESR1
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 2
Number of overlap: 12
Similarity score: 0.063076

Alignment:
MGGTCAGGGTGACCTRDBHV
-------BBSGGCGGGGBS-

Original motif     Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif     Consensus sequence: MGGTCAGGGTGACCTRDBHV


Dataset #: 1
Motif ID: 16
Motif name: CTCF
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 12
Similarity score: 0.0642087

Alignment:
YDRCCASYAGRKGGCRSYV
-BBSGGCGGGGBS------

Original motif     Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif     Consensus sequence: BMSMGCCYMCTKSTGGMHM


Dataset #: 1
Motif ID: 14
Motif name: PPARGRXRA
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 3
Number of overlap: 12
Similarity score: 0.0671548

Alignment:
TGRCCTKTGHCCKAB
-SBCCCCGCCSBB--

Original motif     Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif     Consensus sequence: TGRCCTKTGHCCKAB


Dataset #: 1
Motif ID: 9
Motif name: ESR2
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 12
Similarity score: 0.0734481

Alignment:
BAGGYCABHBTGACCKHV
-SBCCCCGCCSBB-----

Original motif     Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif     Consensus sequence: BAGGYCABHBTGACCKHV


Dataset #: 1
Motif ID: 7
Motif name: REST
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 10
Number of overlap: 12
Similarity score: 0.0751084

Alignment:
TTCAGCACCATGGACAGCKCC
BBSGGCGGGGBS---------

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 2
Motif ID: 18
Motif name: sscCCCGCGcs
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0.5

Alignment:
-SBCGCGGGGSB
BBSGGCGGGGBS

Original motif     Consensus sequence: BSCCCCGCGBS Reverse complement motif     Consensus sequence: SBCGCGGGGSB


Dataset #: 2
Motif ID: 32
Motif name: gCGCGCsCgsG
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0.548902

Alignment:
-CGCGSGCGCGC
BBSGGCGGGGBS

Original motif     Consensus sequence: GCGCGCSCGCG Reverse complement motif     Consensus sequence: CGCGSGCGCGC


Dataset #: 2
Motif ID: 28
Motif name: ssGCkTGCssk
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0.550852

Alignment:
-YSSGCAYGCSS
BBSGGCGGGGBS

Original motif     Consensus sequence: SSGCKTGCSSK Reverse complement motif     Consensus sequence: YSSGCAYGCSS


Dataset #: 2
Motif ID: 29
Motif name: cCGCGGrCACG
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 1
Number of overlap: 11
Similarity score: 0.56634

Alignment:
CGTGKCCGCGG-
BBSGGCGGGGBS

Original motif     Consensus sequence: CCGCGGRCACG Reverse complement motif     Consensus sequence: CGTGKCCGCGG


Dataset #: 1
Motif ID: 4
Motif name: Esrrb
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 11
Similarity score: 0.571364

Alignment:
VBBYCAAGGTCA-
-BBSGGCGGGGBS

Original motif     Consensus sequence: VBBYCAAGGTCA Reverse complement motif     Consensus sequence: TGACCTTGMBBB


Dataset #: 2 Motif ID: 25 Motif name: wwCCAmAGTCmt

Original motif     Consensus sequence: DDCCAMAGTCHB Reverse complement motif     Consensus sequence: VDGACTRTGGDD

Best Matches for Motif ID 25 (Highest to Lowest)

Dataset #: 2
Motif ID: 22
Motif name: CACTGTGrYrtCACAGTGswsCAcT
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 9
Number of overlap: 12
Similarity score: 0.0263648

Alignment:
CACTGTGRTRTCACAGTGSWSCACT
--------DDCCAMAGTCHB-----

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG


Dataset #: 2
Motif ID: 20
Motif name: CagTGCTCCACTGTGgT
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 6
Number of overlap: 12
Similarity score: 0.0282828

Alignment:
ABCACAGTGGAGCACTG
VDGACTRTGGDD-----

Original motif     Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif     Consensus sequence: ABCACAGTGGAGCACTG


Dataset #: 2
Motif ID: 26
Motif name: CAcCACAGTGGAGCAct
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 6
Number of overlap: 12
Similarity score: 0.0291095

Alignment:
AGTGCTCCACTGTGDTG
-----VDGACTRTGGDD

Original motif     Consensus sequence: CAHCACAGTGGAGCACT Reverse complement motif     Consensus sequence: AGTGCTCCACTGTGDTG


Dataset #: 2
Motif ID: 27
Motif name: AgTGCTCCACTGTGgTGTCACAgT
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 6
Number of overlap: 12
Similarity score: 0.0301919

Alignment:
AGTGCTCCACTGTGGTGTCACAGT
-----VDGACTRTGGDD-------

Original motif     Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif     Consensus sequence: ACTGTGACACCACAGTGGAGCACT


Dataset #: 1
Motif ID: 1
Motif name: HNF4A
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 12
Similarity score: 0.032442

Alignment:
RGGBCAAAGKYCA
-DDCCAMAGTCHB

Original motif     Consensus sequence: RGGBCAAAGKYCA Reverse complement motif     Consensus sequence: TGMYCTTTGBCCK


Dataset #: 2
Motif ID: 23
Motif name: TGGAGCACTGTGACAcCACAGTGg
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 4
Number of overlap: 12
Similarity score: 0.0360702

Alignment:
CCACTGTGVTGTCACAGTGCTCCA
---DDCCAMAGTCHB---------

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA


Dataset #: 1
Motif ID: 7
Motif name: REST
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 4
Number of overlap: 12
Similarity score: 0.0391228

Alignment:
GGYGCTGTCCATGGTGCTGAA
---DDCCAMAGTCHB------

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 2
Motif ID: 17
Motif name: TgTGgTGTCACAGTGCTCC
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 3
Number of overlap: 12
Similarity score: 0.0393782

Alignment:
TGTGGTGTCACAGTGCTCC
-----DDCCAMAGTCHB--

Original motif     Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif     Consensus sequence: GGAGCACTGTGACACCACA


Dataset #: 1
Motif ID: 3
Motif name: ESR1
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 12
Similarity score: 0.0407304

Alignment:
VDBHMAGGTCACCCTGACCY
DDCCAMAGTCHB--------

Original motif     Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif     Consensus sequence: MGGTCAGGGTGACCTRDBHV


Dataset #: 1
Motif ID: 10
Motif name: NR1H2RXRA
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 2
Number of overlap: 12
Similarity score: 0.0463384

Alignment:
AAAGGTCAAAGGTCAAC
----DDCCAMAGTCHB-

Original motif     Consensus sequence: AAAGGTCAAAGGTCAAC Reverse complement motif     Consensus sequence: GTTGACCTTTGACCTTT


Dataset #: 2 Motif ID: 26 Motif name: CAcCACAGTGGAGCAct

Original motif     Consensus sequence: CAHCACAGTGGAGCACT Reverse complement motif     Consensus sequence: AGTGCTCCACTGTGDTG

Best Matches for Motif ID 26 (Highest to Lowest)

Dataset #: 2
Motif ID: 27
Motif name: AgTGCTCCACTGTGgTGTCACAgT
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 1
Number of overlap: 17
Similarity score: 0.00742502

Alignment:
AGTGCTCCACTGTGGTGTCACAGT
AGTGCTCCACTGTGDTG-------

Original motif     Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif     Consensus sequence: ACTGTGACACCACAGTGGAGCACT


Dataset #: 2
Motif ID: 22
Motif name: CACTGTGrYrtCACAGTGswsCAcT
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 9
Number of overlap: 17
Similarity score: 0.0456803

Alignment:
CACTGTGRTRTCACAGTGSWSCACT
--------CAHCACAGTGGAGCACT

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG


Dataset #: 1
Motif ID: 7
Motif name: REST
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 3
Number of overlap: 17
Similarity score: 0.0894884

Alignment:
TTCAGCACCATGGACAGCKCC
--CAHCACAGTGGAGCACT--

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 2
Motif ID: 17
Motif name: TgTGgTGTCACAGTGCTCC
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 2
Number of overlap: 17
Similarity score: 0.0962536

Alignment:
GGAGCACTGTGACACCACA
-CAHCACAGTGGAGCACT-

Original motif     Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif     Consensus sequence: GGAGCACTGTGACACCACA


Dataset #: 1
Motif ID: 16
Motif name: CTCF
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 17
Similarity score: 0.0978126

Alignment:
YDRCCASYAGRKGGCRSYV
-CAHCACAGTGGAGCACT-

Original motif     Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif     Consensus sequence: BMSMGCCYMCTKSTGGMHM


Dataset #: 2
Motif ID: 23
Motif name: TGGAGCACTGTGACAcCACAGTGg
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 3
Number of overlap: 17
Similarity score: 0.106708

Alignment:
CCACTGTGVTGTCACAGTGCTCCA
-----AGTGCTCCACTGTGDTG--

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA


Dataset #: 2
Motif ID: 20
Motif name: CagTGCTCCACTGTGgT
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 16
Similarity score: 0.5

Alignment:
ABCACAGTGGAGCACTG-
-CAHCACAGTGGAGCACT

Original motif     Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif     Consensus sequence: ABCACAGTGGAGCACTG


Dataset #: 2
Motif ID: 21
Motif name: AmTGTGACACCACAGT
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 1
Number of overlap: 16
Similarity score: 0.610921

Alignment:
ACTGTGGTGTCACART-
CAHCACAGTGGAGCACT

Original motif     Consensus sequence: AMTGTGACACCACAGT Reverse complement motif     Consensus sequence: ACTGTGGTGTCACART


Dataset #: 2
Motif ID: 25
Motif name: wwCCAmAGTCmt
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 12
Similarity score: 2.5839

Alignment:
-----VDGACTRTGGDD
AGTGCTCCACTGTGDTG

Original motif     Consensus sequence: DDCCAMAGTCHB Reverse complement motif     Consensus sequence: VDGACTRTGGDD


Dataset #: 1
Motif ID: 1
Motif name: HNF4A
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 2
Number of overlap: 12
Similarity score: 2.60332

Alignment:
-----TGMYCTTTGBCCK
AGTGCTCCACTGTGDTG-

Original motif     Consensus sequence: RGGBCAAAGKYCA Reverse complement motif     Consensus sequence: TGMYCTTTGBCCK


Dataset #: 2 Motif ID: 27 Motif name: AgTGCTCCACTGTGgTGTCACAgT

Original motif     Consensus sequence: AGTGCTCCACTGTGGTGTCACAGT Reverse complement motif     Consensus sequence: ACTGTGACACCACAGTGGAGCACT

Best Matches for Motif ID 27 (Highest to Lowest)

Dataset #: 2
Motif ID: 22
Motif name: CACTGTGrYrtCACAGTGswsCAcT
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 24
Similarity score: 0.0409586

Alignment:
AGTGSWSCACTGTGAMAMCACAGTG
-AGTGCTCCACTGTGGTGTCACAGT

Original motif     Consensus sequence: CACTGTGRTRTCACAGTGSWSCACT Reverse complement motif     Consensus sequence: AGTGSWSCACTGTGAMAMCACAGTG


Dataset #: 2
Motif ID: 23
Motif name: TGGAGCACTGTGACAcCACAGTGg
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 3
Number of overlap: 22
Similarity score: 1.06364

Alignment:
CCACTGTGVTGTCACAGTGCTCCA--
--ACTGTGACACCACAGTGGAGCACT

Original motif     Consensus sequence: TGGAGCACTGTGACAVCACAGTGG Reverse complement motif     Consensus sequence: CCACTGTGVTGTCACAGTGCTCCA


Dataset #: 1
Motif ID: 7
Motif name: REST
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 3
Number of overlap: 19
Similarity score: 2.59599

Alignment:
TTCAGCACCATGGACAGCKCC-----
--ACTGTGACACCACAGTGGAGCACT

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 2
Motif ID: 17
Motif name: TgTGgTGTCACAGTGCTCC
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 2
Number of overlap: 18
Similarity score: 3.10123

Alignment:
------GGAGCACTGTGACACCACA
ACTGTGACACCACAGTGGAGCACT-

Original motif     Consensus sequence: TGTGGTGTCACAGTGCTCC Reverse complement motif     Consensus sequence: GGAGCACTGTGACACCACA


Dataset #: 1
Motif ID: 16
Motif name: CTCF
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 2
Number of overlap: 18
Similarity score: 3.10186

Alignment:
------BMSMGCCYMCTKSTGGMHM
AGTGCTCCACTGTGGTGTCACAGT-

Original motif     Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif     Consensus sequence: BMSMGCCYMCTKSTGGMHM


Dataset #: 2
Motif ID: 26
Motif name: CAcCACAGTGGAGCAct
Matching format of first motif: Original Motif
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 17
Similarity score: 3.50248

Alignment:
-------AGTGCTCCACTGTGDTG
AGTGCTCCACTGTGGTGTCACAGT

Original motif     Consensus sequence: CAHCACAGTGGAGCACT Reverse complement motif     Consensus sequence: AGTGCTCCACTGTGDTG


Dataset #: 2
Motif ID: 20
Motif name: CagTGCTCCACTGTGgT
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 2
Number of overlap: 16
Similarity score: 4

Alignment:
CAGTGCTCCACTGTGBT--------
-AGTGCTCCACTGTGGTGTCACAGT

Original motif     Consensus sequence: CAGTGCTCCACTGTGBT Reverse complement motif     Consensus sequence: ABCACAGTGGAGCACTG


Dataset #: 2
Motif ID: 21
Motif name: AmTGTGACACCACAGT
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 16
Similarity score: 4.0041

Alignment:
--------AMTGTGACACCACAGT
ACTGTGACACCACAGTGGAGCACT

Original motif     Consensus sequence: AMTGTGACACCACAGT Reverse complement motif     Consensus sequence: ACTGTGGTGTCACART


Dataset #: 1
Motif ID: 3
Motif name: ESR1
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 6
Number of overlap: 15
Similarity score: 4.59996

Alignment:
MGGTCAGGGTGACCTRDBHV---------
-----ACTGTGACACCACAGTGGAGCACT

Original motif     Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif     Consensus sequence: MGGTCAGGGTGACCTRDBHV


Dataset #: 1
Motif ID: 9
Motif name: ESR2
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 7
Number of overlap: 12
Similarity score: 6.08041

Alignment:
------------VHRGGTCABDBTGMCCTB
AGTGCTCCACTGTGGTGTCACAGT------

Original motif     Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif     Consensus sequence: BAGGYCABHBTGACCKHV


Dataset #: 2 Motif ID: 28 Motif name: ssGCkTGCssk

Original motif     Consensus sequence: SSGCKTGCSSK Reverse complement motif     Consensus sequence: YSSGCAYGCSS

Best Matches for Motif ID 28 (Highest to Lowest)

Dataset #: 2
Motif ID: 32
Motif name: gCGCGCsCgsG
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0.00456539

Alignment:
GCGCGCSCGCG
SSGCKTGCSSK

Original motif     Consensus sequence: GCGCGCSCGCG Reverse complement motif     Consensus sequence: CGCGSGCGCGC


Dataset #: 2
Motif ID: 24
Motif name: ssCCCCGCSssk
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Forward
Position number: 2
Number of overlap: 11
Similarity score: 0.0176347

Alignment:
BBSGGCGGGGBS
-YSSGCAYGCSS

Original motif     Consensus sequence: SBCCCCGCCSBB Reverse complement motif     Consensus sequence: BBSGGCGGGGBS


Dataset #: 2
Motif ID: 18
Motif name: sscCCCGCGcs
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0.0190954

Alignment:
SBCGCGGGGSB
YSSGCAYGCSS

Original motif     Consensus sequence: BSCCCCGCGBS Reverse complement motif     Consensus sequence: SBCGCGGGGSB


Dataset #: 2
Motif ID: 29
Motif name: cCGCGGrCACG
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0.0276515

Alignment:
CCGCGGRCACG
SSGCKTGCSSK

Original motif     Consensus sequence: CCGCGGRCACG Reverse complement motif     Consensus sequence: CGTGKCCGCGG


Dataset #: 1
Motif ID: 16
Motif name: CTCF
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Forward
Position number: 8
Number of overlap: 11
Similarity score: 0.0349439

Alignment:
YDRCCASYAGRKGGCRSYV
-------SSGCKTGCSSK-

Original motif     Consensus sequence: YDRCCASYAGRKGGCRSYV Reverse complement motif     Consensus sequence: BMSMGCCYMCTKSTGGMHM


Dataset #: 1
Motif ID: 4
Motif name: Esrrb
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0.0358701

Alignment:
VBBYCAAGGTCA
-YSSGCAYGCSS

Original motif     Consensus sequence: VBBYCAAGGTCA Reverse complement motif     Consensus sequence: TGACCTTGMBBB


Dataset #: 1
Motif ID: 9
Motif name: ESR2
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 3
Number of overlap: 11
Similarity score: 0.0379074

Alignment:
VHRGGTCABDBTGMCCTB
-----YSSGCAYGCSS--

Original motif     Consensus sequence: VHRGGTCABDBTGMCCTB Reverse complement motif     Consensus sequence: BAGGYCABHBTGACCKHV


Dataset #: 1
Motif ID: 7
Motif name: REST
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 10
Number of overlap: 11
Similarity score: 0.0409322

Alignment:
TTCAGCACCATGGACAGCKCC
-YSSGCAYGCSS---------

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 1
Motif ID: 14
Motif name: PPARGRXRA
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Forward
Position number: 3
Number of overlap: 11
Similarity score: 0.041419

Alignment:
BTRGGDCARAGGKCA
--YSSGCAYGCSS--

Original motif     Consensus sequence: BTRGGDCARAGGKCA Reverse complement motif     Consensus sequence: TGRCCTKTGHCCKAB


Dataset #: 1
Motif ID: 1
Motif name: HNF4A
Matching format of first motif: Reverse Complement
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0.0437981

Alignment:
RGGBCAAAGKYCA
--YSSGCAYGCSS

Original motif     Consensus sequence: RGGBCAAAGKYCA Reverse complement motif     Consensus sequence: TGMYCTTTGBCCK


Dataset #: 2 Motif ID: 29 Motif name: cCGCGGrCACG

Original motif     Consensus sequence: CCGCGGRCACG Reverse complement motif     Consensus sequence: CGTGKCCGCGG

Best Matches for Motif ID 29 (Highest to Lowest)

Dataset #: 2
Motif ID: 32
Motif name: gCGCGCsCgsG
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 1
Number of overlap: 11
Similarity score: 0.010473

Alignment:
GCGCGCSCGCG
CCGCGGRCACG

Original motif     Consensus sequence: GCGCGCSCGCG Reverse complement motif     Consensus sequence: CGCGSGCGCGC


Dataset #: 1
Motif ID: 7
Motif name: REST
Matching format of first motif: Original Motif
Matching format of second motif: Original Motif
Direction: Backward
Position number: 4
Number of overlap: 11
Similarity score: 0.0484441

Alignment:
TTCAGCACCATGGACAGCKCC
-------CCGCGGRCACG---

Original motif     Consensus sequence: TTCAGCACCATGGACAGCKCC Reverse complement motif     Consensus sequence: GGYGCTGTCCATGGTGCTGAA


Dataset #: 1
Motif ID: 3
Motif name: ESR1
Matching format of first motif: Reverse Complement
Matching format of second motif: Reverse Complement
Direction: Backward
Position number: 3
Number of overlap: 11
Similarity score: 0.0486581

Alignment:
MGGTCAGGGTGACCTRDBHV
-------CGTGKCCGCGG--

Original motif     Consensus sequence: VDBHMAGGTCACCCTGACCY Reverse complement motif     Consensus sequence: MGGTC