Version 2.2
Number of files: | 1 |
Number of top significant motifs: | 5 |
Number of best matches: | 5 |
Similarity cutoff >= | 0.5 |
Matching motif database: | None |
Motif tree: | Yes |
Combined similar motifs: | Yes |
Output file type: | All |
Output file format: | All |
File name | Count of motifs | Dataset number |
U20230328-stremeR.txt | 365 | 1 |
There is no global matching for 1 motif file.
Dataset #: 1 | Motif ID: 318 | Motif name: Motif 318 |
Original motif Consensus sequence: CAGCCCCG | Reverse complement motif Consensus sequence: CGGGGCTG |
Best Matches for Significant Motif ID 318 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 88 |
Motif name: | Motif 88 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 8 |
Similarity score: | 0.00509921 |
Original motif Consensus sequence: ACCGGGGCTGCA | Reverse complement motif Consensus sequence: TGCAGCCCCGGT |
Dataset #: | 1 |
Motif ID: | 183 |
Motif name: | Motif 183 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 8 |
Similarity score: | 0.0248687 |
Original motif Consensus sequence: GCCRGCCCTGCYGGCC | Reverse complement motif Consensus sequence: GGCCMGCAGGGCKGGC |
Dataset #: | 1 |
Motif ID: | 78 |
Motif name: | Motif 78 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 8 |
Similarity score: | 0.026456 |
Original motif Consensus sequence: CGAGCCCTGCCCCGCGG | Reverse complement motif Consensus sequence: CCGCGGGGCAGGGCTCG |
Dataset #: | 1 |
Motif ID: | 92 |
Motif name: | Motif 92 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 12 |
Number of overlap: | 8 |
Similarity score: | 0.0266885 |
Original motif Consensus sequence: GGGGGCTGACCCCCCCACC | Reverse complement motif Consensus sequence: GGTGGGGGGGTCAGCCCCC |
Dataset #: | 1 |
Motif ID: | 122 |
Motif name: | Motif 122 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 8 |
Number of overlap: | 8 |
Similarity score: | 0.0291045 |
Original motif Consensus sequence: CCTTGGCCAGCCCAGAAAG | Reverse complement motif Consensus sequence: CTTTCTGGGCTGGCCAAGG |
Dataset #: 1 | Motif ID: 156 | Motif name: Motif 156 |
Original motif Consensus sequence: CACTTCCCAGAC | Reverse complement motif Consensus sequence: GTCTGGGAAGTG |
Best Matches for Significant Motif ID 156 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 27 |
Motif name: | Motif 27 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 7 |
Number of overlap: | 12 |
Similarity score: | 0.00564821 |
Original motif Consensus sequence: CACTTCCCAGACGGGGCG | Reverse complement motif Consensus sequence: CGCCCCGTCTGGGAAGTG |
Dataset #: | 1 |
Motif ID: | 95 |
Motif name: | Motif 95 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 6 |
Number of overlap: | 12 |
Similarity score: | 0.0183065 |
Original motif Consensus sequence: ACCCYGTCTGGGAGGTG | Reverse complement motif Consensus sequence: CACCTCCCAGACMGGGT |
Dataset #: | 1 |
Motif ID: | 45 |
Motif name: | Motif 45 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 12 |
Similarity score: | 0.0205412 |
Original motif Consensus sequence: TGCCCAGTCTGGAAAGTG | Reverse complement motif Consensus sequence: CACTTTCCAGACTGGGCA |
Dataset #: | 1 |
Motif ID: | 74 |
Motif name: | Motif 74 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 12 |
Similarity score: | 0.0315299 |
Original motif Consensus sequence: CACTTCCTAGATGG | Reverse complement motif Consensus sequence: CCATCTAGGAAGTG |
Dataset #: | 1 |
Motif ID: | 72 |
Motif name: | Motif 72 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 12 |
Similarity score: | 0.0670258 |
Original motif Consensus sequence: CGCACTCCTCAGCC | Reverse complement motif Consensus sequence: GGCTGAGGAGTGCG |
Dataset #: 1 | Motif ID: 338 | Motif name: Motif 338 |
Original motif Consensus sequence: CTGCAGCC | Reverse complement motif Consensus sequence: GGCTGCAG |
Best Matches for Significant Motif ID 338 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 68 |
Motif name: | Motif 68 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 8 |
Similarity score: | 0.0130204 |
Original motif Consensus sequence: CATGGCGGGCTGCAGGTC | Reverse complement motif Consensus sequence: GACCTGCAGCCCGCCATG |
Dataset #: | 1 |
Motif ID: | 219 |
Motif name: | Motif 219 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 8 |
Similarity score: | 0.0154581 |
Original motif Consensus sequence: CTGCAGCCTC | Reverse complement motif Consensus sequence: GAGGCTGCAG |
Dataset #: | 1 |
Motif ID: | 149 |
Motif name: | Motif 149 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 12 |
Number of overlap: | 8 |
Similarity score: | 0.0406936 |
Original motif Consensus sequence: ACTCAGCCCRCCTGCACCC | Reverse complement motif Consensus sequence: GGGTGCAGGMGGGCTGAGT |
Dataset #: | 1 |
Motif ID: | 89 |
Motif name: | Motif 89 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 9 |
Number of overlap: | 8 |
Similarity score: | 0.0413146 |
Original motif Consensus sequence: GGCTGCGGAGGGTGTA | Reverse complement motif Consensus sequence: TACACCCTCCGCAGCC |
Dataset #: | 1 |
Motif ID: | 220 |
Motif name: | Motif 220 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 8 |
Similarity score: | 0.0415555 |
Original motif Consensus sequence: TGCACTGCACCCAC | Reverse complement motif Consensus sequence: GTGGGTGCAGTGCA |
Dataset #: 1 | Motif ID: 146 | Motif name: Motif 146 |
Original motif Consensus sequence: CTGTCACCCC | Reverse complement motif Consensus sequence: GGGGTGACAG |
Best Matches for Significant Motif ID 146 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 1 |
Motif name: | Motif 1 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 10 |
Similarity score: | 0.00304976 |
Original motif Consensus sequence: GGGGTGACAGABGB | Reverse complement motif Consensus sequence: BCVTCTGTCACCCC |
Dataset #: | 1 |
Motif ID: | 209 |
Motif name: | Motif 209 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 10 |
Similarity score: | 0.021009 |
Original motif Consensus sequence: CTGTCAGCCCAT | Reverse complement motif Consensus sequence: ATGGGCTGACAG |
Dataset #: | 1 |
Motif ID: | 279 |
Motif name: | Motif 279 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 7 |
Number of overlap: | 10 |
Similarity score: | 0.0415588 |
Original motif Consensus sequence: GGGGGAGACATCACACR | Reverse complement motif Consensus sequence: MGTGTGATGTCTCCCCC |
Dataset #: | 1 |
Motif ID: | 193 |
Motif name: | Motif 193 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 10 |
Similarity score: | 0.0448872 |
Original motif Consensus sequence: ATACAATGGGGGTACAGRC | Reverse complement motif Consensus sequence: GKCTGTACCCCCATTGTAT |
Dataset #: | 1 |
Motif ID: | 205 |
Motif name: | Motif 205 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 10 |
Similarity score: | 0.0451314 |
Original motif Consensus sequence: CATCTGGCAGCCCA | Reverse complement motif Consensus sequence: TGGGCTGCCAGATG |
Dataset #: 1 | Motif ID: 113 | Motif name: Motif 113 |
Original motif Consensus sequence: CACTTCCTA | Reverse complement motif Consensus sequence: TAGGAAGTG |
Best Matches for Significant Motif ID 113 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 74 |
Motif name: | Motif 74 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 9 |
Similarity score: | 0.0147795 |
Original motif Consensus sequence: CACTTCCTAGATGG | Reverse complement motif Consensus sequence: CCATCTAGGAAGTG |
Dataset #: | 1 |
Motif ID: | 153 |
Motif name: | Motif 153 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 9 |
Similarity score: | 0.0332374 |
Original motif Consensus sequence: CACTAGGGAGTGCC | Reverse complement motif Consensus sequence: GGCACTCCCTAGTG |
Dataset #: | 1 |
Motif ID: | 156 |
Motif name: | Motif 156 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 9 |
Similarity score: | 0.0333368 |
Original motif Consensus sequence: CACTTCCCAGAC | Reverse complement motif Consensus sequence: GTCTGGGAAGTG |
Dataset #: | 1 |
Motif ID: | 27 |
Motif name: | Motif 27 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 9 |
Similarity score: | 0.0419916 |
Original motif Consensus sequence: CACTTCCCAGACGGGGCG | Reverse complement motif Consensus sequence: CGCCCCGTCTGGGAAGTG |
Dataset #: | 1 |
Motif ID: | 339 |
Motif name: | Motif 339 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 9 |
Similarity score: | 0.0431985 |
Original motif Consensus sequence: CTCACCTCCTGC | Reverse complement motif Consensus sequence: GCAGGAGGTGAG |
Dataset #: 1 | Motif ID: 1 | Motif name: Motif 1 |
Original motif Consensus sequence: GGGGTGACAGABGB | Reverse complement motif Consensus sequence: BCVTCTGTCACCCC |
Best Matches for Motif ID 1 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 29 |
Motif name: | Motif 29 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 14 |
Similarity score: | 0.0644652 |
Original motif Consensus sequence: CTGGGCRACAGAGYRAGACY | Reverse complement motif Consensus sequence: MGTCTMKCTCTGTKGCCCAG |
Dataset #: | 1 |
Motif ID: | 178 |
Motif name: | Motif 178 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 6 |
Number of overlap: | 14 |
Similarity score: | 0.0767787 |
Original motif Consensus sequence: ACTGTCTTCCACCTCCACAT | Reverse complement motif Consensus sequence: ATGTGGAGGTGGAAGACAGT |
Dataset #: | 1 |
Motif ID: | 139 |
Motif name: | Motif 139 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 6 |
Number of overlap: | 14 |
Similarity score: | 0.0824915 |
Original motif Consensus sequence: AGCCYCTGGYAACCAYYAWT | Reverse complement motif Consensus sequence: AWTKKTGGTTKCCAGKGGCT |
Dataset #: | 1 |
Motif ID: | 357 |
Motif name: | Motif 357 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 14 |
Similarity score: | 0.0825056 |
Original motif Consensus sequence: CAAGTTGACACATAAAATTA | Reverse complement motif Consensus sequence: TAATTTTATGTGTCAACTTG |
Dataset #: | 1 |
Motif ID: | 109 |
Motif name: | Motif 109 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 14 |
Similarity score: | 0.0851234 |
Original motif Consensus sequence: GAGAGAGAGAGAGAGAGAGA | Reverse complement motif Consensus sequence: TCTCTCTCTCTCTCTCTCTC |
Dataset #: | 1 |
Motif ID: | 53 |
Motif name: | Motif 53 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 14 |
Similarity score: | 0.0864815 |
Original motif Consensus sequence: GTCCCATCGACCACCCAAG | Reverse complement motif Consensus sequence: CTTGGGTGGTCGATGGGAC |
Dataset #: 1 | Motif ID: 2 | Motif name: Motif 2 |
Original motif Consensus sequence: ATTAGCYRGGCRTGGTGGC | Reverse complement motif Consensus sequence: GCCACCAMGCCMKGCTAAT |
Best Matches for Motif ID 2 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 155 |
Motif name: | Motif 155 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.0936692 |
Original motif Consensus sequence: TCCCTCCCGGACGGGGYGGC | Reverse complement motif Consensus sequence: GCCKCCCCGTCCGGGAGGGA |
Dataset #: | 1 |
Motif ID: | 165 |
Motif name: | Motif 165 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.109865 |
Original motif Consensus sequence: ATCTGACAGGAGGYRGAGCT | Reverse complement motif Consensus sequence: AGCTCMKCCTCCTGTCAGAT |
Dataset #: | 1 |
Motif ID: | 65 |
Motif name: | Motif 65 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.112387 |
Original motif Consensus sequence: AGAAATCGAGCRCAGCGCCG | Reverse complement motif Consensus sequence: CGGCGCTGMGCTCGATTTCT |
Dataset #: | 1 |
Motif ID: | 43 |
Motif name: | Motif 43 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.116369 |
Original motif Consensus sequence: GCCAGGCAGAGRGKCTCCT | Reverse complement motif Consensus sequence: AGGAGRCMCTCTGCCTGGC |
Dataset #: | 1 |
Motif ID: | 53 |
Motif name: | Motif 53 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.116437 |
Original motif Consensus sequence: GTCCCATCGACCACCCAAG | Reverse complement motif Consensus sequence: CTTGGGTGGTCGATGGGAC |
Dataset #: 1 | Motif ID: 3 | Motif name: Motif 3 |
Original motif Consensus sequence: GCTGGAGTGCAGTGGCRYGA | Reverse complement motif Consensus sequence: TCKMGCCACTGCACTCCAGC |
Best Matches for Motif ID 3 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 350 |
Motif name: | Motif 350 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.100707 |
Original motif Consensus sequence: TCTGGAGTGGACCTCCAGCA | Reverse complement motif Consensus sequence: TGCTGGAGGTCCACTCCAGA |
Dataset #: | 1 |
Motif ID: | 100 |
Motif name: | Motif 100 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.113987 |
Original motif Consensus sequence: GCTGGCCCGCAAGCGCCGCG | Reverse complement motif Consensus sequence: CGCGGCGCTTGCGGGCCAGC |
Dataset #: | 1 |
Motif ID: | 105 |
Motif name: | Motif 105 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.116177 |
Original motif Consensus sequence: GCCTCTCCCTCCACACCTCC | Reverse complement motif Consensus sequence: GGAGGTGTGGAGGGAGAGGC |
Dataset #: | 1 |
Motif ID: | 109 |
Motif name: | Motif 109 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.122582 |
Original motif Consensus sequence: GAGAGAGAGAGAGAGAGAGA | Reverse complement motif Consensus sequence: TCTCTCTCTCTCTCTCTCTC |
Dataset #: | 1 |
Motif ID: | 292 |
Motif name: | Motif 292 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.122944 |
Original motif Consensus sequence: AAGACCTTCCAGTGGGACAA | Reverse complement motif Consensus sequence: TTGTCCCACTGGAAGGTCTT |
Dataset #: 1 | Motif ID: 4 | Motif name: Motif 4 |
Original motif Consensus sequence: GCTGGGATTACAGG | Reverse complement motif Consensus sequence: CCTGTAATCCCAGC |
Best Matches for Motif ID 4 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 191 |
Motif name: | Motif 191 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 14 |
Similarity score: | 0.0598063 |
Original motif Consensus sequence: AAAGTGCCGAGAKTGCAGC | Reverse complement motif Consensus sequence: GCTGCARTCTCGGCACTTT |
Dataset #: | 1 |
Motif ID: | 294 |
Motif name: | Motif 294 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 6 |
Number of overlap: | 14 |
Similarity score: | 0.0659358 |
Original motif Consensus sequence: AGCTGTGAGAAGAGGGCCAC | Reverse complement motif Consensus sequence: GTGGCCCTCTTCTCACAGCT |
Dataset #: | 1 |
Motif ID: | 115 |
Motif name: | Motif 115 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 14 |
Similarity score: | 0.0789579 |
Original motif Consensus sequence: ATGATCCAGCAATYCCACTH | Reverse complement motif Consensus sequence: HAGTGGKATTGCTGGATCAT |
Dataset #: | 1 |
Motif ID: | 193 |
Motif name: | Motif 193 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 14 |
Similarity score: | 0.0825729 |
Original motif Consensus sequence: ATACAATGGGGGTACAGRC | Reverse complement motif Consensus sequence: GKCTGTACCCCCATTGTAT |
Dataset #: | 1 |
Motif ID: | 100 |
Motif name: | Motif 100 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 6 |
Number of overlap: | 14 |
Similarity score: | 0.0827625 |
Original motif Consensus sequence: GCTGGCCCGCAAGCGCCGCG | Reverse complement motif Consensus sequence: CGCGGCGCTTGCGGGCCAGC |
Dataset #: 1 | Motif ID: 5 | Motif name: Motif 5 |
Original motif Consensus sequence: CCTCRGCCTCC | Reverse complement motif Consensus sequence: GGAGGCKGAGG |
Best Matches for Motif ID 5 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 26 |
Motif name: | Motif 26 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 7 |
Number of overlap: | 11 |
Similarity score: | 0.0355603 |
Original motif Consensus sequence: CTCCTGCCTCAGCCTCCCRA | Reverse complement motif Consensus sequence: TMGGGAGGCTGAGGCAGGAG |
Dataset #: | 1 |
Motif ID: | 105 |
Motif name: | Motif 105 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 11 |
Similarity score: | 0.0494199 |
Original motif Consensus sequence: GCCTCTCCCTCCACACCTCC | Reverse complement motif Consensus sequence: GGAGGTGTGGAGGGAGAGGC |
Dataset #: | 1 |
Motif ID: | 165 |
Motif name: | Motif 165 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 11 |
Similarity score: | 0.0544617 |
Original motif Consensus sequence: ATCTGACAGGAGGYRGAGCT | Reverse complement motif Consensus sequence: AGCTCMKCCTCCTGTCAGAT |
Dataset #: | 1 |
Motif ID: | 273 |
Motif name: | Motif 273 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 11 |
Similarity score: | 0.0616596 |
Original motif Consensus sequence: AGCCTAGGCCTAC | Reverse complement motif Consensus sequence: GTAGGCCTAGGCT |
Dataset #: | 1 |
Motif ID: | 47 |
Motif name: | Motif 47 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 11 |
Similarity score: | 0.0620118 |
Original motif Consensus sequence: GCCTCAGTTTCCY | Reverse complement motif Consensus sequence: MGGAAACTGAGGC |
Dataset #: 1 | Motif ID: 6 | Motif name: Motif 6 |
Original motif Consensus sequence: GCTCACTGCAASCTC | Reverse complement motif Consensus sequence: GAGSTTGCAGTGAGC |
Best Matches for Motif ID 6 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 178 |
Motif name: | Motif 178 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 6 |
Number of overlap: | 15 |
Similarity score: | 0.0768829 |
Original motif Consensus sequence: ACTGTCTTCCACCTCCACAT | Reverse complement motif Consensus sequence: ATGTGGAGGTGGAAGACAGT |
Dataset #: | 1 |
Motif ID: | 292 |
Motif name: | Motif 292 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 15 |
Similarity score: | 0.0774202 |
Original motif Consensus sequence: AAGACCTTCCAGTGGGACAA | Reverse complement motif Consensus sequence: TTGTCCCACTGGAAGGTCTT |
Dataset #: | 1 |
Motif ID: | 139 |
Motif name: | Motif 139 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 15 |
Similarity score: | 0.0892327 |
Original motif Consensus sequence: AGCCYCTGGYAACCAYYAWT | Reverse complement motif Consensus sequence: AWTKKTGGTTKCCAGKGGCT |
Dataset #: | 1 |
Motif ID: | 159 |
Motif name: | Motif 159 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 15 |
Similarity score: | 0.0907441 |
Original motif Consensus sequence: ACAGGCTTTGTGTGAGCA | Reverse complement motif Consensus sequence: TGCTCACACAAAGCCTGT |
Dataset #: | 1 |
Motif ID: | 136 |
Motif name: | Motif 136 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 15 |
Similarity score: | 0.091144 |
Original motif Consensus sequence: CCCTCACTGCCCGGGG | Reverse complement motif Consensus sequence: CCCCGGGCAGTGAGGG |
Dataset #: 1 | Motif ID: 7 | Motif name: Motif 7 |
Original motif Consensus sequence: GTCTCWAMAAAAAAWAMAAA | Reverse complement motif Consensus sequence: TTTYTWTTTTTTYTWGAGAC |
Best Matches for Motif ID 7 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 145 |
Motif name: | Motif 145 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.0958672 |
Original motif Consensus sequence: GCCAGTCACAAAARGACAMA | Reverse complement motif Consensus sequence: TYTGTCMTTTTGTGACTGGC |
Dataset #: | 1 |
Motif ID: | 83 |
Motif name: | Motif 83 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.124077 |
Original motif Consensus sequence: AAAATGTGGTAYATAYAYAC | Reverse complement motif Consensus sequence: GTKTMTATMTACCACATTTT |
Dataset #: | 1 |
Motif ID: | 109 |
Motif name: | Motif 109 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.127162 |
Original motif Consensus sequence: GAGAGAGAGAGAGAGAGAGA | Reverse complement motif Consensus sequence: TCTCTCTCTCTCTCTCTCTC |
Dataset #: | 1 |
Motif ID: | 336 |
Motif name: | Motif 336 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.127593 |
Original motif Consensus sequence: ATGTAACCAAAYACCACCTG | Reverse complement motif Consensus sequence: CAGGTGGTKTTTGGTTACAT |
Dataset #: | 1 |
Motif ID: | 119 |
Motif name: | Motif 119 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.129755 |
Original motif Consensus sequence: AAGTCCAAGATCAAGGTGYY | Reverse complement motif Consensus sequence: KKCACCTTGATCTTGGACTT |
Dataset #: 1 | Motif ID: 8 | Motif name: Motif 8 |
Original motif Consensus sequence: ATCRCTTGAGSYCAGGAGKT | Reverse complement motif Consensus sequence: ARCTCCTGKSCTCAAGKGAT |
Best Matches for Motif ID 8 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 139 |
Motif name: | Motif 139 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.0757564 |
Original motif Consensus sequence: AGCCYCTGGYAACCAYYAWT | Reverse complement motif Consensus sequence: AWTKKTGGTTKCCAGKGGCT |
Dataset #: | 1 |
Motif ID: | 119 |
Motif name: | Motif 119 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.0854742 |
Original motif Consensus sequence: AAGTCCAAGATCAAGGTGYY | Reverse complement motif Consensus sequence: KKCACCTTGATCTTGGACTT |
Dataset #: | 1 |
Motif ID: | 48 |
Motif name: | Motif 48 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.0875132 |
Original motif Consensus sequence: AGCTCCCAGCGTGAGCGACG | Reverse complement motif Consensus sequence: CGTCGCTCACGCTGGGAGCT |
Dataset #: | 1 |
Motif ID: | 65 |
Motif name: | Motif 65 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.0919085 |
Original motif Consensus sequence: AGAAATCGAGCRCAGCGCCG | Reverse complement motif Consensus sequence: CGGCGCTGMGCTCGATTTCT |
Dataset #: | 1 |
Motif ID: | 165 |
Motif name: | Motif 165 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.0931628 |
Original motif Consensus sequence: ATCTGACAGGAGGYRGAGCT | Reverse complement motif Consensus sequence: AGCTCMKCCTCCTGTCAGAT |
Dataset #: 1 | Motif ID: 9 | Motif name: Motif 9 |
Original motif Consensus sequence: CACATGGAGC | Reverse complement motif Consensus sequence: GCTCCATGTG |
Best Matches for Motif ID 9 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 353 |
Motif name: | Motif 353 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 10 |
Similarity score: | 0.0442841 |
Original motif Consensus sequence: CACATGGAAGC | Reverse complement motif Consensus sequence: GCTTCCATGTG |
Dataset #: | 1 |
Motif ID: | 326 |
Motif name: | Motif 326 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 7 |
Number of overlap: | 10 |
Similarity score: | 0.0461936 |
Original motif Consensus sequence: GACATGGAGTCAAAGG | Reverse complement motif Consensus sequence: CCTTTGACTCCATGTC |
Dataset #: | 1 |
Motif ID: | 128 |
Motif name: | Motif 128 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 10 |
Similarity score: | 0.0487399 |
Original motif Consensus sequence: CCGCACTCGGAGCRG | Reverse complement motif Consensus sequence: CMGCTCCGAGTGCGG |
Dataset #: | 1 |
Motif ID: | 257 |
Motif name: | Motif 257 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 6 |
Number of overlap: | 10 |
Similarity score: | 0.0488667 |
Original motif Consensus sequence: GAGAACACATGGACA | Reverse complement motif Consensus sequence: TGTCCATGTGTTCTC |
Dataset #: | 1 |
Motif ID: | 320 |
Motif name: | Motif 320 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 10 |
Similarity score: | 0.048999 |
Original motif Consensus sequence: CATCTGGAGCCCCA | Reverse complement motif Consensus sequence: TGGGGCTCCAGATG |
Dataset #: 1 | Motif ID: 10 | Motif name: Motif 10 |
Original motif Consensus sequence: AGGASCSTCYSWGCCMGGY | Reverse complement motif Consensus sequence: MCCYGGCWSMGASGSTCCT |
Best Matches for Motif ID 10 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 43 |
Motif name: | Motif 43 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.0458009 |
Original motif Consensus sequence: GCCAGGCAGAGRGKCTCCT | Reverse complement motif Consensus sequence: AGGAGRCMCTCTGCCTGGC |
Dataset #: | 1 |
Motif ID: | 30 |
Motif name: | Motif 30 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.0489869 |
Original motif Consensus sequence: AGGAGCGCCTCTKCCCGGC | Reverse complement motif Consensus sequence: GCCGGGRAGAGGCGCTCCT |
Dataset #: | 1 |
Motif ID: | 56 |
Motif name: | Motif 56 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.0576721 |
Original motif Consensus sequence: CRTGAGCCACYGYRCCYGGC | Reverse complement motif Consensus sequence: GCCKGGMKCMGTGGCTCAKG |
Dataset #: | 1 |
Motif ID: | 312 |
Motif name: | Motif 312 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.0673069 |
Original motif Consensus sequence: AGGACTGAGGGTGCCYRGGG | Reverse complement motif Consensus sequence: CCCMKGGCACCCTCAGTCCT |
Dataset #: | 1 |
Motif ID: | 14 |
Motif name: | Motif 14 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.0821184 |
Original motif Consensus sequence: ACCTGGAAAATCGGGTCACT | Reverse complement motif Consensus sequence: AGTGACCCGATTTTCCAGGT |
Dataset #: 1 | Motif ID: 11 | Motif name: Motif 11 |
Original motif Consensus sequence: CTCAAGGTCCA | Reverse complement motif Consensus sequence: TGGACCTTGAG |
Best Matches for Motif ID 11 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 350 |
Motif name: | Motif 350 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 8 |
Number of overlap: | 11 |
Similarity score: | 0.0546726 |
Original motif Consensus sequence: TCTGGAGTGGACCTCCAGCA | Reverse complement motif Consensus sequence: TGCTGGAGGTCCACTCCAGA |
Dataset #: | 1 |
Motif ID: | 104 |
Motif name: | Motif 104 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 10 |
Number of overlap: | 11 |
Similarity score: | 0.054717 |
Original motif Consensus sequence: CAACATGGATGRARCTGGAG | Reverse complement motif Consensus sequence: CTCCAGKTMCATCCATGTTG |
Dataset #: | 1 |
Motif ID: | 179 |
Motif name: | Motif 179 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 11 |
Similarity score: | 0.0579649 |
Original motif Consensus sequence: AGGTCCTTCAGGAGGTATTC | Reverse complement motif Consensus sequence: GAATACCTCCTGAAGGACCT |
Dataset #: | 1 |
Motif ID: | 119 |
Motif name: | Motif 119 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 10 |
Number of overlap: | 11 |
Similarity score: | 0.0624438 |
Original motif Consensus sequence: AAGTCCAAGATCAAGGTGYY | Reverse complement motif Consensus sequence: KKCACCTTGATCTTGGACTT |
Dataset #: | 1 |
Motif ID: | 100 |
Motif name: | Motif 100 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 8 |
Number of overlap: | 11 |
Similarity score: | 0.0683174 |
Original motif Consensus sequence: GCTGGCCCGCAAGCGCCGCG | Reverse complement motif Consensus sequence: CGCGGCGCTTGCGGGCCAGC |
Dataset #: 1 | Motif ID: 12 | Motif name: Motif 12 |
Original motif Consensus sequence: AGACCAGCCTGGCCAAC | Reverse complement motif Consensus sequence: GTTGGCCAGGCTGGTCT |
Best Matches for Motif ID 12 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 170 |
Motif name: | Motif 170 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 17 |
Similarity score: | 0.0789836 |
Original motif Consensus sequence: AATCAACCCTGGYRATCAAT | Reverse complement motif Consensus sequence: ATTGATMKCCAGGGTTGATT |
Dataset #: | 1 |
Motif ID: | 292 |
Motif name: | Motif 292 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 17 |
Similarity score: | 0.0836974 |
Original motif Consensus sequence: AAGACCTTCCAGTGGGACAA | Reverse complement motif Consensus sequence: TTGTCCCACTGGAAGGTCTT |
Dataset #: | 1 |
Motif ID: | 48 |
Motif name: | Motif 48 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 17 |
Similarity score: | 0.0879397 |
Original motif Consensus sequence: AGCTCCCAGCGTGAGCGACG | Reverse complement motif Consensus sequence: CGTCGCTCACGCTGGGAGCT |
Dataset #: | 1 |
Motif ID: | 82 |
Motif name: | Motif 82 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 17 |
Similarity score: | 0.0890409 |
Original motif Consensus sequence: GCTTAGCACCYGGGCCAGC | Reverse complement motif Consensus sequence: GCTGGCCCKGGTGCTAAGC |
Dataset #: | 1 |
Motif ID: | 45 |
Motif name: | Motif 45 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 17 |
Similarity score: | 0.0937553 |
Original motif Consensus sequence: TGCCCAGTCTGGAAAGTG | Reverse complement motif Consensus sequence: CACTTTCCAGACTGGGCA |
Dataset #: 1 | Motif ID: 13 | Motif name: Motif 13 |
Original motif Consensus sequence: AAGCAGGGCGAGGCATTGCC | Reverse complement motif Consensus sequence: GGCAATGCCTCGCCCTGCTT |
Best Matches for Motif ID 13 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 96 |
Motif name: | Motif 96 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.0876504 |
Original motif Consensus sequence: AAGCTGAGGGAGCCGGCTCC | Reverse complement motif Consensus sequence: GGAGCCGGCTCCCTCAGCTT |
Dataset #: | 1 |
Motif ID: | 235 |
Motif name: | Motif 235 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.115324 |
Original motif Consensus sequence: TCCAAATGGGAGAAATTGGC | Reverse complement motif Consensus sequence: GCCAATTTCTCCCATTTGGA |
Dataset #: | 1 |
Motif ID: | 202 |
Motif name: | Motif 202 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.115526 |
Original motif Consensus sequence: ACACATCACAAAGCAGTTTC | Reverse complement motif Consensus sequence: GAAACTGCTTTGTGATGTGT |
Dataset #: | 1 |
Motif ID: | 99 |
Motif name: | Motif 99 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.119281 |
Original motif Consensus sequence: GCAAAKGACATGATYTCATT | Reverse complement motif Consensus sequence: AATGAKATCATGTCYTTTGC |
Dataset #: | 1 |
Motif ID: | 225 |
Motif name: | Motif 225 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.120924 |
Original motif Consensus sequence: GCACATGTAYCCYAGAACTT | Reverse complement motif Consensus sequence: AAGTTCTKGGKTACATGTGC |
Dataset #: 1 | Motif ID: 14 | Motif name: Motif 14 |
Original motif Consensus sequence: ACCTGGAAAATCGGGTCACT | Reverse complement motif Consensus sequence: AGTGACCCGATTTTCCAGGT |
Best Matches for Motif ID 14 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 56 |
Motif name: | Motif 56 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.120636 |
Original motif Consensus sequence: CRTGAGCCACYGYRCCYGGC | Reverse complement motif Consensus sequence: GCCKGGMKCMGTGGCTCAKG |
Dataset #: | 1 |
Motif ID: | 63 |
Motif name: | Motif 63 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.12936 |
Original motif Consensus sequence: AGTGAGAACATRYRRTRTTT | Reverse complement motif Consensus sequence: AAAMAMMKMATGTTCTCACT |
Dataset #: | 1 |
Motif ID: | 176 |
Motif name: | Motif 176 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.133601 |
Original motif Consensus sequence: AGGCCCCAGTGTSTGTTGTT | Reverse complement motif Consensus sequence: AACAACASACACTGGGGCCT |
Dataset #: | 1 |
Motif ID: | 294 |
Motif name: | Motif 294 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.133651 |
Original motif Consensus sequence: AGCTGTGAGAAGAGGGCCAC | Reverse complement motif Consensus sequence: GTGGCCCTCTTCTCACAGCT |
Dataset #: | 1 |
Motif ID: | 52 |
Motif name: | Motif 52 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.134283 |
Original motif Consensus sequence: GACTGGCAGGCAGCTCCACC | Reverse complement motif Consensus sequence: GGTGGAGCTGCCTGCCAGTC |
Dataset #: 1 | Motif ID: 15 | Motif name: Motif 15 |
Original motif Consensus sequence: CTTGCGCTTCCCRRGTGA | Reverse complement motif Consensus sequence: TCACKMGGGAAGCGCAAG |
Best Matches for Motif ID 15 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 350 |
Motif name: | Motif 350 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 18 |
Similarity score: | 0.112624 |
Original motif Consensus sequence: TCTGGAGTGGACCTCCAGCA | Reverse complement motif Consensus sequence: TGCTGGAGGTCCACTCCAGA |
Dataset #: | 1 |
Motif ID: | 164 |
Motif name: | Motif 164 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 18 |
Similarity score: | 0.117199 |
Original motif Consensus sequence: AGCCCCGGTTCCCGCYCGC | Reverse complement motif Consensus sequence: GCGMGCGGGAACCGGGGCT |
Dataset #: | 1 |
Motif ID: | 196 |
Motif name: | Motif 196 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 18 |
Similarity score: | 0.117616 |
Original motif Consensus sequence: CCTGCCATTGCYSAGGCTTG | Reverse complement motif Consensus sequence: CAAGCCTSKGCAATGGCAGG |
Dataset #: | 1 |
Motif ID: | 53 |
Motif name: | Motif 53 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 18 |
Similarity score: | 0.117943 |
Original motif Consensus sequence: GTCCCATCGACCACCCAAG | Reverse complement motif Consensus sequence: CTTGGGTGGTCGATGGGAC |
Dataset #: | 1 |
Motif ID: | 332 |
Motif name: | Motif 332 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 18 |
Similarity score: | 0.118862 |
Original motif Consensus sequence: CTGGCCCTCAATGGTTAAAC | Reverse complement motif Consensus sequence: GTTTAACCATTGAGGGCCAG |
Dataset #: 1 | Motif ID: 16 | Motif name: Motif 16 |
Original motif Consensus sequence: GAAAGGGAACTCCCTGACCC | Reverse complement motif Consensus sequence: GGGTCAGGGAGTTCCCTTTC |
Best Matches for Motif ID 16 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 293 |
Motif name: | Motif 293 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.122102 |
Original motif Consensus sequence: CTGACTGGGAGACACCTCCC | Reverse complement motif Consensus sequence: GGGAGGTGTCTCCCAGTCAG |
Dataset #: | 1 |
Motif ID: | 310 |
Motif name: | Motif 310 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.12749 |
Original motif Consensus sequence: CCCATGCAAGTCYRAAATCC | Reverse complement motif Consensus sequence: GGATTTMKGACTTGCATGGG |
Dataset #: | 1 |
Motif ID: | 76 |
Motif name: | Motif 76 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.129322 |
Original motif Consensus sequence: GTGCCAGGCACTGTKCTARG | Reverse complement motif Consensus sequence: CMTAGYACAGTGCCTGGCAC |
Dataset #: | 1 |
Motif ID: | 312 |
Motif name: | Motif 312 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.129551 |
Original motif Consensus sequence: AGGACTGAGGGTGCCYRGGG | Reverse complement motif Consensus sequence: CCCMKGGCACCCTCAGTCCT |
Dataset #: | 1 |
Motif ID: | 52 |
Motif name: | Motif 52 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.133875 |
Original motif Consensus sequence: GACTGGCAGGCAGCTCCACC | Reverse complement motif Consensus sequence: GGTGGAGCTGCCTGCCAGTC |
Dataset #: 1 | Motif ID: 17 | Motif name: Motif 17 |
Original motif Consensus sequence: AGACAGTGGGYGCAGGHCA | Reverse complement motif Consensus sequence: TGHCCTGCKCCCACTGTCT |
Best Matches for Motif ID 17 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 65 |
Motif name: | Motif 65 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.0792941 |
Original motif Consensus sequence: AGAAATCGAGCRCAGCGCCG | Reverse complement motif Consensus sequence: CGGCGCTGMGCTCGATTTCT |
Dataset #: | 1 |
Motif ID: | 312 |
Motif name: | Motif 312 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.0967987 |
Original motif Consensus sequence: AGGACTGAGGGTGCCYRGGG | Reverse complement motif Consensus sequence: CCCMKGGCACCCTCAGTCCT |
Dataset #: | 1 |
Motif ID: | 193 |
Motif name: | Motif 193 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.0971018 |
Original motif Consensus sequence: ATACAATGGGGGTACAGRC | Reverse complement motif Consensus sequence: GKCTGTACCCCCATTGTAT |
Dataset #: | 1 |
Motif ID: | 96 |
Motif name: | Motif 96 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.0996968 |
Original motif Consensus sequence: AAGCTGAGGGAGCCGGCTCC | Reverse complement motif Consensus sequence: GGAGCCGGCTCCCTCAGCTT |
Dataset #: | 1 |
Motif ID: | 109 |
Motif name: | Motif 109 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.101245 |
Original motif Consensus sequence: GAGAGAGAGAGAGAGAGAGA | Reverse complement motif Consensus sequence: TCTCTCTCTCTCTCTCTCTC |
Dataset #: 1 | Motif ID: 18 | Motif name: Motif 18 |
Original motif Consensus sequence: GAAAAGCGCAGTATTMGGG | Reverse complement motif Consensus sequence: CCCYAATACTGCGCTTTTC |
Best Matches for Motif ID 18 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 160 |
Motif name: | Motif 160 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.112986 |
Original motif Consensus sequence: AAATTACCCAGTCTCAGGTA | Reverse complement motif Consensus sequence: TACCTGAGACTGGGTAATTT |
Dataset #: | 1 |
Motif ID: | 195 |
Motif name: | Motif 195 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.113548 |
Original motif Consensus sequence: TAAAAGACTACAWATTGGGT | Reverse complement motif Consensus sequence: ACCCAATWTGTAGTCTTTTA |
Dataset #: | 1 |
Motif ID: | 235 |
Motif name: | Motif 235 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.12058 |
Original motif Consensus sequence: TCCAAATGGGAGAAATTGGC | Reverse complement motif Consensus sequence: GCCAATTTCTCCCATTTGGA |
Dataset #: | 1 |
Motif ID: | 201 |
Motif name: | Motif 201 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.124626 |
Original motif Consensus sequence: GTAACACTCACCGCGARGGT | Reverse complement motif Consensus sequence: ACCKTCGCGGTGAGTGTTAC |
Dataset #: | 1 |
Motif ID: | 99 |
Motif name: | Motif 99 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.125732 |
Original motif Consensus sequence: GCAAAKGACATGATYTCATT | Reverse complement motif Consensus sequence: AATGAKATCATGTCYTTTGC |
Dataset #: 1 | Motif ID: 19 | Motif name: Motif 19 |
Original motif Consensus sequence: CACCAGGAGATTATATCCCR | Reverse complement motif Consensus sequence: MGGGATATAATCTCCTGGTG |
Best Matches for Motif ID 19 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 99 |
Motif name: | Motif 99 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.11753 |
Original motif Consensus sequence: GCAAAKGACATGATYTCATT | Reverse complement motif Consensus sequence: AATGAKATCATGTCYTTTGC |
Dataset #: | 1 |
Motif ID: | 63 |
Motif name: | Motif 63 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.126684 |
Original motif Consensus sequence: AGTGAGAACATRYRRTRTTT | Reverse complement motif Consensus sequence: AAAMAMMKMATGTTCTCACT |
Dataset #: | 1 |
Motif ID: | 336 |
Motif name: | Motif 336 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.137442 |
Original motif Consensus sequence: ATGTAACCAAAYACCACCTG | Reverse complement motif Consensus sequence: CAGGTGGTKTTTGGTTACAT |
Dataset #: | 1 |
Motif ID: | 67 |
Motif name: | Motif 67 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.137843 |
Original motif Consensus sequence: CTGGGCTCCTGAGTCTGGTG | Reverse complement motif Consensus sequence: CACCAGACTCAGGAGCCCAG |
Dataset #: | 1 |
Motif ID: | 104 |
Motif name: | Motif 104 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.139054 |
Original motif Consensus sequence: CAACATGGATGRARCTGGAG | Reverse complement motif Consensus sequence: CTCCAGKTMCATCCATGTTG |
Dataset #: 1 | Motif ID: 20 | Motif name: Motif 20 |
Original motif Consensus sequence: ACAATGGACC | Reverse complement motif Consensus sequence: GGTCCATTGT |
Best Matches for Motif ID 20 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 193 |
Motif name: | Motif 193 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 10 |
Similarity score: | 0.0500147 |
Original motif Consensus sequence: ATACAATGGGGGTACAGRC | Reverse complement motif Consensus sequence: GKCTGTACCCCCATTGTAT |
Dataset #: | 1 |
Motif ID: | 322 |
Motif name: | Motif 322 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 7 |
Number of overlap: | 10 |
Similarity score: | 0.059291 |
Original motif Consensus sequence: AGGGCCTTTGCASWTGC | Reverse complement motif Consensus sequence: GCAWSTGCAAAGGCCCT |
Dataset #: | 1 |
Motif ID: | 284 |
Motif name: | Motif 284 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 10 |
Similarity score: | 0.0608949 |
Original motif Consensus sequence: CATTTGGGAGCCCATTGA | Reverse complement motif Consensus sequence: TCAATGGGCTCCCAAATG |
Dataset #: | 1 |
Motif ID: | 36 |
Motif name: | Motif 36 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 10 |
Similarity score: | 0.0668018 |
Original motif Consensus sequence: ACATCCCAGACGATGGGCG | Reverse complement motif Consensus sequence: CGCCCATCGTCTGGGATGT |
Dataset #: | 1 |
Motif ID: | 147 |
Motif name: | Motif 147 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 10 |
Similarity score: | 0.0697279 |
Original motif Consensus sequence: CTGGGCACCATTGA | Reverse complement motif Consensus sequence: TCAATGGTGCCCAG |
Dataset #: 1 | Motif ID: 21 | Motif name: Motif 21 |
Original motif Consensus sequence: GCCGTTTKTTAAGCCCGTY | Reverse complement motif Consensus sequence: KACGGGCTTAARAAACGGC |
Best Matches for Motif ID 21 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 195 |
Motif name: | Motif 195 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.116692 |
Original motif Consensus sequence: TAAAAGACTACAWATTGGGT | Reverse complement motif Consensus sequence: ACCCAATWTGTAGTCTTTTA |
Dataset #: | 1 |
Motif ID: | 139 |
Motif name: | Motif 139 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.119179 |
Original motif Consensus sequence: AGCCYCTGGYAACCAYYAWT | Reverse complement motif Consensus sequence: AWTKKTGGTTKCCAGKGGCT |
Dataset #: | 1 |
Motif ID: | 194 |
Motif name: | Motif 194 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.119838 |
Original motif Consensus sequence: CAAGGGTATAYGAGTAGCTG | Reverse complement motif Consensus sequence: CAGCTACTCKTATACCCTTG |
Dataset #: | 1 |
Motif ID: | 100 |
Motif name: | Motif 100 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.120266 |
Original motif Consensus sequence: GCTGGCCCGCAAGCGCCGCG | Reverse complement motif Consensus sequence: CGCGGCGCTTGCGGGCCAGC |
Dataset #: | 1 |
Motif ID: | 242 |
Motif name: | Motif 242 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.122834 |
Original motif Consensus sequence: AACCCTATTGTGAACTGYG | Reverse complement motif Consensus sequence: CMCAGTTCACAATAGGGTT |
Dataset #: 1 | Motif ID: 22 | Motif name: Motif 22 |
Original motif Consensus sequence: ATCTCAGACKRY | Reverse complement motif Consensus sequence: KMRGTCTGAGAT |
Best Matches for Motif ID 22 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 36 |
Motif name: | Motif 36 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 6 |
Number of overlap: | 12 |
Similarity score: | 0.0496789 |
Original motif Consensus sequence: ACATCCCAGACGATGGGCG | Reverse complement motif Consensus sequence: CGCCCATCGTCTGGGATGT |
Dataset #: | 1 |
Motif ID: | 261 |
Motif name: | Motif 261 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 12 |
Similarity score: | 0.0600848 |
Original motif Consensus sequence: ATCTCASAAATCACCACTA | Reverse complement motif Consensus sequence: TAGTGGTGATTTSTGAGAT |
Dataset #: | 1 |
Motif ID: | 27 |
Motif name: | Motif 27 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 12 |
Similarity score: | 0.0627798 |
Original motif Consensus sequence: CACTTCCCAGACGGGGCG | Reverse complement motif Consensus sequence: CGCCCCGTCTGGGAAGTG |
Dataset #: | 1 |
Motif ID: | 310 |
Motif name: | Motif 310 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 7 |
Number of overlap: | 12 |
Similarity score: | 0.0718284 |
Original motif Consensus sequence: CCCATGCAAGTCYRAAATCC | Reverse complement motif Consensus sequence: GGATTTMKGACTTGCATGGG |
Dataset #: | 1 |
Motif ID: | 227 |
Motif name: | Motif 227 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 12 |
Similarity score: | 0.0718827 |
Original motif Consensus sequence: CCCAAATCTCATSTTGAAT | Reverse complement motif Consensus sequence: ATTCAASATGAGATTTGGG |
Dataset #: 1 | Motif ID: 23 | Motif name: Motif 23 |
Original motif Consensus sequence: GGTTCATCTCACTAGGGAGT | Reverse complement motif Consensus sequence: ACTCCCTAGTGAGATGAACC |
Best Matches for Motif ID 23 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 48 |
Motif name: | Motif 48 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.116157 |
Original motif Consensus sequence: AGCTCCCAGCGTGAGCGACG | Reverse complement motif Consensus sequence: CGTCGCTCACGCTGGGAGCT |
Dataset #: | 1 |
Motif ID: | 331 |
Motif name: | Motif 331 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.123973 |
Original motif Consensus sequence: CCACCACAGCTCAAGGAGGC | Reverse complement motif Consensus sequence: GCCTCCTTGAGCTGTGGTGG |
Dataset #: | 1 |
Motif ID: | 321 |
Motif name: | Motif 321 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.124427 |
Original motif Consensus sequence: AAGCTCGAACTGGGTGGAGC | Reverse complement motif Consensus sequence: GCTCCACCCAGTTCGAGCTT |
Dataset #: | 1 |
Motif ID: | 3 |
Motif name: | Motif 3 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.127278 |
Original motif Consensus sequence: GCTGGAGTGCAGTGGCRYGA | Reverse complement motif Consensus sequence: TCKMGCCACTGCACTCCAGC |
Dataset #: | 1 |
Motif ID: | 176 |
Motif name: | Motif 176 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.129596 |
Original motif Consensus sequence: AGGCCCCAGTGTSTGTTGTT | Reverse complement motif Consensus sequence: AACAACASACACTGGGGCCT |
Dataset #: 1 | Motif ID: 24 | Motif name: Motif 24 |
Original motif Consensus sequence: CKAGTCAAAGAAA | Reverse complement motif Consensus sequence: TTTCTTTGACTRG |
Best Matches for Motif ID 24 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 274 |
Motif name: | Motif 274 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 13 |
Similarity score: | 0.0524968 |
Original motif Consensus sequence: CTGGTCAAGGAAA | Reverse complement motif Consensus sequence: TTTCCTTGACCAG |
Dataset #: | 1 |
Motif ID: | 23 |
Motif name: | Motif 23 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 6 |
Number of overlap: | 13 |
Similarity score: | 0.0775612 |
Original motif Consensus sequence: GGTTCATCTCACTAGGGAGT | Reverse complement motif Consensus sequence: ACTCCCTAGTGAGATGAACC |
Dataset #: | 1 |
Motif ID: | 129 |
Motif name: | Motif 129 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 13 |
Similarity score: | 0.0797194 |
Original motif Consensus sequence: AAGAGGTTTAATTGRCTCA | Reverse complement motif Consensus sequence: TGAGKCAATTAAACCTCTT |
Dataset #: | 1 |
Motif ID: | 145 |
Motif name: | Motif 145 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 7 |
Number of overlap: | 13 |
Similarity score: | 0.0798508 |
Original motif Consensus sequence: GCCAGTCACAAAARGACAMA | Reverse complement motif Consensus sequence: TYTGTCMTTTTGTGACTGGC |
Dataset #: | 1 |
Motif ID: | 148 |
Motif name: | Motif 148 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 13 |
Similarity score: | 0.0937628 |
Original motif Consensus sequence: AAAGAGAGTCAGCGAAG | Reverse complement motif Consensus sequence: CTTCGCTGACTCTCTTT |
Dataset #: 1 | Motif ID: 25 | Motif name: Motif 25 |
Original motif Consensus sequence: CATTTCCAWCTGAGGTAC | Reverse complement motif Consensus sequence: GTACCTCAGWTGGAAATG |
Best Matches for Motif ID 25 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 179 |
Motif name: | Motif 179 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 18 |
Similarity score: | 0.0987898 |
Original motif Consensus sequence: AGGTCCTTCAGGAGGTATTC | Reverse complement motif Consensus sequence: GAATACCTCCTGAAGGACCT |
Dataset #: | 1 |
Motif ID: | 332 |
Motif name: | Motif 332 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 18 |
Similarity score: | 0.110707 |
Original motif Consensus sequence: CTGGCCCTCAATGGTTAAAC | Reverse complement motif Consensus sequence: GTTTAACCATTGAGGGCCAG |
Dataset #: | 1 |
Motif ID: | 122 |
Motif name: | Motif 122 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 18 |
Similarity score: | 0.117106 |
Original motif Consensus sequence: CCTTGGCCAGCCCAGAAAG | Reverse complement motif Consensus sequence: CTTTCTGGGCTGGCCAAGG |
Dataset #: | 1 |
Motif ID: | 68 |
Motif name: | Motif 68 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 18 |
Similarity score: | 0.118191 |
Original motif Consensus sequence: CATGGCGGGCTGCAGGTC | Reverse complement motif Consensus sequence: GACCTGCAGCCCGCCATG |
Dataset #: | 1 |
Motif ID: | 331 |
Motif name: | Motif 331 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 18 |
Similarity score: | 0.118723 |
Original motif Consensus sequence: CCACCACAGCTCAAGGAGGC | Reverse complement motif Consensus sequence: GCCTCCTTGAGCTGTGGTGG |
Dataset #: 1 | Motif ID: 26 | Motif name: Motif 26 |
Original motif Consensus sequence: CTCCTGCCTCAGCCTCCCRA | Reverse complement motif Consensus sequence: TMGGGAGGCTGAGGCAGGAG |
Best Matches for Motif ID 26 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 67 |
Motif name: | Motif 67 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.0991184 |
Original motif Consensus sequence: CTGGGCTCCTGAGTCTGGTG | Reverse complement motif Consensus sequence: CACCAGACTCAGGAGCCCAG |
Dataset #: | 1 |
Motif ID: | 104 |
Motif name: | Motif 104 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.111358 |
Original motif Consensus sequence: CAACATGGATGRARCTGGAG | Reverse complement motif Consensus sequence: CTCCAGKTMCATCCATGTTG |
Dataset #: | 1 |
Motif ID: | 29 |
Motif name: | Motif 29 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.113787 |
Original motif Consensus sequence: CTGGGCRACAGAGYRAGACY | Reverse complement motif Consensus sequence: MGTCTMKCTCTGTKGCCCAG |
Dataset #: | 1 |
Motif ID: | 64 |
Motif name: | Motif 64 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.115298 |
Original motif Consensus sequence: GAAGGCAGCTAAGGCCCGGY | Reverse complement motif Consensus sequence: KCCGGGCCTTAGCTGCCTTC |
Dataset #: | 1 |
Motif ID: | 109 |
Motif name: | Motif 109 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.121771 |
Original motif Consensus sequence: GAGAGAGAGAGAGAGAGAGA | Reverse complement motif Consensus sequence: TCTCTCTCTCTCTCTCTCTC |
Dataset #: 1 | Motif ID: 27 | Motif name: Motif 27 |
Original motif Consensus sequence: CACTTCCCAGACGGGGCG | Reverse complement motif Consensus sequence: CGCCCCGTCTGGGAAGTG |
Best Matches for Motif ID 27 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 45 |
Motif name: | Motif 45 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 18 |
Similarity score: | 0.0413095 |
Original motif Consensus sequence: TGCCCAGTCTGGAAAGTG | Reverse complement motif Consensus sequence: CACTTTCCAGACTGGGCA |
Dataset #: | 1 |
Motif ID: | 155 |
Motif name: | Motif 155 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 18 |
Similarity score: | 0.0525092 |
Original motif Consensus sequence: TCCCTCCCGGACGGGGYGGC | Reverse complement motif Consensus sequence: GCCKCCCCGTCCGGGAGGGA |
Dataset #: | 1 |
Motif ID: | 260 |
Motif name: | Motif 260 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 18 |
Similarity score: | 0.0884142 |
Original motif Consensus sequence: GGTGCCCCTCTGGGACRAA | Reverse complement motif Consensus sequence: TTMGTCCCAGAGGGGCACC |
Dataset #: | 1 |
Motif ID: | 144 |
Motif name: | Motif 144 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 18 |
Similarity score: | 0.0977824 |
Original motif Consensus sequence: CCGCTGCACTGTGGGAGCCC | Reverse complement motif Consensus sequence: GGGCTCCCACAGTGCAGCGG |
Dataset #: | 1 |
Motif ID: | 176 |
Motif name: | Motif 176 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 18 |
Similarity score: | 0.0995243 |
Original motif Consensus sequence: AGGCCCCAGTGTSTGTTGTT | Reverse complement motif Consensus sequence: AACAACASACACTGGGGCCT |
Dataset #: 1 | Motif ID: 28 | Motif name: Motif 28 |
Original motif Consensus sequence: GTCACCCCATT | Reverse complement motif Consensus sequence: AATGGGGTGAC |
Best Matches for Motif ID 28 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 193 |
Motif name: | Motif 193 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 11 |
Similarity score: | 0.0423623 |
Original motif Consensus sequence: ATACAATGGGGGTACAGRC | Reverse complement motif Consensus sequence: GKCTGTACCCCCATTGTAT |
Dataset #: | 1 |
Motif ID: | 14 |
Motif name: | Motif 14 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 11 |
Similarity score: | 0.0486677 |
Original motif Consensus sequence: ACCTGGAAAATCGGGTCACT | Reverse complement motif Consensus sequence: AGTGACCCGATTTTCCAGGT |
Dataset #: | 1 |
Motif ID: | 232 |
Motif name: | Motif 232 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 7 |
Number of overlap: | 11 |
Similarity score: | 0.0491797 |
Original motif Consensus sequence: AGTTGTAATTGGGAGACTT | Reverse complement motif Consensus sequence: AAGTCTCCCAATTACAACT |
Dataset #: | 1 |
Motif ID: | 284 |
Motif name: | Motif 284 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 11 |
Similarity score: | 0.0587499 |
Original motif Consensus sequence: CATTTGGGAGCCCATTGA | Reverse complement motif Consensus sequence: TCAATGGGCTCCCAAATG |
Dataset #: | 1 |
Motif ID: | 155 |
Motif name: | Motif 155 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 10 |
Number of overlap: | 11 |
Similarity score: | 0.0773836 |
Original motif Consensus sequence: TCCCTCCCGGACGGGGYGGC | Reverse complement motif Consensus sequence: GCCKCCCCGTCCGGGAGGGA |
Dataset #: 1 | Motif ID: 29 | Motif name: Motif 29 |
Original motif Consensus sequence: CTGGGCRACAGAGYRAGACY | Reverse complement motif Consensus sequence: MGTCTMKCTCTGTKGCCCAG |
Best Matches for Motif ID 29 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 109 |
Motif name: | Motif 109 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.0944011 |
Original motif Consensus sequence: GAGAGAGAGAGAGAGAGAGA | Reverse complement motif Consensus sequence: TCTCTCTCTCTCTCTCTCTC |
Dataset #: | 1 |
Motif ID: | 67 |
Motif name: | Motif 67 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.100789 |
Original motif Consensus sequence: CTGGGCTCCTGAGTCTGGTG | Reverse complement motif Consensus sequence: CACCAGACTCAGGAGCCCAG |
Dataset #: | 1 |
Motif ID: | 84 |
Motif name: | Motif 84 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.103081 |
Original motif Consensus sequence: CTGGGTCCCCCAGCAGTGCC | Reverse complement motif Consensus sequence: GGCACTGCTGGGGGACCCAG |
Dataset #: | 1 |
Motif ID: | 26 |
Motif name: | Motif 26 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.108553 |
Original motif Consensus sequence: CTCCTGCCTCAGCCTCCCRA | Reverse complement motif Consensus sequence: TMGGGAGGCTGAGGCAGGAG |
Dataset #: | 1 |
Motif ID: | 144 |
Motif name: | Motif 144 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.11235 |
Original motif Consensus sequence: CCGCTGCACTGTGGGAGCCC | Reverse complement motif Consensus sequence: GGGCTCCCACAGTGCAGCGG |
Dataset #: 1 | Motif ID: 30 | Motif name: Motif 30 |
Original motif Consensus sequence: AGGAGCGCCTCTKCCCGGC | Reverse complement motif Consensus sequence: GCCGGGRAGAGGCGCTCCT |
Best Matches for Motif ID 30 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 43 |
Motif name: | Motif 43 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.0399316 |
Original motif Consensus sequence: GCCAGGCAGAGRGKCTCCT | Reverse complement motif Consensus sequence: AGGAGRCMCTCTGCCTGGC |
Dataset #: | 1 |
Motif ID: | 10 |
Motif name: | Motif 10 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.0610031 |
Original motif Consensus sequence: AGGASCSTCYSWGCCMGGY | Reverse complement motif Consensus sequence: MCCYGGCWSMGASGSTCCT |
Dataset #: | 1 |
Motif ID: | 56 |
Motif name: | Motif 56 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.077695 |
Original motif Consensus sequence: CRTGAGCCACYGYRCCYGGC | Reverse complement motif Consensus sequence: GCCKGGMKCMGTGGCTCAKG |
Dataset #: | 1 |
Motif ID: | 62 |
Motif name: | Motif 62 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.0937137 |
Original motif Consensus sequence: AGGAACAGCTCCRGTCTAC | Reverse complement motif Consensus sequence: GTAGACKGGAGCTGTTCCT |
Dataset #: | 1 |
Motif ID: | 312 |
Motif name: | Motif 312 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.0942612 |
Original motif Consensus sequence: AGGACTGAGGGTGCCYRGGG | Reverse complement motif Consensus sequence: CCCMKGGCACCCTCAGTCCT |
Dataset #: 1 | Motif ID: 31 | Motif name: Motif 31 |
Original motif Consensus sequence: CCGTGCGCGAGCCG | Reverse complement motif Consensus sequence: CGGCTCGCGCACGG |
Best Matches for Motif ID 31 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 299 |
Motif name: | Motif 299 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 14 |
Similarity score: | 0.0706247 |
Original motif Consensus sequence: CCCTGCTAGAACCTCCAA | Reverse complement motif Consensus sequence: TTGGAGGTTCTAGCAGGG |
Dataset #: | 1 |
Motif ID: | 48 |
Motif name: | Motif 48 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 14 |
Similarity score: | 0.0742371 |
Original motif Consensus sequence: AGCTCCCAGCGTGAGCGACG | Reverse complement motif Consensus sequence: CGTCGCTCACGCTGGGAGCT |
Dataset #: | 1 |
Motif ID: | 64 |
Motif name: | Motif 64 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 14 |
Similarity score: | 0.0791073 |
Original motif Consensus sequence: GAAGGCAGCTAAGGCCCGGY | Reverse complement motif Consensus sequence: KCCGGGCCTTAGCTGCCTTC |
Dataset #: | 1 |
Motif ID: | 164 |
Motif name: | Motif 164 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 14 |
Similarity score: | 0.0804139 |
Original motif Consensus sequence: AGCCCCGGTTCCCGCYCGC | Reverse complement motif Consensus sequence: GCGMGCGGGAACCGGGGCT |
Dataset #: | 1 |
Motif ID: | 96 |
Motif name: | Motif 96 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 14 |
Similarity score: | 0.0852899 |
Original motif Consensus sequence: AAGCTGAGGGAGCCGGCTCC | Reverse complement motif Consensus sequence: GGAGCCGGCTCCCTCAGCTT |
Dataset #: 1 | Motif ID: 32 | Motif name: Motif 32 |
Original motif Consensus sequence: ATGGTGAAACCC | Reverse complement motif Consensus sequence: GGGTTTCACCAT |
Best Matches for Motif ID 32 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 61 |
Motif name: | Motif 61 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 9 |
Number of overlap: | 12 |
Similarity score: | 0.0712132 |
Original motif Consensus sequence: GGATCCACTGGGTGAAGCCA | Reverse complement motif Consensus sequence: TGGCTTCACCCAGTGGATCC |
Dataset #: | 1 |
Motif ID: | 204 |
Motif name: | Motif 204 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 12 |
Similarity score: | 0.0785008 |
Original motif Consensus sequence: AGAGYRAGACTCC | Reverse complement motif Consensus sequence: GGAGTCTMKCTCT |
Dataset #: | 1 |
Motif ID: | 253 |
Motif name: | Motif 253 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 12 |
Similarity score: | 0.0802664 |
Original motif Consensus sequence: AGAGTCTCACTCTGT | Reverse complement motif Consensus sequence: ACAGAGTGAGACTCT |
Dataset #: | 1 |
Motif ID: | 310 |
Motif name: | Motif 310 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 12 |
Similarity score: | 0.0852091 |
Original motif Consensus sequence: CCCATGCAAGTCYRAAATCC | Reverse complement motif Consensus sequence: GGATTTMKGACTTGCATGGG |
Dataset #: | 1 |
Motif ID: | 16 |
Motif name: | Motif 16 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 8 |
Number of overlap: | 12 |
Similarity score: | 0.0877995 |
Original motif Consensus sequence: GAAAGGGAACTCCCTGACCC | Reverse complement motif Consensus sequence: GGGTCAGGGAGTTCCCTTTC |
Dataset #: 1 | Motif ID: 33 | Motif name: Motif 33 |
Original motif Consensus sequence: ACGCCCACGGAGTCTC | Reverse complement motif Consensus sequence: GAGACTCCGTGGGCGT |
Best Matches for Motif ID 33 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 291 |
Motif name: | Motif 291 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 16 |
Similarity score: | 0.0890595 |
Original motif Consensus sequence: CTGAGGACCTGAGGTCRTA | Reverse complement motif Consensus sequence: TAMGACCTCAGGTCCTCAG |
Dataset #: | 1 |
Motif ID: | 159 |
Motif name: | Motif 159 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 16 |
Similarity score: | 0.100481 |
Original motif Consensus sequence: ACAGGCTTTGTGTGAGCA | Reverse complement motif Consensus sequence: TGCTCACACAAAGCCTGT |
Dataset #: | 1 |
Motif ID: | 144 |
Motif name: | Motif 144 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 16 |
Similarity score: | 0.102336 |
Original motif Consensus sequence: CCGCTGCACTGTGGGAGCCC | Reverse complement motif Consensus sequence: GGGCTCCCACAGTGCAGCGG |
Dataset #: | 1 |
Motif ID: | 10 |
Motif name: | Motif 10 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 16 |
Similarity score: | 0.103114 |
Original motif Consensus sequence: AGGASCSTCYSWGCCMGGY | Reverse complement motif Consensus sequence: MCCYGGCWSMGASGSTCCT |
Dataset #: | 1 |
Motif ID: | 67 |
Motif name: | Motif 67 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 16 |
Similarity score: | 0.103795 |
Original motif Consensus sequence: CTGGGCTCCTGAGTCTGGTG | Reverse complement motif Consensus sequence: CACCAGACTCAGGAGCCCAG |
Dataset #: 1 | Motif ID: 34 | Motif name: Motif 34 |
Original motif Consensus sequence: GGACGCACA | Reverse complement motif Consensus sequence: TGTGCGTCC |
Best Matches for Motif ID 34 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 314 |
Motif name: | Motif 314 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 9 |
Similarity score: | 0.0220227 |
Original motif Consensus sequence: GGAACGCACAT | Reverse complement motif Consensus sequence: ATGTGCGTTCC |
Dataset #: | 1 |
Motif ID: | 87 |
Motif name: | Motif 87 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 9 |
Similarity score: | 0.0275308 |
Original motif Consensus sequence: CATGTGTGTCC | Reverse complement motif Consensus sequence: GGACACACATG |
Dataset #: | 1 |
Motif ID: | 206 |
Motif name: | Motif 206 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 9 |
Similarity score: | 0.0465084 |
Original motif Consensus sequence: GCTCCWGTGYGKCC | Reverse complement motif Consensus sequence: GGRCKCACWGGAGC |
Dataset #: | 1 |
Motif ID: | 215 |
Motif name: | Motif 215 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 7 |
Number of overlap: | 9 |
Similarity score: | 0.0483962 |
Original motif Consensus sequence: HGCTCCTGTGSKCCC | Reverse complement motif Consensus sequence: GGGRSCACAGGAGCD |
Dataset #: | 1 |
Motif ID: | 120 |
Motif name: | Motif 120 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 9 |
Similarity score: | 0.0524947 |
Original motif Consensus sequence: CCATGTGSTCCC | Reverse complement motif Consensus sequence: GGGASCACATGG |
Dataset #: 1 | Motif ID: 35 | Motif name: Motif 35 |
Original motif Consensus sequence: CAGAAATCACCCGTCTT | Reverse complement motif Consensus sequence: AAGACGGGTGATTTCTG |
Best Matches for Motif ID 35 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 85 |
Motif name: | Motif 85 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 17 |
Similarity score: | 0.104456 |
Original motif Consensus sequence: CTAGACATAAAGGTTCTCCA | Reverse complement motif Consensus sequence: TGGAGAACCTTTATGTCTAG |
Dataset #: | 1 |
Motif ID: | 191 |
Motif name: | Motif 191 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 17 |
Similarity score: | 0.109156 |
Original motif Consensus sequence: AAAGTGCCGAGAKTGCAGC | Reverse complement motif Consensus sequence: GCTGCARTCTCGGCACTTT |
Dataset #: | 1 |
Motif ID: | 62 |
Motif name: | Motif 62 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 17 |
Similarity score: | 0.112474 |
Original motif Consensus sequence: AGGAACAGCTCCRGTCTAC | Reverse complement motif Consensus sequence: GTAGACKGGAGCTGTTCCT |
Dataset #: | 1 |
Motif ID: | 13 |
Motif name: | Motif 13 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 17 |
Similarity score: | 0.113142 |
Original motif Consensus sequence: AAGCAGGGCGAGGCATTGCC | Reverse complement motif Consensus sequence: GGCAATGCCTCGCCCTGCTT |
Dataset #: | 1 |
Motif ID: | 235 |
Motif name: | Motif 235 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 17 |
Similarity score: | 0.11691 |
Original motif Consensus sequence: TCCAAATGGGAGAAATTGGC | Reverse complement motif Consensus sequence: GCCAATTTCTCCCATTTGGA |
Dataset #: 1 | Motif ID: 36 | Motif name: Motif 36 |
Original motif Consensus sequence: ACATCCCAGACGATGGGCG | Reverse complement motif Consensus sequence: CGCCCATCGTCTGGGATGT |
Best Matches for Motif ID 36 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 155 |
Motif name: | Motif 155 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.102313 |
Original motif Consensus sequence: TCCCTCCCGGACGGGGYGGC | Reverse complement motif Consensus sequence: GCCKCCCCGTCCGGGAGGGA |
Dataset #: | 1 |
Motif ID: | 176 |
Motif name: | Motif 176 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.105478 |
Original motif Consensus sequence: AGGCCCCAGTGTSTGTTGTT | Reverse complement motif Consensus sequence: AACAACASACACTGGGGCCT |
Dataset #: | 1 |
Motif ID: | 294 |
Motif name: | Motif 294 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.110347 |
Original motif Consensus sequence: AGCTGTGAGAAGAGGGCCAC | Reverse complement motif Consensus sequence: GTGGCCCTCTTCTCACAGCT |
Dataset #: | 1 |
Motif ID: | 307 |
Motif name: | Motif 307 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.111784 |
Original motif Consensus sequence: AGATGCCAGCCAGAGCTCT | Reverse complement motif Consensus sequence: AGAGCTCTGGCTGGCATCT |
Dataset #: | 1 |
Motif ID: | 292 |
Motif name: | Motif 292 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.112924 |
Original motif Consensus sequence: AAGACCTTCCAGTGGGACAA | Reverse complement motif Consensus sequence: TTGTCCCACTGGAAGGTCTT |
Dataset #: 1 | Motif ID: 37 | Motif name: Motif 37 |
Original motif Consensus sequence: CCTTGAGAGCW | Reverse complement motif Consensus sequence: WGCTCTCAAGG |
Best Matches for Motif ID 37 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 332 |
Motif name: | Motif 332 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 11 |
Similarity score: | 0.0617144 |
Original motif Consensus sequence: CTGGCCCTCAATGGTTAAAC | Reverse complement motif Consensus sequence: GTTTAACCATTGAGGGCCAG |
Dataset #: | 1 |
Motif ID: | 303 |
Motif name: | Motif 303 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 11 |
Similarity score: | 0.0637615 |
Original motif Consensus sequence: AGTTCTTAAAGATGGT | Reverse complement motif Consensus sequence: ACCATCTTTAAGAACT |
Dataset #: | 1 |
Motif ID: | 48 |
Motif name: | Motif 48 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 10 |
Number of overlap: | 11 |
Similarity score: | 0.0663901 |
Original motif Consensus sequence: AGCTCCCAGCGTGAGCGACG | Reverse complement motif Consensus sequence: CGTCGCTCACGCTGGGAGCT |
Dataset #: | 1 |
Motif ID: | 239 |
Motif name: | Motif 239 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 11 |
Similarity score: | 0.0666861 |
Original motif Consensus sequence: AGCCTCCAGAACTGT | Reverse complement motif Consensus sequence: ACAGTTCTGGAGGCT |
Dataset #: | 1 |
Motif ID: | 331 |
Motif name: | Motif 331 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 11 |
Similarity score: | 0.0705972 |
Original motif Consensus sequence: CCACCACAGCTCAAGGAGGC | Reverse complement motif Consensus sequence: GCCTCCTTGAGCTGTGGTGG |
Dataset #: 1 | Motif ID: 38 | Motif name: Motif 38 |
Original motif Consensus sequence: GCAGTGAGCYRAGA | Reverse complement motif Consensus sequence: TCTMKGCTCACTGC |
Best Matches for Motif ID 38 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 294 |
Motif name: | Motif 294 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 14 |
Similarity score: | 0.0688783 |
Original motif Consensus sequence: AGCTGTGAGAAGAGGGCCAC | Reverse complement motif Consensus sequence: GTGGCCCTCTTCTCACAGCT |
Dataset #: | 1 |
Motif ID: | 64 |
Motif name: | Motif 64 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 7 |
Number of overlap: | 14 |
Similarity score: | 0.0904176 |
Original motif Consensus sequence: GAAGGCAGCTAAGGCCCGGY | Reverse complement motif Consensus sequence: KCCGGGCCTTAGCTGCCTTC |
Dataset #: | 1 |
Motif ID: | 17 |
Motif name: | Motif 17 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 14 |
Similarity score: | 0.0919739 |
Original motif Consensus sequence: AGACAGTGGGYGCAGGHCA | Reverse complement motif Consensus sequence: TGHCCTGCKCCCACTGTCT |
Dataset #: | 1 |
Motif ID: | 261 |
Motif name: | Motif 261 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 14 |
Similarity score: | 0.0928109 |
Original motif Consensus sequence: ATCTCASAAATCACCACTA | Reverse complement motif Consensus sequence: TAGTGGTGATTTSTGAGAT |
Dataset #: | 1 |
Motif ID: | 331 |
Motif name: | Motif 331 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 14 |
Similarity score: | 0.0951907 |
Original motif Consensus sequence: CCACCACAGCTCAAGGAGGC | Reverse complement motif Consensus sequence: GCCTCCTTGAGCTGTGGTGG |
Dataset #: 1 | Motif ID: 39 | Motif name: Motif 39 |
Original motif Consensus sequence: AGGCGGCTGGGAGG | Reverse complement motif Consensus sequence: CCTCCCAGCCGCCT |
Best Matches for Motif ID 39 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 10 |
Motif name: | Motif 10 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 14 |
Similarity score: | 0.0839569 |
Original motif Consensus sequence: AGGASCSTCYSWGCCMGGY | Reverse complement motif Consensus sequence: MCCYGGCWSMGASGSTCCT |
Dataset #: | 1 |
Motif ID: | 68 |
Motif name: | Motif 68 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 14 |
Similarity score: | 0.0883656 |
Original motif Consensus sequence: CATGGCGGGCTGCAGGTC | Reverse complement motif Consensus sequence: GACCTGCAGCCCGCCATG |
Dataset #: | 1 |
Motif ID: | 183 |
Motif name: | Motif 183 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 14 |
Similarity score: | 0.0920495 |
Original motif Consensus sequence: GCCRGCCCTGCYGGCC | Reverse complement motif Consensus sequence: GGCCMGCAGGGCKGGC |
Dataset #: | 1 |
Motif ID: | 36 |
Motif name: | Motif 36 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 14 |
Similarity score: | 0.0926326 |
Original motif Consensus sequence: ACATCCCAGACGATGGGCG | Reverse complement motif Consensus sequence: CGCCCATCGTCTGGGATGT |
Dataset #: | 1 |
Motif ID: | 27 |
Motif name: | Motif 27 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 14 |
Similarity score: | 0.0926448 |
Original motif Consensus sequence: CACTTCCCAGACGGGGCG | Reverse complement motif Consensus sequence: CGCCCCGTCTGGGAAGTG |
Dataset #: 1 | Motif ID: 40 | Motif name: Motif 40 |
Original motif Consensus sequence: ACTTTGGGAGGC | Reverse complement motif Consensus sequence: GCCTCCCAAAGT |
Best Matches for Motif ID 40 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 144 |
Motif name: | Motif 144 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 12 |
Similarity score: | 0.0448889 |
Original motif Consensus sequence: CCGCTGCACTGTGGGAGCCC | Reverse complement motif Consensus sequence: GGGCTCCCACAGTGCAGCGG |
Dataset #: | 1 |
Motif ID: | 239 |
Motif name: | Motif 239 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 12 |
Similarity score: | 0.0724344 |
Original motif Consensus sequence: AGCCTCCAGAACTGT | Reverse complement motif Consensus sequence: ACAGTTCTGGAGGCT |
Dataset #: | 1 |
Motif ID: | 61 |
Motif name: | Motif 61 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 12 |
Similarity score: | 0.0760424 |
Original motif Consensus sequence: GGATCCACTGGGTGAAGCCA | Reverse complement motif Consensus sequence: TGGCTTCACCCAGTGGATCC |
Dataset #: | 1 |
Motif ID: | 284 |
Motif name: | Motif 284 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 7 |
Number of overlap: | 12 |
Similarity score: | 0.0785575 |
Original motif Consensus sequence: CATTTGGGAGCCCATTGA | Reverse complement motif Consensus sequence: TCAATGGGCTCCCAAATG |
Dataset #: | 1 |
Motif ID: | 108 |
Motif name: | Motif 108 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 6 |
Number of overlap: | 12 |
Similarity score: | 0.081011 |
Original motif Consensus sequence: CGAGCCTCCCCGAYGAGCGC | Reverse complement motif Consensus sequence: GCGCTCKTCGGGGAGGCTCG |
Dataset #: 1 | Motif ID: 41 | Motif name: Motif 41 |
Original motif Consensus sequence: AAAYAAAAAAA | Reverse complement motif Consensus sequence: TTTTTTTMTTT |
Best Matches for Motif ID 41 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 7 |
Motif name: | Motif 7 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 11 |
Similarity score: | 0.0197219 |
Original motif Consensus sequence: GTCTCWAMAAAAAAWAMAAA | Reverse complement motif Consensus sequence: TTTYTWTTTTTTYTWGAGAC |
Dataset #: | 1 |
Motif ID: | 54 |
Motif name: | Motif 54 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 11 |
Similarity score: | 0.0476983 |
Original motif Consensus sequence: AAGGAAAAGAAA | Reverse complement motif Consensus sequence: TTTCTTTTCCTT |
Dataset #: | 1 |
Motif ID: | 117 |
Motif name: | Motif 117 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 11 |
Similarity score: | 0.055347 |
Original motif Consensus sequence: AACAACAACAACAAMAA | Reverse complement motif Consensus sequence: TTYTTGTTGTTGTTGTT |
Dataset #: | 1 |
Motif ID: | 106 |
Motif name: | Motif 106 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 11 |
Similarity score: | 0.0567271 |
Original motif Consensus sequence: ATTGGTGTATTTACAATCCC | Reverse complement motif Consensus sequence: GGGATTGTAAATACACCAAT |
Dataset #: | 1 |
Motif ID: | 328 |
Motif name: | Motif 328 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 6 |
Number of overlap: | 11 |
Similarity score: | 0.0636192 |
Original motif Consensus sequence: GATACAAAATCAATGTR | Reverse complement motif Consensus sequence: KACATTGATTTTGTATC |
Dataset #: 1 | Motif ID: 42 | Motif name: Motif 42 |
Original motif Consensus sequence: CTCTGCCCGGCCGC | Reverse complement motif Consensus sequence: GCGGCCGGGCAGAG |
Best Matches for Motif ID 42 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 149 |
Motif name: | Motif 149 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 14 |
Similarity score: | 0.0584472 |
Original motif Consensus sequence: ACTCAGCCCRCCTGCACCC | Reverse complement motif Consensus sequence: GGGTGCAGGMGGGCTGAGT |
Dataset #: | 1 |
Motif ID: | 307 |
Motif name: | Motif 307 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 14 |
Similarity score: | 0.0775689 |
Original motif Consensus sequence: AGATGCCAGCCAGAGCTCT | Reverse complement motif Consensus sequence: AGAGCTCTGGCTGGCATCT |
Dataset #: | 1 |
Motif ID: | 125 |
Motif name: | Motif 125 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 14 |
Similarity score: | 0.0841912 |
Original motif Consensus sequence: CGCCCGGCCAGCCGC | Reverse complement motif Consensus sequence: GCGGCTGGCCGGGCG |
Dataset #: | 1 |
Motif ID: | 52 |
Motif name: | Motif 52 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 14 |
Similarity score: | 0.0856029 |
Original motif Consensus sequence: GACTGGCAGGCAGCTCCACC | Reverse complement motif Consensus sequence: GGTGGAGCTGCCTGCCAGTC |
Dataset #: | 1 |
Motif ID: | 285 |
Motif name: | Motif 285 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 14 |
Similarity score: | 0.0882618 |
Original motif Consensus sequence: CACTGCACTCCAGC | Reverse complement motif Consensus sequence: GCTGGAGTGCAGTG |
Dataset #: 1 | Motif ID: 43 | Motif name: Motif 43 |
Original motif Consensus sequence: GCCAGGCAGAGRGKCTCCT | Reverse complement motif Consensus sequence: AGGAGRCMCTCTGCCTGGC |
Best Matches for Motif ID 43 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 30 |
Motif name: | Motif 30 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.049578 |
Original motif Consensus sequence: AGGAGCGCCTCTKCCCGGC | Reverse complement motif Consensus sequence: GCCGGGRAGAGGCGCTCCT |
Dataset #: | 1 |
Motif ID: | 10 |
Motif name: | Motif 10 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.0674635 |
Original motif Consensus sequence: AGGASCSTCYSWGCCMGGY | Reverse complement motif Consensus sequence: MCCYGGCWSMGASGSTCCT |
Dataset #: | 1 |
Motif ID: | 56 |
Motif name: | Motif 56 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.0870511 |
Original motif Consensus sequence: CRTGAGCCACYGYRCCYGGC | Reverse complement motif Consensus sequence: GCCKGGMKCMGTGGCTCAKG |
Dataset #: | 1 |
Motif ID: | 312 |
Motif name: | Motif 312 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.101843 |
Original motif Consensus sequence: AGGACTGAGGGTGCCYRGGG | Reverse complement motif Consensus sequence: CCCMKGGCACCCTCAGTCCT |
Dataset #: | 1 |
Motif ID: | 99 |
Motif name: | Motif 99 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.106781 |
Original motif Consensus sequence: GCAAAKGACATGATYTCATT | Reverse complement motif Consensus sequence: AATGAKATCATGTCYTTTGC |
Dataset #: 1 | Motif ID: 44 | Motif name: Motif 44 |
Original motif Consensus sequence: AATCGCTTGAACC | Reverse complement motif Consensus sequence: GGTTCAAGCGATT |
Best Matches for Motif ID 44 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 16 |
Motif name: | Motif 16 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 13 |
Similarity score: | 0.0728317 |
Original motif Consensus sequence: GAAAGGGAACTCCCTGACCC | Reverse complement motif Consensus sequence: GGGTCAGGGAGTTCCCTTTC |
Dataset #: | 1 |
Motif ID: | 178 |
Motif name: | Motif 178 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 8 |
Number of overlap: | 13 |
Similarity score: | 0.0766097 |
Original motif Consensus sequence: ACTGTCTTCCACCTCCACAT | Reverse complement motif Consensus sequence: ATGTGGAGGTGGAAGACAGT |
Dataset #: | 1 |
Motif ID: | 129 |
Motif name: | Motif 129 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 13 |
Similarity score: | 0.0779699 |
Original motif Consensus sequence: AAGAGGTTTAATTGRCTCA | Reverse complement motif Consensus sequence: TGAGKCAATTAAACCTCTT |
Dataset #: | 1 |
Motif ID: | 333 |
Motif name: | Motif 333 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 6 |
Number of overlap: | 13 |
Similarity score: | 0.0810095 |
Original motif Consensus sequence: TAGATAATAGCTCCAGCTTT | Reverse complement motif Consensus sequence: AAAGCTGGAGCTATTATCTA |
Dataset #: | 1 |
Motif ID: | 23 |
Motif name: | Motif 23 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 13 |
Similarity score: | 0.081536 |
Original motif Consensus sequence: GGTTCATCTCACTAGGGAGT | Reverse complement motif Consensus sequence: ACTCCCTAGTGAGATGAACC |
Dataset #: 1 | Motif ID: 45 | Motif name: Motif 45 |
Original motif Consensus sequence: TGCCCAGTCTGGAAAGTG | Reverse complement motif Consensus sequence: CACTTTCCAGACTGGGCA |
Best Matches for Motif ID 45 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 27 |
Motif name: | Motif 27 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 18 |
Similarity score: | 0.0555298 |
Original motif Consensus sequence: CACTTCCCAGACGGGGCG | Reverse complement motif Consensus sequence: CGCCCCGTCTGGGAAGTG |
Dataset #: | 1 |
Motif ID: | 155 |
Motif name: | Motif 155 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 18 |
Similarity score: | 0.104002 |
Original motif Consensus sequence: TCCCTCCCGGACGGGGYGGC | Reverse complement motif Consensus sequence: GCCKCCCCGTCCGGGAGGGA |
Dataset #: | 1 |
Motif ID: | 292 |
Motif name: | Motif 292 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 18 |
Similarity score: | 0.11381 |
Original motif Consensus sequence: AAGACCTTCCAGTGGGACAA | Reverse complement motif Consensus sequence: TTGTCCCACTGGAAGGTCTT |
Dataset #: | 1 |
Motif ID: | 176 |
Motif name: | Motif 176 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 18 |
Similarity score: | 0.114247 |
Original motif Consensus sequence: AGGCCCCAGTGTSTGTTGTT | Reverse complement motif Consensus sequence: AACAACASACACTGGGGCCT |
Dataset #: | 1 |
Motif ID: | 349 |
Motif name: | Motif 349 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 18 |
Similarity score: | 0.12083 |
Original motif Consensus sequence: AGAGCCAAATCATGARTGAA | Reverse complement motif Consensus sequence: TTCAMTCATGATTTGGCTCT |
Dataset #: 1 | Motif ID: 46 | Motif name: Motif 46 |
Original motif Consensus sequence: CCCCWCCCCCA | Reverse complement motif Consensus sequence: TGGGGGWGGGG |
Best Matches for Motif ID 46 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 78 |
Motif name: | Motif 78 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 11 |
Similarity score: | 0.0694266 |
Original motif Consensus sequence: CGAGCCCTGCCCCGCGG | Reverse complement motif Consensus sequence: CCGCGGGGCAGGGCTCG |
Dataset #: | 1 |
Motif ID: | 221 |
Motif name: | Motif 221 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 5 |
Number of overlap: | 11 |
Similarity score: | 0.0733808 |
Original motif Consensus sequence: GGGAGGAAGGGGACAC | Reverse complement motif Consensus sequence: GTGTCCCCTTCCTCCC |
Dataset #: | 1 |
Motif ID: | 26 |
Motif name: | Motif 26 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 11 |
Similarity score: | 0.0736838 |
Original motif Consensus sequence: CTCCTGCCTCAGCCTCCCRA | Reverse complement motif Consensus sequence: TMGGGAGGCTGAGGCAGGAG |
Dataset #: | 1 |
Motif ID: | 53 |
Motif name: | Motif 53 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 7 |
Number of overlap: | 11 |
Similarity score: | 0.0739686 |
Original motif Consensus sequence: GTCCCATCGACCACCCAAG | Reverse complement motif Consensus sequence: CTTGGGTGGTCGATGGGAC |
Dataset #: | 1 |
Motif ID: | 313 |
Motif name: | Motif 313 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 11 |
Similarity score: | 0.0768738 |
Original motif Consensus sequence: CTCCTGCCTCAGCY | Reverse complement motif Consensus sequence: MGCTGAGGCAGGAG |
Dataset #: 1 | Motif ID: 47 | Motif name: Motif 47 |
Original motif Consensus sequence: GCCTCAGTTTCCY | Reverse complement motif Consensus sequence: MGGAAACTGAGGC |
Best Matches for Motif ID 47 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 26 |
Motif name: | Motif 26 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 6 |
Number of overlap: | 13 |
Similarity score: | 0.0351242 |
Original motif Consensus sequence: CTCCTGCCTCAGCCTCCCRA | Reverse complement motif Consensus sequence: TMGGGAGGCTGAGGCAGGAG |
Dataset #: | 1 |
Motif ID: | 64 |
Motif name: | Motif 64 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 13 |
Similarity score: | 0.0624672 |
Original motif Consensus sequence: GAAGGCAGCTAAGGCCCGGY | Reverse complement motif Consensus sequence: KCCGGGCCTTAGCTGCCTTC |
Dataset #: | 1 |
Motif ID: | 164 |
Motif name: | Motif 164 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 6 |
Number of overlap: | 13 |
Similarity score: | 0.067911 |
Original motif Consensus sequence: AGCCCCGGTTCCCGCYCGC | Reverse complement motif Consensus sequence: GCGMGCGGGAACCGGGGCT |
Dataset #: | 1 |
Motif ID: | 176 |
Motif name: | Motif 176 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 6 |
Number of overlap: | 13 |
Similarity score: | 0.0734205 |
Original motif Consensus sequence: AGGCCCCAGTGTSTGTTGTT | Reverse complement motif Consensus sequence: AACAACASACACTGGGGCCT |
Dataset #: | 1 |
Motif ID: | 291 |
Motif name: | Motif 291 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 13 |
Similarity score: | 0.0791421 |
Original motif Consensus sequence: CTGAGGACCTGAGGTCRTA | Reverse complement motif Consensus sequence: TAMGACCTCAGGTCCTCAG |
Dataset #: 1 | Motif ID: 48 | Motif name: Motif 48 |
Original motif Consensus sequence: AGCTCCCAGCGTGAGCGACG | Reverse complement motif Consensus sequence: CGTCGCTCACGCTGGGAGCT |
Best Matches for Motif ID 48 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 176 |
Motif name: | Motif 176 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.113918 |
Original motif Consensus sequence: AGGCCCCAGTGTSTGTTGTT | Reverse complement motif Consensus sequence: AACAACASACACTGGGGCCT |
Dataset #: | 1 |
Motif ID: | 312 |
Motif name: | Motif 312 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.121076 |
Original motif Consensus sequence: AGGACTGAGGGTGCCYRGGG | Reverse complement motif Consensus sequence: CCCMKGGCACCCTCAGTCCT |
Dataset #: | 1 |
Motif ID: | 23 |
Motif name: | Motif 23 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.123602 |
Original motif Consensus sequence: GGTTCATCTCACTAGGGAGT | Reverse complement motif Consensus sequence: ACTCCCTAGTGAGATGAACC |
Dataset #: | 1 |
Motif ID: | 8 |
Motif name: | Motif 8 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.124233 |
Original motif Consensus sequence: ATCRCTTGAGSYCAGGAGKT | Reverse complement motif Consensus sequence: ARCTCCTGKSCTCAAGKGAT |
Dataset #: | 1 |
Motif ID: | 119 |
Motif name: | Motif 119 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.129197 |
Original motif Consensus sequence: AAGTCCAAGATCAAGGTGYY | Reverse complement motif Consensus sequence: KKCACCTTGATCTTGGACTT |
Dataset #: 1 | Motif ID: 49 | Motif name: Motif 49 |
Original motif Consensus sequence: ACATCTGYMMCC | Reverse complement motif Consensus sequence: GGRRMCAGATGT |
Best Matches for Motif ID 49 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 1 |
Motif name: | Motif 1 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 12 |
Similarity score: | 0.0495311 |
Original motif Consensus sequence: GGGGTGACAGABGB | Reverse complement motif Consensus sequence: BCVTCTGTCACCCC |
Dataset #: | 1 |
Motif ID: | 199 |
Motif name: | Motif 199 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 12 |
Similarity score: | 0.0505389 |
Original motif Consensus sequence: ACAGCTGGCACC | Reverse complement motif Consensus sequence: GGTGCCAGCTGT |
Dataset #: | 1 |
Motif ID: | 120 |
Motif name: | Motif 120 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 12 |
Similarity score: | 0.0662574 |
Original motif Consensus sequence: CCATGTGSTCCC | Reverse complement motif Consensus sequence: GGGASCACATGG |
Dataset #: | 1 |
Motif ID: | 225 |
Motif name: | Motif 225 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 7 |
Number of overlap: | 12 |
Similarity score: | 0.0777612 |
Original motif Consensus sequence: GCACATGTAYCCYAGAACTT | Reverse complement motif Consensus sequence: AAGTTCTKGGKTACATGTGC |
Dataset #: | 1 |
Motif ID: | 257 |
Motif name: | Motif 257 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 12 |
Similarity score: | 0.0790361 |
Original motif Consensus sequence: GAGAACACATGGACA | Reverse complement motif Consensus sequence: TGTCCATGTGTTCTC |
Dataset #: 1 | Motif ID: 50 | Motif name: Motif 50 |
Original motif Consensus sequence: GATGTGAGGGC | Reverse complement motif Consensus sequence: GCCCTCACATC |
Best Matches for Motif ID 50 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 277 |
Motif name: | Motif 277 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 11 |
Similarity score: | 0.0679708 |
Original motif Consensus sequence: GCCCTCACCAGAAGC | Reverse complement motif Consensus sequence: GCTTCTGGTGAGGGC |
Dataset #: | 1 |
Motif ID: | 283 |
Motif name: | Motif 283 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 11 |
Similarity score: | 0.0702987 |
Original motif Consensus sequence: GCCCTCACCATCC | Reverse complement motif Consensus sequence: GGATGGTGAGGGC |
Dataset #: | 1 |
Motif ID: | 294 |
Motif name: | Motif 294 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 7 |
Number of overlap: | 11 |
Similarity score: | 0.0711373 |
Original motif Consensus sequence: AGCTGTGAGAAGAGGGCCAC | Reverse complement motif Consensus sequence: GTGGCCCTCTTCTCACAGCT |
Dataset #: | 1 |
Motif ID: | 291 |
Motif name: | Motif 291 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 6 |
Number of overlap: | 11 |
Similarity score: | 0.0726313 |
Original motif Consensus sequence: CTGAGGACCTGAGGTCRTA | Reverse complement motif Consensus sequence: TAMGACCTCAGGTCCTCAG |
Dataset #: | 1 |
Motif ID: | 323 |
Motif name: | Motif 323 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 11 |
Similarity score: | 0.0745066 |
Original motif Consensus sequence: GCTCTCAGGTCCA | Reverse complement motif Consensus sequence: TGGACCTGAGAGC |
Dataset #: 1 | Motif ID: 51 | Motif name: Motif 51 |
Original motif Consensus sequence: GTGGGTGCGCGCA | Reverse complement motif Consensus sequence: TGCGCGCACCCAC |
Best Matches for Motif ID 51 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 17 |
Motif name: | Motif 17 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 6 |
Number of overlap: | 13 |
Similarity score: | 0.0746013 |
Original motif Consensus sequence: AGACAGTGGGYGCAGGHCA | Reverse complement motif Consensus sequence: TGHCCTGCKCCCACTGTCT |
Dataset #: | 1 |
Motif ID: | 159 |
Motif name: | Motif 159 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 6 |
Number of overlap: | 13 |
Similarity score: | 0.0830854 |
Original motif Consensus sequence: ACAGGCTTTGTGTGAGCA | Reverse complement motif Consensus sequence: TGCTCACACAAAGCCTGT |
Dataset #: | 1 |
Motif ID: | 289 |
Motif name: | Motif 289 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 13 |
Similarity score: | 0.0852016 |
Original motif Consensus sequence: TGATGGGTGCACCAAA | Reverse complement motif Consensus sequence: TTTGGTGCACCCATCA |
Dataset #: | 1 |
Motif ID: | 312 |
Motif name: | Motif 312 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 7 |
Number of overlap: | 13 |
Similarity score: | 0.0893244 |
Original motif Consensus sequence: AGGACTGAGGGTGCCYRGGG | Reverse complement motif Consensus sequence: CCCMKGGCACCCTCAGTCCT |
Dataset #: | 1 |
Motif ID: | 148 |
Motif name: | Motif 148 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 13 |
Similarity score: | 0.0903644 |
Original motif Consensus sequence: AAAGAGAGTCAGCGAAG | Reverse complement motif Consensus sequence: CTTCGCTGACTCTCTTT |
Dataset #: 1 | Motif ID: 52 | Motif name: Motif 52 |
Original motif Consensus sequence: GACTGGCAGGCAGCTCCACC | Reverse complement motif Consensus sequence: GGTGGAGCTGCCTGCCAGTC |
Best Matches for Motif ID 52 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 350 |
Motif name: | Motif 350 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.108621 |
Original motif Consensus sequence: TCTGGAGTGGACCTCCAGCA | Reverse complement motif Consensus sequence: TGCTGGAGGTCCACTCCAGA |
Dataset #: | 1 |
Motif ID: | 105 |
Motif name: | Motif 105 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.118973 |
Original motif Consensus sequence: GCCTCTCCCTCCACACCTCC | Reverse complement motif Consensus sequence: GGAGGTGTGGAGGGAGAGGC |
Dataset #: | 1 |
Motif ID: | 100 |
Motif name: | Motif 100 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.11909 |
Original motif Consensus sequence: GCTGGCCCGCAAGCGCCGCG | Reverse complement motif Consensus sequence: CGCGGCGCTTGCGGGCCAGC |
Dataset #: | 1 |
Motif ID: | 165 |
Motif name: | Motif 165 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.122785 |
Original motif Consensus sequence: ATCTGACAGGAGGYRGAGCT | Reverse complement motif Consensus sequence: AGCTCMKCCTCCTGTCAGAT |
Dataset #: | 1 |
Motif ID: | 177 |
Motif name: | Motif 177 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.125451 |
Original motif Consensus sequence: CCCGAAGCTGCRYRCTCGGT | Reverse complement motif Consensus sequence: ACCGAGMKMGCAGCTTCGGG |
Dataset #: 1 | Motif ID: 53 | Motif name: Motif 53 |
Original motif Consensus sequence: GTCCCATCGACCACCCAAG | Reverse complement motif Consensus sequence: CTTGGGTGGTCGATGGGAC |
Best Matches for Motif ID 53 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 309 |
Motif name: | Motif 309 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.113725 |
Original motif Consensus sequence: CATTCTGGGGTCTGGAGGAY | Reverse complement motif Consensus sequence: MTCCTCCAGACCCCAGAATG |
Dataset #: | 1 |
Motif ID: | 178 |
Motif name: | Motif 178 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.118023 |
Original motif Consensus sequence: ACTGTCTTCCACCTCCACAT | Reverse complement motif Consensus sequence: ATGTGGAGGTGGAAGACAGT |
Dataset #: | 1 |
Motif ID: | 201 |
Motif name: | Motif 201 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.119118 |
Original motif Consensus sequence: GTAACACTCACCGCGARGGT | Reverse complement motif Consensus sequence: ACCKTCGCGGTGAGTGTTAC |
Dataset #: | 1 |
Motif ID: | 196 |
Motif name: | Motif 196 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.119924 |
Original motif Consensus sequence: CCTGCCATTGCYSAGGCTTG | Reverse complement motif Consensus sequence: CAAGCCTSKGCAATGGCAGG |
Dataset #: | 1 |
Motif ID: | 2 |
Motif name: | Motif 2 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.127526 |
Original motif Consensus sequence: ATTAGCYRGGCRTGGTGGC | Reverse complement motif Consensus sequence: GCCACCAMGCCMKGCTAAT |
Dataset #: 1 | Motif ID: 54 | Motif name: Motif 54 |
Original motif Consensus sequence: AAGGAAAAGAAA | Reverse complement motif Consensus sequence: TTTCTTTTCCTT |
Best Matches for Motif ID 54 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 7 |
Motif name: | Motif 7 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 12 |
Similarity score: | 0.0346455 |
Original motif Consensus sequence: GTCTCWAMAAAAAAWAMAAA | Reverse complement motif Consensus sequence: TTTYTWTTTTTTYTWGAGAC |
Dataset #: | 1 |
Motif ID: | 356 |
Motif name: | Motif 356 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 12 |
Similarity score: | 0.0458962 |
Original motif Consensus sequence: AATTAAAAGACACAGACTG | Reverse complement motif Consensus sequence: CAGTCTGTGTCTTTTAATT |
Dataset #: | 1 |
Motif ID: | 214 |
Motif name: | Motif 214 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 12 |
Similarity score: | 0.0516933 |
Original motif Consensus sequence: CTCAGGAATGGAAAACC | Reverse complement motif Consensus sequence: GGTTTTCCATTCCTGAG |
Dataset #: | 1 |
Motif ID: | 24 |
Motif name: | Motif 24 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 12 |
Similarity score: | 0.052923 |
Original motif Consensus sequence: CKAGTCAAAGAAA | Reverse complement motif Consensus sequence: TTTCTTTGACTRG |
Dataset #: | 1 |
Motif ID: | 99 |
Motif name: | Motif 99 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 6 |
Number of overlap: | 12 |
Similarity score: | 0.0590252 |
Original motif Consensus sequence: GCAAAKGACATGATYTCATT | Reverse complement motif Consensus sequence: AATGAKATCATGTCYTTTGC |
Dataset #: 1 | Motif ID: 55 | Motif name: Motif 55 |
Original motif Consensus sequence: ATGGAATAYTATTCAGCCAT | Reverse complement motif Consensus sequence: ATGGCTGAATAKTATTCCAT |
Best Matches for Motif ID 55 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 234 |
Motif name: | Motif 234 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.0832183 |
Original motif Consensus sequence: AAGGAACAAACTCCRGACAC | Reverse complement motif Consensus sequence: GTGTCKGGAGTTTGTTCCTT |
Dataset #: | 1 |
Motif ID: | 336 |
Motif name: | Motif 336 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.102251 |
Original motif Consensus sequence: ATGTAACCAAAYACCACCTG | Reverse complement motif Consensus sequence: CAGGTGGTKTTTGGTTACAT |
Dataset #: | 1 |
Motif ID: | 170 |
Motif name: | Motif 170 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.109578 |
Original motif Consensus sequence: AATCAACCCTGGYRATCAAT | Reverse complement motif Consensus sequence: ATTGATMKCCAGGGTTGATT |
Dataset #: | 1 |
Motif ID: | 58 |
Motif name: | Motif 58 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.110655 |
Original motif Consensus sequence: ATGGACAYTTRGGTTGHTTC | Reverse complement motif Consensus sequence: GAAHCAACCKAAKTGTCCAT |
Dataset #: | 1 |
Motif ID: | 292 |
Motif name: | Motif 292 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.116225 |
Original motif Consensus sequence: AAGACCTTCCAGTGGGACAA | Reverse complement motif Consensus sequence: TTGTCCCACTGGAAGGTCTT |
Dataset #: 1 | Motif ID: 56 | Motif name: Motif 56 |
Original motif Consensus sequence: CRTGAGCCACYGYRCCYGGC | Reverse complement motif Consensus sequence: GCCKGGMKCMGTGGCTCAKG |
Best Matches for Motif ID 56 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 177 |
Motif name: | Motif 177 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.0865863 |
Original motif Consensus sequence: CCCGAAGCTGCRYRCTCGGT | Reverse complement motif Consensus sequence: ACCGAGMKMGCAGCTTCGGG |
Dataset #: | 1 |
Motif ID: | 112 |
Motif name: | Motif 112 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.103187 |
Original motif Consensus sequence: GCTGTGTGACCTTGGGCAAG | Reverse complement motif Consensus sequence: CTTGCCCAAGGTCACACAGC |
Dataset #: | 1 |
Motif ID: | 14 |
Motif name: | Motif 14 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.10735 |
Original motif Consensus sequence: ACCTGGAAAATCGGGTCACT | Reverse complement motif Consensus sequence: AGTGACCCGATTTTCCAGGT |
Dataset #: | 1 |
Motif ID: | 145 |
Motif name: | Motif 145 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.113075 |
Original motif Consensus sequence: GCCAGTCACAAAARGACAMA | Reverse complement motif Consensus sequence: TYTGTCMTTTTGTGACTGGC |
Dataset #: | 1 |
Motif ID: | 64 |
Motif name: | Motif 64 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.117573 |
Original motif Consensus sequence: GAAGGCAGCTAAGGCCCGGY | Reverse complement motif Consensus sequence: KCCGGGCCTTAGCTGCCTTC |
Dataset #: 1 | Motif ID: 57 | Motif name: Motif 57 |
Original motif Consensus sequence: AAATATTTATT | Reverse complement motif Consensus sequence: AATAAATATTT |
Best Matches for Motif ID 57 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 55 |
Motif name: | Motif 55 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 11 |
Similarity score: | 0.0640425 |
Original motif Consensus sequence: ATGGAATAYTATTCAGCCAT | Reverse complement motif Consensus sequence: ATGGCTGAATAKTATTCCAT |
Dataset #: | 1 |
Motif ID: | 70 |
Motif name: | Motif 70 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 11 |
Similarity score: | 0.0653502 |
Original motif Consensus sequence: CTATTGTGAATARTGCTGC | Reverse complement motif Consensus sequence: GCAGCAMTATTCACAATAG |
Dataset #: | 1 |
Motif ID: | 137 |
Motif name: | Motif 137 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 10 |
Number of overlap: | 11 |
Similarity score: | 0.0659605 |
Original motif Consensus sequence: AGGTTTGTTACATAGGTAWA | Reverse complement motif Consensus sequence: TWTACCTATGTAACAAACCT |
Dataset #: | 1 |
Motif ID: | 195 |
Motif name: | Motif 195 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 11 |
Similarity score: | 0.0663702 |
Original motif Consensus sequence: TAAAAGACTACAWATTGGGT | Reverse complement motif Consensus sequence: ACCCAATWTGTAGTCTTTTA |
Dataset #: | 1 |
Motif ID: | 168 |
Motif name: | Motif 168 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 6 |
Number of overlap: | 11 |
Similarity score: | 0.066951 |
Original motif Consensus sequence: AGGTATTTCTCCCACC | Reverse complement motif Consensus sequence: GGTGGGAGAAATACCT |
Dataset #: 1 | Motif ID: 58 | Motif name: Motif 58 |
Original motif Consensus sequence: ATGGACAYTTRGGTTGHTTC | Reverse complement motif Consensus sequence: GAAHCAACCKAAKTGTCCAT |
Best Matches for Motif ID 58 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 85 |
Motif name: | Motif 85 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.107048 |
Original motif Consensus sequence: CTAGACATAAAGGTTCTCCA | Reverse complement motif Consensus sequence: TGGAGAACCTTTATGTCTAG |
Dataset #: | 1 |
Motif ID: | 308 |
Motif name: | Motif 308 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.10886 |
Original motif Consensus sequence: AAATTAGGCCAATTAATAAC | Reverse complement motif Consensus sequence: GTTATTAATTGGCCTAATTT |
Dataset #: | 1 |
Motif ID: | 67 |
Motif name: | Motif 67 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.111911 |
Original motif Consensus sequence: CTGGGCTCCTGAGTCTGGTG | Reverse complement motif Consensus sequence: CACCAGACTCAGGAGCCCAG |
Dataset #: | 1 |
Motif ID: | 55 |
Motif name: | Motif 55 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.111988 |
Original motif Consensus sequence: ATGGAATAYTATTCAGCCAT | Reverse complement motif Consensus sequence: ATGGCTGAATAKTATTCCAT |
Dataset #: | 1 |
Motif ID: | 170 |
Motif name: | Motif 170 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.112726 |
Original motif Consensus sequence: AATCAACCCTGGYRATCAAT | Reverse complement motif Consensus sequence: ATTGATMKCCAGGGTTGATT |
Dataset #: 1 | Motif ID: 59 | Motif name: Motif 59 |
Original motif Consensus sequence: CCTCCCSGACGRG | Reverse complement motif Consensus sequence: CKCGTCSGGGAGG |
Best Matches for Motif ID 59 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 155 |
Motif name: | Motif 155 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 13 |
Similarity score: | 0.0335165 |
Original motif Consensus sequence: TCCCTCCCGGACGGGGYGGC | Reverse complement motif Consensus sequence: GCCKCCCCGTCCGGGAGGGA |
Dataset #: | 1 |
Motif ID: | 108 |
Motif name: | Motif 108 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 13 |
Similarity score: | 0.0365108 |
Original motif Consensus sequence: CGAGCCTCCCCGAYGAGCGC | Reverse complement motif Consensus sequence: GCGCTCKTCGGGGAGGCTCG |
Dataset #: | 1 |
Motif ID: | 27 |
Motif name: | Motif 27 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 13 |
Similarity score: | 0.0569667 |
Original motif Consensus sequence: CACTTCCCAGACGGGGCG | Reverse complement motif Consensus sequence: CGCCCCGTCTGGGAAGTG |
Dataset #: | 1 |
Motif ID: | 95 |
Motif name: | Motif 95 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 13 |
Similarity score: | 0.0606018 |
Original motif Consensus sequence: ACCCYGTCTGGGAGGTG | Reverse complement motif Consensus sequence: CACCTCCCAGACMGGGT |
Dataset #: | 1 |
Motif ID: | 36 |
Motif name: | Motif 36 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 6 |
Number of overlap: | 13 |
Similarity score: | 0.0628382 |
Original motif Consensus sequence: ACATCCCAGACGATGGGCG | Reverse complement motif Consensus sequence: CGCCCATCGTCTGGGATGT |
Dataset #: 1 | Motif ID: 60 | Motif name: Motif 60 |
Original motif Consensus sequence: GATCACGAGGTCAGGAG | Reverse complement motif Consensus sequence: CTCCTGACCTCGTGATC |
Best Matches for Motif ID 60 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 309 |
Motif name: | Motif 309 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 17 |
Similarity score: | 0.08025 |
Original motif Consensus sequence: CATTCTGGGGTCTGGAGGAY | Reverse complement motif Consensus sequence: MTCCTCCAGACCCCAGAATG |
Dataset #: | 1 |
Motif ID: | 290 |
Motif name: | Motif 290 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 17 |
Similarity score: | 0.0894593 |
Original motif Consensus sequence: TGATACCCAGGCAAACAG | Reverse complement motif Consensus sequence: CTGTTTGCCTGGGTATCA |
Dataset #: | 1 |
Motif ID: | 8 |
Motif name: | Motif 8 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 17 |
Similarity score: | 0.0913916 |
Original motif Consensus sequence: ATCRCTTGAGSYCAGGAGKT | Reverse complement motif Consensus sequence: ARCTCCTGKSCTCAAGKGAT |
Dataset #: | 1 |
Motif ID: | 65 |
Motif name: | Motif 65 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 17 |
Similarity score: | 0.101368 |
Original motif Consensus sequence: AGAAATCGAGCRCAGCGCCG | Reverse complement motif Consensus sequence: CGGCGCTGMGCTCGATTTCT |
Dataset #: | 1 |
Motif ID: | 306 |
Motif name: | Motif 306 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 17 |
Similarity score: | 0.1095 |
Original motif Consensus sequence: GACATGAGCTGGCGCTTG | Reverse complement motif Consensus sequence: CAAGCGCCAGCTCATGTC |
Dataset #: 1 | Motif ID: 61 | Motif name: Motif 61 |
Original motif Consensus sequence: GGATCCACTGGGTGAAGCCA | Reverse complement motif Consensus sequence: TGGCTTCACCCAGTGGATCC |
Best Matches for Motif ID 61 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 84 |
Motif name: | Motif 84 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.110456 |
Original motif Consensus sequence: CTGGGTCCCCCAGCAGTGCC | Reverse complement motif Consensus sequence: GGCACTGCTGGGGGACCCAG |
Dataset #: | 1 |
Motif ID: | 202 |
Motif name: | Motif 202 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.116364 |
Original motif Consensus sequence: ACACATCACAAAGCAGTTTC | Reverse complement motif Consensus sequence: GAAACTGCTTTGTGATGTGT |
Dataset #: | 1 |
Motif ID: | 144 |
Motif name: | Motif 144 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.117839 |
Original motif Consensus sequence: CCGCTGCACTGTGGGAGCCC | Reverse complement motif Consensus sequence: GGGCTCCCACAGTGCAGCGG |
Dataset #: | 1 |
Motif ID: | 349 |
Motif name: | Motif 349 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.125399 |
Original motif Consensus sequence: AGAGCCAAATCATGARTGAA | Reverse complement motif Consensus sequence: TTCAMTCATGATTTGGCTCT |
Dataset #: | 1 |
Motif ID: | 108 |
Motif name: | Motif 108 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.128668 |
Original motif Consensus sequence: CGAGCCTCCCCGAYGAGCGC | Reverse complement motif Consensus sequence: GCGCTCKTCGGGGAGGCTCG |
Dataset #: 1 | Motif ID: 62 | Motif name: Motif 62 |
Original motif Consensus sequence: AGGAACAGCTCCRGTCTAC | Reverse complement motif Consensus sequence: GTAGACKGGAGCTGTTCCT |
Best Matches for Motif ID 62 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 30 |
Motif name: | Motif 30 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.108892 |
Original motif Consensus sequence: AGGAGCGCCTCTKCCCGGC | Reverse complement motif Consensus sequence: GCCGGGRAGAGGCGCTCCT |
Dataset #: | 1 |
Motif ID: | 234 |
Motif name: | Motif 234 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.110299 |
Original motif Consensus sequence: AAGGAACAAACTCCRGACAC | Reverse complement motif Consensus sequence: GTGTCKGGAGTTTGTTCCTT |
Dataset #: | 1 |
Motif ID: | 165 |
Motif name: | Motif 165 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.116495 |
Original motif Consensus sequence: ATCTGACAGGAGGYRGAGCT | Reverse complement motif Consensus sequence: AGCTCMKCCTCCTGTCAGAT |
Dataset #: | 1 |
Motif ID: | 331 |
Motif name: | Motif 331 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.118299 |
Original motif Consensus sequence: CCACCACAGCTCAAGGAGGC | Reverse complement motif Consensus sequence: GCCTCCTTGAGCTGTGGTGG |
Dataset #: | 1 |
Motif ID: | 350 |
Motif name: | Motif 350 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.120152 |
Original motif Consensus sequence: TCTGGAGTGGACCTCCAGCA | Reverse complement motif Consensus sequence: TGCTGGAGGTCCACTCCAGA |
Dataset #: 1 | Motif ID: 63 | Motif name: Motif 63 |
Original motif Consensus sequence: AGTGAGAACATRYRRTRTTT | Reverse complement motif Consensus sequence: AAAMAMMKMATGTTCTCACT |
Best Matches for Motif ID 63 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 170 |
Motif name: | Motif 170 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.10502 |
Original motif Consensus sequence: AATCAACCCTGGYRATCAAT | Reverse complement motif Consensus sequence: ATTGATMKCCAGGGTTGATT |
Dataset #: | 1 |
Motif ID: | 99 |
Motif name: | Motif 99 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.106569 |
Original motif Consensus sequence: GCAAAKGACATGATYTCATT | Reverse complement motif Consensus sequence: AATGAKATCATGTCYTTTGC |
Dataset #: | 1 |
Motif ID: | 171 |
Motif name: | Motif 171 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.121267 |
Original motif Consensus sequence: AAAAGTCCACAGTCCAAAGT | Reverse complement motif Consensus sequence: ACTTTGGACTGTGGACTTTT |
Dataset #: | 1 |
Motif ID: | 179 |
Motif name: | Motif 179 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.121353 |
Original motif Consensus sequence: AGGTCCTTCAGGAGGTATTC | Reverse complement motif Consensus sequence: GAATACCTCCTGAAGGACCT |
Dataset #: | 1 |
Motif ID: | 19 |
Motif name: | Motif 19 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.123743 |
Original motif Consensus sequence: CACCAGGAGATTATATCCCR | Reverse complement motif Consensus sequence: MGGGATATAATCTCCTGGTG |
Dataset #: 1 | Motif ID: 64 | Motif name: Motif 64 |
Original motif Consensus sequence: GAAGGCAGCTAAGGCCCGGY | Reverse complement motif Consensus sequence: KCCGGGCCTTAGCTGCCTTC |
Best Matches for Motif ID 64 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 100 |
Motif name: | Motif 100 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.088142 |
Original motif Consensus sequence: GCTGGCCCGCAAGCGCCGCG | Reverse complement motif Consensus sequence: CGCGGCGCTTGCGGGCCAGC |
Dataset #: | 1 |
Motif ID: | 26 |
Motif name: | Motif 26 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.0936635 |
Original motif Consensus sequence: CTCCTGCCTCAGCCTCCCRA | Reverse complement motif Consensus sequence: TMGGGAGGCTGAGGCAGGAG |
Dataset #: | 1 |
Motif ID: | 105 |
Motif name: | Motif 105 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.0969655 |
Original motif Consensus sequence: GCCTCTCCCTCCACACCTCC | Reverse complement motif Consensus sequence: GGAGGTGTGGAGGGAGAGGC |
Dataset #: | 1 |
Motif ID: | 56 |
Motif name: | Motif 56 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.100994 |
Original motif Consensus sequence: CRTGAGCCACYGYRCCYGGC | Reverse complement motif Consensus sequence: GCCKGGMKCMGTGGCTCAKG |
Dataset #: | 1 |
Motif ID: | 58 |
Motif name: | Motif 58 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.102861 |
Original motif Consensus sequence: ATGGACAYTTRGGTTGHTTC | Reverse complement motif Consensus sequence: GAAHCAACCKAAKTGTCCAT |
Dataset #: 1 | Motif ID: 65 | Motif name: Motif 65 |
Original motif Consensus sequence: AGAAATCGAGCRCAGCGCCG | Reverse complement motif Consensus sequence: CGGCGCTGMGCTCGATTTCT |
Best Matches for Motif ID 65 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 8 |
Motif name: | Motif 8 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.126973 |
Original motif Consensus sequence: ATCRCTTGAGSYCAGGAGKT | Reverse complement motif Consensus sequence: ARCTCCTGKSCTCAAGKGAT |
Dataset #: | 1 |
Motif ID: | 48 |
Motif name: | Motif 48 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.134703 |
Original motif Consensus sequence: AGCTCCCAGCGTGAGCGACG | Reverse complement motif Consensus sequence: CGTCGCTCACGCTGGGAGCT |
Dataset #: | 1 |
Motif ID: | 139 |
Motif name: | Motif 139 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.135709 |
Original motif Consensus sequence: AGCCYCTGGYAACCAYYAWT | Reverse complement motif Consensus sequence: AWTKKTGGTTKCCAGKGGCT |
Dataset #: | 1 |
Motif ID: | 176 |
Motif name: | Motif 176 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.135953 |
Original motif Consensus sequence: AGGCCCCAGTGTSTGTTGTT | Reverse complement motif Consensus sequence: AACAACASACACTGGGGCCT |
Dataset #: | 1 |
Motif ID: | 225 |
Motif name: | Motif 225 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.137378 |
Original motif Consensus sequence: GCACATGTAYCCYAGAACTT | Reverse complement motif Consensus sequence: AAGTTCTKGGKTACATGTGC |
Dataset #: 1 | Motif ID: 66 | Motif name: Motif 66 |
Original motif Consensus sequence: ACACACAYACACACACACA | Reverse complement motif Consensus sequence: TGTGTGTGTGTKTGTGTGT |
Best Matches for Motif ID 66 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 145 |
Motif name: | Motif 145 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.0762936 |
Original motif Consensus sequence: GCCAGTCACAAAARGACAMA | Reverse complement motif Consensus sequence: TYTGTCMTTTTGTGACTGGC |
Dataset #: | 1 |
Motif ID: | 109 |
Motif name: | Motif 109 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.084962 |
Original motif Consensus sequence: GAGAGAGAGAGAGAGAGAGA | Reverse complement motif Consensus sequence: TCTCTCTCTCTCTCTCTCTC |
Dataset #: | 1 |
Motif ID: | 139 |
Motif name: | Motif 139 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.0883926 |
Original motif Consensus sequence: AGCCYCTGGYAACCAYYAWT | Reverse complement motif Consensus sequence: AWTKKTGGTTKCCAGKGGCT |
Dataset #: | 1 |
Motif ID: | 7 |
Motif name: | Motif 7 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.0886505 |
Original motif Consensus sequence: GTCTCWAMAAAAAAWAMAAA | Reverse complement motif Consensus sequence: TTTYTWTTTTTTYTWGAGAC |
Dataset #: | 1 |
Motif ID: | 254 |
Motif name: | Motif 254 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.0911508 |
Original motif Consensus sequence: AAAATCACAAGCATTCCTAT | Reverse complement motif Consensus sequence: ATAGGAATGCTTGTGATTTT |
Dataset #: 1 | Motif ID: 67 | Motif name: Motif 67 |
Original motif Consensus sequence: CTGGGCTCCTGAGTCTGGTG | Reverse complement motif Consensus sequence: CACCAGACTCAGGAGCCCAG |
Best Matches for Motif ID 67 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 26 |
Motif name: | Motif 26 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.10051 |
Original motif Consensus sequence: CTCCTGCCTCAGCCTCCCRA | Reverse complement motif Consensus sequence: TMGGGAGGCTGAGGCAGGAG |
Dataset #: | 1 |
Motif ID: | 29 |
Motif name: | Motif 29 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.107414 |
Original motif Consensus sequence: CTGGGCRACAGAGYRAGACY | Reverse complement motif Consensus sequence: MGTCTMKCTCTGTKGCCCAG |
Dataset #: | 1 |
Motif ID: | 84 |
Motif name: | Motif 84 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.116021 |
Original motif Consensus sequence: CTGGGTCCCCCAGCAGTGCC | Reverse complement motif Consensus sequence: GGCACTGCTGGGGGACCCAG |
Dataset #: | 1 |
Motif ID: | 58 |
Motif name: | Motif 58 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.123442 |
Original motif Consensus sequence: ATGGACAYTTRGGTTGHTTC | Reverse complement motif Consensus sequence: GAAHCAACCKAAKTGTCCAT |
Dataset #: | 1 |
Motif ID: | 64 |
Motif name: | Motif 64 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.126703 |
Original motif Consensus sequence: GAAGGCAGCTAAGGCCCGGY | Reverse complement motif Consensus sequence: KCCGGGCCTTAGCTGCCTTC |
Dataset #: 1 | Motif ID: 68 | Motif name: Motif 68 |
Original motif Consensus sequence: CATGGCGGGCTGCAGGTC | Reverse complement motif Consensus sequence: GACCTGCAGCCCGCCATG |
Best Matches for Motif ID 68 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 52 |
Motif name: | Motif 52 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 18 |
Similarity score: | 0.102941 |
Original motif Consensus sequence: GACTGGCAGGCAGCTCCACC | Reverse complement motif Consensus sequence: GGTGGAGCTGCCTGCCAGTC |
Dataset #: | 1 |
Motif ID: | 164 |
Motif name: | Motif 164 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 18 |
Similarity score: | 0.111785 |
Original motif Consensus sequence: AGCCCCGGTTCCCGCYCGC | Reverse complement motif Consensus sequence: GCGMGCGGGAACCGGGGCT |
Dataset #: | 1 |
Motif ID: | 309 |
Motif name: | Motif 309 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 18 |
Similarity score: | 0.116332 |
Original motif Consensus sequence: CATTCTGGGGTCTGGAGGAY | Reverse complement motif Consensus sequence: MTCCTCCAGACCCCAGAATG |
Dataset #: | 1 |
Motif ID: | 53 |
Motif name: | Motif 53 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 18 |
Similarity score: | 0.116432 |
Original motif Consensus sequence: GTCCCATCGACCACCCAAG | Reverse complement motif Consensus sequence: CTTGGGTGGTCGATGGGAC |
Dataset #: | 1 |
Motif ID: | 310 |
Motif name: | Motif 310 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 18 |
Similarity score: | 0.116568 |
Original motif Consensus sequence: CCCATGCAAGTCYRAAATCC | Reverse complement motif Consensus sequence: GGATTTMKGACTTGCATGGG |
Dataset #: 1 | Motif ID: 69 | Motif name: Motif 69 |
Original motif Consensus sequence: GTAGCTGGGAYTACA | Reverse complement motif Consensus sequence: TGTAKTCCCAGCTAC |
Best Matches for Motif ID 69 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 102 |
Motif name: | Motif 102 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 15 |
Similarity score: | 0.0936422 |
Original motif Consensus sequence: CTCATTTAATCCTCACAAC | Reverse complement motif Consensus sequence: GTTGTGAGGATTAAATGAG |
Dataset #: | 1 |
Motif ID: | 106 |
Motif name: | Motif 106 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 6 |
Number of overlap: | 15 |
Similarity score: | 0.0994445 |
Original motif Consensus sequence: ATTGGTGTATTTACAATCCC | Reverse complement motif Consensus sequence: GGGATTGTAAATACACCAAT |
Dataset #: | 1 |
Motif ID: | 290 |
Motif name: | Motif 290 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 15 |
Similarity score: | 0.0999355 |
Original motif Consensus sequence: TGATACCCAGGCAAACAG | Reverse complement motif Consensus sequence: CTGTTTGCCTGGGTATCA |
Dataset #: | 1 |
Motif ID: | 104 |
Motif name: | Motif 104 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 15 |
Similarity score: | 0.102257 |
Original motif Consensus sequence: CAACATGGATGRARCTGGAG | Reverse complement motif Consensus sequence: CTCCAGKTMCATCCATGTTG |
Dataset #: | 1 |
Motif ID: | 76 |
Motif name: | Motif 76 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 6 |
Number of overlap: | 15 |
Similarity score: | 0.102692 |
Original motif Consensus sequence: GTGCCAGGCACTGTKCTARG | Reverse complement motif Consensus sequence: CMTAGYACAGTGCCTGGCAC |
Dataset #: 1 | Motif ID: 70 | Motif name: Motif 70 |
Original motif Consensus sequence: CTATTGTGAATARTGCTGC | Reverse complement motif Consensus sequence: GCAGCAMTATTCACAATAG |
Best Matches for Motif ID 70 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 191 |
Motif name: | Motif 191 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.0948966 |
Original motif Consensus sequence: AAAGTGCCGAGAKTGCAGC | Reverse complement motif Consensus sequence: GCTGCARTCTCGGCACTTT |
Dataset #: | 1 |
Motif ID: | 106 |
Motif name: | Motif 106 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.100944 |
Original motif Consensus sequence: ATTGGTGTATTTACAATCCC | Reverse complement motif Consensus sequence: GGGATTGTAAATACACCAAT |
Dataset #: | 1 |
Motif ID: | 85 |
Motif name: | Motif 85 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.102726 |
Original motif Consensus sequence: CTAGACATAAAGGTTCTCCA | Reverse complement motif Consensus sequence: TGGAGAACCTTTATGTCTAG |
Dataset #: | 1 |
Motif ID: | 294 |
Motif name: | Motif 294 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.10487 |
Original motif Consensus sequence: AGCTGTGAGAAGAGGGCCAC | Reverse complement motif Consensus sequence: GTGGCCCTCTTCTCACAGCT |
Dataset #: | 1 |
Motif ID: | 201 |
Motif name: | Motif 201 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.105823 |
Original motif Consensus sequence: GTAACACTCACCGCGARGGT | Reverse complement motif Consensus sequence: ACCKTCGCGGTGAGTGTTAC |
Dataset #: 1 | Motif ID: 71 | Motif name: Motif 71 |
Original motif Consensus sequence: AGCACTTTG | Reverse complement motif Consensus sequence: CAAAGTGCT |
Best Matches for Motif ID 71 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 304 |
Motif name: | Motif 304 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 9 |
Similarity score: | 0.039262 |
Original motif Consensus sequence: AGTGTTTCCAAMCTGCT | Reverse complement motif Consensus sequence: AGCAGYTTGGAAACACT |
Dataset #: | 1 |
Motif ID: | 73 |
Motif name: | Motif 73 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 9 |
Similarity score: | 0.0420544 |
Original motif Consensus sequence: CAAACTGCAAG | Reverse complement motif Consensus sequence: CTTGCAGTTTG |
Dataset #: | 1 |
Motif ID: | 134 |
Motif name: | Motif 134 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 9 |
Similarity score: | 0.0420544 |
Original motif Consensus sequence: CAAACTGCA | Reverse complement motif Consensus sequence: TGCAGTTTG |
Dataset #: | 1 |
Motif ID: | 123 |
Motif name: | Motif 123 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 9 |
Similarity score: | 0.0420544 |
Original motif Consensus sequence: AGCAGTCTGAG | Reverse complement motif Consensus sequence: CTCAGACTGCT |
Dataset #: | 1 |
Motif ID: | 202 |
Motif name: | Motif 202 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 9 |
Similarity score: | 0.0501263 |
Original motif Consensus sequence: ACACATCACAAAGCAGTTTC | Reverse complement motif Consensus sequence: GAAACTGCTTTGTGATGTGT |
Dataset #: 1 | Motif ID: 72 | Motif name: Motif 72 |
Original motif Consensus sequence: CGCACTCCTCAGCC | Reverse complement motif Consensus sequence: GGCTGAGGAGTGCG |
Best Matches for Motif ID 72 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 89 |
Motif name: | Motif 89 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 14 |
Similarity score: | 0.0631515 |
Original motif Consensus sequence: GGCTGCGGAGGGTGTA | Reverse complement motif Consensus sequence: TACACCCTCCGCAGCC |
Dataset #: | 1 |
Motif ID: | 26 |
Motif name: | Motif 26 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 14 |
Similarity score: | 0.0793425 |
Original motif Consensus sequence: CTCCTGCCTCAGCCTCCCRA | Reverse complement motif Consensus sequence: TMGGGAGGCTGAGGCAGGAG |
Dataset #: | 1 |
Motif ID: | 313 |
Motif name: | Motif 313 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 14 |
Similarity score: | 0.0845425 |
Original motif Consensus sequence: CTCCTGCCTCAGCY | Reverse complement motif Consensus sequence: MGCTGAGGCAGGAG |
Dataset #: | 1 |
Motif ID: | 67 |
Motif name: | Motif 67 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 6 |
Number of overlap: | 14 |
Similarity score: | 0.0925295 |
Original motif Consensus sequence: CTGGGCTCCTGAGTCTGGTG | Reverse complement motif Consensus sequence: CACCAGACTCAGGAGCCCAG |
Dataset #: | 1 |
Motif ID: | 105 |
Motif name: | Motif 105 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 5 |
Number of overlap: | 14 |
Similarity score: | 0.0943803 |
Original motif Consensus sequence: GCCTCTCCCTCCACACCTCC | Reverse complement motif Consensus sequence: GGAGGTGTGGAGGGAGAGGC |
Dataset #: 1 | Motif ID: 73 | Motif name: Motif 73 |
Original motif Consensus sequence: CAAACTGCAAG | Reverse complement motif Consensus sequence: CTTGCAGTTTG |
Best Matches for Motif ID 73 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 292 |
Motif name: | Motif 292 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 6 |
Number of overlap: | 11 |
Similarity score: | 0.0679381 |
Original motif Consensus sequence: AAGACCTTCCAGTGGGACAA | Reverse complement motif Consensus sequence: TTGTCCCACTGGAAGGTCTT |
Dataset #: | 1 |
Motif ID: | 6 |
Motif name: | Motif 6 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 11 |
Similarity score: | 0.0730245 |
Original motif Consensus sequence: GCTCACTGCAASCTC | Reverse complement motif Consensus sequence: GAGSTTGCAGTGAGC |
Dataset #: | 1 |
Motif ID: | 330 |
Motif name: | Motif 330 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 11 |
Similarity score: | 0.0750068 |
Original motif Consensus sequence: AAAACCAGCAAGTTTTTAT | Reverse complement motif Consensus sequence: ATAAAAACTTGCTGGTTTT |
Dataset #: | 1 |
Motif ID: | 245 |
Motif name: | Motif 245 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 11 |
Similarity score: | 0.0826446 |
Original motif Consensus sequence: CAGACTGCCTCCTCAA | Reverse complement motif Consensus sequence: TTGAGGAGGCAGTCTG |
Dataset #: | 1 |
Motif ID: | 293 |
Motif name: | Motif 293 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 10 |
Number of overlap: | 11 |
Similarity score: | 0.0847484 |
Original motif Consensus sequence: CTGACTGGGAGACACCTCCC | Reverse complement motif Consensus sequence: GGGAGGTGTCTCCCAGTCAG |
Dataset #: 1 | Motif ID: 74 | Motif name: Motif 74 |
Original motif Consensus sequence: CACTTCCTAGATGG | Reverse complement motif Consensus sequence: CCATCTAGGAAGTG |
Best Matches for Motif ID 74 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 27 |
Motif name: | Motif 27 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 14 |
Similarity score: | 0.0286091 |
Original motif Consensus sequence: CACTTCCCAGACGGGGCG | Reverse complement motif Consensus sequence: CGCCCCGTCTGGGAAGTG |
Dataset #: | 1 |
Motif ID: | 95 |
Motif name: | Motif 95 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 14 |
Similarity score: | 0.0523125 |
Original motif Consensus sequence: ACCCYGTCTGGGAGGTG | Reverse complement motif Consensus sequence: CACCTCCCAGACMGGGT |
Dataset #: | 1 |
Motif ID: | 45 |
Motif name: | Motif 45 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 14 |
Similarity score: | 0.0563676 |
Original motif Consensus sequence: TGCCCAGTCTGGAAAGTG | Reverse complement motif Consensus sequence: CACTTTCCAGACTGGGCA |
Dataset #: | 1 |
Motif ID: | 15 |
Motif name: | Motif 15 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 14 |
Similarity score: | 0.0605408 |
Original motif Consensus sequence: CTTGCGCTTCCCRRGTGA | Reverse complement motif Consensus sequence: TCACKMGGGAAGCGCAAG |
Dataset #: | 1 |
Motif ID: | 155 |
Motif name: | Motif 155 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 6 |
Number of overlap: | 14 |
Similarity score: | 0.0688109 |
Original motif Consensus sequence: TCCCTCCCGGACGGGGYGGC | Reverse complement motif Consensus sequence: GCCKCCCCGTCCGGGAGGGA |
Dataset #: 1 | Motif ID: 75 | Motif name: Motif 75 |
Original motif Consensus sequence: CATGGAGCGGKK | Reverse complement motif Consensus sequence: RRCCGCTCCATG |
Best Matches for Motif ID 75 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 331 |
Motif name: | Motif 331 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 12 |
Similarity score: | 0.0720918 |
Original motif Consensus sequence: CCACCACAGCTCAAGGAGGC | Reverse complement motif Consensus sequence: GCCTCCTTGAGCTGTGGTGG |
Dataset #: | 1 |
Motif ID: | 56 |
Motif name: | Motif 56 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 12 |
Similarity score: | 0.0764369 |
Original motif Consensus sequence: CRTGAGCCACYGYRCCYGGC | Reverse complement motif Consensus sequence: GCCKGGMKCMGTGGCTCAKG |
Dataset #: | 1 |
Motif ID: | 52 |
Motif name: | Motif 52 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 12 |
Similarity score: | 0.0782422 |
Original motif Consensus sequence: GACTGGCAGGCAGCTCCACC | Reverse complement motif Consensus sequence: GGTGGAGCTGCCTGCCAGTC |
Dataset #: | 1 |
Motif ID: | 43 |
Motif name: | Motif 43 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 12 |
Similarity score: | 0.0795317 |
Original motif Consensus sequence: GCCAGGCAGAGRGKCTCCT | Reverse complement motif Consensus sequence: AGGAGRCMCTCTGCCTGGC |
Dataset #: | 1 |
Motif ID: | 68 |
Motif name: | Motif 68 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 12 |
Similarity score: | 0.0797618 |
Original motif Consensus sequence: CATGGCGGGCTGCAGGTC | Reverse complement motif Consensus sequence: GACCTGCAGCCCGCCATG |
Dataset #: 1 | Motif ID: 76 | Motif name: Motif 76 |
Original motif Consensus sequence: GTGCCAGGCACTGTKCTARG | Reverse complement motif Consensus sequence: CMTAGYACAGTGCCTGGCAC |
Best Matches for Motif ID 76 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 201 |
Motif name: | Motif 201 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.101723 |
Original motif Consensus sequence: GTAACACTCACCGCGARGGT | Reverse complement motif Consensus sequence: ACCKTCGCGGTGAGTGTTAC |
Dataset #: | 1 |
Motif ID: | 109 |
Motif name: | Motif 109 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.102379 |
Original motif Consensus sequence: GAGAGAGAGAGAGAGAGAGA | Reverse complement motif Consensus sequence: TCTCTCTCTCTCTCTCTCTC |
Dataset #: | 1 |
Motif ID: | 16 |
Motif name: | Motif 16 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.103246 |
Original motif Consensus sequence: GAAAGGGAACTCCCTGACCC | Reverse complement motif Consensus sequence: GGGTCAGGGAGTTCCCTTTC |
Dataset #: | 1 |
Motif ID: | 321 |
Motif name: | Motif 321 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.110477 |
Original motif Consensus sequence: AAGCTCGAACTGGGTGGAGC | Reverse complement motif Consensus sequence: GCTCCACCCAGTTCGAGCTT |
Dataset #: | 1 |
Motif ID: | 311 |
Motif name: | Motif 311 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.110507 |
Original motif Consensus sequence: GGCATCACGGATCCTACCAA | Reverse complement motif Consensus sequence: TTGGTAGGATCCGTGATGCC |
Dataset #: 1 | Motif ID: 77 | Motif name: Motif 77 |
Original motif Consensus sequence: AGGAAGAAA | Reverse complement motif Consensus sequence: TTTCTTCCT |
Best Matches for Motif ID 77 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 173 |
Motif name: | Motif 173 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 9 |
Similarity score: | 0.0441796 |
Original motif Consensus sequence: AAGGAAACAA | Reverse complement motif Consensus sequence: TTGTTTCCTT |
Dataset #: | 1 |
Motif ID: | 234 |
Motif name: | Motif 234 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 9 |
Similarity score: | 0.0447051 |
Original motif Consensus sequence: AAGGAACAAACTCCRGACAC | Reverse complement motif Consensus sequence: GTGTCKGGAGTTTGTTCCTT |
Dataset #: | 1 |
Motif ID: | 327 |
Motif name: | Motif 327 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 9 |
Similarity score: | 0.0555228 |
Original motif Consensus sequence: AGGAGGAAGTCAATTTC | Reverse complement motif Consensus sequence: GAAATTGACTTCCTCCT |
Dataset #: | 1 |
Motif ID: | 54 |
Motif name: | Motif 54 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 9 |
Similarity score: | 0.0606671 |
Original motif Consensus sequence: AAGGAAAAGAAA | Reverse complement motif Consensus sequence: TTTCTTTTCCTT |
Dataset #: | 1 |
Motif ID: | 230 |
Motif name: | Motif 230 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 9 |
Number of overlap: | 9 |
Similarity score: | 0.0607922 |
Original motif Consensus sequence: AGAAAGGCATGTGAAAA | Reverse complement motif Consensus sequence: TTTTCACATGCCTTTCT |
Dataset #: 1 | Motif ID: 78 | Motif name: Motif 78 |
Original motif Consensus sequence: CGAGCCCTGCCCCGCGG | Reverse complement motif Consensus sequence: CCGCGGGGCAGGGCTCG |
Best Matches for Motif ID 78 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 96 |
Motif name: | Motif 96 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 17 |
Similarity score: | 0.0803184 |
Original motif Consensus sequence: AAGCTGAGGGAGCCGGCTCC | Reverse complement motif Consensus sequence: GGAGCCGGCTCCCTCAGCTT |
Dataset #: | 1 |
Motif ID: | 30 |
Motif name: | Motif 30 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 17 |
Similarity score: | 0.0851642 |
Original motif Consensus sequence: AGGAGCGCCTCTKCCCGGC | Reverse complement motif Consensus sequence: GCCGGGRAGAGGCGCTCCT |
Dataset #: | 1 |
Motif ID: | 307 |
Motif name: | Motif 307 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 17 |
Similarity score: | 0.0879196 |
Original motif Consensus sequence: AGATGCCAGCCAGAGCTCT | Reverse complement motif Consensus sequence: AGAGCTCTGGCTGGCATCT |
Dataset #: | 1 |
Motif ID: | 56 |
Motif name: | Motif 56 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 17 |
Similarity score: | 0.0902181 |
Original motif Consensus sequence: CRTGAGCCACYGYRCCYGGC | Reverse complement motif Consensus sequence: GCCKGGMKCMGTGGCTCAKG |
Dataset #: | 1 |
Motif ID: | 291 |
Motif name: | Motif 291 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 17 |
Similarity score: | 0.0910467 |
Original motif Consensus sequence: CTGAGGACCTGAGGTCRTA | Reverse complement motif Consensus sequence: TAMGACCTCAGGTCCTCAG |
Dataset #: 1 | Motif ID: 79 | Motif name: Motif 79 |
Original motif Consensus sequence: AATGAATGAAT | Reverse complement motif Consensus sequence: ATTCATTCATT |
Best Matches for Motif ID 79 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 341 |
Motif name: | Motif 341 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 11 |
Similarity score: | 0.0536965 |
Original motif Consensus sequence: ATCCATCCATCCATCCA | Reverse complement motif Consensus sequence: TGGATGGATGGATGGAT |
Dataset #: | 1 |
Motif ID: | 211 |
Motif name: | Motif 211 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 11 |
Similarity score: | 0.0549499 |
Original motif Consensus sequence: GACTTCAAGAATGAAGCCG | Reverse complement motif Consensus sequence: CGGCTTCATTCTTGAAGTC |
Dataset #: | 1 |
Motif ID: | 224 |
Motif name: | Motif 224 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 7 |
Number of overlap: | 11 |
Similarity score: | 0.0557571 |
Original motif Consensus sequence: AATGAGTTAAGACTTTG | Reverse complement motif Consensus sequence: CAAAGTCTTAACTCATT |
Dataset #: | 1 |
Motif ID: | 241 |
Motif name: | Motif 241 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 11 |
Similarity score: | 0.0618186 |
Original motif Consensus sequence: GCACTGAGTGAACGA | Reverse complement motif Consensus sequence: TCGTTCACTCAGTGC |
Dataset #: | 1 |
Motif ID: | 104 |
Motif name: | Motif 104 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 7 |
Number of overlap: | 11 |
Similarity score: | 0.0646429 |
Original motif Consensus sequence: CAACATGGATGRARCTGGAG | Reverse complement motif Consensus sequence: CTCCAGKTMCATCCATGTTG |
Dataset #: 1 | Motif ID: 80 | Motif name: Motif 80 |
Original motif Consensus sequence: WTTTTWAAAAW | Reverse complement motif Consensus sequence: WTTTTWAAAAW |
Best Matches for Motif ID 80 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 319 |
Motif name: | Motif 319 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 11 |
Similarity score: | 0.0536456 |
Original motif Consensus sequence: TAGTTTTTAACAA | Reverse complement motif Consensus sequence: TTGTTAAAAACTA |
Dataset #: | 1 |
Motif ID: | 81 |
Motif name: | Motif 81 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 11 |
Similarity score: | 0.0558466 |
Original motif Consensus sequence: CATCTGTAAAAT | Reverse complement motif Consensus sequence: ATTTTACAGATG |
Dataset #: | 1 |
Motif ID: | 70 |
Motif name: | Motif 70 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 11 |
Similarity score: | 0.0629985 |
Original motif Consensus sequence: CTATTGTGAATARTGCTGC | Reverse complement motif Consensus sequence: GCAGCAMTATTCACAATAG |
Dataset #: | 1 |
Motif ID: | 303 |
Motif name: | Motif 303 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 11 |
Similarity score: | 0.0640096 |
Original motif Consensus sequence: AGTTCTTAAAGATGGT | Reverse complement motif Consensus sequence: ACCATCTTTAAGAACT |
Dataset #: | 1 |
Motif ID: | 21 |
Motif name: | Motif 21 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 11 |
Similarity score: | 0.0694174 |
Original motif Consensus sequence: GCCGTTTKTTAAGCCCGTY | Reverse complement motif Consensus sequence: KACGGGCTTAARAAACGGC |
Dataset #: 1 | Motif ID: 81 | Motif name: Motif 81 |
Original motif Consensus sequence: CATCTGTAAAAT | Reverse complement motif Consensus sequence: ATTTTACAGATG |
Best Matches for Motif ID 81 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 233 |
Motif name: | Motif 233 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 12 |
Similarity score: | 0.0547757 |
Original motif Consensus sequence: GTTAACTGTAAAACAGCCT | Reverse complement motif Consensus sequence: AGGCTGTTTTACAGTTAAC |
Dataset #: | 1 |
Motif ID: | 303 |
Motif name: | Motif 303 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 12 |
Similarity score: | 0.0658845 |
Original motif Consensus sequence: AGTTCTTAAAGATGGT | Reverse complement motif Consensus sequence: ACCATCTTTAAGAACT |
Dataset #: | 1 |
Motif ID: | 325 |
Motif name: | Motif 325 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 12 |
Similarity score: | 0.068248 |
Original motif Consensus sequence: AGCAGCTGTAAATA | Reverse complement motif Consensus sequence: TATTTACAGCTGCT |
Dataset #: | 1 |
Motif ID: | 346 |
Motif name: | Motif 346 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 12 |
Similarity score: | 0.0776147 |
Original motif Consensus sequence: AAATCTTAAAGCTC | Reverse complement motif Consensus sequence: GAGCTTTAAGATTT |
Dataset #: | 1 |
Motif ID: | 280 |
Motif name: | Motif 280 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 12 |
Similarity score: | 0.0783249 |
Original motif Consensus sequence: CCTAGATTTCAGARGATGT | Reverse complement motif Consensus sequence: ACATCMTCTGAAATCTAGG |
Dataset #: 1 | Motif ID: 82 | Motif name: Motif 82 |
Original motif Consensus sequence: GCTTAGCACCYGGGCCAGC | Reverse complement motif Consensus sequence: GCTGGCCCKGGTGCTAAGC |
Best Matches for Motif ID 82 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 100 |
Motif name: | Motif 100 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.0733424 |
Original motif Consensus sequence: GCTGGCCCGCAAGCGCCGCG | Reverse complement motif Consensus sequence: CGCGGCGCTTGCGGGCCAGC |
Dataset #: | 1 |
Motif ID: | 56 |
Motif name: | Motif 56 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.104947 |
Original motif Consensus sequence: CRTGAGCCACYGYRCCYGGC | Reverse complement motif Consensus sequence: GCCKGGMKCMGTGGCTCAKG |
Dataset #: | 1 |
Motif ID: | 149 |
Motif name: | Motif 149 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.10979 |
Original motif Consensus sequence: ACTCAGCCCRCCTGCACCC | Reverse complement motif Consensus sequence: GGGTGCAGGMGGGCTGAGT |
Dataset #: | 1 |
Motif ID: | 155 |
Motif name: | Motif 155 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.114535 |
Original motif Consensus sequence: TCCCTCCCGGACGGGGYGGC | Reverse complement motif Consensus sequence: GCCKCCCCGTCCGGGAGGGA |
Dataset #: | 1 |
Motif ID: | 171 |
Motif name: | Motif 171 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.115408 |
Original motif Consensus sequence: AAAAGTCCACAGTCCAAAGT | Reverse complement motif Consensus sequence: ACTTTGGACTGTGGACTTTT |
Dataset #: 1 | Motif ID: 83 | Motif name: Motif 83 |
Original motif Consensus sequence: AAAATGTGGTAYATAYAYAC | Reverse complement motif Consensus sequence: GTKTMTATMTACCACATTTT |
Best Matches for Motif ID 83 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 86 |
Motif name: | Motif 86 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.100064 |
Original motif Consensus sequence: AGTAGGTGCTCARTAAATRB | Reverse complement motif Consensus sequence: VMATTTAKTGAGCACCTACT |
Dataset #: | 1 |
Motif ID: | 308 |
Motif name: | Motif 308 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.110604 |
Original motif Consensus sequence: AAATTAGGCCAATTAATAAC | Reverse complement motif Consensus sequence: GTTATTAATTGGCCTAATTT |
Dataset #: | 1 |
Motif ID: | 225 |
Motif name: | Motif 225 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.110608 |
Original motif Consensus sequence: GCACATGTAYCCYAGAACTT | Reverse complement motif Consensus sequence: AAGTTCTKGGKTACATGTGC |
Dataset #: | 1 |
Motif ID: | 254 |
Motif name: | Motif 254 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.111201 |
Original motif Consensus sequence: AAAATCACAAGCATTCCTAT | Reverse complement motif Consensus sequence: ATAGGAATGCTTGTGATTTT |
Dataset #: | 1 |
Motif ID: | 178 |
Motif name: | Motif 178 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.120185 |
Original motif Consensus sequence: ACTGTCTTCCACCTCCACAT | Reverse complement motif Consensus sequence: ATGTGGAGGTGGAAGACAGT |
Dataset #: 1 | Motif ID: 84 | Motif name: Motif 84 |
Original motif Consensus sequence: CTGGGTCCCCCAGCAGTGCC | Reverse complement motif Consensus sequence: GGCACTGCTGGGGGACCCAG |
Best Matches for Motif ID 84 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 61 |
Motif name: | Motif 61 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.106094 |
Original motif Consensus sequence: GGATCCACTGGGTGAAGCCA | Reverse complement motif Consensus sequence: TGGCTTCACCCAGTGGATCC |
Dataset #: | 1 |
Motif ID: | 29 |
Motif name: | Motif 29 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.107291 |
Original motif Consensus sequence: CTGGGCRACAGAGYRAGACY | Reverse complement motif Consensus sequence: MGTCTMKCTCTGTKGCCCAG |
Dataset #: | 1 |
Motif ID: | 67 |
Motif name: | Motif 67 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.113605 |
Original motif Consensus sequence: CTGGGCTCCTGAGTCTGGTG | Reverse complement motif Consensus sequence: CACCAGACTCAGGAGCCCAG |
Dataset #: | 1 |
Motif ID: | 100 |
Motif name: | Motif 100 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.113686 |
Original motif Consensus sequence: GCTGGCCCGCAAGCGCCGCG | Reverse complement motif Consensus sequence: CGCGGCGCTTGCGGGCCAGC |
Dataset #: | 1 |
Motif ID: | 312 |
Motif name: | Motif 312 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.115597 |
Original motif Consensus sequence: AGGACTGAGGGTGCCYRGGG | Reverse complement motif Consensus sequence: CCCMKGGCACCCTCAGTCCT |
Dataset #: 1 | Motif ID: 85 | Motif name: Motif 85 |
Original motif Consensus sequence: CTAGACATAAAGGTTCTCCA | Reverse complement motif Consensus sequence: TGGAGAACCTTTATGTCTAG |
Best Matches for Motif ID 85 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 58 |
Motif name: | Motif 58 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.122722 |
Original motif Consensus sequence: ATGGACAYTTRGGTTGHTTC | Reverse complement motif Consensus sequence: GAAHCAACCKAAKTGTCCAT |
Dataset #: | 1 |
Motif ID: | 332 |
Motif name: | Motif 332 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.127727 |
Original motif Consensus sequence: CTGGCCCTCAATGGTTAAAC | Reverse complement motif Consensus sequence: GTTTAACCATTGAGGGCCAG |
Dataset #: | 1 |
Motif ID: | 26 |
Motif name: | Motif 26 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.1415 |
Original motif Consensus sequence: CTCCTGCCTCAGCCTCCCRA | Reverse complement motif Consensus sequence: TMGGGAGGCTGAGGCAGGAG |
Dataset #: | 1 |
Motif ID: | 254 |
Motif name: | Motif 254 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.141611 |
Original motif Consensus sequence: AAAATCACAAGCATTCCTAT | Reverse complement motif Consensus sequence: ATAGGAATGCTTGTGATTTT |
Dataset #: | 1 |
Motif ID: | 262 |
Motif name: | Motif 262 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.142355 |
Original motif Consensus sequence: CTCAGTGTTAATCTCCTGTC | Reverse complement motif Consensus sequence: GACAGGAGATTAACACTGAG |
Dataset #: 1 | Motif ID: 86 | Motif name: Motif 86 |
Original motif Consensus sequence: AGTAGGTGCTCARTAAATRB | Reverse complement motif Consensus sequence: VMATTTAKTGAGCACCTACT |
Best Matches for Motif ID 86 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 83 |
Motif name: | Motif 83 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.0711295 |
Original motif Consensus sequence: AAAATGTGGTAYATAYAYAC | Reverse complement motif Consensus sequence: GTKTMTATMTACCACATTTT |
Dataset #: | 1 |
Motif ID: | 137 |
Motif name: | Motif 137 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.0944134 |
Original motif Consensus sequence: AGGTTTGTTACATAGGTAWA | Reverse complement motif Consensus sequence: TWTACCTATGTAACAAACCT |
Dataset #: | 1 |
Motif ID: | 139 |
Motif name: | Motif 139 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.097593 |
Original motif Consensus sequence: AGCCYCTGGYAACCAYYAWT | Reverse complement motif Consensus sequence: AWTKKTGGTTKCCAGKGGCT |
Dataset #: | 1 |
Motif ID: | 8 |
Motif name: | Motif 8 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.0992318 |
Original motif Consensus sequence: ATCRCTTGAGSYCAGGAGKT | Reverse complement motif Consensus sequence: ARCTCCTGKSCTCAAGKGAT |
Dataset #: | 1 |
Motif ID: | 63 |
Motif name: | Motif 63 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.100826 |
Original motif Consensus sequence: AGTGAGAACATRYRRTRTTT | Reverse complement motif Consensus sequence: AAAMAMMKMATGTTCTCACT |
Dataset #: 1 | Motif ID: 87 | Motif name: Motif 87 |
Original motif Consensus sequence: CATGTGTGTCC | Reverse complement motif Consensus sequence: GGACACACATG |
Best Matches for Motif ID 87 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 206 |
Motif name: | Motif 206 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 11 |
Similarity score: | 0.0574969 |
Original motif Consensus sequence: GCTCCWGTGYGKCC | Reverse complement motif Consensus sequence: GGRCKCACWGGAGC |
Dataset #: | 1 |
Motif ID: | 120 |
Motif name: | Motif 120 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 11 |
Similarity score: | 0.062082 |
Original motif Consensus sequence: CCATGTGSTCCC | Reverse complement motif Consensus sequence: GGGASCACATGG |
Dataset #: | 1 |
Motif ID: | 49 |
Motif name: | Motif 49 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 11 |
Similarity score: | 0.0650944 |
Original motif Consensus sequence: ACATCTGYMMCC | Reverse complement motif Consensus sequence: GGRRMCAGATGT |
Dataset #: | 1 |
Motif ID: | 310 |
Motif name: | Motif 310 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 11 |
Similarity score: | 0.0757271 |
Original motif Consensus sequence: CCCATGCAAGTCYRAAATCC | Reverse complement motif Consensus sequence: GGATTTMKGACTTGCATGGG |
Dataset #: | 1 |
Motif ID: | 293 |
Motif name: | Motif 293 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 8 |
Number of overlap: | 11 |
Similarity score: | 0.076468 |
Original motif Consensus sequence: CTGACTGGGAGACACCTCCC | Reverse complement motif Consensus sequence: GGGAGGTGTCTCCCAGTCAG |
Dataset #: 1 | Motif ID: 88 | Motif name: Motif 88 |
Original motif Consensus sequence: ACCGGGGCTGCA | Reverse complement motif Consensus sequence: TGCAGCCCCGGT |
Best Matches for Motif ID 88 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 62 |
Motif name: | Motif 62 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 12 |
Similarity score: | 0.0744827 |
Original motif Consensus sequence: AGGAACAGCTCCRGTCTAC | Reverse complement motif Consensus sequence: GTAGACKGGAGCTGTTCCT |
Dataset #: | 1 |
Motif ID: | 17 |
Motif name: | Motif 17 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 12 |
Similarity score: | 0.0782839 |
Original motif Consensus sequence: AGACAGTGGGYGCAGGHCA | Reverse complement motif Consensus sequence: TGHCCTGCKCCCACTGTCT |
Dataset #: | 1 |
Motif ID: | 312 |
Motif name: | Motif 312 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 12 |
Similarity score: | 0.0814191 |
Original motif Consensus sequence: AGGACTGAGGGTGCCYRGGG | Reverse complement motif Consensus sequence: CCCMKGGCACCCTCAGTCCT |
Dataset #: | 1 |
Motif ID: | 68 |
Motif name: | Motif 68 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 12 |
Similarity score: | 0.0835295 |
Original motif Consensus sequence: CATGGCGGGCTGCAGGTC | Reverse complement motif Consensus sequence: GACCTGCAGCCCGCCATG |
Dataset #: | 1 |
Motif ID: | 177 |
Motif name: | Motif 177 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 12 |
Similarity score: | 0.0835511 |
Original motif Consensus sequence: CCCGAAGCTGCRYRCTCGGT | Reverse complement motif Consensus sequence: ACCGAGMKMGCAGCTTCGGG |
Dataset #: 1 | Motif ID: 89 | Motif name: Motif 89 |
Original motif Consensus sequence: GGCTGCGGAGGGTGTA | Reverse complement motif Consensus sequence: TACACCCTCCGCAGCC |
Best Matches for Motif ID 89 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 105 |
Motif name: | Motif 105 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 16 |
Similarity score: | 0.0814615 |
Original motif Consensus sequence: GCCTCTCCCTCCACACCTCC | Reverse complement motif Consensus sequence: GGAGGTGTGGAGGGAGAGGC |
Dataset #: | 1 |
Motif ID: | 67 |
Motif name: | Motif 67 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 16 |
Similarity score: | 0.0835227 |
Original motif Consensus sequence: CTGGGCTCCTGAGTCTGGTG | Reverse complement motif Consensus sequence: CACCAGACTCAGGAGCCCAG |
Dataset #: | 1 |
Motif ID: | 61 |
Motif name: | Motif 61 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 5 |
Number of overlap: | 16 |
Similarity score: | 0.089486 |
Original motif Consensus sequence: GGATCCACTGGGTGAAGCCA | Reverse complement motif Consensus sequence: TGGCTTCACCCAGTGGATCC |
Dataset #: | 1 |
Motif ID: | 191 |
Motif name: | Motif 191 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 16 |
Similarity score: | 0.0927728 |
Original motif Consensus sequence: AAAGTGCCGAGAKTGCAGC | Reverse complement motif Consensus sequence: GCTGCARTCTCGGCACTTT |
Dataset #: | 1 |
Motif ID: | 26 |
Motif name: | Motif 26 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 16 |
Similarity score: | 0.0932417 |
Original motif Consensus sequence: CTCCTGCCTCAGCCTCCCRA | Reverse complement motif Consensus sequence: TMGGGAGGCTGAGGCAGGAG |
Dataset #: 1 | Motif ID: 90 | Motif name: Motif 90 |
Original motif Consensus sequence: CCCCATTGCY | Reverse complement motif Consensus sequence: KGCAATGGGG |
Best Matches for Motif ID 90 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 193 |
Motif name: | Motif 193 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 9 |
Number of overlap: | 10 |
Similarity score: | 0.0254376 |
Original motif Consensus sequence: ATACAATGGGGGTACAGRC | Reverse complement motif Consensus sequence: GKCTGTACCCCCATTGTAT |
Dataset #: | 1 |
Motif ID: | 196 |
Motif name: | Motif 196 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 9 |
Number of overlap: | 10 |
Similarity score: | 0.0348826 |
Original motif Consensus sequence: CCTGCCATTGCYSAGGCTTG | Reverse complement motif Consensus sequence: CAAGCCTSKGCAATGGCAGG |
Dataset #: | 1 |
Motif ID: | 247 |
Motif name: | Motif 247 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 10 |
Similarity score: | 0.0547148 |
Original motif Consensus sequence: GCCTCACTGCCRC | Reverse complement motif Consensus sequence: GKGGCAGTGAGGC |
Dataset #: | 1 |
Motif ID: | 3 |
Motif name: | Motif 3 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 10 |
Similarity score: | 0.0556877 |
Original motif Consensus sequence: GCTGGAGTGCAGTGGCRYGA | Reverse complement motif Consensus sequence: TCKMGCCACTGCACTCCAGC |
Dataset #: | 1 |
Motif ID: | 136 |
Motif name: | Motif 136 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 6 |
Number of overlap: | 10 |
Similarity score: | 0.0564416 |
Original motif Consensus sequence: CCCTCACTGCCCGGGG | Reverse complement motif Consensus sequence: CCCCGGGCAGTGAGGG |
Dataset #: 1 | Motif ID: 91 | Motif name: Motif 91 |
Original motif Consensus sequence: AGACYCYGTCTCAA | Reverse complement motif Consensus sequence: TTGAGACMGKGTCT |
Best Matches for Motif ID 91 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 175 |
Motif name: | Motif 175 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 14 |
Similarity score: | 0.0743241 |
Original motif Consensus sequence: AGCTAGAYACAGAGTGC | Reverse complement motif Consensus sequence: GCACTCTGTMTCTAGCT |
Dataset #: | 1 |
Motif ID: | 160 |
Motif name: | Motif 160 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 14 |
Similarity score: | 0.0811922 |
Original motif Consensus sequence: AAATTACCCAGTCTCAGGTA | Reverse complement motif Consensus sequence: TACCTGAGACTGGGTAATTT |
Dataset #: | 1 |
Motif ID: | 85 |
Motif name: | Motif 85 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 14 |
Similarity score: | 0.0815627 |
Original motif Consensus sequence: CTAGACATAAAGGTTCTCCA | Reverse complement motif Consensus sequence: TGGAGAACCTTTATGTCTAG |
Dataset #: | 1 |
Motif ID: | 99 |
Motif name: | Motif 99 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 6 |
Number of overlap: | 14 |
Similarity score: | 0.0862654 |
Original motif Consensus sequence: GCAAAKGACATGATYTCATT | Reverse complement motif Consensus sequence: AATGAKATCATGTCYTTTGC |
Dataset #: | 1 |
Motif ID: | 76 |
Motif name: | Motif 76 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 6 |
Number of overlap: | 14 |
Similarity score: | 0.0925706 |
Original motif Consensus sequence: GTGCCAGGCACTGTKCTARG | Reverse complement motif Consensus sequence: CMTAGYACAGTGCCTGGCAC |
Dataset #: 1 | Motif ID: 92 | Motif name: Motif 92 |
Original motif Consensus sequence: GGGGGCTGACCCCCCCACC | Reverse complement motif Consensus sequence: GGTGGGGGGGTCAGCCCCC |
Best Matches for Motif ID 92 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 52 |
Motif name: | Motif 52 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.100201 |
Original motif Consensus sequence: GACTGGCAGGCAGCTCCACC | Reverse complement motif Consensus sequence: GGTGGAGCTGCCTGCCAGTC |
Dataset #: | 1 |
Motif ID: | 293 |
Motif name: | Motif 293 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.10109 |
Original motif Consensus sequence: CTGACTGGGAGACACCTCCC | Reverse complement motif Consensus sequence: GGGAGGTGTCTCCCAGTCAG |
Dataset #: | 1 |
Motif ID: | 178 |
Motif name: | Motif 178 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.111897 |
Original motif Consensus sequence: ACTGTCTTCCACCTCCACAT | Reverse complement motif Consensus sequence: ATGTGGAGGTGGAAGACAGT |
Dataset #: | 1 |
Motif ID: | 350 |
Motif name: | Motif 350 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.111901 |
Original motif Consensus sequence: TCTGGAGTGGACCTCCAGCA | Reverse complement motif Consensus sequence: TGCTGGAGGTCCACTCCAGA |
Dataset #: | 1 |
Motif ID: | 96 |
Motif name: | Motif 96 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.113858 |
Original motif Consensus sequence: AAGCTGAGGGAGCCGGCTCC | Reverse complement motif Consensus sequence: GGAGCCGGCTCCCTCAGCTT |
Dataset #: 1 | Motif ID: 93 | Motif name: Motif 93 |
Original motif Consensus sequence: CCATGTGCGG | Reverse complement motif Consensus sequence: CCGCACATGG |
Best Matches for Motif ID 93 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 128 |
Motif name: | Motif 128 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 10 |
Similarity score: | 0.0496914 |
Original motif Consensus sequence: CCGCACTCGGAGCRG | Reverse complement motif Consensus sequence: CMGCTCCGAGTGCGG |
Dataset #: | 1 |
Motif ID: | 25 |
Motif name: | Motif 25 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 6 |
Number of overlap: | 10 |
Similarity score: | 0.0540497 |
Original motif Consensus sequence: CATTTCCAWCTGAGGTAC | Reverse complement motif Consensus sequence: GTACCTCAGWTGGAAATG |
Dataset #: | 1 |
Motif ID: | 120 |
Motif name: | Motif 120 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 10 |
Similarity score: | 0.0552113 |
Original motif Consensus sequence: CCATGTGSTCCC | Reverse complement motif Consensus sequence: GGGASCACATGG |
Dataset #: | 1 |
Motif ID: | 324 |
Motif name: | Motif 324 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 10 |
Similarity score: | 0.0568222 |
Original motif Consensus sequence: ACGCACCTGTA | Reverse complement motif Consensus sequence: TACAGGTGCGT |
Dataset #: | 1 |
Motif ID: | 257 |
Motif name: | Motif 257 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 10 |
Similarity score: | 0.0665322 |
Original motif Consensus sequence: GAGAACACATGGACA | Reverse complement motif Consensus sequence: TGTCCATGTGTTCTC |
Dataset #: 1 | Motif ID: 94 | Motif name: Motif 94 |
Original motif Consensus sequence: TAAGTGGGAGCTAARC | Reverse complement motif Consensus sequence: GMTTAGCTCCCACTTA |
Best Matches for Motif ID 94 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 333 |
Motif name: | Motif 333 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 16 |
Similarity score: | 0.062587 |
Original motif Consensus sequence: TAGATAATAGCTCCAGCTTT | Reverse complement motif Consensus sequence: AAAGCTGGAGCTATTATCTA |
Dataset #: | 1 |
Motif ID: | 306 |
Motif name: | Motif 306 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 16 |
Similarity score: | 0.0700236 |
Original motif Consensus sequence: GACATGAGCTGGCGCTTG | Reverse complement motif Consensus sequence: CAAGCGCCAGCTCATGTC |
Dataset #: | 1 |
Motif ID: | 293 |
Motif name: | Motif 293 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 16 |
Similarity score: | 0.0707484 |
Original motif Consensus sequence: CTGACTGGGAGACACCTCCC | Reverse complement motif Consensus sequence: GGGAGGTGTCTCCCAGTCAG |
Dataset #: | 1 |
Motif ID: | 284 |
Motif name: | Motif 284 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 16 |
Similarity score: | 0.0721808 |
Original motif Consensus sequence: CATTTGGGAGCCCATTGA | Reverse complement motif Consensus sequence: TCAATGGGCTCCCAAATG |
Dataset #: | 1 |
Motif ID: | 17 |
Motif name: | Motif 17 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 16 |
Similarity score: | 0.0724147 |
Original motif Consensus sequence: AGACAGTGGGYGCAGGHCA | Reverse complement motif Consensus sequence: TGHCCTGCKCCCACTGTCT |
Dataset #: 1 | Motif ID: 95 | Motif name: Motif 95 |
Original motif Consensus sequence: ACCCYGTCTGGGAGGTG | Reverse complement motif Consensus sequence: CACCTCCCAGACMGGGT |
Best Matches for Motif ID 95 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 27 |
Motif name: | Motif 27 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 17 |
Similarity score: | 0.0376618 |
Original motif Consensus sequence: CACTTCCCAGACGGGGCG | Reverse complement motif Consensus sequence: CGCCCCGTCTGGGAAGTG |
Dataset #: | 1 |
Motif ID: | 45 |
Motif name: | Motif 45 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 17 |
Similarity score: | 0.0519023 |
Original motif Consensus sequence: TGCCCAGTCTGGAAAGTG | Reverse complement motif Consensus sequence: CACTTTCCAGACTGGGCA |
Dataset #: | 1 |
Motif ID: | 155 |
Motif name: | Motif 155 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 17 |
Similarity score: | 0.0726859 |
Original motif Consensus sequence: TCCCTCCCGGACGGGGYGGC | Reverse complement motif Consensus sequence: GCCKCCCCGTCCGGGAGGGA |
Dataset #: | 1 |
Motif ID: | 202 |
Motif name: | Motif 202 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 17 |
Similarity score: | 0.0892583 |
Original motif Consensus sequence: ACACATCACAAAGCAGTTTC | Reverse complement motif Consensus sequence: GAAACTGCTTTGTGATGTGT |
Dataset #: | 1 |
Motif ID: | 242 |
Motif name: | Motif 242 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 17 |
Similarity score: | 0.0946365 |
Original motif Consensus sequence: AACCCTATTGTGAACTGYG | Reverse complement motif Consensus sequence: CMCAGTTCACAATAGGGTT |
Dataset #: 1 | Motif ID: 96 | Motif name: Motif 96 |
Original motif Consensus sequence: AAGCTGAGGGAGCCGGCTCC | Reverse complement motif Consensus sequence: GGAGCCGGCTCCCTCAGCTT |
Best Matches for Motif ID 96 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 13 |
Motif name: | Motif 13 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.0900694 |
Original motif Consensus sequence: AAGCAGGGCGAGGCATTGCC | Reverse complement motif Consensus sequence: GGCAATGCCTCGCCCTGCTT |
Dataset #: | 1 |
Motif ID: | 108 |
Motif name: | Motif 108 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.11205 |
Original motif Consensus sequence: CGAGCCTCCCCGAYGAGCGC | Reverse complement motif Consensus sequence: GCGCTCKTCGGGGAGGCTCG |
Dataset #: | 1 |
Motif ID: | 333 |
Motif name: | Motif 333 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.116847 |
Original motif Consensus sequence: TAGATAATAGCTCCAGCTTT | Reverse complement motif Consensus sequence: AAAGCTGGAGCTATTATCTA |
Dataset #: | 1 |
Motif ID: | 225 |
Motif name: | Motif 225 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.118204 |
Original motif Consensus sequence: GCACATGTAYCCYAGAACTT | Reverse complement motif Consensus sequence: AAGTTCTKGGKTACATGTGC |
Dataset #: | 1 |
Motif ID: | 178 |
Motif name: | Motif 178 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.125147 |
Original motif Consensus sequence: ACTGTCTTCCACCTCCACAT | Reverse complement motif Consensus sequence: ATGTGGAGGTGGAAGACAGT |
Dataset #: 1 | Motif ID: 97 | Motif name: Motif 97 |
Original motif Consensus sequence: AAGATGGCCGAAT | Reverse complement motif Consensus sequence: ATTCGGCCATCTT |
Best Matches for Motif ID 97 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 35 |
Motif name: | Motif 35 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 13 |
Similarity score: | 0.0664224 |
Original motif Consensus sequence: CAGAAATCACCCGTCTT | Reverse complement motif Consensus sequence: AAGACGGGTGATTTCTG |
Dataset #: | 1 |
Motif ID: | 308 |
Motif name: | Motif 308 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 6 |
Number of overlap: | 13 |
Similarity score: | 0.0712075 |
Original motif Consensus sequence: AAATTAGGCCAATTAATAAC | Reverse complement motif Consensus sequence: GTTATTAATTGGCCTAATTT |
Dataset #: | 1 |
Motif ID: | 149 |
Motif name: | Motif 149 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 7 |
Number of overlap: | 13 |
Similarity score: | 0.0758335 |
Original motif Consensus sequence: ACTCAGCCCRCCTGCACCC | Reverse complement motif Consensus sequence: GGGTGCAGGMGGGCTGAGT |
Dataset #: | 1 |
Motif ID: | 18 |
Motif name: | Motif 18 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 6 |
Number of overlap: | 13 |
Similarity score: | 0.0829089 |
Original motif Consensus sequence: GAAAAGCGCAGTATTMGGG | Reverse complement motif Consensus sequence: CCCYAATACTGCGCTTTTC |
Dataset #: | 1 |
Motif ID: | 309 |
Motif name: | Motif 309 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 13 |
Similarity score: | 0.0840391 |
Original motif Consensus sequence: CATTCTGGGGTCTGGAGGAY | Reverse complement motif Consensus sequence: MTCCTCCAGACCCCAGAATG |
Dataset #: 1 | Motif ID: 98 | Motif name: Motif 98 |
Original motif Consensus sequence: AGTTCCGGGTGGGCGTGGG | Reverse complement motif Consensus sequence: CCCACGCCCACCCGGAACT |
Best Matches for Motif ID 98 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 122 |
Motif name: | Motif 122 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.0965972 |
Original motif Consensus sequence: CCTTGGCCAGCCCAGAAAG | Reverse complement motif Consensus sequence: CTTTCTGGGCTGGCCAAGG |
Dataset #: | 1 |
Motif ID: | 312 |
Motif name: | Motif 312 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.0978875 |
Original motif Consensus sequence: AGGACTGAGGGTGCCYRGGG | Reverse complement motif Consensus sequence: CCCMKGGCACCCTCAGTCCT |
Dataset #: | 1 |
Motif ID: | 176 |
Motif name: | Motif 176 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.0980426 |
Original motif Consensus sequence: AGGCCCCAGTGTSTGTTGTT | Reverse complement motif Consensus sequence: AACAACASACACTGGGGCCT |
Dataset #: | 1 |
Motif ID: | 321 |
Motif name: | Motif 321 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.102363 |
Original motif Consensus sequence: AAGCTCGAACTGGGTGGAGC | Reverse complement motif Consensus sequence: GCTCCACCCAGTTCGAGCTT |
Dataset #: | 1 |
Motif ID: | 149 |
Motif name: | Motif 149 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.103971 |
Original motif Consensus sequence: ACTCAGCCCRCCTGCACCC | Reverse complement motif Consensus sequence: GGGTGCAGGMGGGCTGAGT |
Dataset #: 1 | Motif ID: 99 | Motif name: Motif 99 |
Original motif Consensus sequence: GCAAAKGACATGATYTCATT | Reverse complement motif Consensus sequence: AATGAKATCATGTCYTTTGC |
Best Matches for Motif ID 99 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 63 |
Motif name: | Motif 63 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.0793398 |
Original motif Consensus sequence: AGTGAGAACATRYRRTRTTT | Reverse complement motif Consensus sequence: AAAMAMMKMATGTTCTCACT |
Dataset #: | 1 |
Motif ID: | 19 |
Motif name: | Motif 19 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.0873595 |
Original motif Consensus sequence: CACCAGGAGATTATATCCCR | Reverse complement motif Consensus sequence: MGGGATATAATCTCCTGGTG |
Dataset #: | 1 |
Motif ID: | 145 |
Motif name: | Motif 145 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.0892295 |
Original motif Consensus sequence: GCCAGTCACAAAARGACAMA | Reverse complement motif Consensus sequence: TYTGTCMTTTTGTGACTGGC |
Dataset #: | 1 |
Motif ID: | 177 |
Motif name: | Motif 177 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.0978439 |
Original motif Consensus sequence: CCCGAAGCTGCRYRCTCGGT | Reverse complement motif Consensus sequence: ACCGAGMKMGCAGCTTCGGG |
Dataset #: | 1 |
Motif ID: | 13 |
Motif name: | Motif 13 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.0984998 |
Original motif Consensus sequence: AAGCAGGGCGAGGCATTGCC | Reverse complement motif Consensus sequence: GGCAATGCCTCGCCCTGCTT |
Dataset #: 1 | Motif ID: 100 | Motif name: Motif 100 |
Original motif Consensus sequence: GCTGGCCCGCAAGCGCCGCG | Reverse complement motif Consensus sequence: CGCGGCGCTTGCGGGCCAGC |
Best Matches for Motif ID 100 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 64 |
Motif name: | Motif 64 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.109117 |
Original motif Consensus sequence: GAAGGCAGCTAAGGCCCGGY | Reverse complement motif Consensus sequence: KCCGGGCCTTAGCTGCCTTC |
Dataset #: | 1 |
Motif ID: | 3 |
Motif name: | Motif 3 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.111065 |
Original motif Consensus sequence: GCTGGAGTGCAGTGGCRYGA | Reverse complement motif Consensus sequence: TCKMGCCACTGCACTCCAGC |
Dataset #: | 1 |
Motif ID: | 52 |
Motif name: | Motif 52 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.112704 |
Original motif Consensus sequence: GACTGGCAGGCAGCTCCACC | Reverse complement motif Consensus sequence: GGTGGAGCTGCCTGCCAGTC |
Dataset #: | 1 |
Motif ID: | 84 |
Motif name: | Motif 84 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.114051 |
Original motif Consensus sequence: CTGGGTCCCCCAGCAGTGCC | Reverse complement motif Consensus sequence: GGCACTGCTGGGGGACCCAG |
Dataset #: | 1 |
Motif ID: | 155 |
Motif name: | Motif 155 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.12131 |
Original motif Consensus sequence: TCCCTCCCGGACGGGGYGGC | Reverse complement motif Consensus sequence: GCCKCCCCGTCCGGGAGGGA |
Dataset #: 1 | Motif ID: 101 | Motif name: Motif 101 |
Original motif Consensus sequence: CGCCGCCGCCGC | Reverse complement motif Consensus sequence: GCGGCGGCGGCG |
Best Matches for Motif ID 101 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 266 |
Motif name: | Motif 266 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 12 |
Similarity score: | 0.0686683 |
Original motif Consensus sequence: GCAGCAGCAGCA | Reverse complement motif Consensus sequence: TGCTGCTGCTGC |
Dataset #: | 1 |
Motif ID: | 100 |
Motif name: | Motif 100 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 12 |
Similarity score: | 0.0752454 |
Original motif Consensus sequence: GCTGGCCCGCAAGCGCCGCG | Reverse complement motif Consensus sequence: CGCGGCGCTTGCGGGCCAGC |
Dataset #: | 1 |
Motif ID: | 39 |
Motif name: | Motif 39 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 12 |
Similarity score: | 0.0783129 |
Original motif Consensus sequence: AGGCGGCTGGGAGG | Reverse complement motif Consensus sequence: CCTCCCAGCCGCCT |
Dataset #: | 1 |
Motif ID: | 286 |
Motif name: | Motif 286 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 12 |
Similarity score: | 0.078982 |
Original motif Consensus sequence: CAGGCGGCTGGGAG | Reverse complement motif Consensus sequence: CTCCCAGCCGCCTG |
Dataset #: | 1 |
Motif ID: | 229 |
Motif name: | Motif 229 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 12 |
Similarity score: | 0.0792901 |
Original motif Consensus sequence: GCCTTGCTGCCGC | Reverse complement motif Consensus sequence: GCGGCAGCAAGGC |
Dataset #: 1 | Motif ID: 102 | Motif name: Motif 102 |
Original motif Consensus sequence: CTCATTTAATCCTCACAAC | Reverse complement motif Consensus sequence: GTTGTGAGGATTAAATGAG |
Best Matches for Motif ID 102 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 310 |
Motif name: | Motif 310 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.0961125 |
Original motif Consensus sequence: CCCATGCAAGTCYRAAATCC | Reverse complement motif Consensus sequence: GGATTTMKGACTTGCATGGG |
Dataset #: | 1 |
Motif ID: | 309 |
Motif name: | Motif 309 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.0968109 |
Original motif Consensus sequence: CATTCTGGGGTCTGGAGGAY | Reverse complement motif Consensus sequence: MTCCTCCAGACCCCAGAATG |
Dataset #: | 1 |
Motif ID: | 8 |
Motif name: | Motif 8 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.0987666 |
Original motif Consensus sequence: ATCRCTTGAGSYCAGGAGKT | Reverse complement motif Consensus sequence: ARCTCCTGKSCTCAAGKGAT |
Dataset #: | 1 |
Motif ID: | 178 |
Motif name: | Motif 178 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.101876 |
Original motif Consensus sequence: ACTGTCTTCCACCTCCACAT | Reverse complement motif Consensus sequence: ATGTGGAGGTGGAAGACAGT |
Dataset #: | 1 |
Motif ID: | 7 |
Motif name: | Motif 7 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.101917 |
Original motif Consensus sequence: GTCTCWAMAAAAAAWAMAAA | Reverse complement motif Consensus sequence: TTTYTWTTTTTTYTWGAGAC |
Dataset #: 1 | Motif ID: 103 | Motif name: Motif 103 |
Original motif Consensus sequence: AAGTGAAATAA | Reverse complement motif Consensus sequence: TTATTTCACTT |
Best Matches for Motif ID 103 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 24 |
Motif name: | Motif 24 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 11 |
Similarity score: | 0.0659798 |
Original motif Consensus sequence: CKAGTCAAAGAAA | Reverse complement motif Consensus sequence: TTTCTTTGACTRG |
Dataset #: | 1 |
Motif ID: | 281 |
Motif name: | Motif 281 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 11 |
Similarity score: | 0.068219 |
Original motif Consensus sequence: AAATGGAATCAT | Reverse complement motif Consensus sequence: ATGATTCCATTT |
Dataset #: | 1 |
Motif ID: | 23 |
Motif name: | Motif 23 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 7 |
Number of overlap: | 11 |
Similarity score: | 0.069022 |
Original motif Consensus sequence: GGTTCATCTCACTAGGGAGT | Reverse complement motif Consensus sequence: ACTCCCTAGTGAGATGAACC |
Dataset #: | 1 |
Motif ID: | 129 |
Motif name: | Motif 129 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 11 |
Similarity score: | 0.0694615 |
Original motif Consensus sequence: AAGAGGTTTAATTGRCTCA | Reverse complement motif Consensus sequence: TGAGKCAATTAAACCTCTT |
Dataset #: | 1 |
Motif ID: | 16 |
Motif name: | Motif 16 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 11 |
Similarity score: | 0.0711874 |
Original motif Consensus sequence: GAAAGGGAACTCCCTGACCC | Reverse complement motif Consensus sequence: GGGTCAGGGAGTTCCCTTTC |
Dataset #: 1 | Motif ID: 104 | Motif name: Motif 104 |
Original motif Consensus sequence: CAACATGGATGRARCTGGAG | Reverse complement motif Consensus sequence: CTCCAGKTMCATCCATGTTG |
Best Matches for Motif ID 104 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 26 |
Motif name: | Motif 26 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.0969491 |
Original motif Consensus sequence: CTCCTGCCTCAGCCTCCCRA | Reverse complement motif Consensus sequence: TMGGGAGGCTGAGGCAGGAG |
Dataset #: | 1 |
Motif ID: | 139 |
Motif name: | Motif 139 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.111535 |
Original motif Consensus sequence: AGCCYCTGGYAACCAYYAWT | Reverse complement motif Consensus sequence: AWTKKTGGTTKCCAGKGGCT |
Dataset #: | 1 |
Motif ID: | 262 |
Motif name: | Motif 262 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.113078 |
Original motif Consensus sequence: CTCAGTGTTAATCTCCTGTC | Reverse complement motif Consensus sequence: GACAGGAGATTAACACTGAG |
Dataset #: | 1 |
Motif ID: | 202 |
Motif name: | Motif 202 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.113748 |
Original motif Consensus sequence: ACACATCACAAAGCAGTTTC | Reverse complement motif Consensus sequence: GAAACTGCTTTGTGATGTGT |
Dataset #: | 1 |
Motif ID: | 83 |
Motif name: | Motif 83 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.117001 |
Original motif Consensus sequence: AAAATGTGGTAYATAYAYAC | Reverse complement motif Consensus sequence: GTKTMTATMTACCACATTTT |
Dataset #: 1 | Motif ID: 105 | Motif name: Motif 105 |
Original motif Consensus sequence: GCCTCTCCCTCCACACCTCC | Reverse complement motif Consensus sequence: GGAGGTGTGGAGGGAGAGGC |
Best Matches for Motif ID 105 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 52 |
Motif name: | Motif 52 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.118803 |
Original motif Consensus sequence: GACTGGCAGGCAGCTCCACC | Reverse complement motif Consensus sequence: GGTGGAGCTGCCTGCCAGTC |
Dataset #: | 1 |
Motif ID: | 3 |
Motif name: | Motif 3 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.11947 |
Original motif Consensus sequence: GCTGGAGTGCAGTGGCRYGA | Reverse complement motif Consensus sequence: TCKMGCCACTGCACTCCAGC |
Dataset #: | 1 |
Motif ID: | 64 |
Motif name: | Motif 64 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.124156 |
Original motif Consensus sequence: GAAGGCAGCTAAGGCCCGGY | Reverse complement motif Consensus sequence: KCCGGGCCTTAGCTGCCTTC |
Dataset #: | 1 |
Motif ID: | 294 |
Motif name: | Motif 294 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.124772 |
Original motif Consensus sequence: AGCTGTGAGAAGAGGGCCAC | Reverse complement motif Consensus sequence: GTGGCCCTCTTCTCACAGCT |
Dataset #: | 1 |
Motif ID: | 165 |
Motif name: | Motif 165 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.127369 |
Original motif Consensus sequence: ATCTGACAGGAGGYRGAGCT | Reverse complement motif Consensus sequence: AGCTCMKCCTCCTGTCAGAT |
Dataset #: 1 | Motif ID: 106 | Motif name: Motif 106 |
Original motif Consensus sequence: ATTGGTGTATTTACAATCCC | Reverse complement motif Consensus sequence: GGGATTGTAAATACACCAAT |
Best Matches for Motif ID 106 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 333 |
Motif name: | Motif 333 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.112321 |
Original motif Consensus sequence: TAGATAATAGCTCCAGCTTT | Reverse complement motif Consensus sequence: AAAGCTGGAGCTATTATCTA |
Dataset #: | 1 |
Motif ID: | 137 |
Motif name: | Motif 137 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.123702 |
Original motif Consensus sequence: AGGTTTGTTACATAGGTAWA | Reverse complement motif Consensus sequence: TWTACCTATGTAACAAACCT |
Dataset #: | 1 |
Motif ID: | 84 |
Motif name: | Motif 84 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.124374 |
Original motif Consensus sequence: CTGGGTCCCCCAGCAGTGCC | Reverse complement motif Consensus sequence: GGCACTGCTGGGGGACCCAG |
Dataset #: | 1 |
Motif ID: | 311 |
Motif name: | Motif 311 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.128647 |
Original motif Consensus sequence: GGCATCACGGATCCTACCAA | Reverse complement motif Consensus sequence: TTGGTAGGATCCGTGATGCC |
Dataset #: | 1 |
Motif ID: | 55 |
Motif name: | Motif 55 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.134342 |
Original motif Consensus sequence: ATGGAATAYTATTCAGCCAT | Reverse complement motif Consensus sequence: ATGGCTGAATAKTATTCCAT |
Dataset #: 1 | Motif ID: 107 | Motif name: Motif 107 |
Original motif Consensus sequence: GAGCCACYGCRCC | Reverse complement motif Consensus sequence: GGMGCKGTGGCTC |
Best Matches for Motif ID 107 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 56 |
Motif name: | Motif 56 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 5 |
Number of overlap: | 13 |
Similarity score: | 0.00724402 |
Original motif Consensus sequence: CRTGAGCCACYGYRCCYGGC | Reverse complement motif Consensus sequence: GCCKGGMKCMGTGGCTCAKG |
Dataset #: | 1 |
Motif ID: | 10 |
Motif name: | Motif 10 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 13 |
Similarity score: | 0.0668268 |
Original motif Consensus sequence: AGGASCSTCYSWGCCMGGY | Reverse complement motif Consensus sequence: MCCYGGCWSMGASGSTCCT |
Dataset #: | 1 |
Motif ID: | 111 |
Motif name: | Motif 111 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 13 |
Similarity score: | 0.070263 |
Original motif Consensus sequence: AGGAGCCCCTCHGCCCR | Reverse complement motif Consensus sequence: KGGGCDGAGGGGCTCCT |
Dataset #: | 1 |
Motif ID: | 3 |
Motif name: | Motif 3 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 13 |
Similarity score: | 0.0734949 |
Original motif Consensus sequence: GCTGGAGTGCAGTGGCRYGA | Reverse complement motif Consensus sequence: TCKMGCCACTGCACTCCAGC |
Dataset #: | 1 |
Motif ID: | 108 |
Motif name: | Motif 108 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 13 |
Similarity score: | 0.0783677 |
Original motif Consensus sequence: CGAGCCTCCCCGAYGAGCGC | Reverse complement motif Consensus sequence: GCGCTCKTCGGGGAGGCTCG |
Dataset #: 1 | Motif ID: 108 | Motif name: Motif 108 |
Original motif Consensus sequence: CGAGCCTCCCCGAYGAGCGC | Reverse complement motif Consensus sequence: GCGCTCKTCGGGGAGGCTCG |
Best Matches for Motif ID 108 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 196 |
Motif name: | Motif 196 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.0943206 |
Original motif Consensus sequence: CCTGCCATTGCYSAGGCTTG | Reverse complement motif Consensus sequence: CAAGCCTSKGCAATGGCAGG |
Dataset #: | 1 |
Motif ID: | 194 |
Motif name: | Motif 194 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.095821 |
Original motif Consensus sequence: CAAGGGTATAYGAGTAGCTG | Reverse complement motif Consensus sequence: CAGCTACTCKTATACCCTTG |
Dataset #: | 1 |
Motif ID: | 96 |
Motif name: | Motif 96 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.100601 |
Original motif Consensus sequence: AAGCTGAGGGAGCCGGCTCC | Reverse complement motif Consensus sequence: GGAGCCGGCTCCCTCAGCTT |
Dataset #: | 1 |
Motif ID: | 179 |
Motif name: | Motif 179 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.107842 |
Original motif Consensus sequence: AGGTCCTTCAGGAGGTATTC | Reverse complement motif Consensus sequence: GAATACCTCCTGAAGGACCT |
Dataset #: | 1 |
Motif ID: | 61 |
Motif name: | Motif 61 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.112636 |
Original motif Consensus sequence: GGATCCACTGGGTGAAGCCA | Reverse complement motif Consensus sequence: TGGCTTCACCCAGTGGATCC |
Dataset #: 1 | Motif ID: 109 | Motif name: Motif 109 |
Original motif Consensus sequence: GAGAGAGAGAGAGAGAGAGA | Reverse complement motif Consensus sequence: TCTCTCTCTCTCTCTCTCTC |
Best Matches for Motif ID 109 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 29 |
Motif name: | Motif 29 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.0851551 |
Original motif Consensus sequence: CTGGGCRACAGAGYRAGACY | Reverse complement motif Consensus sequence: MGTCTMKCTCTGTKGCCCAG |
Dataset #: | 1 |
Motif ID: | 145 |
Motif name: | Motif 145 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.0867304 |
Original motif Consensus sequence: GCCAGTCACAAAARGACAMA | Reverse complement motif Consensus sequence: TYTGTCMTTTTGTGACTGGC |
Dataset #: | 1 |
Motif ID: | 76 |
Motif name: | Motif 76 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.105417 |
Original motif Consensus sequence: GTGCCAGGCACTGTKCTARG | Reverse complement motif Consensus sequence: CMTAGYACAGTGCCTGGCAC |
Dataset #: | 1 |
Motif ID: | 3 |
Motif name: | Motif 3 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.10584 |
Original motif Consensus sequence: GCTGGAGTGCAGTGGCRYGA | Reverse complement motif Consensus sequence: TCKMGCCACTGCACTCCAGC |
Dataset #: | 1 |
Motif ID: | 26 |
Motif name: | Motif 26 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.107291 |
Original motif Consensus sequence: CTCCTGCCTCAGCCTCCCRA | Reverse complement motif Consensus sequence: TMGGGAGGCTGAGGCAGGAG |
Dataset #: 1 | Motif ID: 110 | Motif name: Motif 110 |
Original motif Consensus sequence: ATGGGGTGCCA | Reverse complement motif Consensus sequence: TGGCACCCCAT |
Best Matches for Motif ID 110 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 284 |
Motif name: | Motif 284 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 11 |
Similarity score: | 0.0371465 |
Original motif Consensus sequence: CATTTGGGAGCCCATTGA | Reverse complement motif Consensus sequence: TCAATGGGCTCCCAAATG |
Dataset #: | 1 |
Motif ID: | 209 |
Motif name: | Motif 209 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 11 |
Similarity score: | 0.0451831 |
Original motif Consensus sequence: CTGTCAGCCCAT | Reverse complement motif Consensus sequence: ATGGGCTGACAG |
Dataset #: | 1 |
Motif ID: | 193 |
Motif name: | Motif 193 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 6 |
Number of overlap: | 11 |
Similarity score: | 0.0571751 |
Original motif Consensus sequence: ATACAATGGGGGTACAGRC | Reverse complement motif Consensus sequence: GKCTGTACCCCCATTGTAT |
Dataset #: | 1 |
Motif ID: | 332 |
Motif name: | Motif 332 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 9 |
Number of overlap: | 11 |
Similarity score: | 0.0710968 |
Original motif Consensus sequence: CTGGCCCTCAATGGTTAAAC | Reverse complement motif Consensus sequence: GTTTAACCATTGAGGGCCAG |
Dataset #: | 1 |
Motif ID: | 306 |
Motif name: | Motif 306 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 11 |
Similarity score: | 0.07764 |
Original motif Consensus sequence: GACATGAGCTGGCGCTTG | Reverse complement motif Consensus sequence: CAAGCGCCAGCTCATGTC |
Dataset #: 1 | Motif ID: 111 | Motif name: Motif 111 |
Original motif Consensus sequence: AGGAGCCCCTCHGCCCR | Reverse complement motif Consensus sequence: KGGGCDGAGGGGCTCCT |
Best Matches for Motif ID 111 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 30 |
Motif name: | Motif 30 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 17 |
Similarity score: | 0.0374525 |
Original motif Consensus sequence: AGGAGCGCCTCTKCCCGGC | Reverse complement motif Consensus sequence: GCCGGGRAGAGGCGCTCCT |
Dataset #: | 1 |
Motif ID: | 43 |
Motif name: | Motif 43 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 17 |
Similarity score: | 0.0498697 |
Original motif Consensus sequence: GCCAGGCAGAGRGKCTCCT | Reverse complement motif Consensus sequence: AGGAGRCMCTCTGCCTGGC |
Dataset #: | 1 |
Motif ID: | 10 |
Motif name: | Motif 10 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 17 |
Similarity score: | 0.0589885 |
Original motif Consensus sequence: AGGASCSTCYSWGCCMGGY | Reverse complement motif Consensus sequence: MCCYGGCWSMGASGSTCCT |
Dataset #: | 1 |
Motif ID: | 56 |
Motif name: | Motif 56 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 17 |
Similarity score: | 0.0794456 |
Original motif Consensus sequence: CRTGAGCCACYGYRCCYGGC | Reverse complement motif Consensus sequence: GCCKGGMKCMGTGGCTCAKG |
Dataset #: | 1 |
Motif ID: | 62 |
Motif name: | Motif 62 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 17 |
Similarity score: | 0.0976585 |
Original motif Consensus sequence: AGGAACAGCTCCRGTCTAC | Reverse complement motif Consensus sequence: GTAGACKGGAGCTGTTCCT |
Dataset #: 1 | Motif ID: 112 | Motif name: Motif 112 |
Original motif Consensus sequence: GCTGTGTGACCTTGGGCAAG | Reverse complement motif Consensus sequence: CTTGCCCAAGGTCACACAGC |
Best Matches for Motif ID 112 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 56 |
Motif name: | Motif 56 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.100531 |
Original motif Consensus sequence: CRTGAGCCACYGYRCCYGGC | Reverse complement motif Consensus sequence: GCCKGGMKCMGTGGCTCAKG |
Dataset #: | 1 |
Motif ID: | 293 |
Motif name: | Motif 293 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.117214 |
Original motif Consensus sequence: CTGACTGGGAGACACCTCCC | Reverse complement motif Consensus sequence: GGGAGGTGTCTCCCAGTCAG |
Dataset #: | 1 |
Motif ID: | 29 |
Motif name: | Motif 29 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.117422 |
Original motif Consensus sequence: CTGGGCRACAGAGYRAGACY | Reverse complement motif Consensus sequence: MGTCTMKCTCTGTKGCCCAG |
Dataset #: | 1 |
Motif ID: | 178 |
Motif name: | Motif 178 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.121986 |
Original motif Consensus sequence: ACTGTCTTCCACCTCCACAT | Reverse complement motif Consensus sequence: ATGTGGAGGTGGAAGACAGT |
Dataset #: | 1 |
Motif ID: | 3 |
Motif name: | Motif 3 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.122256 |
Original motif Consensus sequence: GCTGGAGTGCAGTGGCRYGA | Reverse complement motif Consensus sequence: TCKMGCCACTGCACTCCAGC |
Dataset #: 1 | Motif ID: 113 | Motif name: Motif 113 |
Original motif Consensus sequence: CACTTCCTA | Reverse complement motif Consensus sequence: TAGGAAGTG |
Best Matches for Motif ID 113 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 74 |
Motif name: | Motif 74 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 9 |
Similarity score: | 0.0147795 |
Original motif Consensus sequence: CACTTCCTAGATGG | Reverse complement motif Consensus sequence: CCATCTAGGAAGTG |
Dataset #: | 1 |
Motif ID: | 153 |
Motif name: | Motif 153 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 9 |
Similarity score: | 0.0332374 |
Original motif Consensus sequence: CACTAGGGAGTGCC | Reverse complement motif Consensus sequence: GGCACTCCCTAGTG |
Dataset #: | 1 |
Motif ID: | 156 |
Motif name: | Motif 156 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 9 |
Similarity score: | 0.0333368 |
Original motif Consensus sequence: CACTTCCCAGAC | Reverse complement motif Consensus sequence: GTCTGGGAAGTG |
Dataset #: | 1 |
Motif ID: | 27 |
Motif name: | Motif 27 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 9 |
Similarity score: | 0.0419916 |
Original motif Consensus sequence: CACTTCCCAGACGGGGCG | Reverse complement motif Consensus sequence: CGCCCCGTCTGGGAAGTG |
Dataset #: | 1 |
Motif ID: | 339 |
Motif name: | Motif 339 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 9 |
Similarity score: | 0.0431985 |
Original motif Consensus sequence: CTCACCTCCTGC | Reverse complement motif Consensus sequence: GCAGGAGGTGAG |
Dataset #: 1 | Motif ID: 114 | Motif name: Motif 114 |
Original motif Consensus sequence: CTACGTTCTC | Reverse complement motif Consensus sequence: GAGAACGTAG |
Best Matches for Motif ID 114 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 63 |
Motif name: | Motif 63 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 10 |
Similarity score: | 0.0559267 |
Original motif Consensus sequence: AGTGAGAACATRYRRTRTTT | Reverse complement motif Consensus sequence: AAAMAMMKMATGTTCTCACT |
Dataset #: | 1 |
Motif ID: | 235 |
Motif name: | Motif 235 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 10 |
Similarity score: | 0.0641267 |
Original motif Consensus sequence: TCCAAATGGGAGAAATTGGC | Reverse complement motif Consensus sequence: GCCAATTTCTCCCATTTGGA |
Dataset #: | 1 |
Motif ID: | 257 |
Motif name: | Motif 257 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 6 |
Number of overlap: | 10 |
Similarity score: | 0.064949 |
Original motif Consensus sequence: GAGAACACATGGACA | Reverse complement motif Consensus sequence: TGTCCATGTGTTCTC |
Dataset #: | 1 |
Motif ID: | 154 |
Motif name: | Motif 154 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 7 |
Number of overlap: | 10 |
Similarity score: | 0.0660371 |
Original motif Consensus sequence: CATTAGATTCTCATAGGA | Reverse complement motif Consensus sequence: TCCTATGAGAATCTAATG |
Dataset #: | 1 |
Motif ID: | 245 |
Motif name: | Motif 245 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 10 |
Similarity score: | 0.0692709 |
Original motif Consensus sequence: CAGACTGCCTCCTCAA | Reverse complement motif Consensus sequence: TTGAGGAGGCAGTCTG |
Dataset #: 1 | Motif ID: 115 | Motif name: Motif 115 |
Original motif Consensus sequence: ATGATCCAGCAATYCCACTH | Reverse complement motif Consensus sequence: HAGTGGKATTGCTGGATCAT |
Best Matches for Motif ID 115 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 292 |
Motif name: | Motif 292 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.106467 |
Original motif Consensus sequence: AAGACCTTCCAGTGGGACAA | Reverse complement motif Consensus sequence: TTGTCCCACTGGAAGGTCTT |
Dataset #: | 1 |
Motif ID: | 309 |
Motif name: | Motif 309 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.108003 |
Original motif Consensus sequence: CATTCTGGGGTCTGGAGGAY | Reverse complement motif Consensus sequence: MTCCTCCAGACCCCAGAATG |
Dataset #: | 1 |
Motif ID: | 178 |
Motif name: | Motif 178 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.110049 |
Original motif Consensus sequence: ACTGTCTTCCACCTCCACAT | Reverse complement motif Consensus sequence: ATGTGGAGGTGGAAGACAGT |
Dataset #: | 1 |
Motif ID: | 139 |
Motif name: | Motif 139 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.110453 |
Original motif Consensus sequence: AGCCYCTGGYAACCAYYAWT | Reverse complement motif Consensus sequence: AWTKKTGGTTKCCAGKGGCT |
Dataset #: | 1 |
Motif ID: | 336 |
Motif name: | Motif 336 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.110612 |
Original motif Consensus sequence: ATGTAACCAAAYACCACCTG | Reverse complement motif Consensus sequence: CAGGTGGTKTTTGGTTACAT |
Dataset #: 1 | Motif ID: 116 | Motif name: Motif 116 |
Original motif Consensus sequence: GCAGAGGCGCTCCT | Reverse complement motif Consensus sequence: AGGAGCGCCTCTGC |
Best Matches for Motif ID 116 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 30 |
Motif name: | Motif 30 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 6 |
Number of overlap: | 14 |
Similarity score: | 0.023579 |
Original motif Consensus sequence: AGGAGCGCCTCTKCCCGGC | Reverse complement motif Consensus sequence: GCCGGGRAGAGGCGCTCCT |
Dataset #: | 1 |
Motif ID: | 43 |
Motif name: | Motif 43 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 6 |
Number of overlap: | 14 |
Similarity score: | 0.0315071 |
Original motif Consensus sequence: GCCAGGCAGAGRGKCTCCT | Reverse complement motif Consensus sequence: AGGAGRCMCTCTGCCTGGC |
Dataset #: | 1 |
Motif ID: | 111 |
Motif name: | Motif 111 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 14 |
Similarity score: | 0.0401354 |
Original motif Consensus sequence: AGGAGCCCCTCHGCCCR | Reverse complement motif Consensus sequence: KGGGCDGAGGGGCTCCT |
Dataset #: | 1 |
Motif ID: | 10 |
Motif name: | Motif 10 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 14 |
Similarity score: | 0.068644 |
Original motif Consensus sequence: AGGASCSTCYSWGCCMGGY | Reverse complement motif Consensus sequence: MCCYGGCWSMGASGSTCCT |
Dataset #: | 1 |
Motif ID: | 246 |
Motif name: | Motif 246 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 14 |
Similarity score: | 0.0780562 |
Original motif Consensus sequence: GCAGCTTCACTCCTGA | Reverse complement motif Consensus sequence: TCAGGAGTGAAGCTGC |
Dataset #: 1 | Motif ID: 117 | Motif name: Motif 117 |
Original motif Consensus sequence: AACAACAACAACAAMAA | Reverse complement motif Consensus sequence: TTYTTGTTGTTGTTGTT |
Best Matches for Motif ID 117 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 7 |
Motif name: | Motif 7 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 17 |
Similarity score: | 0.0705339 |
Original motif Consensus sequence: GTCTCWAMAAAAAAWAMAAA | Reverse complement motif Consensus sequence: TTTYTWTTTTTTYTWGAGAC |
Dataset #: | 1 |
Motif ID: | 66 |
Motif name: | Motif 66 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 17 |
Similarity score: | 0.0820961 |
Original motif Consensus sequence: ACACACAYACACACACACA | Reverse complement motif Consensus sequence: TGTGTGTGTGTKTGTGTGT |
Dataset #: | 1 |
Motif ID: | 70 |
Motif name: | Motif 70 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 17 |
Similarity score: | 0.0864402 |
Original motif Consensus sequence: CTATTGTGAATARTGCTGC | Reverse complement motif Consensus sequence: GCAGCAMTATTCACAATAG |
Dataset #: | 1 |
Motif ID: | 119 |
Motif name: | Motif 119 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 17 |
Similarity score: | 0.0907831 |
Original motif Consensus sequence: AAGTCCAAGATCAAGGTGYY | Reverse complement motif Consensus sequence: KKCACCTTGATCTTGGACTT |
Dataset #: | 1 |
Motif ID: | 145 |
Motif name: | Motif 145 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 17 |
Similarity score: | 0.0925617 |
Original motif Consensus sequence: GCCAGTCACAAAARGACAMA | Reverse complement motif Consensus sequence: TYTGTCMTTTTGTGACTGGC |
Dataset #: 1 | Motif ID: 118 | Motif name: Motif 118 |
Original motif Consensus sequence: CTCARGTGATCCTCC | Reverse complement motif Consensus sequence: GGAGGATCACKTGAG |
Best Matches for Motif ID 118 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 102 |
Motif name: | Motif 102 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 5 |
Number of overlap: | 15 |
Similarity score: | 0.0724382 |
Original motif Consensus sequence: CTCATTTAATCCTCACAAC | Reverse complement motif Consensus sequence: GTTGTGAGGATTAAATGAG |
Dataset #: | 1 |
Motif ID: | 350 |
Motif name: | Motif 350 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 5 |
Number of overlap: | 15 |
Similarity score: | 0.0817171 |
Original motif Consensus sequence: TCTGGAGTGGACCTCCAGCA | Reverse complement motif Consensus sequence: TGCTGGAGGTCCACTCCAGA |
Dataset #: | 1 |
Motif ID: | 115 |
Motif name: | Motif 115 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 15 |
Similarity score: | 0.0933094 |
Original motif Consensus sequence: ATGATCCAGCAATYCCACTH | Reverse complement motif Consensus sequence: HAGTGGKATTGCTGGATCAT |
Dataset #: | 1 |
Motif ID: | 8 |
Motif name: | Motif 8 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 15 |
Similarity score: | 0.0976823 |
Original motif Consensus sequence: ATCRCTTGAGSYCAGGAGKT | Reverse complement motif Consensus sequence: ARCTCCTGKSCTCAAGKGAT |
Dataset #: | 1 |
Motif ID: | 129 |
Motif name: | Motif 129 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 15 |
Similarity score: | 0.0995502 |
Original motif Consensus sequence: AAGAGGTTTAATTGRCTCA | Reverse complement motif Consensus sequence: TGAGKCAATTAAACCTCTT |
Dataset #: 1 | Motif ID: 119 | Motif name: Motif 119 |
Original motif Consensus sequence: AAGTCCAAGATCAAGGTGYY | Reverse complement motif Consensus sequence: KKCACCTTGATCTTGGACTT |
Best Matches for Motif ID 119 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 292 |
Motif name: | Motif 292 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.103662 |
Original motif Consensus sequence: AAGACCTTCCAGTGGGACAA | Reverse complement motif Consensus sequence: TTGTCCCACTGGAAGGTCTT |
Dataset #: | 1 |
Motif ID: | 331 |
Motif name: | Motif 331 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.107278 |
Original motif Consensus sequence: CCACCACAGCTCAAGGAGGC | Reverse complement motif Consensus sequence: GCCTCCTTGAGCTGTGGTGG |
Dataset #: | 1 |
Motif ID: | 8 |
Motif name: | Motif 8 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.111713 |
Original motif Consensus sequence: ATCRCTTGAGSYCAGGAGKT | Reverse complement motif Consensus sequence: ARCTCCTGKSCTCAAGKGAT |
Dataset #: | 1 |
Motif ID: | 179 |
Motif name: | Motif 179 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.11466 |
Original motif Consensus sequence: AGGTCCTTCAGGAGGTATTC | Reverse complement motif Consensus sequence: GAATACCTCCTGAAGGACCT |
Dataset #: | 1 |
Motif ID: | 176 |
Motif name: | Motif 176 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.118674 |
Original motif Consensus sequence: AGGCCCCAGTGTSTGTTGTT | Reverse complement motif Consensus sequence: AACAACASACACTGGGGCCT |
Dataset #: 1 | Motif ID: 120 | Motif name: Motif 120 |
Original motif Consensus sequence: CCATGTGSTCCC | Reverse complement motif Consensus sequence: GGGASCACATGG |
Best Matches for Motif ID 120 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 257 |
Motif name: | Motif 257 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 12 |
Similarity score: | 0.0458809 |
Original motif Consensus sequence: GAGAACACATGGACA | Reverse complement motif Consensus sequence: TGTCCATGTGTTCTC |
Dataset #: | 1 |
Motif ID: | 284 |
Motif name: | Motif 284 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 6 |
Number of overlap: | 12 |
Similarity score: | 0.0509107 |
Original motif Consensus sequence: CATTTGGGAGCCCATTGA | Reverse complement motif Consensus sequence: TCAATGGGCTCCCAAATG |
Dataset #: | 1 |
Motif ID: | 215 |
Motif name: | Motif 215 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 12 |
Similarity score: | 0.0529225 |
Original motif Consensus sequence: HGCTCCTGTGSKCCC | Reverse complement motif Consensus sequence: GGGRSCACAGGAGCD |
Dataset #: | 1 |
Motif ID: | 235 |
Motif name: | Motif 235 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 12 |
Similarity score: | 0.0661093 |
Original motif Consensus sequence: TCCAAATGGGAGAAATTGGC | Reverse complement motif Consensus sequence: GCCAATTTCTCCCATTTGGA |
Dataset #: | 1 |
Motif ID: | 49 |
Motif name: | Motif 49 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 12 |
Similarity score: | 0.0699992 |
Original motif Consensus sequence: ACATCTGYMMCC | Reverse complement motif Consensus sequence: GGRRMCAGATGT |
Dataset #: 1 | Motif ID: 121 | Motif name: Motif 121 |
Original motif Consensus sequence: CTASAACCTCCA | Reverse complement motif Consensus sequence: TGGAGGTTSTAG |
Best Matches for Motif ID 121 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 299 |
Motif name: | Motif 299 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 6 |
Number of overlap: | 12 |
Similarity score: | 0.0292892 |
Original motif Consensus sequence: CCCTGCTAGAACCTCCAA | Reverse complement motif Consensus sequence: TTGGAGGTTCTAGCAGGG |
Dataset #: | 1 |
Motif ID: | 178 |
Motif name: | Motif 178 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 12 |
Similarity score: | 0.0571056 |
Original motif Consensus sequence: ACTGTCTTCCACCTCCACAT | Reverse complement motif Consensus sequence: ATGTGGAGGTGGAAGACAGT |
Dataset #: | 1 |
Motif ID: | 333 |
Motif name: | Motif 333 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 6 |
Number of overlap: | 12 |
Similarity score: | 0.0815825 |
Original motif Consensus sequence: TAGATAATAGCTCCAGCTTT | Reverse complement motif Consensus sequence: AAAGCTGGAGCTATTATCTA |
Dataset #: | 1 |
Motif ID: | 234 |
Motif name: | Motif 234 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 12 |
Similarity score: | 0.0881505 |
Original motif Consensus sequence: AAGGAACAAACTCCRGACAC | Reverse complement motif Consensus sequence: GTGTCKGGAGTTTGTTCCTT |
Dataset #: | 1 |
Motif ID: | 328 |
Motif name: | Motif 328 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 12 |
Similarity score: | 0.0886401 |
Original motif Consensus sequence: GATACAAAATCAATGTR | Reverse complement motif Consensus sequence: KACATTGATTTTGTATC |
Dataset #: 1 | Motif ID: 122 | Motif name: Motif 122 |
Original motif Consensus sequence: CCTTGGCCAGCCCAGAAAG | Reverse complement motif Consensus sequence: CTTTCTGGGCTGGCCAAGG |
Best Matches for Motif ID 122 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 98 |
Motif name: | Motif 98 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.0950931 |
Original motif Consensus sequence: AGTTCCGGGTGGGCGTGGG | Reverse complement motif Consensus sequence: CCCACGCCCACCCGGAACT |
Dataset #: | 1 |
Motif ID: | 309 |
Motif name: | Motif 309 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.0996139 |
Original motif Consensus sequence: CATTCTGGGGTCTGGAGGAY | Reverse complement motif Consensus sequence: MTCCTCCAGACCCCAGAATG |
Dataset #: | 1 |
Motif ID: | 112 |
Motif name: | Motif 112 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.110655 |
Original motif Consensus sequence: GCTGTGTGACCTTGGGCAAG | Reverse complement motif Consensus sequence: CTTGCCCAAGGTCACACAGC |
Dataset #: | 1 |
Motif ID: | 312 |
Motif name: | Motif 312 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.111917 |
Original motif Consensus sequence: AGGACTGAGGGTGCCYRGGG | Reverse complement motif Consensus sequence: CCCMKGGCACCCTCAGTCCT |
Dataset #: | 1 |
Motif ID: | 310 |
Motif name: | Motif 310 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.1122 |
Original motif Consensus sequence: CCCATGCAAGTCYRAAATCC | Reverse complement motif Consensus sequence: GGATTTMKGACTTGCATGGG |
Dataset #: 1 | Motif ID: 123 | Motif name: Motif 123 |
Original motif Consensus sequence: AGCAGTCTGAG | Reverse complement motif Consensus sequence: CTCAGACTGCT |
Best Matches for Motif ID 123 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 26 |
Motif name: | Motif 26 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 8 |
Number of overlap: | 11 |
Similarity score: | 0.0598949 |
Original motif Consensus sequence: CTCCTGCCTCAGCCTCCCRA | Reverse complement motif Consensus sequence: TMGGGAGGCTGAGGCAGGAG |
Dataset #: | 1 |
Motif ID: | 165 |
Motif name: | Motif 165 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 8 |
Number of overlap: | 11 |
Similarity score: | 0.0609349 |
Original motif Consensus sequence: ATCTGACAGGAGGYRGAGCT | Reverse complement motif Consensus sequence: AGCTCMKCCTCCTGTCAGAT |
Dataset #: | 1 |
Motif ID: | 13 |
Motif name: | Motif 13 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 9 |
Number of overlap: | 11 |
Similarity score: | 0.0631275 |
Original motif Consensus sequence: AAGCAGGGCGAGGCATTGCC | Reverse complement motif Consensus sequence: GGCAATGCCTCGCCCTGCTT |
Dataset #: | 1 |
Motif ID: | 67 |
Motif name: | Motif 67 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 11 |
Similarity score: | 0.0649018 |
Original motif Consensus sequence: CTGGGCTCCTGAGTCTGGTG | Reverse complement motif Consensus sequence: CACCAGACTCAGGAGCCCAG |
Dataset #: | 1 |
Motif ID: | 191 |
Motif name: | Motif 191 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 11 |
Similarity score: | 0.0650683 |
Original motif Consensus sequence: AAAGTGCCGAGAKTGCAGC | Reverse complement motif Consensus sequence: GCTGCARTCTCGGCACTTT |
Dataset #: 1 | Motif ID: 124 | Motif name: Motif 124 |
Original motif Consensus sequence: AAAATAAAA | Reverse complement motif Consensus sequence: TTTTATTTT |
Best Matches for Motif ID 124 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 7 |
Motif name: | Motif 7 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 9 |
Similarity score: | 0.021153 |
Original motif Consensus sequence: GTCTCWAMAAAAAAWAMAAA | Reverse complement motif Consensus sequence: TTTYTWTTTTTTYTWGAGAC |
Dataset #: | 1 |
Motif ID: | 337 |
Motif name: | Motif 337 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 9 |
Similarity score: | 0.0464816 |
Original motif Consensus sequence: AAACTAGAAA | Reverse complement motif Consensus sequence: TTTCTAGTTT |
Dataset #: | 1 |
Motif ID: | 328 |
Motif name: | Motif 328 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 6 |
Number of overlap: | 9 |
Similarity score: | 0.0522862 |
Original motif Consensus sequence: GATACAAAATCAATGTR | Reverse complement motif Consensus sequence: KACATTGATTTTGTATC |
Dataset #: | 1 |
Motif ID: | 41 |
Motif name: | Motif 41 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 9 |
Similarity score: | 0.0560355 |
Original motif Consensus sequence: AAAYAAAAAAA | Reverse complement motif Consensus sequence: TTTTTTTMTTT |
Dataset #: | 1 |
Motif ID: | 254 |
Motif name: | Motif 254 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 9 |
Similarity score: | 0.0620817 |
Original motif Consensus sequence: AAAATCACAAGCATTCCTAT | Reverse complement motif Consensus sequence: ATAGGAATGCTTGTGATTTT |
Dataset #: 1 | Motif ID: 125 | Motif name: Motif 125 |
Original motif Consensus sequence: CGCCCGGCCAGCCGC | Reverse complement motif Consensus sequence: GCGGCTGGCCGGGCG |
Best Matches for Motif ID 125 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 98 |
Motif name: | Motif 98 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 5 |
Number of overlap: | 15 |
Similarity score: | 0.0866862 |
Original motif Consensus sequence: AGTTCCGGGTGGGCGTGGG | Reverse complement motif Consensus sequence: CCCACGCCCACCCGGAACT |
Dataset #: | 1 |
Motif ID: | 92 |
Motif name: | Motif 92 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 15 |
Similarity score: | 0.0950761 |
Original motif Consensus sequence: GGGGGCTGACCCCCCCACC | Reverse complement motif Consensus sequence: GGTGGGGGGGTCAGCCCCC |
Dataset #: | 1 |
Motif ID: | 164 |
Motif name: | Motif 164 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 15 |
Similarity score: | 0.0965381 |
Original motif Consensus sequence: AGCCCCGGTTCCCGCYCGC | Reverse complement motif Consensus sequence: GCGMGCGGGAACCGGGGCT |
Dataset #: | 1 |
Motif ID: | 78 |
Motif name: | Motif 78 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 15 |
Similarity score: | 0.0972915 |
Original motif Consensus sequence: CGAGCCCTGCCCCGCGG | Reverse complement motif Consensus sequence: CCGCGGGGCAGGGCTCG |
Dataset #: | 1 |
Motif ID: | 100 |
Motif name: | Motif 100 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 15 |
Similarity score: | 0.098833 |
Original motif Consensus sequence: GCTGGCCCGCAAGCGCCGCG | Reverse complement motif Consensus sequence: CGCGGCGCTTGCGGGCCAGC |
Dataset #: 1 | Motif ID: 126 | Motif name: Motif 126 |
Original motif Consensus sequence: AYGCCTGTAATC | Reverse complement motif Consensus sequence: GATTACAGGCMT |
Best Matches for Motif ID 126 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 278 |
Motif name: | Motif 278 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 12 |
Similarity score: | 0.0669992 |
Original motif Consensus sequence: ACTTTCAGGCATAACA | Reverse complement motif Consensus sequence: TGTTATGCCTGAAAGT |
Dataset #: | 1 |
Motif ID: | 211 |
Motif name: | Motif 211 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 12 |
Similarity score: | 0.0695709 |
Original motif Consensus sequence: GACTTCAAGAATGAAGCCG | Reverse complement motif Consensus sequence: CGGCTTCATTCTTGAAGTC |
Dataset #: | 1 |
Motif ID: | 254 |
Motif name: | Motif 254 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 12 |
Similarity score: | 0.0736473 |
Original motif Consensus sequence: AAAATCACAAGCATTCCTAT | Reverse complement motif Consensus sequence: ATAGGAATGCTTGTGATTTT |
Dataset #: | 1 |
Motif ID: | 310 |
Motif name: | Motif 310 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 8 |
Number of overlap: | 12 |
Similarity score: | 0.0740911 |
Original motif Consensus sequence: CCCATGCAAGTCYRAAATCC | Reverse complement motif Consensus sequence: GGATTTMKGACTTGCATGGG |
Dataset #: | 1 |
Motif ID: | 19 |
Motif name: | Motif 19 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 12 |
Similarity score: | 0.0813954 |
Original motif Consensus sequence: CACCAGGAGATTATATCCCR | Reverse complement motif Consensus sequence: MGGGATATAATCTCCTGGTG |
Dataset #: 1 | Motif ID: 127 | Motif name: Motif 127 |
Original motif Consensus sequence: CCCCAACCCC | Reverse complement motif Consensus sequence: GGGGTTGGGG |
Best Matches for Motif ID 127 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 46 |
Motif name: | Motif 46 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 10 |
Similarity score: | 0.0369517 |
Original motif Consensus sequence: CCCCWCCCCCA | Reverse complement motif Consensus sequence: TGGGGGWGGGG |
Dataset #: | 1 |
Motif ID: | 92 |
Motif name: | Motif 92 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 10 |
Similarity score: | 0.0650488 |
Original motif Consensus sequence: GGGGGCTGACCCCCCCACC | Reverse complement motif Consensus sequence: GGTGGGGGGGTCAGCCCCC |
Dataset #: | 1 |
Motif ID: | 309 |
Motif name: | Motif 309 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 5 |
Number of overlap: | 10 |
Similarity score: | 0.0661693 |
Original motif Consensus sequence: CATTCTGGGGTCTGGAGGAY | Reverse complement motif Consensus sequence: MTCCTCCAGACCCCAGAATG |
Dataset #: | 1 |
Motif ID: | 259 |
Motif name: | Motif 259 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 6 |
Number of overlap: | 10 |
Similarity score: | 0.0688836 |
Original motif Consensus sequence: CCCACACCCTTATTA | Reverse complement motif Consensus sequence: TAATAAGGGTGTGGG |
Dataset #: | 1 |
Motif ID: | 105 |
Motif name: | Motif 105 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 8 |
Number of overlap: | 10 |
Similarity score: | 0.0693706 |
Original motif Consensus sequence: GCCTCTCCCTCCACACCTCC | Reverse complement motif Consensus sequence: GGAGGTGTGGAGGGAGAGGC |
Dataset #: 1 | Motif ID: 128 | Motif name: Motif 128 |
Original motif Consensus sequence: CCGCACTCGGAGCRG | Reverse complement motif Consensus sequence: CMGCTCCGAGTGCGG |
Best Matches for Motif ID 128 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 95 |
Motif name: | Motif 95 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 15 |
Similarity score: | 0.0771871 |
Original motif Consensus sequence: ACCCYGTCTGGGAGGTG | Reverse complement motif Consensus sequence: CACCTCCCAGACMGGGT |
Dataset #: | 1 |
Motif ID: | 321 |
Motif name: | Motif 321 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 15 |
Similarity score: | 0.0895427 |
Original motif Consensus sequence: AAGCTCGAACTGGGTGGAGC | Reverse complement motif Consensus sequence: GCTCCACCCAGTTCGAGCTT |
Dataset #: | 1 |
Motif ID: | 82 |
Motif name: | Motif 82 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 15 |
Similarity score: | 0.090819 |
Original motif Consensus sequence: GCTTAGCACCYGGGCCAGC | Reverse complement motif Consensus sequence: GCTGGCCCKGGTGCTAAGC |
Dataset #: | 1 |
Motif ID: | 25 |
Motif name: | Motif 25 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 15 |
Similarity score: | 0.0937468 |
Original motif Consensus sequence: CATTTCCAWCTGAGGTAC | Reverse complement motif Consensus sequence: GTACCTCAGWTGGAAATG |
Dataset #: | 1 |
Motif ID: | 191 |
Motif name: | Motif 191 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 15 |
Similarity score: | 0.0954398 |
Original motif Consensus sequence: AAAGTGCCGAGAKTGCAGC | Reverse complement motif Consensus sequence: GCTGCARTCTCGGCACTTT |
Dataset #: 1 | Motif ID: 129 | Motif name: Motif 129 |
Original motif Consensus sequence: AAGAGGTTTAATTGRCTCA | Reverse complement motif Consensus sequence: TGAGKCAATTAAACCTCTT |
Best Matches for Motif ID 129 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 292 |
Motif name: | Motif 292 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.093225 |
Original motif Consensus sequence: AAGACCTTCCAGTGGGACAA | Reverse complement motif Consensus sequence: TTGTCCCACTGGAAGGTCTT |
Dataset #: | 1 |
Motif ID: | 115 |
Motif name: | Motif 115 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.0969481 |
Original motif Consensus sequence: ATGATCCAGCAATYCCACTH | Reverse complement motif Consensus sequence: HAGTGGKATTGCTGGATCAT |
Dataset #: | 1 |
Motif ID: | 262 |
Motif name: | Motif 262 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.110541 |
Original motif Consensus sequence: CTCAGTGTTAATCTCCTGTC | Reverse complement motif Consensus sequence: GACAGGAGATTAACACTGAG |
Dataset #: | 1 |
Motif ID: | 83 |
Motif name: | Motif 83 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.114822 |
Original motif Consensus sequence: AAAATGTGGTAYATAYAYAC | Reverse complement motif Consensus sequence: GTKTMTATMTACCACATTTT |
Dataset #: | 1 |
Motif ID: | 64 |
Motif name: | Motif 64 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.116601 |
Original motif Consensus sequence: GAAGGCAGCTAAGGCCCGGY | Reverse complement motif Consensus sequence: KCCGGGCCTTAGCTGCCTTC |
Dataset #: 1 | Motif ID: 130 | Motif name: Motif 130 |
Original motif Consensus sequence: ATTATTATYAT | Reverse complement motif Consensus sequence: ATMATAATAAT |
Best Matches for Motif ID 130 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 190 |
Motif name: | Motif 190 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 11 |
Similarity score: | 0.0362259 |
Original motif Consensus sequence: CAAAGGCATAAGAATGAT | Reverse complement motif Consensus sequence: ATCATTCTTATGCCTTTG |
Dataset #: | 1 |
Motif ID: | 270 |
Motif name: | Motif 270 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 11 |
Similarity score: | 0.0458076 |
Original motif Consensus sequence: CCATGATTGTRAGG | Reverse complement motif Consensus sequence: CCTMACAATCATGG |
Dataset #: | 1 |
Motif ID: | 70 |
Motif name: | Motif 70 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 7 |
Number of overlap: | 11 |
Similarity score: | 0.0543851 |
Original motif Consensus sequence: CTATTGTGAATARTGCTGC | Reverse complement motif Consensus sequence: GCAGCAMTATTCACAATAG |
Dataset #: | 1 |
Motif ID: | 287 |
Motif name: | Motif 287 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 11 |
Similarity score: | 0.0550832 |
Original motif Consensus sequence: CATTATGCTAARTG | Reverse complement motif Consensus sequence: CAMTTAGCATAATG |
Dataset #: | 1 |
Motif ID: | 55 |
Motif name: | Motif 55 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 8 |
Number of overlap: | 11 |
Similarity score: | 0.0576294 |
Original motif Consensus sequence: ATGGAATAYTATTCAGCCAT | Reverse complement motif Consensus sequence: ATGGCTGAATAKTATTCCAT |
Dataset #: 1 | Motif ID: 131 | Motif name: Motif 131 |
Original motif Consensus sequence: CCTGGGTTCAA | Reverse complement motif Consensus sequence: TTGAACCCAGG |
Best Matches for Motif ID 131 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 8 |
Motif name: | Motif 8 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 6 |
Number of overlap: | 11 |
Similarity score: | 0.044498 |
Original motif Consensus sequence: ATCRCTTGAGSYCAGGAGKT | Reverse complement motif Consensus sequence: ARCTCCTGKSCTCAAGKGAT |
Dataset #: | 1 |
Motif ID: | 82 |
Motif name: | Motif 82 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 6 |
Number of overlap: | 11 |
Similarity score: | 0.0639634 |
Original motif Consensus sequence: GCTTAGCACCYGGGCCAGC | Reverse complement motif Consensus sequence: GCTGGCCCKGGTGCTAAGC |
Dataset #: | 1 |
Motif ID: | 290 |
Motif name: | Motif 290 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 11 |
Similarity score: | 0.0646962 |
Original motif Consensus sequence: TGATACCCAGGCAAACAG | Reverse complement motif Consensus sequence: CTGTTTGCCTGGGTATCA |
Dataset #: | 1 |
Motif ID: | 170 |
Motif name: | Motif 170 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 9 |
Number of overlap: | 11 |
Similarity score: | 0.0706085 |
Original motif Consensus sequence: AATCAACCCTGGYRATCAAT | Reverse complement motif Consensus sequence: ATTGATMKCCAGGGTTGATT |
Dataset #: | 1 |
Motif ID: | 326 |
Motif name: | Motif 326 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 11 |
Similarity score: | 0.0708014 |
Original motif Consensus sequence: GACATGGAGTCAAAGG | Reverse complement motif Consensus sequence: CCTTTGACTCCATGTC |
Dataset #: 1 | Motif ID: 132 | Motif name: Motif 132 |
Original motif Consensus sequence: CAAGATGGCGGC | Reverse complement motif Consensus sequence: GCCGCCATCTTG |
Best Matches for Motif ID 132 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 191 |
Motif name: | Motif 191 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 8 |
Number of overlap: | 12 |
Similarity score: | 0.0630794 |
Original motif Consensus sequence: AAAGTGCCGAGAKTGCAGC | Reverse complement motif Consensus sequence: GCTGCARTCTCGGCACTTT |
Dataset #: | 1 |
Motif ID: | 294 |
Motif name: | Motif 294 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 9 |
Number of overlap: | 12 |
Similarity score: | 0.0641012 |
Original motif Consensus sequence: AGCTGTGAGAAGAGGGCCAC | Reverse complement motif Consensus sequence: GTGGCCCTCTTCTCACAGCT |
Dataset #: | 1 |
Motif ID: | 48 |
Motif name: | Motif 48 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 8 |
Number of overlap: | 12 |
Similarity score: | 0.0710877 |
Original motif Consensus sequence: AGCTCCCAGCGTGAGCGACG | Reverse complement motif Consensus sequence: CGTCGCTCACGCTGGGAGCT |
Dataset #: | 1 |
Motif ID: | 70 |
Motif name: | Motif 70 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 8 |
Number of overlap: | 12 |
Similarity score: | 0.0731765 |
Original motif Consensus sequence: CTATTGTGAATARTGCTGC | Reverse complement motif Consensus sequence: GCAGCAMTATTCACAATAG |
Dataset #: | 1 |
Motif ID: | 222 |
Motif name: | Motif 222 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 12 |
Similarity score: | 0.0777048 |
Original motif Consensus sequence: CGAGATCACGCCA | Reverse complement motif Consensus sequence: TGGCGTGATCTCG |
Dataset #: 1 | Motif ID: 133 | Motif name: Motif 133 |
Original motif Consensus sequence: CTGYGTCCCCA | Reverse complement motif Consensus sequence: TGGGGACMCAG |
Best Matches for Motif ID 133 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 84 |
Motif name: | Motif 84 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 11 |
Similarity score: | 0.0319466 |
Original motif Consensus sequence: CTGGGTCCCCCAGCAGTGCC | Reverse complement motif Consensus sequence: GGCACTGCTGGGGGACCCAG |
Dataset #: | 1 |
Motif ID: | 193 |
Motif name: | Motif 193 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 11 |
Similarity score: | 0.0508347 |
Original motif Consensus sequence: ATACAATGGGGGTACAGRC | Reverse complement motif Consensus sequence: GKCTGTACCCCCATTGTAT |
Dataset #: | 1 |
Motif ID: | 245 |
Motif name: | Motif 245 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 11 |
Similarity score: | 0.0518197 |
Original motif Consensus sequence: CAGACTGCCTCCTCAA | Reverse complement motif Consensus sequence: TTGAGGAGGCAGTCTG |
Dataset #: | 1 |
Motif ID: | 91 |
Motif name: | Motif 91 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 11 |
Similarity score: | 0.0670325 |
Original motif Consensus sequence: AGACYCYGTCTCAA | Reverse complement motif Consensus sequence: TTGAGACMGKGTCT |
Dataset #: | 1 |
Motif ID: | 112 |
Motif name: | Motif 112 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 11 |
Similarity score: | 0.0690455 |
Original motif Consensus sequence: GCTGTGTGACCTTGGGCAAG | Reverse complement motif Consensus sequence: CTTGCCCAAGGTCACACAGC |
Dataset #: 1 | Motif ID: 134 | Motif name: Motif 134 |
Original motif Consensus sequence: CAAACTGCA | Reverse complement motif Consensus sequence: TGCAGTTTG |
Best Matches for Motif ID 134 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 73 |
Motif name: | Motif 73 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 9 |
Similarity score: | 0 |
Original motif Consensus sequence: CAAACTGCAAG | Reverse complement motif Consensus sequence: CTTGCAGTTTG |
Dataset #: | 1 |
Motif ID: | 304 |
Motif name: | Motif 304 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 9 |
Similarity score: | 0.0499634 |
Original motif Consensus sequence: AGTGTTTCCAAMCTGCT | Reverse complement motif Consensus sequence: AGCAGYTTGGAAACACT |
Dataset #: | 1 |
Motif ID: | 245 |
Motif name: | Motif 245 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 9 |
Similarity score: | 0.050505 |
Original motif Consensus sequence: CAGACTGCCTCCTCAA | Reverse complement motif Consensus sequence: TTGAGGAGGCAGTCTG |
Dataset #: | 1 |
Motif ID: | 123 |
Motif name: | Motif 123 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 9 |
Similarity score: | 0.050505 |
Original motif Consensus sequence: AGCAGTCTGAG | Reverse complement motif Consensus sequence: CTCAGACTGCT |
Dataset #: | 1 |
Motif ID: | 71 |
Motif name: | Motif 71 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 9 |
Similarity score: | 0.050505 |
Original motif Consensus sequence: AGCACTTTG | Reverse complement motif Consensus sequence: CAAAGTGCT |
Dataset #: 1 | Motif ID: 135 | Motif name: Motif 135 |
Original motif Consensus sequence: CTCTTGTTGCCCAG | Reverse complement motif Consensus sequence: CTGGGCAACAAGAG |
Best Matches for Motif ID 135 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 100 |
Motif name: | Motif 100 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 14 |
Similarity score: | 0.0668647 |
Original motif Consensus sequence: GCTGGCCCGCAAGCGCCGCG | Reverse complement motif Consensus sequence: CGCGGCGCTTGCGGGCCAGC |
Dataset #: | 1 |
Motif ID: | 29 |
Motif name: | Motif 29 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 7 |
Number of overlap: | 14 |
Similarity score: | 0.0777944 |
Original motif Consensus sequence: CTGGGCRACAGAGYRAGACY | Reverse complement motif Consensus sequence: MGTCTMKCTCTGTKGCCCAG |
Dataset #: | 1 |
Motif ID: | 332 |
Motif name: | Motif 332 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 14 |
Similarity score: | 0.078748 |
Original motif Consensus sequence: CTGGCCCTCAATGGTTAAAC | Reverse complement motif Consensus sequence: GTTTAACCATTGAGGGCCAG |
Dataset #: | 1 |
Motif ID: | 225 |
Motif name: | Motif 225 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 6 |
Number of overlap: | 14 |
Similarity score: | 0.0800399 |
Original motif Consensus sequence: GCACATGTAYCCYAGAACTT | Reverse complement motif Consensus sequence: AAGTTCTKGGKTACATGTGC |
Dataset #: | 1 |
Motif ID: | 147 |
Motif name: | Motif 147 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 14 |
Similarity score: | 0.0850974 |
Original motif Consensus sequence: CTGGGCACCATTGA | Reverse complement motif Consensus sequence: TCAATGGTGCCCAG |
Dataset #: 1 | Motif ID: 136 | Motif name: Motif 136 |
Original motif Consensus sequence: CCCTCACTGCCCGGGG | Reverse complement motif Consensus sequence: CCCCGGGCAGTGAGGG |
Best Matches for Motif ID 136 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 155 |
Motif name: | Motif 155 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 16 |
Similarity score: | 0.0741545 |
Original motif Consensus sequence: TCCCTCCCGGACGGGGYGGC | Reverse complement motif Consensus sequence: GCCKCCCCGTCCGGGAGGGA |
Dataset #: | 1 |
Motif ID: | 201 |
Motif name: | Motif 201 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 16 |
Similarity score: | 0.0805996 |
Original motif Consensus sequence: GTAACACTCACCGCGARGGT | Reverse complement motif Consensus sequence: ACCKTCGCGGTGAGTGTTAC |
Dataset #: | 1 |
Motif ID: | 95 |
Motif name: | Motif 95 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 16 |
Similarity score: | 0.090189 |
Original motif Consensus sequence: ACCCYGTCTGGGAGGTG | Reverse complement motif Consensus sequence: CACCTCCCAGACMGGGT |
Dataset #: | 1 |
Motif ID: | 78 |
Motif name: | Motif 78 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 16 |
Similarity score: | 0.0920974 |
Original motif Consensus sequence: CGAGCCCTGCCCCGCGG | Reverse complement motif Consensus sequence: CCGCGGGGCAGGGCTCG |
Dataset #: | 1 |
Motif ID: | 331 |
Motif name: | Motif 331 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 5 |
Number of overlap: | 16 |
Similarity score: | 0.0934462 |
Original motif Consensus sequence: CCACCACAGCTCAAGGAGGC | Reverse complement motif Consensus sequence: GCCTCCTTGAGCTGTGGTGG |
Dataset #: 1 | Motif ID: 137 | Motif name: Motif 137 |
Original motif Consensus sequence: AGGTTTGTTACATAGGTAWA | Reverse complement motif Consensus sequence: TWTACCTATGTAACAAACCT |
Best Matches for Motif ID 137 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 357 |
Motif name: | Motif 357 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.114314 |
Original motif Consensus sequence: CAAGTTGACACATAAAATTA | Reverse complement motif Consensus sequence: TAATTTTATGTGTCAACTTG |
Dataset #: | 1 |
Motif ID: | 119 |
Motif name: | Motif 119 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.118814 |
Original motif Consensus sequence: AAGTCCAAGATCAAGGTGYY | Reverse complement motif Consensus sequence: KKCACCTTGATCTTGGACTT |
Dataset #: | 1 |
Motif ID: | 106 |
Motif name: | Motif 106 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.120138 |
Original motif Consensus sequence: ATTGGTGTATTTACAATCCC | Reverse complement motif Consensus sequence: GGGATTGTAAATACACCAAT |
Dataset #: | 1 |
Motif ID: | 86 |
Motif name: | Motif 86 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.120421 |
Original motif Consensus sequence: AGTAGGTGCTCARTAAATRB | Reverse complement motif Consensus sequence: VMATTTAKTGAGCACCTACT |
Dataset #: | 1 |
Motif ID: | 308 |
Motif name: | Motif 308 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.122062 |
Original motif Consensus sequence: AAATTAGGCCAATTAATAAC | Reverse complement motif Consensus sequence: GTTATTAATTGGCCTAATTT |
Dataset #: 1 | Motif ID: 138 | Motif name: Motif 138 |
Original motif Consensus sequence: CAGCCAGATCRSCC | Reverse complement motif Consensus sequence: GGSKGATCTGGCTG |
Best Matches for Motif ID 138 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 52 |
Motif name: | Motif 52 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 7 |
Number of overlap: | 14 |
Similarity score: | 0.0576267 |
Original motif Consensus sequence: GACTGGCAGGCAGCTCCACC | Reverse complement motif Consensus sequence: GGTGGAGCTGCCTGCCAGTC |
Dataset #: | 1 |
Motif ID: | 299 |
Motif name: | Motif 299 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 14 |
Similarity score: | 0.0761753 |
Original motif Consensus sequence: CCCTGCTAGAACCTCCAA | Reverse complement motif Consensus sequence: TTGGAGGTTCTAGCAGGG |
Dataset #: | 1 |
Motif ID: | 56 |
Motif name: | Motif 56 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 14 |
Similarity score: | 0.0779469 |
Original motif Consensus sequence: CRTGAGCCACYGYRCCYGGC | Reverse complement motif Consensus sequence: GCCKGGMKCMGTGGCTCAKG |
Dataset #: | 1 |
Motif ID: | 321 |
Motif name: | Motif 321 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 14 |
Similarity score: | 0.0788168 |
Original motif Consensus sequence: AAGCTCGAACTGGGTGGAGC | Reverse complement motif Consensus sequence: GCTCCACCCAGTTCGAGCTT |
Dataset #: | 1 |
Motif ID: | 96 |
Motif name: | Motif 96 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 14 |
Similarity score: | 0.081782 |
Original motif Consensus sequence: AAGCTGAGGGAGCCGGCTCC | Reverse complement motif Consensus sequence: GGAGCCGGCTCCCTCAGCTT |
Dataset #: 1 | Motif ID: 139 | Motif name: Motif 139 |
Original motif Consensus sequence: AGCCYCTGGYAACCAYYAWT | Reverse complement motif Consensus sequence: AWTKKTGGTTKCCAGKGGCT |
Best Matches for Motif ID 139 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 8 |
Motif name: | Motif 8 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.087556 |
Original motif Consensus sequence: ATCRCTTGAGSYCAGGAGKT | Reverse complement motif Consensus sequence: ARCTCCTGKSCTCAAGKGAT |
Dataset #: | 1 |
Motif ID: | 176 |
Motif name: | Motif 176 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.0947311 |
Original motif Consensus sequence: AGGCCCCAGTGTSTGTTGTT | Reverse complement motif Consensus sequence: AACAACASACACTGGGGCCT |
Dataset #: | 1 |
Motif ID: | 309 |
Motif name: | Motif 309 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.099271 |
Original motif Consensus sequence: CATTCTGGGGTCTGGAGGAY | Reverse complement motif Consensus sequence: MTCCTCCAGACCCCAGAATG |
Dataset #: | 1 |
Motif ID: | 115 |
Motif name: | Motif 115 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.103788 |
Original motif Consensus sequence: ATGATCCAGCAATYCCACTH | Reverse complement motif Consensus sequence: HAGTGGKATTGCTGGATCAT |
Dataset #: | 1 |
Motif ID: | 104 |
Motif name: | Motif 104 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.108741 |
Original motif Consensus sequence: CAACATGGATGRARCTGGAG | Reverse complement motif Consensus sequence: CTCCAGKTMCATCCATGTTG |
Dataset #: 1 | Motif ID: 140 | Motif name: Motif 140 |
Original motif Consensus sequence: CTCCATGAAGTC | Reverse complement motif Consensus sequence: GACTTCATGGAG |
Best Matches for Motif ID 140 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 211 |
Motif name: | Motif 211 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 8 |
Number of overlap: | 12 |
Similarity score: | 0.0741011 |
Original motif Consensus sequence: GACTTCAAGAATGAAGCCG | Reverse complement motif Consensus sequence: CGGCTTCATTCTTGAAGTC |
Dataset #: | 1 |
Motif ID: | 321 |
Motif name: | Motif 321 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 8 |
Number of overlap: | 12 |
Similarity score: | 0.0805058 |
Original motif Consensus sequence: AAGCTCGAACTGGGTGGAGC | Reverse complement motif Consensus sequence: GCTCCACCCAGTTCGAGCTT |
Dataset #: | 1 |
Motif ID: | 33 |
Motif name: | Motif 33 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 12 |
Similarity score: | 0.0841075 |
Original motif Consensus sequence: ACGCCCACGGAGTCTC | Reverse complement motif Consensus sequence: GAGACTCCGTGGGCGT |
Dataset #: | 1 |
Motif ID: | 163 |
Motif name: | Motif 163 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 12 |
Similarity score: | 0.0844469 |
Original motif Consensus sequence: CCTCCGTGGGCTCC | Reverse complement motif Consensus sequence: GGAGCCCACGGAGG |
Dataset #: | 1 |
Motif ID: | 179 |
Motif name: | Motif 179 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 6 |
Number of overlap: | 12 |
Similarity score: | 0.0846544 |
Original motif Consensus sequence: AGGTCCTTCAGGAGGTATTC | Reverse complement motif Consensus sequence: GAATACCTCCTGAAGGACCT |
Dataset #: 1 | Motif ID: 141 | Motif name: Motif 141 |
Original motif Consensus sequence: AAGGTCCATGTAG | Reverse complement motif Consensus sequence: CTACATGGACCTT |
Best Matches for Motif ID 141 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 299 |
Motif name: | Motif 299 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 13 |
Similarity score: | 0.0879979 |
Original motif Consensus sequence: CCCTGCTAGAACCTCCAA | Reverse complement motif Consensus sequence: TTGGAGGTTCTAGCAGGG |
Dataset #: | 1 |
Motif ID: | 225 |
Motif name: | Motif 225 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 8 |
Number of overlap: | 13 |
Similarity score: | 0.0909434 |
Original motif Consensus sequence: GCACATGTAYCCYAGAACTT | Reverse complement motif Consensus sequence: AAGTTCTKGGKTACATGTGC |
Dataset #: | 1 |
Motif ID: | 104 |
Motif name: | Motif 104 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 13 |
Similarity score: | 0.0949678 |
Original motif Consensus sequence: CAACATGGATGRARCTGGAG | Reverse complement motif Consensus sequence: CTCCAGKTMCATCCATGTTG |
Dataset #: | 1 |
Motif ID: | 322 |
Motif name: | Motif 322 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 13 |
Similarity score: | 0.101755 |
Original motif Consensus sequence: AGGGCCTTTGCASWTGC | Reverse complement motif Consensus sequence: GCAWSTGCAAAGGCCCT |
Dataset #: | 1 |
Motif ID: | 311 |
Motif name: | Motif 311 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 13 |
Similarity score: | 0.102169 |
Original motif Consensus sequence: GGCATCACGGATCCTACCAA | Reverse complement motif Consensus sequence: TTGGTAGGATCCGTGATGCC |
Dataset #: 1 | Motif ID: 142 | Motif name: Motif 142 |
Original motif Consensus sequence: CAGATGTC | Reverse complement motif Consensus sequence: GACATCTG |
Best Matches for Motif ID 142 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 272 |
Motif name: | Motif 272 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 8 |
Similarity score: | 0.0284091 |
Original motif Consensus sequence: CAGCTGTCAC | Reverse complement motif Consensus sequence: GTGACAGCTG |
Dataset #: | 1 |
Motif ID: | 269 |
Motif name: | Motif 269 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 8 |
Similarity score: | 0.0407488 |
Original motif Consensus sequence: AGCGACATGTGC | Reverse complement motif Consensus sequence: GCACATGTCGCT |
Dataset #: | 1 |
Motif ID: | 166 |
Motif name: | Motif 166 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 5 |
Number of overlap: | 8 |
Similarity score: | 0.0533279 |
Original motif Consensus sequence: AAGGGACATTKGAG | Reverse complement motif Consensus sequence: CTCRAATGTCCCTT |
Dataset #: | 1 |
Motif ID: | 216 |
Motif name: | Motif 216 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 8 |
Similarity score: | 0.0568181 |
Original motif Consensus sequence: CAGAAATCACC | Reverse complement motif Consensus sequence: GGTGATTTCTG |
Dataset #: | 1 |
Motif ID: | 334 |
Motif name: | Motif 334 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 8 |
Similarity score: | 0.0568181 |
Original motif Consensus sequence: CATCTGTCAC | Reverse complement motif Consensus sequence: GTGACAGATG |
Dataset #: 1 | Motif ID: 143 | Motif name: Motif 143 |
Original motif Consensus sequence: CTGCGTCGCTCAC | Reverse complement motif Consensus sequence: GTGAGCGACGCAG |
Best Matches for Motif ID 143 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 84 |
Motif name: | Motif 84 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 8 |
Number of overlap: | 13 |
Similarity score: | 0.0703083 |
Original motif Consensus sequence: CTGGGTCCCCCAGCAGTGCC | Reverse complement motif Consensus sequence: GGCACTGCTGGGGGACCCAG |
Dataset #: | 1 |
Motif ID: | 56 |
Motif name: | Motif 56 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 7 |
Number of overlap: | 13 |
Similarity score: | 0.0789125 |
Original motif Consensus sequence: CRTGAGCCACYGYRCCYGGC | Reverse complement motif Consensus sequence: GCCKGGMKCMGTGGCTCAKG |
Dataset #: | 1 |
Motif ID: | 246 |
Motif name: | Motif 246 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 13 |
Similarity score: | 0.0814278 |
Original motif Consensus sequence: GCAGCTTCACTCCTGA | Reverse complement motif Consensus sequence: TCAGGAGTGAAGCTGC |
Dataset #: | 1 |
Motif ID: | 29 |
Motif name: | Motif 29 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 8 |
Number of overlap: | 13 |
Similarity score: | 0.0830321 |
Original motif Consensus sequence: CTGGGCRACAGAGYRAGACY | Reverse complement motif Consensus sequence: MGTCTMKCTCTGTKGCCCAG |
Dataset #: | 1 |
Motif ID: | 116 |
Motif name: | Motif 116 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 13 |
Similarity score: | 0.0837431 |
Original motif Consensus sequence: GCAGAGGCGCTCCT | Reverse complement motif Consensus sequence: AGGAGCGCCTCTGC |
Dataset #: 1 | Motif ID: 144 | Motif name: Motif 144 |
Original motif Consensus sequence: CCGCTGCACTGTGGGAGCCC | Reverse complement motif Consensus sequence: GGGCTCCCACAGTGCAGCGG |
Best Matches for Motif ID 144 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 61 |
Motif name: | Motif 61 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.120211 |
Original motif Consensus sequence: GGATCCACTGGGTGAAGCCA | Reverse complement motif Consensus sequence: TGGCTTCACCCAGTGGATCC |
Dataset #: | 1 |
Motif ID: | 321 |
Motif name: | Motif 321 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.121341 |
Original motif Consensus sequence: AAGCTCGAACTGGGTGGAGC | Reverse complement motif Consensus sequence: GCTCCACCCAGTTCGAGCTT |
Dataset #: | 1 |
Motif ID: | 171 |
Motif name: | Motif 171 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.121783 |
Original motif Consensus sequence: AAAAGTCCACAGTCCAAAGT | Reverse complement motif Consensus sequence: ACTTTGGACTGTGGACTTTT |
Dataset #: | 1 |
Motif ID: | 29 |
Motif name: | Motif 29 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.123294 |
Original motif Consensus sequence: CTGGGCRACAGAGYRAGACY | Reverse complement motif Consensus sequence: MGTCTMKCTCTGTKGCCCAG |
Dataset #: | 1 |
Motif ID: | 310 |
Motif name: | Motif 310 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.123788 |
Original motif Consensus sequence: CCCATGCAAGTCYRAAATCC | Reverse complement motif Consensus sequence: GGATTTMKGACTTGCATGGG |
Dataset #: 1 | Motif ID: 145 | Motif name: Motif 145 |
Original motif Consensus sequence: GCCAGTCACAAAARGACAMA | Reverse complement motif Consensus sequence: TYTGTCMTTTTGTGACTGGC |
Best Matches for Motif ID 145 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 7 |
Motif name: | Motif 7 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.0929275 |
Original motif Consensus sequence: GTCTCWAMAAAAAAWAMAAA | Reverse complement motif Consensus sequence: TTTYTWTTTTTTYTWGAGAC |
Dataset #: | 1 |
Motif ID: | 109 |
Motif name: | Motif 109 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.0984643 |
Original motif Consensus sequence: GAGAGAGAGAGAGAGAGAGA | Reverse complement motif Consensus sequence: TCTCTCTCTCTCTCTCTCTC |
Dataset #: | 1 |
Motif ID: | 99 |
Motif name: | Motif 99 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.110928 |
Original motif Consensus sequence: GCAAAKGACATGATYTCATT | Reverse complement motif Consensus sequence: AATGAKATCATGTCYTTTGC |
Dataset #: | 1 |
Motif ID: | 294 |
Motif name: | Motif 294 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.114037 |
Original motif Consensus sequence: AGCTGTGAGAAGAGGGCCAC | Reverse complement motif Consensus sequence: GTGGCCCTCTTCTCACAGCT |
Dataset #: | 1 |
Motif ID: | 56 |
Motif name: | Motif 56 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.115384 |
Original motif Consensus sequence: CRTGAGCCACYGYRCCYGGC | Reverse complement motif Consensus sequence: GCCKGGMKCMGTGGCTCAKG |
Dataset #: 1 | Motif ID: 146 | Motif name: Motif 146 |
Original motif Consensus sequence: CTGTCACCCC | Reverse complement motif Consensus sequence: GGGGTGACAG |
Best Matches for Motif ID 146 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 1 |
Motif name: | Motif 1 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 10 |
Similarity score: | 0.00304976 |
Original motif Consensus sequence: GGGGTGACAGABGB | Reverse complement motif Consensus sequence: BCVTCTGTCACCCC |
Dataset #: | 1 |
Motif ID: | 209 |
Motif name: | Motif 209 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 10 |
Similarity score: | 0.021009 |
Original motif Consensus sequence: CTGTCAGCCCAT | Reverse complement motif Consensus sequence: ATGGGCTGACAG |
Dataset #: | 1 |
Motif ID: | 279 |
Motif name: | Motif 279 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 7 |
Number of overlap: | 10 |
Similarity score: | 0.0415588 |
Original motif Consensus sequence: GGGGGAGACATCACACR | Reverse complement motif Consensus sequence: MGTGTGATGTCTCCCCC |
Dataset #: | 1 |
Motif ID: | 193 |
Motif name: | Motif 193 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 10 |
Similarity score: | 0.0448872 |
Original motif Consensus sequence: ATACAATGGGGGTACAGRC | Reverse complement motif Consensus sequence: GKCTGTACCCCCATTGTAT |
Dataset #: | 1 |
Motif ID: | 205 |
Motif name: | Motif 205 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 10 |
Similarity score: | 0.0451314 |
Original motif Consensus sequence: CATCTGGCAGCCCA | Reverse complement motif Consensus sequence: TGGGCTGCCAGATG |
Dataset #: 1 | Motif ID: 147 | Motif name: Motif 147 |
Original motif Consensus sequence: CTGGGCACCATTGA | Reverse complement motif Consensus sequence: TCAATGGTGCCCAG |
Best Matches for Motif ID 147 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 29 |
Motif name: | Motif 29 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 7 |
Number of overlap: | 14 |
Similarity score: | 0.0836978 |
Original motif Consensus sequence: CTGGGCRACAGAGYRAGACY | Reverse complement motif Consensus sequence: MGTCTMKCTCTGTKGCCCAG |
Dataset #: | 1 |
Motif ID: | 332 |
Motif name: | Motif 332 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 14 |
Similarity score: | 0.088413 |
Original motif Consensus sequence: CTGGCCCTCAATGGTTAAAC | Reverse complement motif Consensus sequence: GTTTAACCATTGAGGGCCAG |
Dataset #: | 1 |
Motif ID: | 135 |
Motif name: | Motif 135 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 14 |
Similarity score: | 0.0903886 |
Original motif Consensus sequence: CTCTTGTTGCCCAG | Reverse complement motif Consensus sequence: CTGGGCAACAAGAG |
Dataset #: | 1 |
Motif ID: | 67 |
Motif name: | Motif 67 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 14 |
Similarity score: | 0.0918241 |
Original motif Consensus sequence: CTGGGCTCCTGAGTCTGGTG | Reverse complement motif Consensus sequence: CACCAGACTCAGGAGCCCAG |
Dataset #: | 1 |
Motif ID: | 65 |
Motif name: | Motif 65 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 14 |
Similarity score: | 0.0919503 |
Original motif Consensus sequence: AGAAATCGAGCRCAGCGCCG | Reverse complement motif Consensus sequence: CGGCGCTGMGCTCGATTTCT |
Dataset #: 1 | Motif ID: 148 | Motif name: Motif 148 |
Original motif Consensus sequence: AAAGAGAGTCAGCGAAG | Reverse complement motif Consensus sequence: CTTCGCTGACTCTCTTT |
Best Matches for Motif ID 148 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 109 |
Motif name: | Motif 109 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 17 |
Similarity score: | 0.0787922 |
Original motif Consensus sequence: GAGAGAGAGAGAGAGAGAGA | Reverse complement motif Consensus sequence: TCTCTCTCTCTCTCTCTCTC |
Dataset #: | 1 |
Motif ID: | 48 |
Motif name: | Motif 48 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 17 |
Similarity score: | 0.0890404 |
Original motif Consensus sequence: AGCTCCCAGCGTGAGCGACG | Reverse complement motif Consensus sequence: CGTCGCTCACGCTGGGAGCT |
Dataset #: | 1 |
Motif ID: | 201 |
Motif name: | Motif 201 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 17 |
Similarity score: | 0.0907364 |
Original motif Consensus sequence: GTAACACTCACCGCGARGGT | Reverse complement motif Consensus sequence: ACCKTCGCGGTGAGTGTTAC |
Dataset #: | 1 |
Motif ID: | 194 |
Motif name: | Motif 194 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 17 |
Similarity score: | 0.0975057 |
Original motif Consensus sequence: CAAGGGTATAYGAGTAGCTG | Reverse complement motif Consensus sequence: CAGCTACTCKTATACCCTTG |
Dataset #: | 1 |
Motif ID: | 312 |
Motif name: | Motif 312 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 17 |
Similarity score: | 0.1019 |
Original motif Consensus sequence: AGGACTGAGGGTGCCYRGGG | Reverse complement motif Consensus sequence: CCCMKGGCACCCTCAGTCCT |
Dataset #: 1 | Motif ID: 149 | Motif name: Motif 149 |
Original motif Consensus sequence: ACTCAGCCCRCCTGCACCC | Reverse complement motif Consensus sequence: GGGTGCAGGMGGGCTGAGT |
Best Matches for Motif ID 149 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 98 |
Motif name: | Motif 98 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.107094 |
Original motif Consensus sequence: AGTTCCGGGTGGGCGTGGG | Reverse complement motif Consensus sequence: CCCACGCCCACCCGGAACT |
Dataset #: | 1 |
Motif ID: | 82 |
Motif name: | Motif 82 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.11583 |
Original motif Consensus sequence: GCTTAGCACCYGGGCCAGC | Reverse complement motif Consensus sequence: GCTGGCCCKGGTGCTAAGC |
Dataset #: | 1 |
Motif ID: | 321 |
Motif name: | Motif 321 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.118514 |
Original motif Consensus sequence: AAGCTCGAACTGGGTGGAGC | Reverse complement motif Consensus sequence: GCTCCACCCAGTTCGAGCTT |
Dataset #: | 1 |
Motif ID: | 144 |
Motif name: | Motif 144 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.119864 |
Original motif Consensus sequence: CCGCTGCACTGTGGGAGCCC | Reverse complement motif Consensus sequence: GGGCTCCCACAGTGCAGCGG |
Dataset #: | 1 |
Motif ID: | 16 |
Motif name: | Motif 16 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.120923 |
Original motif Consensus sequence: GAAAGGGAACTCCCTGACCC | Reverse complement motif Consensus sequence: GGGTCAGGGAGTTCCCTTTC |
Dataset #: 1 | Motif ID: 150 | Motif name: Motif 150 |
Original motif Consensus sequence: ATTGCTAGCACA | Reverse complement motif Consensus sequence: TGTGCTAGCAAT |
Best Matches for Motif ID 150 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 115 |
Motif name: | Motif 115 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 12 |
Similarity score: | 0.0632108 |
Original motif Consensus sequence: ATGATCCAGCAATYCCACTH | Reverse complement motif Consensus sequence: HAGTGGKATTGCTGGATCAT |
Dataset #: | 1 |
Motif ID: | 306 |
Motif name: | Motif 306 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 12 |
Similarity score: | 0.0772146 |
Original motif Consensus sequence: GACATGAGCTGGCGCTTG | Reverse complement motif Consensus sequence: CAAGCGCCAGCTCATGTC |
Dataset #: | 1 |
Motif ID: | 317 |
Motif name: | Motif 317 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 12 |
Similarity score: | 0.0823231 |
Original motif Consensus sequence: ACATGCTACAACAT | Reverse complement motif Consensus sequence: ATGTTGTAGCATGT |
Dataset #: | 1 |
Motif ID: | 192 |
Motif name: | Motif 192 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 7 |
Number of overlap: | 12 |
Similarity score: | 0.0825726 |
Original motif Consensus sequence: GAATCCTGGGACAGCCTGT | Reverse complement motif Consensus sequence: ACAGGCTGTCCCAGGATTC |
Dataset #: | 1 |
Motif ID: | 284 |
Motif name: | Motif 284 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 12 |
Similarity score: | 0.0836196 |
Original motif Consensus sequence: CATTTGGGAGCCCATTGA | Reverse complement motif Consensus sequence: TCAATGGGCTCCCAAATG |
Dataset #: 1 | Motif ID: 151 | Motif name: Motif 151 |
Original motif Consensus sequence: CATTGTAGB | Reverse complement motif Consensus sequence: BCTACAATG |
Best Matches for Motif ID 151 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 317 |
Motif name: | Motif 317 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 9 |
Similarity score: | 0.0584909 |
Original motif Consensus sequence: ACATGCTACAACAT | Reverse complement motif Consensus sequence: ATGTTGTAGCATGT |
Dataset #: | 1 |
Motif ID: | 144 |
Motif name: | Motif 144 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 7 |
Number of overlap: | 9 |
Similarity score: | 0.0645319 |
Original motif Consensus sequence: CCGCTGCACTGTGGGAGCCC | Reverse complement motif Consensus sequence: GGGCTCCCACAGTGCAGCGG |
Dataset #: | 1 |
Motif ID: | 106 |
Motif name: | Motif 106 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 10 |
Number of overlap: | 9 |
Similarity score: | 0.0647318 |
Original motif Consensus sequence: ATTGGTGTATTTACAATCCC | Reverse complement motif Consensus sequence: GGGATTGTAAATACACCAAT |
Dataset #: | 1 |
Motif ID: | 344 |
Motif name: | Motif 344 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 9 |
Similarity score: | 0.0674469 |
Original motif Consensus sequence: CATAGGAGATGAC | Reverse complement motif Consensus sequence: GTCATCTCCTATG |
Dataset #: | 1 |
Motif ID: | 258 |
Motif name: | Motif 258 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 9 |
Similarity score: | 0.0683218 |
Original motif Consensus sequence: CCACCAACAGTGTAY | Reverse complement motif Consensus sequence: MTACACTGTTGGTGG |
Dataset #: 1 | Motif ID: 152 | Motif name: Motif 152 |
Original motif Consensus sequence: TAAAATAA | Reverse complement motif Consensus sequence: TTATTTTA |
Best Matches for Motif ID 152 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 357 |
Motif name: | Motif 357 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 8 |
Similarity score: | 0.0340112 |
Original motif Consensus sequence: CAAGTTGACACATAAAATTA | Reverse complement motif Consensus sequence: TAATTTTATGTGTCAACTTG |
Dataset #: | 1 |
Motif ID: | 103 |
Motif name: | Motif 103 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 8 |
Similarity score: | 0.0363851 |
Original motif Consensus sequence: AAGTGAAATAA | Reverse complement motif Consensus sequence: TTATTTCACTT |
Dataset #: | 1 |
Motif ID: | 195 |
Motif name: | Motif 195 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 13 |
Number of overlap: | 8 |
Similarity score: | 0.044499 |
Original motif Consensus sequence: TAAAAGACTACAWATTGGGT | Reverse complement motif Consensus sequence: ACCCAATWTGTAGTCTTTTA |
Dataset #: | 1 |
Motif ID: | 233 |
Motif name: | Motif 233 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 9 |
Number of overlap: | 8 |
Similarity score: | 0.0489303 |
Original motif Consensus sequence: GTTAACTGTAAAACAGCCT | Reverse complement motif Consensus sequence: AGGCTGTTTTACAGTTAAC |
Dataset #: | 1 |
Motif ID: | 328 |
Motif name: | Motif 328 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 8 |
Similarity score: | 0.0492169 |
Original motif Consensus sequence: GATACAAAATCAATGTR | Reverse complement motif Consensus sequence: KACATTGATTTTGTATC |
Dataset #: 1 | Motif ID: 153 | Motif name: Motif 153 |
Original motif Consensus sequence: CACTAGGGAGTGCC | Reverse complement motif Consensus sequence: GGCACTCCCTAGTG |
Best Matches for Motif ID 153 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 61 |
Motif name: | Motif 61 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 14 |
Similarity score: | 0.0824482 |
Original motif Consensus sequence: GGATCCACTGGGTGAAGCCA | Reverse complement motif Consensus sequence: TGGCTTCACCCAGTGGATCC |
Dataset #: | 1 |
Motif ID: | 84 |
Motif name: | Motif 84 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 14 |
Similarity score: | 0.082834 |
Original motif Consensus sequence: CTGGGTCCCCCAGCAGTGCC | Reverse complement motif Consensus sequence: GGCACTGCTGGGGGACCCAG |
Dataset #: | 1 |
Motif ID: | 13 |
Motif name: | Motif 13 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 7 |
Number of overlap: | 14 |
Similarity score: | 0.0887847 |
Original motif Consensus sequence: AAGCAGGGCGAGGCATTGCC | Reverse complement motif Consensus sequence: GGCAATGCCTCGCCCTGCTT |
Dataset #: | 1 |
Motif ID: | 202 |
Motif name: | Motif 202 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 14 |
Similarity score: | 0.0903253 |
Original motif Consensus sequence: ACACATCACAAAGCAGTTTC | Reverse complement motif Consensus sequence: GAAACTGCTTTGTGATGTGT |
Dataset #: | 1 |
Motif ID: | 332 |
Motif name: | Motif 332 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 14 |
Similarity score: | 0.0915329 |
Original motif Consensus sequence: CTGGCCCTCAATGGTTAAAC | Reverse complement motif Consensus sequence: GTTTAACCATTGAGGGCCAG |
Dataset #: 1 | Motif ID: 154 | Motif name: Motif 154 |
Original motif Consensus sequence: CATTAGATTCTCATAGGA | Reverse complement motif Consensus sequence: TCCTATGAGAATCTAATG |
Best Matches for Motif ID 154 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 262 |
Motif name: | Motif 262 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 18 |
Similarity score: | 0.100102 |
Original motif Consensus sequence: CTCAGTGTTAATCTCCTGTC | Reverse complement motif Consensus sequence: GACAGGAGATTAACACTGAG |
Dataset #: | 1 |
Motif ID: | 299 |
Motif name: | Motif 299 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 18 |
Similarity score: | 0.111266 |
Original motif Consensus sequence: CCCTGCTAGAACCTCCAA | Reverse complement motif Consensus sequence: TTGGAGGTTCTAGCAGGG |
Dataset #: | 1 |
Motif ID: | 19 |
Motif name: | Motif 19 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 18 |
Similarity score: | 0.114558 |
Original motif Consensus sequence: CACCAGGAGATTATATCCCR | Reverse complement motif Consensus sequence: MGGGATATAATCTCCTGGTG |
Dataset #: | 1 |
Motif ID: | 15 |
Motif name: | Motif 15 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 18 |
Similarity score: | 0.116802 |
Original motif Consensus sequence: CTTGCGCTTCCCRRGTGA | Reverse complement motif Consensus sequence: TCACKMGGGAAGCGCAAG |
Dataset #: | 1 |
Motif ID: | 160 |
Motif name: | Motif 160 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 18 |
Similarity score: | 0.117572 |
Original motif Consensus sequence: AAATTACCCAGTCTCAGGTA | Reverse complement motif Consensus sequence: TACCTGAGACTGGGTAATTT |
Dataset #: 1 | Motif ID: 155 | Motif name: Motif 155 |
Original motif Consensus sequence: TCCCTCCCGGACGGGGYGGC | Reverse complement motif Consensus sequence: GCCKCCCCGTCCGGGAGGGA |
Best Matches for Motif ID 155 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 331 |
Motif name: | Motif 331 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.112683 |
Original motif Consensus sequence: CCACCACAGCTCAAGGAGGC | Reverse complement motif Consensus sequence: GCCTCCTTGAGCTGTGGTGG |
Dataset #: | 1 |
Motif ID: | 201 |
Motif name: | Motif 201 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.117283 |
Original motif Consensus sequence: GTAACACTCACCGCGARGGT | Reverse complement motif Consensus sequence: ACCKTCGCGGTGAGTGTTAC |
Dataset #: | 1 |
Motif ID: | 235 |
Motif name: | Motif 235 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.121478 |
Original motif Consensus sequence: TCCAAATGGGAGAAATTGGC | Reverse complement motif Consensus sequence: GCCAATTTCTCCCATTTGGA |
Dataset #: | 1 |
Motif ID: | 100 |
Motif name: | Motif 100 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.122155 |
Original motif Consensus sequence: GCTGGCCCGCAAGCGCCGCG | Reverse complement motif Consensus sequence: CGCGGCGCTTGCGGGCCAGC |
Dataset #: | 1 |
Motif ID: | 165 |
Motif name: | Motif 165 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.125857 |
Original motif Consensus sequence: ATCTGACAGGAGGYRGAGCT | Reverse complement motif Consensus sequence: AGCTCMKCCTCCTGTCAGAT |
Dataset #: 1 | Motif ID: 156 | Motif name: Motif 156 |
Original motif Consensus sequence: CACTTCCCAGAC | Reverse complement motif Consensus sequence: GTCTGGGAAGTG |
Best Matches for Motif ID 156 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 27 |
Motif name: | Motif 27 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 7 |
Number of overlap: | 12 |
Similarity score: | 0.00564821 |
Original motif Consensus sequence: CACTTCCCAGACGGGGCG | Reverse complement motif Consensus sequence: CGCCCCGTCTGGGAAGTG |
Dataset #: | 1 |
Motif ID: | 95 |
Motif name: | Motif 95 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 6 |
Number of overlap: | 12 |
Similarity score: | 0.0183065 |
Original motif Consensus sequence: ACCCYGTCTGGGAGGTG | Reverse complement motif Consensus sequence: CACCTCCCAGACMGGGT |
Dataset #: | 1 |
Motif ID: | 45 |
Motif name: | Motif 45 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 12 |
Similarity score: | 0.0205412 |
Original motif Consensus sequence: TGCCCAGTCTGGAAAGTG | Reverse complement motif Consensus sequence: CACTTTCCAGACTGGGCA |
Dataset #: | 1 |
Motif ID: | 74 |
Motif name: | Motif 74 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 12 |
Similarity score: | 0.0315299 |
Original motif Consensus sequence: CACTTCCTAGATGG | Reverse complement motif Consensus sequence: CCATCTAGGAAGTG |
Dataset #: | 1 |
Motif ID: | 72 |
Motif name: | Motif 72 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 12 |
Similarity score: | 0.0670258 |
Original motif Consensus sequence: CGCACTCCTCAGCC | Reverse complement motif Consensus sequence: GGCTGAGGAGTGCG |
Dataset #: 1 | Motif ID: 157 | Motif name: Motif 157 |
Original motif Consensus sequence: GCGCACGGCGCGG | Reverse complement motif Consensus sequence: CCGCGCCGTGCGC |
Best Matches for Motif ID 157 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 128 |
Motif name: | Motif 128 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 13 |
Similarity score: | 0.056845 |
Original motif Consensus sequence: CCGCACTCGGAGCRG | Reverse complement motif Consensus sequence: CMGCTCCGAGTGCGG |
Dataset #: | 1 |
Motif ID: | 155 |
Motif name: | Motif 155 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 13 |
Similarity score: | 0.0678809 |
Original motif Consensus sequence: TCCCTCCCGGACGGGGYGGC | Reverse complement motif Consensus sequence: GCCKCCCCGTCCGGGAGGGA |
Dataset #: | 1 |
Motif ID: | 13 |
Motif name: | Motif 13 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 8 |
Number of overlap: | 13 |
Similarity score: | 0.0702925 |
Original motif Consensus sequence: AAGCAGGGCGAGGCATTGCC | Reverse complement motif Consensus sequence: GGCAATGCCTCGCCCTGCTT |
Dataset #: | 1 |
Motif ID: | 65 |
Motif name: | Motif 65 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 13 |
Similarity score: | 0.0726491 |
Original motif Consensus sequence: AGAAATCGAGCRCAGCGCCG | Reverse complement motif Consensus sequence: CGGCGCTGMGCTCGATTTCT |
Dataset #: | 1 |
Motif ID: | 136 |
Motif name: | Motif 136 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 13 |
Similarity score: | 0.0740305 |
Original motif Consensus sequence: CCCTCACTGCCCGGGG | Reverse complement motif Consensus sequence: CCCCGGGCAGTGAGGG |
Dataset #: 1 | Motif ID: 158 | Motif name: Motif 158 |
Original motif Consensus sequence: TAGTTTGCTGA | Reverse complement motif Consensus sequence: TCAGCAAACTA |
Best Matches for Motif ID 158 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 280 |
Motif name: | Motif 280 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 7 |
Number of overlap: | 11 |
Similarity score: | 0.0721214 |
Original motif Consensus sequence: CCTAGATTTCAGARGATGT | Reverse complement motif Consensus sequence: ACATCMTCTGAAATCTAGG |
Dataset #: | 1 |
Motif ID: | 23 |
Motif name: | Motif 23 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 11 |
Similarity score: | 0.077411 |
Original motif Consensus sequence: GGTTCATCTCACTAGGGAGT | Reverse complement motif Consensus sequence: ACTCCCTAGTGAGATGAACC |
Dataset #: | 1 |
Motif ID: | 97 |
Motif name: | Motif 97 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 11 |
Similarity score: | 0.0826841 |
Original motif Consensus sequence: AAGATGGCCGAAT | Reverse complement motif Consensus sequence: ATTCGGCCATCTT |
Dataset #: | 1 |
Motif ID: | 129 |
Motif name: | Motif 129 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 9 |
Number of overlap: | 11 |
Similarity score: | 0.0832491 |
Original motif Consensus sequence: AAGAGGTTTAATTGRCTCA | Reverse complement motif Consensus sequence: TGAGKCAATTAAACCTCTT |
Dataset #: | 1 |
Motif ID: | 38 |
Motif name: | Motif 38 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 11 |
Similarity score: | 0.0844969 |
Original motif Consensus sequence: GCAGTGAGCYRAGA | Reverse complement motif Consensus sequence: TCTMKGCTCACTGC |
Dataset #: 1 | Motif ID: 159 | Motif name: Motif 159 |
Original motif Consensus sequence: ACAGGCTTTGTGTGAGCA | Reverse complement motif Consensus sequence: TGCTCACACAAAGCCTGT |
Best Matches for Motif ID 159 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 144 |
Motif name: | Motif 144 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 18 |
Similarity score: | 0.104283 |
Original motif Consensus sequence: CCGCTGCACTGTGGGAGCCC | Reverse complement motif Consensus sequence: GGGCTCCCACAGTGCAGCGG |
Dataset #: | 1 |
Motif ID: | 129 |
Motif name: | Motif 129 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 18 |
Similarity score: | 0.109531 |
Original motif Consensus sequence: AAGAGGTTTAATTGRCTCA | Reverse complement motif Consensus sequence: TGAGKCAATTAAACCTCTT |
Dataset #: | 1 |
Motif ID: | 261 |
Motif name: | Motif 261 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 18 |
Similarity score: | 0.111806 |
Original motif Consensus sequence: ATCTCASAAATCACCACTA | Reverse complement motif Consensus sequence: TAGTGGTGATTTSTGAGAT |
Dataset #: | 1 |
Motif ID: | 115 |
Motif name: | Motif 115 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 18 |
Similarity score: | 0.114641 |
Original motif Consensus sequence: ATGATCCAGCAATYCCACTH | Reverse complement motif Consensus sequence: HAGTGGKATTGCTGGATCAT |
Dataset #: | 1 |
Motif ID: | 105 |
Motif name: | Motif 105 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 18 |
Similarity score: | 0.115994 |
Original motif Consensus sequence: GCCTCTCCCTCCACACCTCC | Reverse complement motif Consensus sequence: GGAGGTGTGGAGGGAGAGGC |
Dataset #: 1 | Motif ID: 160 | Motif name: Motif 160 |
Original motif Consensus sequence: AAATTACCCAGTCTCAGGTA | Reverse complement motif Consensus sequence: TACCTGAGACTGGGTAATTT |
Best Matches for Motif ID 160 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 321 |
Motif name: | Motif 321 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.115677 |
Original motif Consensus sequence: AAGCTCGAACTGGGTGGAGC | Reverse complement motif Consensus sequence: GCTCCACCCAGTTCGAGCTT |
Dataset #: | 1 |
Motif ID: | 308 |
Motif name: | Motif 308 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.123051 |
Original motif Consensus sequence: AAATTAGGCCAATTAATAAC | Reverse complement motif Consensus sequence: GTTATTAATTGGCCTAATTT |
Dataset #: | 1 |
Motif ID: | 336 |
Motif name: | Motif 336 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.12689 |
Original motif Consensus sequence: ATGTAACCAAAYACCACCTG | Reverse complement motif Consensus sequence: CAGGTGGTKTTTGGTTACAT |
Dataset #: | 1 |
Motif ID: | 254 |
Motif name: | Motif 254 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.129148 |
Original motif Consensus sequence: AAAATCACAAGCATTCCTAT | Reverse complement motif Consensus sequence: ATAGGAATGCTTGTGATTTT |
Dataset #: | 1 |
Motif ID: | 357 |
Motif name: | Motif 357 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.129326 |
Original motif Consensus sequence: CAAGTTGACACATAAAATTA | Reverse complement motif Consensus sequence: TAATTTTATGTGTCAACTTG |
Dataset #: 1 | Motif ID: 161 | Motif name: Motif 161 |
Original motif Consensus sequence: GAGGAGGRGGAGGDGGV | Reverse complement motif Consensus sequence: VCCDCCTCCKCCTCCTC |
Best Matches for Motif ID 161 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 26 |
Motif name: | Motif 26 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 17 |
Similarity score: | 0.0527497 |
Original motif Consensus sequence: CTCCTGCCTCAGCCTCCCRA | Reverse complement motif Consensus sequence: TMGGGAGGCTGAGGCAGGAG |
Dataset #: | 1 |
Motif ID: | 178 |
Motif name: | Motif 178 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 17 |
Similarity score: | 0.0591495 |
Original motif Consensus sequence: ACTGTCTTCCACCTCCACAT | Reverse complement motif Consensus sequence: ATGTGGAGGTGGAAGACAGT |
Dataset #: | 1 |
Motif ID: | 109 |
Motif name: | Motif 109 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 17 |
Similarity score: | 0.062256 |
Original motif Consensus sequence: GAGAGAGAGAGAGAGAGAGA | Reverse complement motif Consensus sequence: TCTCTCTCTCTCTCTCTCTC |
Dataset #: | 1 |
Motif ID: | 105 |
Motif name: | Motif 105 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 17 |
Similarity score: | 0.0741592 |
Original motif Consensus sequence: GCCTCTCCCTCCACACCTCC | Reverse complement motif Consensus sequence: GGAGGTGTGGAGGGAGAGGC |
Dataset #: | 1 |
Motif ID: | 2 |
Motif name: | Motif 2 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 17 |
Similarity score: | 0.080042 |
Original motif Consensus sequence: ATTAGCYRGGCRTGGTGGC | Reverse complement motif Consensus sequence: GCCACCAMGCCMKGCTAAT |
Dataset #: 1 | Motif ID: 162 | Motif name: Motif 162 |
Original motif Consensus sequence: ATGGACCTTG | Reverse complement motif Consensus sequence: CAAGGTCCAT |
Best Matches for Motif ID 162 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 166 |
Motif name: | Motif 166 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 10 |
Similarity score: | 0.0562526 |
Original motif Consensus sequence: AAGGGACATTKGAG | Reverse complement motif Consensus sequence: CTCRAATGTCCCTT |
Dataset #: | 1 |
Motif ID: | 104 |
Motif name: | Motif 104 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 9 |
Number of overlap: | 10 |
Similarity score: | 0.0574028 |
Original motif Consensus sequence: CAACATGGATGRARCTGGAG | Reverse complement motif Consensus sequence: CTCCAGKTMCATCCATGTTG |
Dataset #: | 1 |
Motif ID: | 306 |
Motif name: | Motif 306 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 10 |
Similarity score: | 0.0633278 |
Original motif Consensus sequence: GACATGAGCTGGCGCTTG | Reverse complement motif Consensus sequence: CAAGCGCCAGCTCATGTC |
Dataset #: | 1 |
Motif ID: | 171 |
Motif name: | Motif 171 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 10 |
Similarity score: | 0.0659068 |
Original motif Consensus sequence: AAAAGTCCACAGTCCAAAGT | Reverse complement motif Consensus sequence: ACTTTGGACTGTGGACTTTT |
Dataset #: | 1 |
Motif ID: | 322 |
Motif name: | Motif 322 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 8 |
Number of overlap: | 10 |
Similarity score: | 0.0673833 |
Original motif Consensus sequence: AGGGCCTTTGCASWTGC | Reverse complement motif Consensus sequence: GCAWSTGCAAAGGCCCT |
Dataset #: 1 | Motif ID: 163 | Motif name: Motif 163 |
Original motif Consensus sequence: CCTCCGTGGGCTCC | Reverse complement motif Consensus sequence: GGAGCCCACGGAGG |
Best Matches for Motif ID 163 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 331 |
Motif name: | Motif 331 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 14 |
Similarity score: | 0.0750229 |
Original motif Consensus sequence: CCACCACAGCTCAAGGAGGC | Reverse complement motif Consensus sequence: GCCTCCTTGAGCTGTGGTGG |
Dataset #: | 1 |
Motif ID: | 144 |
Motif name: | Motif 144 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 14 |
Similarity score: | 0.0899923 |
Original motif Consensus sequence: CCGCTGCACTGTGGGAGCCC | Reverse complement motif Consensus sequence: GGGCTCCCACAGTGCAGCGG |
Dataset #: | 1 |
Motif ID: | 48 |
Motif name: | Motif 48 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 6 |
Number of overlap: | 14 |
Similarity score: | 0.102654 |
Original motif Consensus sequence: AGCTCCCAGCGTGAGCGACG | Reverse complement motif Consensus sequence: CGTCGCTCACGCTGGGAGCT |
Dataset #: | 1 |
Motif ID: | 84 |
Motif name: | Motif 84 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 14 |
Similarity score: | 0.104798 |
Original motif Consensus sequence: CTGGGTCCCCCAGCAGTGCC | Reverse complement motif Consensus sequence: GGCACTGCTGGGGGACCCAG |
Dataset #: | 1 |
Motif ID: | 105 |
Motif name: | Motif 105 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 14 |
Similarity score: | 0.105867 |
Original motif Consensus sequence: GCCTCTCCCTCCACACCTCC | Reverse complement motif Consensus sequence: GGAGGTGTGGAGGGAGAGGC |
Dataset #: 1 | Motif ID: 164 | Motif name: Motif 164 |
Original motif Consensus sequence: AGCCCCGGTTCCCGCYCGC | Reverse complement motif Consensus sequence: GCGMGCGGGAACCGGGGCT |
Best Matches for Motif ID 164 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 165 |
Motif name: | Motif 165 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.102596 |
Original motif Consensus sequence: ATCTGACAGGAGGYRGAGCT | Reverse complement motif Consensus sequence: AGCTCMKCCTCCTGTCAGAT |
Dataset #: | 1 |
Motif ID: | 96 |
Motif name: | Motif 96 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.111018 |
Original motif Consensus sequence: AAGCTGAGGGAGCCGGCTCC | Reverse complement motif Consensus sequence: GGAGCCGGCTCCCTCAGCTT |
Dataset #: | 1 |
Motif ID: | 119 |
Motif name: | Motif 119 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.112548 |
Original motif Consensus sequence: AAGTCCAAGATCAAGGTGYY | Reverse complement motif Consensus sequence: KKCACCTTGATCTTGGACTT |
Dataset #: | 1 |
Motif ID: | 139 |
Motif name: | Motif 139 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.112947 |
Original motif Consensus sequence: AGCCYCTGGYAACCAYYAWT | Reverse complement motif Consensus sequence: AWTKKTGGTTKCCAGKGGCT |
Dataset #: | 1 |
Motif ID: | 8 |
Motif name: | Motif 8 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.119454 |
Original motif Consensus sequence: ATCRCTTGAGSYCAGGAGKT | Reverse complement motif Consensus sequence: ARCTCCTGKSCTCAAGKGAT |
Dataset #: 1 | Motif ID: 165 | Motif name: Motif 165 |
Original motif Consensus sequence: ATCTGACAGGAGGYRGAGCT | Reverse complement motif Consensus sequence: AGCTCMKCCTCCTGTCAGAT |
Best Matches for Motif ID 165 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 52 |
Motif name: | Motif 52 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.118513 |
Original motif Consensus sequence: GACTGGCAGGCAGCTCCACC | Reverse complement motif Consensus sequence: GGTGGAGCTGCCTGCCAGTC |
Dataset #: | 1 |
Motif ID: | 294 |
Motif name: | Motif 294 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.1205 |
Original motif Consensus sequence: AGCTGTGAGAAGAGGGCCAC | Reverse complement motif Consensus sequence: GTGGCCCTCTTCTCACAGCT |
Dataset #: | 1 |
Motif ID: | 349 |
Motif name: | Motif 349 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.123054 |
Original motif Consensus sequence: AGAGCCAAATCATGARTGAA | Reverse complement motif Consensus sequence: TTCAMTCATGATTTGGCTCT |
Dataset #: | 1 |
Motif ID: | 105 |
Motif name: | Motif 105 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.123269 |
Original motif Consensus sequence: GCCTCTCCCTCCACACCTCC | Reverse complement motif Consensus sequence: GGAGGTGTGGAGGGAGAGGC |
Dataset #: | 1 |
Motif ID: | 8 |
Motif name: | Motif 8 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.12362 |
Original motif Consensus sequence: ATCRCTTGAGSYCAGGAGKT | Reverse complement motif Consensus sequence: ARCTCCTGKSCTCAAGKGAT |
Dataset #: 1 | Motif ID: 166 | Motif name: Motif 166 |
Original motif Consensus sequence: AAGGGACATTKGAG | Reverse complement motif Consensus sequence: CTCRAATGTCCCTT |
Best Matches for Motif ID 166 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 305 |
Motif name: | Motif 305 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 14 |
Similarity score: | 0.0470693 |
Original motif Consensus sequence: AATGACCAATTGAGAGC | Reverse complement motif Consensus sequence: GCTCTCAATTGGTCATT |
Dataset #: | 1 |
Motif ID: | 329 |
Motif name: | Motif 329 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 14 |
Similarity score: | 0.0535951 |
Original motif Consensus sequence: GGGAGGGATATATTAGC | Reverse complement motif Consensus sequence: GCTAATATATCCCTCCC |
Dataset #: | 1 |
Motif ID: | 227 |
Motif name: | Motif 227 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 14 |
Similarity score: | 0.0576035 |
Original motif Consensus sequence: CCCAAATCTCATSTTGAAT | Reverse complement motif Consensus sequence: ATTCAASATGAGATTTGGG |
Dataset #: | 1 |
Motif ID: | 176 |
Motif name: | Motif 176 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 14 |
Similarity score: | 0.0589344 |
Original motif Consensus sequence: AGGCCCCAGTGTSTGTTGTT | Reverse complement motif Consensus sequence: AACAACASACACTGGGGCCT |
Dataset #: | 1 |
Motif ID: | 99 |
Motif name: | Motif 99 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 14 |
Similarity score: | 0.0601117 |
Original motif Consensus sequence: GCAAAKGACATGATYTCATT | Reverse complement motif Consensus sequence: AATGAKATCATGTCYTTTGC |
Dataset #: 1 | Motif ID: 167 | Motif name: Motif 167 |
Original motif Consensus sequence: CCGCTCCTGTGC | Reverse complement motif Consensus sequence: GCACAGGAGCGG |
Best Matches for Motif ID 167 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 62 |
Motif name: | Motif 62 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 12 |
Similarity score: | 0.0721943 |
Original motif Consensus sequence: AGGAACAGCTCCRGTCTAC | Reverse complement motif Consensus sequence: GTAGACKGGAGCTGTTCCT |
Dataset #: | 1 |
Motif ID: | 144 |
Motif name: | Motif 144 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 12 |
Similarity score: | 0.0736876 |
Original motif Consensus sequence: CCGCTGCACTGTGGGAGCCC | Reverse complement motif Consensus sequence: GGGCTCCCACAGTGCAGCGG |
Dataset #: | 1 |
Motif ID: | 67 |
Motif name: | Motif 67 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 7 |
Number of overlap: | 12 |
Similarity score: | 0.0807459 |
Original motif Consensus sequence: CTGGGCTCCTGAGTCTGGTG | Reverse complement motif Consensus sequence: CACCAGACTCAGGAGCCCAG |
Dataset #: | 1 |
Motif ID: | 84 |
Motif name: | Motif 84 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 8 |
Number of overlap: | 12 |
Similarity score: | 0.082955 |
Original motif Consensus sequence: CTGGGTCCCCCAGCAGTGCC | Reverse complement motif Consensus sequence: GGCACTGCTGGGGGACCCAG |
Dataset #: | 1 |
Motif ID: | 165 |
Motif name: | Motif 165 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 12 |
Similarity score: | 0.0877385 |
Original motif Consensus sequence: ATCTGACAGGAGGYRGAGCT | Reverse complement motif Consensus sequence: AGCTCMKCCTCCTGTCAGAT |
Dataset #: 1 | Motif ID: 168 | Motif name: Motif 168 |
Original motif Consensus sequence: AGGTATTTCTCCCACC | Reverse complement motif Consensus sequence: GGTGGGAGAAATACCT |
Best Matches for Motif ID 168 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 16 |
Motif name: | Motif 16 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 16 |
Similarity score: | 0.0930663 |
Original motif Consensus sequence: GAAAGGGAACTCCCTGACCC | Reverse complement motif Consensus sequence: GGGTCAGGGAGTTCCCTTTC |
Dataset #: | 1 |
Motif ID: | 235 |
Motif name: | Motif 235 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 16 |
Similarity score: | 0.0952107 |
Original motif Consensus sequence: TCCAAATGGGAGAAATTGGC | Reverse complement motif Consensus sequence: GCCAATTTCTCCCATTTGGA |
Dataset #: | 1 |
Motif ID: | 62 |
Motif name: | Motif 62 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 16 |
Similarity score: | 0.0971787 |
Original motif Consensus sequence: AGGAACAGCTCCRGTCTAC | Reverse complement motif Consensus sequence: GTAGACKGGAGCTGTTCCT |
Dataset #: | 1 |
Motif ID: | 106 |
Motif name: | Motif 106 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 16 |
Similarity score: | 0.10263 |
Original motif Consensus sequence: ATTGGTGTATTTACAATCCC | Reverse complement motif Consensus sequence: GGGATTGTAAATACACCAAT |
Dataset #: | 1 |
Motif ID: | 102 |
Motif name: | Motif 102 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 16 |
Similarity score: | 0.104426 |
Original motif Consensus sequence: CTCATTTAATCCTCACAAC | Reverse complement motif Consensus sequence: GTTGTGAGGATTAAATGAG |
Dataset #: 1 | Motif ID: 169 | Motif name: Motif 169 |
Original motif Consensus sequence: CCCAAATCCTATAAAA | Reverse complement motif Consensus sequence: TTTTATAGGATTTGGG |
Best Matches for Motif ID 169 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 235 |
Motif name: | Motif 235 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 16 |
Similarity score: | 0.0869109 |
Original motif Consensus sequence: TCCAAATGGGAGAAATTGGC | Reverse complement motif Consensus sequence: GCCAATTTCTCCCATTTGGA |
Dataset #: | 1 |
Motif ID: | 227 |
Motif name: | Motif 227 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 16 |
Similarity score: | 0.0879004 |
Original motif Consensus sequence: CCCAAATCTCATSTTGAAT | Reverse complement motif Consensus sequence: ATTCAASATGAGATTTGGG |
Dataset #: | 1 |
Motif ID: | 309 |
Motif name: | Motif 309 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 16 |
Similarity score: | 0.0971624 |
Original motif Consensus sequence: CATTCTGGGGTCTGGAGGAY | Reverse complement motif Consensus sequence: MTCCTCCAGACCCCAGAATG |
Dataset #: | 1 |
Motif ID: | 349 |
Motif name: | Motif 349 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 16 |
Similarity score: | 0.0994535 |
Original motif Consensus sequence: AGAGCCAAATCATGARTGAA | Reverse complement motif Consensus sequence: TTCAMTCATGATTTGGCTCT |
Dataset #: | 1 |
Motif ID: | 165 |
Motif name: | Motif 165 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 16 |
Similarity score: | 0.100749 |
Original motif Consensus sequence: ATCTGACAGGAGGYRGAGCT | Reverse complement motif Consensus sequence: AGCTCMKCCTCCTGTCAGAT |
Dataset #: 1 | Motif ID: 170 | Motif name: Motif 170 |
Original motif Consensus sequence: AATCAACCCTGGYRATCAAT | Reverse complement motif Consensus sequence: ATTGATMKCCAGGGTTGATT |
Best Matches for Motif ID 170 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 63 |
Motif name: | Motif 63 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.0971686 |
Original motif Consensus sequence: AGTGAGAACATRYRRTRTTT | Reverse complement motif Consensus sequence: AAAMAMMKMATGTTCTCACT |
Dataset #: | 1 |
Motif ID: | 332 |
Motif name: | Motif 332 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.114396 |
Original motif Consensus sequence: CTGGCCCTCAATGGTTAAAC | Reverse complement motif Consensus sequence: GTTTAACCATTGAGGGCCAG |
Dataset #: | 1 |
Motif ID: | 55 |
Motif name: | Motif 55 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.115985 |
Original motif Consensus sequence: ATGGAATAYTATTCAGCCAT | Reverse complement motif Consensus sequence: ATGGCTGAATAKTATTCCAT |
Dataset #: | 1 |
Motif ID: | 58 |
Motif name: | Motif 58 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.117799 |
Original motif Consensus sequence: ATGGACAYTTRGGTTGHTTC | Reverse complement motif Consensus sequence: GAAHCAACCKAAKTGTCCAT |
Dataset #: | 1 |
Motif ID: | 177 |
Motif name: | Motif 177 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.120018 |
Original motif Consensus sequence: CCCGAAGCTGCRYRCTCGGT | Reverse complement motif Consensus sequence: ACCGAGMKMGCAGCTTCGGG |
Dataset #: 1 | Motif ID: 171 | Motif name: Motif 171 |
Original motif Consensus sequence: AAAAGTCCACAGTCCAAAGT | Reverse complement motif Consensus sequence: ACTTTGGACTGTGGACTTTT |
Best Matches for Motif ID 171 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 144 |
Motif name: | Motif 144 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.11926 |
Original motif Consensus sequence: CCGCTGCACTGTGGGAGCCC | Reverse complement motif Consensus sequence: GGGCTCCCACAGTGCAGCGG |
Dataset #: | 1 |
Motif ID: | 63 |
Motif name: | Motif 63 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.121669 |
Original motif Consensus sequence: AGTGAGAACATRYRRTRTTT | Reverse complement motif Consensus sequence: AAAMAMMKMATGTTCTCACT |
Dataset #: | 1 |
Motif ID: | 115 |
Motif name: | Motif 115 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.124783 |
Original motif Consensus sequence: ATGATCCAGCAATYCCACTH | Reverse complement motif Consensus sequence: HAGTGGKATTGCTGGATCAT |
Dataset #: | 1 |
Motif ID: | 176 |
Motif name: | Motif 176 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.127032 |
Original motif Consensus sequence: AGGCCCCAGTGTSTGTTGTT | Reverse complement motif Consensus sequence: AACAACASACACTGGGGCCT |
Dataset #: | 1 |
Motif ID: | 202 |
Motif name: | Motif 202 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.127973 |
Original motif Consensus sequence: ACACATCACAAAGCAGTTTC | Reverse complement motif Consensus sequence: GAAACTGCTTTGTGATGTGT |
Dataset #: 1 | Motif ID: 172 | Motif name: Motif 172 |
Original motif Consensus sequence: AGAAACAGAA | Reverse complement motif Consensus sequence: TTCTGTTTCT |
Best Matches for Motif ID 172 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 356 |
Motif name: | Motif 356 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 8 |
Number of overlap: | 10 |
Similarity score: | 0.0394673 |
Original motif Consensus sequence: AATTAAAAGACACAGACTG | Reverse complement motif Consensus sequence: CAGTCTGTGTCTTTTAATT |
Dataset #: | 1 |
Motif ID: | 145 |
Motif name: | Motif 145 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 8 |
Number of overlap: | 10 |
Similarity score: | 0.0541669 |
Original motif Consensus sequence: GCCAGTCACAAAARGACAMA | Reverse complement motif Consensus sequence: TYTGTCMTTTTGTGACTGGC |
Dataset #: | 1 |
Motif ID: | 175 |
Motif name: | Motif 175 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 5 |
Number of overlap: | 10 |
Similarity score: | 0.0544219 |
Original motif Consensus sequence: AGCTAGAYACAGAGTGC | Reverse complement motif Consensus sequence: GCACTCTGTMTCTAGCT |
Dataset #: | 1 |
Motif ID: | 54 |
Motif name: | Motif 54 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 10 |
Similarity score: | 0.0568571 |
Original motif Consensus sequence: AAGGAAAAGAAA | Reverse complement motif Consensus sequence: TTTCTTTTCCTT |
Dataset #: | 1 |
Motif ID: | 7 |
Motif name: | Motif 7 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 10 |
Similarity score: | 0.0594764 |
Original motif Consensus sequence: GTCTCWAMAAAAAAWAMAAA | Reverse complement motif Consensus sequence: TTTYTWTTTTTTYTWGAGAC |
Dataset #: 1 | Motif ID: 173 | Motif name: Motif 173 |
Original motif Consensus sequence: AAGGAAACAA | Reverse complement motif Consensus sequence: TTGTTTCCTT |
Best Matches for Motif ID 173 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 234 |
Motif name: | Motif 234 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 11 |
Number of overlap: | 10 |
Similarity score: | 0.043227 |
Original motif Consensus sequence: AAGGAACAAACTCCRGACAC | Reverse complement motif Consensus sequence: GTGTCKGGAGTTTGTTCCTT |
Dataset #: | 1 |
Motif ID: | 41 |
Motif name: | Motif 41 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 10 |
Similarity score: | 0.0491703 |
Original motif Consensus sequence: AAAYAAAAAAA | Reverse complement motif Consensus sequence: TTTTTTTMTTT |
Dataset #: | 1 |
Motif ID: | 54 |
Motif name: | Motif 54 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 10 |
Similarity score: | 0.0529937 |
Original motif Consensus sequence: AAGGAAAAGAAA | Reverse complement motif Consensus sequence: TTTCTTTTCCTT |
Dataset #: | 1 |
Motif ID: | 7 |
Motif name: | Motif 7 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 10 |
Number of overlap: | 10 |
Similarity score: | 0.0605263 |
Original motif Consensus sequence: GTCTCWAMAAAAAAWAMAAA | Reverse complement motif Consensus sequence: TTTYTWTTTTTTYTWGAGAC |
Dataset #: | 1 |
Motif ID: | 158 |
Motif name: | Motif 158 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 10 |
Similarity score: | 0.0611844 |
Original motif Consensus sequence: TAGTTTGCTGA | Reverse complement motif Consensus sequence: TCAGCAAACTA |
Dataset #: 1 | Motif ID: 174 | Motif name: Motif 174 |
Original motif Consensus sequence: GGGGTGAVCAGAT | Reverse complement motif Consensus sequence: ATCTGVTCACCCC |
Best Matches for Motif ID 174 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 205 |
Motif name: | Motif 205 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 13 |
Similarity score: | 0.0735305 |
Original motif Consensus sequence: CATCTGGCAGCCCA | Reverse complement motif Consensus sequence: TGGGCTGCCAGATG |
Dataset #: | 1 |
Motif ID: | 320 |
Motif name: | Motif 320 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 13 |
Similarity score: | 0.0766821 |
Original motif Consensus sequence: CATCTGGAGCCCCA | Reverse complement motif Consensus sequence: TGGGGCTCCAGATG |
Dataset #: | 1 |
Motif ID: | 294 |
Motif name: | Motif 294 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 7 |
Number of overlap: | 13 |
Similarity score: | 0.0767655 |
Original motif Consensus sequence: AGCTGTGAGAAGAGGGCCAC | Reverse complement motif Consensus sequence: GTGGCCCTCTTCTCACAGCT |
Dataset #: | 1 |
Motif ID: | 38 |
Motif name: | Motif 38 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 13 |
Similarity score: | 0.0827379 |
Original motif Consensus sequence: GCAGTGAGCYRAGA | Reverse complement motif Consensus sequence: TCTMKGCTCACTGC |
Dataset #: | 1 |
Motif ID: | 92 |
Motif name: | Motif 92 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 13 |
Similarity score: | 0.083141 |
Original motif Consensus sequence: GGGGGCTGACCCCCCCACC | Reverse complement motif Consensus sequence: GGTGGGGGGGTCAGCCCCC |
Dataset #: 1 | Motif ID: 175 | Motif name: Motif 175 |
Original motif Consensus sequence: AGCTAGAYACAGAGTGC | Reverse complement motif Consensus sequence: GCACTCTGTMTCTAGCT |
Best Matches for Motif ID 175 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 109 |
Motif name: | Motif 109 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 17 |
Similarity score: | 0.0923803 |
Original motif Consensus sequence: GAGAGAGAGAGAGAGAGAGA | Reverse complement motif Consensus sequence: TCTCTCTCTCTCTCTCTCTC |
Dataset #: | 1 |
Motif ID: | 349 |
Motif name: | Motif 349 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 17 |
Similarity score: | 0.0970004 |
Original motif Consensus sequence: AGAGCCAAATCATGARTGAA | Reverse complement motif Consensus sequence: TTCAMTCATGATTTGGCTCT |
Dataset #: | 1 |
Motif ID: | 192 |
Motif name: | Motif 192 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 17 |
Similarity score: | 0.106953 |
Original motif Consensus sequence: GAATCCTGGGACAGCCTGT | Reverse complement motif Consensus sequence: ACAGGCTGTCCCAGGATTC |
Dataset #: | 1 |
Motif ID: | 294 |
Motif name: | Motif 294 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 17 |
Similarity score: | 0.107528 |
Original motif Consensus sequence: AGCTGTGAGAAGAGGGCCAC | Reverse complement motif Consensus sequence: GTGGCCCTCTTCTCACAGCT |
Dataset #: | 1 |
Motif ID: | 176 |
Motif name: | Motif 176 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 17 |
Similarity score: | 0.112575 |
Original motif Consensus sequence: AGGCCCCAGTGTSTGTTGTT | Reverse complement motif Consensus sequence: AACAACASACACTGGGGCCT |
Dataset #: 1 | Motif ID: 176 | Motif name: Motif 176 |
Original motif Consensus sequence: AGGCCCCAGTGTSTGTTGTT | Reverse complement motif Consensus sequence: AACAACASACACTGGGGCCT |
Best Matches for Motif ID 176 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 48 |
Motif name: | Motif 48 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.100522 |
Original motif Consensus sequence: AGCTCCCAGCGTGAGCGACG | Reverse complement motif Consensus sequence: CGTCGCTCACGCTGGGAGCT |
Dataset #: | 1 |
Motif ID: | 292 |
Motif name: | Motif 292 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.103197 |
Original motif Consensus sequence: AAGACCTTCCAGTGGGACAA | Reverse complement motif Consensus sequence: TTGTCCCACTGGAAGGTCTT |
Dataset #: | 1 |
Motif ID: | 139 |
Motif name: | Motif 139 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.106256 |
Original motif Consensus sequence: AGCCYCTGGYAACCAYYAWT | Reverse complement motif Consensus sequence: AWTKKTGGTTKCCAGKGGCT |
Dataset #: | 1 |
Motif ID: | 312 |
Motif name: | Motif 312 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.108547 |
Original motif Consensus sequence: AGGACTGAGGGTGCCYRGGG | Reverse complement motif Consensus sequence: CCCMKGGCACCCTCAGTCCT |
Dataset #: | 1 |
Motif ID: | 254 |
Motif name: | Motif 254 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.115174 |
Original motif Consensus sequence: AAAATCACAAGCATTCCTAT | Reverse complement motif Consensus sequence: ATAGGAATGCTTGTGATTTT |
Dataset #: 1 | Motif ID: 177 | Motif name: Motif 177 |
Original motif Consensus sequence: CCCGAAGCTGCRYRCTCGGT | Reverse complement motif Consensus sequence: ACCGAGMKMGCAGCTTCGGG |
Best Matches for Motif ID 177 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 56 |
Motif name: | Motif 56 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.0760829 |
Original motif Consensus sequence: CRTGAGCCACYGYRCCYGGC | Reverse complement motif Consensus sequence: GCCKGGMKCMGTGGCTCAKG |
Dataset #: | 1 |
Motif ID: | 52 |
Motif name: | Motif 52 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.104166 |
Original motif Consensus sequence: GACTGGCAGGCAGCTCCACC | Reverse complement motif Consensus sequence: GGTGGAGCTGCCTGCCAGTC |
Dataset #: | 1 |
Motif ID: | 195 |
Motif name: | Motif 195 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.104438 |
Original motif Consensus sequence: TAAAAGACTACAWATTGGGT | Reverse complement motif Consensus sequence: ACCCAATWTGTAGTCTTTTA |
Dataset #: | 1 |
Motif ID: | 99 |
Motif name: | Motif 99 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.106729 |
Original motif Consensus sequence: GCAAAKGACATGATYTCATT | Reverse complement motif Consensus sequence: AATGAKATCATGTCYTTTGC |
Dataset #: | 1 |
Motif ID: | 235 |
Motif name: | Motif 235 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.107691 |
Original motif Consensus sequence: TCCAAATGGGAGAAATTGGC | Reverse complement motif Consensus sequence: GCCAATTTCTCCCATTTGGA |
Dataset #: 1 | Motif ID: 178 | Motif name: Motif 178 |
Original motif Consensus sequence: ACTGTCTTCCACCTCCACAT | Reverse complement motif Consensus sequence: ATGTGGAGGTGGAAGACAGT |
Best Matches for Motif ID 178 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 350 |
Motif name: | Motif 350 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.101056 |
Original motif Consensus sequence: TCTGGAGTGGACCTCCAGCA | Reverse complement motif Consensus sequence: TGCTGGAGGTCCACTCCAGA |
Dataset #: | 1 |
Motif ID: | 292 |
Motif name: | Motif 292 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.111286 |
Original motif Consensus sequence: AAGACCTTCCAGTGGGACAA | Reverse complement motif Consensus sequence: TTGTCCCACTGGAAGGTCTT |
Dataset #: | 1 |
Motif ID: | 115 |
Motif name: | Motif 115 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.119924 |
Original motif Consensus sequence: ATGATCCAGCAATYCCACTH | Reverse complement motif Consensus sequence: HAGTGGKATTGCTGGATCAT |
Dataset #: | 1 |
Motif ID: | 83 |
Motif name: | Motif 83 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.121173 |
Original motif Consensus sequence: AAAATGTGGTAYATAYAYAC | Reverse complement motif Consensus sequence: GTKTMTATMTACCACATTTT |
Dataset #: | 1 |
Motif ID: | 119 |
Motif name: | Motif 119 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.125588 |
Original motif Consensus sequence: AAGTCCAAGATCAAGGTGYY | Reverse complement motif Consensus sequence: KKCACCTTGATCTTGGACTT |
Dataset #: 1 | Motif ID: 179 | Motif name: Motif 179 |
Original motif Consensus sequence: AGGTCCTTCAGGAGGTATTC | Reverse complement motif Consensus sequence: GAATACCTCCTGAAGGACCT |
Best Matches for Motif ID 179 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 292 |
Motif name: | Motif 292 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.0979569 |
Original motif Consensus sequence: AAGACCTTCCAGTGGGACAA | Reverse complement motif Consensus sequence: TTGTCCCACTGGAAGGTCTT |
Dataset #: | 1 |
Motif ID: | 332 |
Motif name: | Motif 332 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.114535 |
Original motif Consensus sequence: CTGGCCCTCAATGGTTAAAC | Reverse complement motif Consensus sequence: GTTTAACCATTGAGGGCCAG |
Dataset #: | 1 |
Motif ID: | 225 |
Motif name: | Motif 225 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.12063 |
Original motif Consensus sequence: GCACATGTAYCCYAGAACTT | Reverse complement motif Consensus sequence: AAGTTCTKGGKTACATGTGC |
Dataset #: | 1 |
Motif ID: | 119 |
Motif name: | Motif 119 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.120895 |
Original motif Consensus sequence: AAGTCCAAGATCAAGGTGYY | Reverse complement motif Consensus sequence: KKCACCTTGATCTTGGACTT |
Dataset #: | 1 |
Motif ID: | 63 |
Motif name: | Motif 63 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.122039 |
Original motif Consensus sequence: AGTGAGAACATRYRRTRTTT | Reverse complement motif Consensus sequence: AAAMAMMKMATGTTCTCACT |
Dataset #: 1 | Motif ID: 180 | Motif name: Motif 180 |
Original motif Consensus sequence: TGCGCATGCGCA | Reverse complement motif Consensus sequence: TGCGCATGCGCA |
Best Matches for Motif ID 180 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 100 |
Motif name: | Motif 100 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 12 |
Similarity score: | 0.0728388 |
Original motif Consensus sequence: GCTGGCCCGCAAGCGCCGCG | Reverse complement motif Consensus sequence: CGCGGCGCTTGCGGGCCAGC |
Dataset #: | 1 |
Motif ID: | 306 |
Motif name: | Motif 306 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 12 |
Similarity score: | 0.0731846 |
Original motif Consensus sequence: GACATGAGCTGGCGCTTG | Reverse complement motif Consensus sequence: CAAGCGCCAGCTCATGTC |
Dataset #: | 1 |
Motif ID: | 215 |
Motif name: | Motif 215 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 12 |
Similarity score: | 0.0736063 |
Original motif Consensus sequence: HGCTCCTGTGSKCCC | Reverse complement motif Consensus sequence: GGGRSCACAGGAGCD |
Dataset #: | 1 |
Motif ID: | 51 |
Motif name: | Motif 51 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 12 |
Similarity score: | 0.0741066 |
Original motif Consensus sequence: GTGGGTGCGCGCA | Reverse complement motif Consensus sequence: TGCGCGCACCCAC |
Dataset #: | 1 |
Motif ID: | 96 |
Motif name: | Motif 96 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 9 |
Number of overlap: | 12 |
Similarity score: | 0.0850468 |
Original motif Consensus sequence: AAGCTGAGGGAGCCGGCTCC | Reverse complement motif Consensus sequence: GGAGCCGGCTCCCTCAGCTT |
Dataset #: 1 | Motif ID: 181 | Motif name: Motif 181 |
Original motif Consensus sequence: AAATGCAAAT | Reverse complement motif Consensus sequence: ATTTGCATTT |
Best Matches for Motif ID 181 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 322 |
Motif name: | Motif 322 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 6 |
Number of overlap: | 10 |
Similarity score: | 0.0560732 |
Original motif Consensus sequence: AGGGCCTTTGCASWTGC | Reverse complement motif Consensus sequence: GCAWSTGCAAAGGCCCT |
Dataset #: | 1 |
Motif ID: | 25 |
Motif name: | Motif 25 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 10 |
Similarity score: | 0.0591841 |
Original motif Consensus sequence: CATTTCCAWCTGAGGTAC | Reverse complement motif Consensus sequence: GTACCTCAGWTGGAAATG |
Dataset #: | 1 |
Motif ID: | 233 |
Motif name: | Motif 233 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 10 |
Similarity score: | 0.0615448 |
Original motif Consensus sequence: GTTAACTGTAAAACAGCCT | Reverse complement motif Consensus sequence: AGGCTGTTTTACAGTTAAC |
Dataset #: | 1 |
Motif ID: | 214 |
Motif name: | Motif 214 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 6 |
Number of overlap: | 10 |
Similarity score: | 0.0631714 |
Original motif Consensus sequence: CTCAGGAATGGAAAACC | Reverse complement motif Consensus sequence: GGTTTTCCATTCCTGAG |
Dataset #: | 1 |
Motif ID: | 106 |
Motif name: | Motif 106 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 9 |
Number of overlap: | 10 |
Similarity score: | 0.0657257 |
Original motif Consensus sequence: ATTGGTGTATTTACAATCCC | Reverse complement motif Consensus sequence: GGGATTGTAAATACACCAAT |
Dataset #: 1 | Motif ID: 182 | Motif name: Motif 182 |
Original motif Consensus sequence: GACCAMGAACCCA | Reverse complement motif Consensus sequence: TGGGTTCYTGGTC |
Best Matches for Motif ID 182 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 68 |
Motif name: | Motif 68 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 13 |
Similarity score: | 0.0852314 |
Original motif Consensus sequence: CATGGCGGGCTGCAGGTC | Reverse complement motif Consensus sequence: GACCTGCAGCCCGCCATG |
Dataset #: | 1 |
Motif ID: | 271 |
Motif name: | Motif 271 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 13 |
Similarity score: | 0.0870886 |
Original motif Consensus sequence: AGGGATCTAGGTTGCR | Reverse complement motif Consensus sequence: KGCAACCTAGATCCCT |
Dataset #: | 1 |
Motif ID: | 67 |
Motif name: | Motif 67 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 13 |
Similarity score: | 0.0874714 |
Original motif Consensus sequence: CTGGGCTCCTGAGTCTGGTG | Reverse complement motif Consensus sequence: CACCAGACTCAGGAGCCCAG |
Dataset #: | 1 |
Motif ID: | 60 |
Motif name: | Motif 60 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 13 |
Similarity score: | 0.0899738 |
Original motif Consensus sequence: GATCACGAGGTCAGGAG | Reverse complement motif Consensus sequence: CTCCTGACCTCGTGATC |
Dataset #: | 1 |
Motif ID: | 164 |
Motif name: | Motif 164 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 13 |
Similarity score: | 0.0928807 |
Original motif Consensus sequence: AGCCCCGGTTCCCGCYCGC | Reverse complement motif Consensus sequence: GCGMGCGGGAACCGGGGCT |
Dataset #: 1 | Motif ID: 183 | Motif name: Motif 183 |
Original motif Consensus sequence: GCCRGCCCTGCYGGCC | Reverse complement motif Consensus sequence: GGCCMGCAGGGCKGGC |
Best Matches for Motif ID 183 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 100 |
Motif name: | Motif 100 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 16 |
Similarity score: | 0.0673082 |
Original motif Consensus sequence: GCTGGCCCGCAAGCGCCGCG | Reverse complement motif Consensus sequence: CGCGGCGCTTGCGGGCCAGC |
Dataset #: | 1 |
Motif ID: | 52 |
Motif name: | Motif 52 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 16 |
Similarity score: | 0.0703996 |
Original motif Consensus sequence: GACTGGCAGGCAGCTCCACC | Reverse complement motif Consensus sequence: GGTGGAGCTGCCTGCCAGTC |
Dataset #: | 1 |
Motif ID: | 155 |
Motif name: | Motif 155 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 16 |
Similarity score: | 0.0746523 |
Original motif Consensus sequence: TCCCTCCCGGACGGGGYGGC | Reverse complement motif Consensus sequence: GCCKCCCCGTCCGGGAGGGA |
Dataset #: | 1 |
Motif ID: | 2 |
Motif name: | Motif 2 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 16 |
Similarity score: | 0.079611 |
Original motif Consensus sequence: ATTAGCYRGGCRTGGTGGC | Reverse complement motif Consensus sequence: GCCACCAMGCCMKGCTAAT |
Dataset #: | 1 |
Motif ID: | 149 |
Motif name: | Motif 149 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 16 |
Similarity score: | 0.081514 |
Original motif Consensus sequence: ACTCAGCCCRCCTGCACCC | Reverse complement motif Consensus sequence: GGGTGCAGGMGGGCTGAGT |
Dataset #: 1 | Motif ID: 184 | Motif name: Motif 184 |
Original motif Consensus sequence: ATATTGATGATCCTGACC | Reverse complement motif Consensus sequence: GGTCAGGATCATCAATAT |
Best Matches for Motif ID 184 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 254 |
Motif name: | Motif 254 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 18 |
Similarity score: | 0.08828 |
Original motif Consensus sequence: AAAATCACAAGCATTCCTAT | Reverse complement motif Consensus sequence: ATAGGAATGCTTGTGATTTT |
Dataset #: | 1 |
Motif ID: | 16 |
Motif name: | Motif 16 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 18 |
Similarity score: | 0.0954042 |
Original motif Consensus sequence: GAAAGGGAACTCCCTGACCC | Reverse complement motif Consensus sequence: GGGTCAGGGAGTTCCCTTTC |
Dataset #: | 1 |
Motif ID: | 104 |
Motif name: | Motif 104 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 18 |
Similarity score: | 0.0972719 |
Original motif Consensus sequence: CAACATGGATGRARCTGGAG | Reverse complement motif Consensus sequence: CTCCAGKTMCATCCATGTTG |
Dataset #: | 1 |
Motif ID: | 308 |
Motif name: | Motif 308 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 18 |
Similarity score: | 0.104578 |
Original motif Consensus sequence: AAATTAGGCCAATTAATAAC | Reverse complement motif Consensus sequence: GTTATTAATTGGCCTAATTT |
Dataset #: | 1 |
Motif ID: | 137 |
Motif name: | Motif 137 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 18 |
Similarity score: | 0.106783 |
Original motif Consensus sequence: AGGTTTGTTACATAGGTAWA | Reverse complement motif Consensus sequence: TWTACCTATGTAACAAACCT |
Dataset #: 1 | Motif ID: 185 | Motif name: Motif 185 |
Original motif Consensus sequence: GAAGATGAMG | Reverse complement motif Consensus sequence: CYTCATCTTC |
Best Matches for Motif ID 185 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 161 |
Motif name: | Motif 161 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 10 |
Similarity score: | 0.038579 |
Original motif Consensus sequence: GAGGAGGRGGAGGDGGV | Reverse complement motif Consensus sequence: VCCDCCTCCKCCTCCTC |
Dataset #: | 1 |
Motif ID: | 26 |
Motif name: | Motif 26 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 7 |
Number of overlap: | 10 |
Similarity score: | 0.0396628 |
Original motif Consensus sequence: CTCCTGCCTCAGCCTCCCRA | Reverse complement motif Consensus sequence: TMGGGAGGCTGAGGCAGGAG |
Dataset #: | 1 |
Motif ID: | 245 |
Motif name: | Motif 245 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 10 |
Similarity score: | 0.0437873 |
Original motif Consensus sequence: CAGACTGCCTCCTCAA | Reverse complement motif Consensus sequence: TTGAGGAGGCAGTCTG |
Dataset #: | 1 |
Motif ID: | 283 |
Motif name: | Motif 283 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 10 |
Similarity score: | 0.0453186 |
Original motif Consensus sequence: GCCCTCACCATCC | Reverse complement motif Consensus sequence: GGATGGTGAGGGC |
Dataset #: | 1 |
Motif ID: | 5 |
Motif name: | Motif 5 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 10 |
Similarity score: | 0.0464636 |
Original motif Consensus sequence: CCTCRGCCTCC | Reverse complement motif Consensus sequence: GGAGGCKGAGG |
Dataset #: 1 | Motif ID: 186 | Motif name: Motif 186 |
Original motif Consensus sequence: AAATATTT | Reverse complement motif Consensus sequence: AAATATTT |
Best Matches for Motif ID 186 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 57 |
Motif name: | Motif 57 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 8 |
Similarity score: | 0.0174942 |
Original motif Consensus sequence: AAATATTTATT | Reverse complement motif Consensus sequence: AATAAATATTT |
Dataset #: | 1 |
Motif ID: | 168 |
Motif name: | Motif 168 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 8 |
Similarity score: | 0.0532506 |
Original motif Consensus sequence: AGGTATTTCTCCCACC | Reverse complement motif Consensus sequence: GGTGGGAGAAATACCT |
Dataset #: | 1 |
Motif ID: | 329 |
Motif name: | Motif 329 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 8 |
Number of overlap: | 8 |
Similarity score: | 0.055379 |
Original motif Consensus sequence: GGGAGGGATATATTAGC | Reverse complement motif Consensus sequence: GCTAATATATCCCTCCC |
Dataset #: | 1 |
Motif ID: | 346 |
Motif name: | Motif 346 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 7 |
Number of overlap: | 8 |
Similarity score: | 0.060748 |
Original motif Consensus sequence: AAATCTTAAAGCTC | Reverse complement motif Consensus sequence: GAGCTTTAAGATTT |
Dataset #: | 1 |
Motif ID: | 330 |
Motif name: | Motif 330 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 8 |
Similarity score: | 0.0630537 |
Original motif Consensus sequence: AAAACCAGCAAGTTTTTAT | Reverse complement motif Consensus sequence: ATAAAAACTTGCTGGTTTT |
Dataset #: 1 | Motif ID: 187 | Motif name: Motif 187 |
Original motif Consensus sequence: TCTCTGAGCCTCAGTT | Reverse complement motif Consensus sequence: AACTGAGGCTCAGAGA |
Best Matches for Motif ID 187 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 8 |
Motif name: | Motif 8 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 16 |
Similarity score: | 0.0912831 |
Original motif Consensus sequence: ATCRCTTGAGSYCAGGAGKT | Reverse complement motif Consensus sequence: ARCTCCTGKSCTCAAGKGAT |
Dataset #: | 1 |
Motif ID: | 26 |
Motif name: | Motif 26 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 16 |
Similarity score: | 0.0936416 |
Original motif Consensus sequence: CTCCTGCCTCAGCCTCCCRA | Reverse complement motif Consensus sequence: TMGGGAGGCTGAGGCAGGAG |
Dataset #: | 1 |
Motif ID: | 83 |
Motif name: | Motif 83 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 16 |
Similarity score: | 0.097136 |
Original motif Consensus sequence: AAAATGTGGTAYATAYAYAC | Reverse complement motif Consensus sequence: GTKTMTATMTACCACATTTT |
Dataset #: | 1 |
Motif ID: | 109 |
Motif name: | Motif 109 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 5 |
Number of overlap: | 16 |
Similarity score: | 0.0973627 |
Original motif Consensus sequence: GAGAGAGAGAGAGAGAGAGA | Reverse complement motif Consensus sequence: TCTCTCTCTCTCTCTCTCTC |
Dataset #: | 1 |
Motif ID: | 160 |
Motif name: | Motif 160 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 5 |
Number of overlap: | 16 |
Similarity score: | 0.09885 |
Original motif Consensus sequence: AAATTACCCAGTCTCAGGTA | Reverse complement motif Consensus sequence: TACCTGAGACTGGGTAATTT |
Dataset #: 1 | Motif ID: 188 | Motif name: Motif 188 |
Original motif Consensus sequence: CTCCAGACACATC | Reverse complement motif Consensus sequence: GATGTGTCTGGAG |
Best Matches for Motif ID 188 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 105 |
Motif name: | Motif 105 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 13 |
Similarity score: | 0.0694148 |
Original motif Consensus sequence: GCCTCTCCCTCCACACCTCC | Reverse complement motif Consensus sequence: GGAGGTGTGGAGGGAGAGGC |
Dataset #: | 1 |
Motif ID: | 104 |
Motif name: | Motif 104 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 8 |
Number of overlap: | 13 |
Similarity score: | 0.0708894 |
Original motif Consensus sequence: CAACATGGATGRARCTGGAG | Reverse complement motif Consensus sequence: CTCCAGKTMCATCCATGTTG |
Dataset #: | 1 |
Motif ID: | 313 |
Motif name: | Motif 313 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 13 |
Similarity score: | 0.0851305 |
Original motif Consensus sequence: CTCCTGCCTCAGCY | Reverse complement motif Consensus sequence: MGCTGAGGCAGGAG |
Dataset #: | 1 |
Motif ID: | 26 |
Motif name: | Motif 26 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 8 |
Number of overlap: | 13 |
Similarity score: | 0.0869612 |
Original motif Consensus sequence: CTCCTGCCTCAGCCTCCCRA | Reverse complement motif Consensus sequence: TMGGGAGGCTGAGGCAGGAG |
Dataset #: | 1 |
Motif ID: | 67 |
Motif name: | Motif 67 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 8 |
Number of overlap: | 13 |
Similarity score: | 0.0873184 |
Original motif Consensus sequence: CTGGGCTCCTGAGTCTGGTG | Reverse complement motif Consensus sequence: CACCAGACTCAGGAGCCCAG |
Dataset #: 1 | Motif ID: 189 | Motif name: Motif 189 |
Original motif Consensus sequence: ATCCAGTCTATCATTG | Reverse complement motif Consensus sequence: CAATGATAGACTGGAT |
Best Matches for Motif ID 189 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 349 |
Motif name: | Motif 349 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 16 |
Similarity score: | 0.0977739 |
Original motif Consensus sequence: AGAGCCAAATCATGARTGAA | Reverse complement motif Consensus sequence: TTCAMTCATGATTTGGCTCT |
Dataset #: | 1 |
Motif ID: | 310 |
Motif name: | Motif 310 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 16 |
Similarity score: | 0.106334 |
Original motif Consensus sequence: CCCATGCAAGTCYRAAATCC | Reverse complement motif Consensus sequence: GGATTTMKGACTTGCATGGG |
Dataset #: | 1 |
Motif ID: | 341 |
Motif name: | Motif 341 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 16 |
Similarity score: | 0.108161 |
Original motif Consensus sequence: ATCCATCCATCCATCCA | Reverse complement motif Consensus sequence: TGGATGGATGGATGGAT |
Dataset #: | 1 |
Motif ID: | 19 |
Motif name: | Motif 19 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 16 |
Similarity score: | 0.108907 |
Original motif Consensus sequence: CACCAGGAGATTATATCCCR | Reverse complement motif Consensus sequence: MGGGATATAATCTCCTGGTG |
Dataset #: | 1 |
Motif ID: | 194 |
Motif name: | Motif 194 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 16 |
Similarity score: | 0.10982 |
Original motif Consensus sequence: CAAGGGTATAYGAGTAGCTG | Reverse complement motif Consensus sequence: CAGCTACTCKTATACCCTTG |
Dataset #: 1 | Motif ID: 190 | Motif name: Motif 190 |
Original motif Consensus sequence: CAAAGGCATAAGAATGAT | Reverse complement motif Consensus sequence: ATCATTCTTATGCCTTTG |
Best Matches for Motif ID 190 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 194 |
Motif name: | Motif 194 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 18 |
Similarity score: | 0.0879984 |
Original motif Consensus sequence: CAAGGGTATAYGAGTAGCTG | Reverse complement motif Consensus sequence: CAGCTACTCKTATACCCTTG |
Dataset #: | 1 |
Motif ID: | 262 |
Motif name: | Motif 262 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 18 |
Similarity score: | 0.101423 |
Original motif Consensus sequence: CTCAGTGTTAATCTCCTGTC | Reverse complement motif Consensus sequence: GACAGGAGATTAACACTGAG |
Dataset #: | 1 |
Motif ID: | 235 |
Motif name: | Motif 235 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 18 |
Similarity score: | 0.110461 |
Original motif Consensus sequence: TCCAAATGGGAGAAATTGGC | Reverse complement motif Consensus sequence: GCCAATTTCTCCCATTTGGA |
Dataset #: | 1 |
Motif ID: | 21 |
Motif name: | Motif 21 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 18 |
Similarity score: | 0.111473 |
Original motif Consensus sequence: GCCGTTTKTTAAGCCCGTY | Reverse complement motif Consensus sequence: KACGGGCTTAARAAACGGC |
Dataset #: | 1 |
Motif ID: | 308 |
Motif name: | Motif 308 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 18 |
Similarity score: | 0.114401 |
Original motif Consensus sequence: AAATTAGGCCAATTAATAAC | Reverse complement motif Consensus sequence: GTTATTAATTGGCCTAATTT |
Dataset #: 1 | Motif ID: 191 | Motif name: Motif 191 |
Original motif Consensus sequence: AAAGTGCCGAGAKTGCAGC | Reverse complement motif Consensus sequence: GCTGCARTCTCGGCACTTT |
Best Matches for Motif ID 191 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 160 |
Motif name: | Motif 160 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.105699 |
Original motif Consensus sequence: AAATTACCCAGTCTCAGGTA | Reverse complement motif Consensus sequence: TACCTGAGACTGGGTAATTT |
Dataset #: | 1 |
Motif ID: | 171 |
Motif name: | Motif 171 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.106747 |
Original motif Consensus sequence: AAAAGTCCACAGTCCAAAGT | Reverse complement motif Consensus sequence: ACTTTGGACTGTGGACTTTT |
Dataset #: | 1 |
Motif ID: | 70 |
Motif name: | Motif 70 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.111752 |
Original motif Consensus sequence: CTATTGTGAATARTGCTGC | Reverse complement motif Consensus sequence: GCAGCAMTATTCACAATAG |
Dataset #: | 1 |
Motif ID: | 105 |
Motif name: | Motif 105 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.11316 |
Original motif Consensus sequence: GCCTCTCCCTCCACACCTCC | Reverse complement motif Consensus sequence: GGAGGTGTGGAGGGAGAGGC |
Dataset #: | 1 |
Motif ID: | 14 |
Motif name: | Motif 14 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.114153 |
Original motif Consensus sequence: ACCTGGAAAATCGGGTCACT | Reverse complement motif Consensus sequence: AGTGACCCGATTTTCCAGGT |
Dataset #: 1 | Motif ID: 192 | Motif name: Motif 192 |
Original motif Consensus sequence: GAATCCTGGGACAGCCTGT | Reverse complement motif Consensus sequence: ACAGGCTGTCCCAGGATTC |
Best Matches for Motif ID 192 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 348 |
Motif name: | Motif 348 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.111729 |
Original motif Consensus sequence: ATGGCCTATGACYGSTTTG | Reverse complement motif Consensus sequence: CAAASCKGTCATAGGCCAT |
Dataset #: | 1 |
Motif ID: | 64 |
Motif name: | Motif 64 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.111948 |
Original motif Consensus sequence: GAAGGCAGCTAAGGCCCGGY | Reverse complement motif Consensus sequence: KCCGGGCCTTAGCTGCCTTC |
Dataset #: | 1 |
Motif ID: | 280 |
Motif name: | Motif 280 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.113733 |
Original motif Consensus sequence: CCTAGATTTCAGARGATGT | Reverse complement motif Consensus sequence: ACATCMTCTGAAATCTAGG |
Dataset #: | 1 |
Motif ID: | 16 |
Motif name: | Motif 16 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.116458 |
Original motif Consensus sequence: GAAAGGGAACTCCCTGACCC | Reverse complement motif Consensus sequence: GGGTCAGGGAGTTCCCTTTC |
Dataset #: | 1 |
Motif ID: | 65 |
Motif name: | Motif 65 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.11685 |
Original motif Consensus sequence: AGAAATCGAGCRCAGCGCCG | Reverse complement motif Consensus sequence: CGGCGCTGMGCTCGATTTCT |
Dataset #: 1 | Motif ID: 193 | Motif name: Motif 193 |
Original motif Consensus sequence: ATACAATGGGGGTACAGRC | Reverse complement motif Consensus sequence: GKCTGTACCCCCATTGTAT |
Best Matches for Motif ID 193 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 17 |
Motif name: | Motif 17 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.0903363 |
Original motif Consensus sequence: AGACAGTGGGYGCAGGHCA | Reverse complement motif Consensus sequence: TGHCCTGCKCCCACTGTCT |
Dataset #: | 1 |
Motif ID: | 350 |
Motif name: | Motif 350 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.0979844 |
Original motif Consensus sequence: TCTGGAGTGGACCTCCAGCA | Reverse complement motif Consensus sequence: TGCTGGAGGTCCACTCCAGA |
Dataset #: | 1 |
Motif ID: | 105 |
Motif name: | Motif 105 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.105978 |
Original motif Consensus sequence: GCCTCTCCCTCCACACCTCC | Reverse complement motif Consensus sequence: GGAGGTGTGGAGGGAGAGGC |
Dataset #: | 1 |
Motif ID: | 2 |
Motif name: | Motif 2 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.109522 |
Original motif Consensus sequence: ATTAGCYRGGCRTGGTGGC | Reverse complement motif Consensus sequence: GCCACCAMGCCMKGCTAAT |
Dataset #: | 1 |
Motif ID: | 178 |
Motif name: | Motif 178 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.110084 |
Original motif Consensus sequence: ACTGTCTTCCACCTCCACAT | Reverse complement motif Consensus sequence: ATGTGGAGGTGGAAGACAGT |
Dataset #: 1 | Motif ID: 194 | Motif name: Motif 194 |
Original motif Consensus sequence: CAAGGGTATAYGAGTAGCTG | Reverse complement motif Consensus sequence: CAGCTACTCKTATACCCTTG |
Best Matches for Motif ID 194 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 108 |
Motif name: | Motif 108 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.111361 |
Original motif Consensus sequence: CGAGCCTCCCCGAYGAGCGC | Reverse complement motif Consensus sequence: GCGCTCKTCGGGGAGGCTCG |
Dataset #: | 1 |
Motif ID: | 357 |
Motif name: | Motif 357 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.126829 |
Original motif Consensus sequence: CAAGTTGACACATAAAATTA | Reverse complement motif Consensus sequence: TAATTTTATGTGTCAACTTG |
Dataset #: | 1 |
Motif ID: | 333 |
Motif name: | Motif 333 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.13392 |
Original motif Consensus sequence: TAGATAATAGCTCCAGCTTT | Reverse complement motif Consensus sequence: AAAGCTGGAGCTATTATCTA |
Dataset #: | 1 |
Motif ID: | 115 |
Motif name: | Motif 115 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.134335 |
Original motif Consensus sequence: ATGATCCAGCAATYCCACTH | Reverse complement motif Consensus sequence: HAGTGGKATTGCTGGATCAT |
Dataset #: | 1 |
Motif ID: | 196 |
Motif name: | Motif 196 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.134728 |
Original motif Consensus sequence: CCTGCCATTGCYSAGGCTTG | Reverse complement motif Consensus sequence: CAAGCCTSKGCAATGGCAGG |
Dataset #: 1 | Motif ID: 195 | Motif name: Motif 195 |
Original motif Consensus sequence: TAAAAGACTACAWATTGGGT | Reverse complement motif Consensus sequence: ACCCAATWTGTAGTCTTTTA |
Best Matches for Motif ID 195 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 202 |
Motif name: | Motif 202 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.113069 |
Original motif Consensus sequence: ACACATCACAAAGCAGTTTC | Reverse complement motif Consensus sequence: GAAACTGCTTTGTGATGTGT |
Dataset #: | 1 |
Motif ID: | 177 |
Motif name: | Motif 177 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.113969 |
Original motif Consensus sequence: CCCGAAGCTGCRYRCTCGGT | Reverse complement motif Consensus sequence: ACCGAGMKMGCAGCTTCGGG |
Dataset #: | 1 |
Motif ID: | 254 |
Motif name: | Motif 254 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.122348 |
Original motif Consensus sequence: AAAATCACAAGCATTCCTAT | Reverse complement motif Consensus sequence: ATAGGAATGCTTGTGATTTT |
Dataset #: | 1 |
Motif ID: | 201 |
Motif name: | Motif 201 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.123108 |
Original motif Consensus sequence: GTAACACTCACCGCGARGGT | Reverse complement motif Consensus sequence: ACCKTCGCGGTGAGTGTTAC |
Dataset #: | 1 |
Motif ID: | 194 |
Motif name: | Motif 194 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.128438 |
Original motif Consensus sequence: CAAGGGTATAYGAGTAGCTG | Reverse complement motif Consensus sequence: CAGCTACTCKTATACCCTTG |
Dataset #: 1 | Motif ID: 196 | Motif name: Motif 196 |
Original motif Consensus sequence: CCTGCCATTGCYSAGGCTTG | Reverse complement motif Consensus sequence: CAAGCCTSKGCAATGGCAGG |
Best Matches for Motif ID 196 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 108 |
Motif name: | Motif 108 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.113175 |
Original motif Consensus sequence: CGAGCCTCCCCGAYGAGCGC | Reverse complement motif Consensus sequence: GCGCTCKTCGGGGAGGCTCG |
Dataset #: | 1 |
Motif ID: | 58 |
Motif name: | Motif 58 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.135677 |
Original motif Consensus sequence: ATGGACAYTTRGGTTGHTTC | Reverse complement motif Consensus sequence: GAAHCAACCKAAKTGTCCAT |
Dataset #: | 1 |
Motif ID: | 333 |
Motif name: | Motif 333 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.136179 |
Original motif Consensus sequence: TAGATAATAGCTCCAGCTTT | Reverse complement motif Consensus sequence: AAAGCTGGAGCTATTATCTA |
Dataset #: | 1 |
Motif ID: | 194 |
Motif name: | Motif 194 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.138043 |
Original motif Consensus sequence: CAAGGGTATAYGAGTAGCTG | Reverse complement motif Consensus sequence: CAGCTACTCKTATACCCTTG |
Dataset #: | 1 |
Motif ID: | 112 |
Motif name: | Motif 112 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.139891 |
Original motif Consensus sequence: GCTGTGTGACCTTGGGCAAG | Reverse complement motif Consensus sequence: CTTGCCCAAGGTCACACAGC |
Dataset #: 1 | Motif ID: 197 | Motif name: Motif 197 |
Original motif Consensus sequence: CGCCCGGCCAGC | Reverse complement motif Consensus sequence: GCTGGCCGGGCG |
Best Matches for Motif ID 197 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 125 |
Motif name: | Motif 125 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 12 |
Similarity score: | 0.0154405 |
Original motif Consensus sequence: CGCCCGGCCAGCCGC | Reverse complement motif Consensus sequence: GCGGCTGGCCGGGCG |
Dataset #: | 1 |
Motif ID: | 42 |
Motif name: | Motif 42 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 12 |
Similarity score: | 0.0710698 |
Original motif Consensus sequence: CTCTGCCCGGCCGC | Reverse complement motif Consensus sequence: GCGGCCGGGCAGAG |
Dataset #: | 1 |
Motif ID: | 12 |
Motif name: | Motif 12 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 12 |
Similarity score: | 0.076685 |
Original motif Consensus sequence: AGACCAGCCTGGCCAAC | Reverse complement motif Consensus sequence: GTTGGCCAGGCTGGTCT |
Dataset #: | 1 |
Motif ID: | 183 |
Motif name: | Motif 183 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 12 |
Similarity score: | 0.0771111 |
Original motif Consensus sequence: GCCRGCCCTGCYGGCC | Reverse complement motif Consensus sequence: GGCCMGCAGGGCKGGC |
Dataset #: | 1 |
Motif ID: | 82 |
Motif name: | Motif 82 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 8 |
Number of overlap: | 12 |
Similarity score: | 0.0775994 |
Original motif Consensus sequence: GCTTAGCACCYGGGCCAGC | Reverse complement motif Consensus sequence: GCTGGCCCKGGTGCTAAGC |
Dataset #: 1 | Motif ID: 198 | Motif name: Motif 198 |
Original motif Consensus sequence: AGGGMAGGGA | Reverse complement motif Consensus sequence: TCCCTRCCCT |
Best Matches for Motif ID 198 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 78 |
Motif name: | Motif 78 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 10 |
Similarity score: | 0.0499279 |
Original motif Consensus sequence: CGAGCCCTGCCCCGCGG | Reverse complement motif Consensus sequence: CCGCGGGGCAGGGCTCG |
Dataset #: | 1 |
Motif ID: | 16 |
Motif name: | Motif 16 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 10 |
Similarity score: | 0.0554968 |
Original motif Consensus sequence: GAAAGGGAACTCCCTGACCC | Reverse complement motif Consensus sequence: GGGTCAGGGAGTTCCCTTTC |
Dataset #: | 1 |
Motif ID: | 136 |
Motif name: | Motif 136 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 10 |
Similarity score: | 0.0566967 |
Original motif Consensus sequence: CCCTCACTGCCCGGGG | Reverse complement motif Consensus sequence: CCCCGGGCAGTGAGGG |
Dataset #: | 1 |
Motif ID: | 221 |
Motif name: | Motif 221 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 10 |
Similarity score: | 0.0612344 |
Original motif Consensus sequence: GGGAGGAAGGGGACAC | Reverse complement motif Consensus sequence: GTGTCCCCTTCCTCCC |
Dataset #: | 1 |
Motif ID: | 46 |
Motif name: | Motif 46 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 10 |
Similarity score: | 0.0645706 |
Original motif Consensus sequence: CCCCWCCCCCA | Reverse complement motif Consensus sequence: TGGGGGWGGGG |
Dataset #: 1 | Motif ID: 199 | Motif name: Motif 199 |
Original motif Consensus sequence: ACAGCTGGCACC | Reverse complement motif Consensus sequence: GGTGCCAGCTGT |
Best Matches for Motif ID 199 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 49 |
Motif name: | Motif 49 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 12 |
Similarity score: | 0.0585218 |
Original motif Consensus sequence: ACATCTGYMMCC | Reverse complement motif Consensus sequence: GGRRMCAGATGT |
Dataset #: | 1 |
Motif ID: | 1 |
Motif name: | Motif 1 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 12 |
Similarity score: | 0.0698583 |
Original motif Consensus sequence: GGGGTGACAGABGB | Reverse complement motif Consensus sequence: BCVTCTGTCACCCC |
Dataset #: | 1 |
Motif ID: | 96 |
Motif name: | Motif 96 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 12 |
Similarity score: | 0.0749537 |
Original motif Consensus sequence: AAGCTGAGGGAGCCGGCTCC | Reverse complement motif Consensus sequence: GGAGCCGGCTCCCTCAGCTT |
Dataset #: | 1 |
Motif ID: | 306 |
Motif name: | Motif 306 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 12 |
Similarity score: | 0.0751946 |
Original motif Consensus sequence: GACATGAGCTGGCGCTTG | Reverse complement motif Consensus sequence: CAAGCGCCAGCTCATGTC |
Dataset #: | 1 |
Motif ID: | 299 |
Motif name: | Motif 299 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 6 |
Number of overlap: | 12 |
Similarity score: | 0.075898 |
Original motif Consensus sequence: CCCTGCTAGAACCTCCAA | Reverse complement motif Consensus sequence: TTGGAGGTTCTAGCAGGG |
Dataset #: 1 | Motif ID: 200 | Motif name: Motif 200 |
Original motif Consensus sequence: ACCCCGTCTGGGA | Reverse complement motif Consensus sequence: TCCCAGACGGGGT |
Best Matches for Motif ID 200 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 95 |
Motif name: | Motif 95 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 5 |
Number of overlap: | 13 |
Similarity score: | 0.0106929 |
Original motif Consensus sequence: ACCCYGTCTGGGAGGTG | Reverse complement motif Consensus sequence: CACCTCCCAGACMGGGT |
Dataset #: | 1 |
Motif ID: | 27 |
Motif name: | Motif 27 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 13 |
Similarity score: | 0.0207173 |
Original motif Consensus sequence: CACTTCCCAGACGGGGCG | Reverse complement motif Consensus sequence: CGCCCCGTCTGGGAAGTG |
Dataset #: | 1 |
Motif ID: | 155 |
Motif name: | Motif 155 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 13 |
Similarity score: | 0.040436 |
Original motif Consensus sequence: TCCCTCCCGGACGGGGYGGC | Reverse complement motif Consensus sequence: GCCKCCCCGTCCGGGAGGGA |
Dataset #: | 1 |
Motif ID: | 45 |
Motif name: | Motif 45 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 5 |
Number of overlap: | 13 |
Similarity score: | 0.0497149 |
Original motif Consensus sequence: TGCCCAGTCTGGAAAGTG | Reverse complement motif Consensus sequence: CACTTTCCAGACTGGGCA |
Dataset #: | 1 |
Motif ID: | 36 |
Motif name: | Motif 36 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 13 |
Similarity score: | 0.0528184 |
Original motif Consensus sequence: ACATCCCAGACGATGGGCG | Reverse complement motif Consensus sequence: CGCCCATCGTCTGGGATGT |
Dataset #: 1 | Motif ID: 201 | Motif name: Motif 201 |
Original motif Consensus sequence: GTAACACTCACCGCGARGGT | Reverse complement motif Consensus sequence: ACCKTCGCGGTGAGTGTTAC |
Best Matches for Motif ID 201 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 294 |
Motif name: | Motif 294 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.11338 |
Original motif Consensus sequence: AGCTGTGAGAAGAGGGCCAC | Reverse complement motif Consensus sequence: GTGGCCCTCTTCTCACAGCT |
Dataset #: | 1 |
Motif ID: | 321 |
Motif name: | Motif 321 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.114848 |
Original motif Consensus sequence: AAGCTCGAACTGGGTGGAGC | Reverse complement motif Consensus sequence: GCTCCACCCAGTTCGAGCTT |
Dataset #: | 1 |
Motif ID: | 155 |
Motif name: | Motif 155 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.120361 |
Original motif Consensus sequence: TCCCTCCCGGACGGGGYGGC | Reverse complement motif Consensus sequence: GCCKCCCCGTCCGGGAGGGA |
Dataset #: | 1 |
Motif ID: | 76 |
Motif name: | Motif 76 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.122505 |
Original motif Consensus sequence: GTGCCAGGCACTGTKCTARG | Reverse complement motif Consensus sequence: CMTAGYACAGTGCCTGGCAC |
Dataset #: | 1 |
Motif ID: | 225 |
Motif name: | Motif 225 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.125295 |
Original motif Consensus sequence: GCACATGTAYCCYAGAACTT | Reverse complement motif Consensus sequence: AAGTTCTKGGKTACATGTGC |
Dataset #: 1 | Motif ID: 202 | Motif name: Motif 202 |
Original motif Consensus sequence: ACACATCACAAAGCAGTTTC | Reverse complement motif Consensus sequence: GAAACTGCTTTGTGATGTGT |
Best Matches for Motif ID 202 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 61 |
Motif name: | Motif 61 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.117486 |
Original motif Consensus sequence: GGATCCACTGGGTGAAGCCA | Reverse complement motif Consensus sequence: TGGCTTCACCCAGTGGATCC |
Dataset #: | 1 |
Motif ID: | 357 |
Motif name: | Motif 357 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.1227 |
Original motif Consensus sequence: CAAGTTGACACATAAAATTA | Reverse complement motif Consensus sequence: TAATTTTATGTGTCAACTTG |
Dataset #: | 1 |
Motif ID: | 195 |
Motif name: | Motif 195 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.123556 |
Original motif Consensus sequence: TAAAAGACTACAWATTGGGT | Reverse complement motif Consensus sequence: ACCCAATWTGTAGTCTTTTA |
Dataset #: | 1 |
Motif ID: | 13 |
Motif name: | Motif 13 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.123649 |
Original motif Consensus sequence: AAGCAGGGCGAGGCATTGCC | Reverse complement motif Consensus sequence: GGCAATGCCTCGCCCTGCTT |
Dataset #: | 1 |
Motif ID: | 84 |
Motif name: | Motif 84 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.123761 |
Original motif Consensus sequence: CTGGGTCCCCCAGCAGTGCC | Reverse complement motif Consensus sequence: GGCACTGCTGGGGGACCCAG |
Dataset #: 1 | Motif ID: 203 | Motif name: Motif 203 |
Original motif Consensus sequence: CCATGGCGTCC | Reverse complement motif Consensus sequence: GGACGCCATGG |
Best Matches for Motif ID 203 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 120 |
Motif name: | Motif 120 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 11 |
Similarity score: | 0.0640975 |
Original motif Consensus sequence: CCATGTGSTCCC | Reverse complement motif Consensus sequence: GGGASCACATGG |
Dataset #: | 1 |
Motif ID: | 312 |
Motif name: | Motif 312 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 9 |
Number of overlap: | 11 |
Similarity score: | 0.0662761 |
Original motif Consensus sequence: AGGACTGAGGGTGCCYRGGG | Reverse complement motif Consensus sequence: CCCMKGGCACCCTCAGTCCT |
Dataset #: | 1 |
Motif ID: | 163 |
Motif name: | Motif 163 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 11 |
Similarity score: | 0.066425 |
Original motif Consensus sequence: CCTCCGTGGGCTCC | Reverse complement motif Consensus sequence: GGAGCCCACGGAGG |
Dataset #: | 1 |
Motif ID: | 147 |
Motif name: | Motif 147 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 11 |
Similarity score: | 0.0668759 |
Original motif Consensus sequence: CTGGGCACCATTGA | Reverse complement motif Consensus sequence: TCAATGGTGCCCAG |
Dataset #: | 1 |
Motif ID: | 326 |
Motif name: | Motif 326 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 11 |
Similarity score: | 0.071383 |
Original motif Consensus sequence: GACATGGAGTCAAAGG | Reverse complement motif Consensus sequence: CCTTTGACTCCATGTC |
Dataset #: 1 | Motif ID: 204 | Motif name: Motif 204 |
Original motif Consensus sequence: AGAGYRAGACTCC | Reverse complement motif Consensus sequence: GGAGTCTMKCTCT |
Best Matches for Motif ID 204 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 253 |
Motif name: | Motif 253 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 13 |
Similarity score: | 0.0513045 |
Original motif Consensus sequence: AGAGTCTCACTCTGT | Reverse complement motif Consensus sequence: ACAGAGTGAGACTCT |
Dataset #: | 1 |
Motif ID: | 262 |
Motif name: | Motif 262 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 13 |
Similarity score: | 0.0874128 |
Original motif Consensus sequence: CTCAGTGTTAATCTCCTGTC | Reverse complement motif Consensus sequence: GACAGGAGATTAACACTGAG |
Dataset #: | 1 |
Motif ID: | 350 |
Motif name: | Motif 350 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 13 |
Similarity score: | 0.0904804 |
Original motif Consensus sequence: TCTGGAGTGGACCTCCAGCA | Reverse complement motif Consensus sequence: TGCTGGAGGTCCACTCCAGA |
Dataset #: | 1 |
Motif ID: | 246 |
Motif name: | Motif 246 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 13 |
Similarity score: | 0.091609 |
Original motif Consensus sequence: GCAGCTTCACTCCTGA | Reverse complement motif Consensus sequence: TCAGGAGTGAAGCTGC |
Dataset #: | 1 |
Motif ID: | 234 |
Motif name: | Motif 234 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 7 |
Number of overlap: | 13 |
Similarity score: | 0.093082 |
Original motif Consensus sequence: AAGGAACAAACTCCRGACAC | Reverse complement motif Consensus sequence: GTGTCKGGAGTTTGTTCCTT |
Dataset #: 1 | Motif ID: 205 | Motif name: Motif 205 |
Original motif Consensus sequence: CATCTGGCAGCCCA | Reverse complement motif Consensus sequence: TGGGCTGCCAGATG |
Best Matches for Motif ID 205 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 284 |
Motif name: | Motif 284 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 5 |
Number of overlap: | 14 |
Similarity score: | 0.036398 |
Original motif Consensus sequence: CATTTGGGAGCCCATTGA | Reverse complement motif Consensus sequence: TCAATGGGCTCCCAAATG |
Dataset #: | 1 |
Motif ID: | 320 |
Motif name: | Motif 320 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 14 |
Similarity score: | 0.0491079 |
Original motif Consensus sequence: CATCTGGAGCCCCA | Reverse complement motif Consensus sequence: TGGGGCTCCAGATG |
Dataset #: | 1 |
Motif ID: | 122 |
Motif name: | Motif 122 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 6 |
Number of overlap: | 14 |
Similarity score: | 0.0681372 |
Original motif Consensus sequence: CCTTGGCCAGCCCAGAAAG | Reverse complement motif Consensus sequence: CTTTCTGGGCTGGCCAAGG |
Dataset #: | 1 |
Motif ID: | 139 |
Motif name: | Motif 139 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 5 |
Number of overlap: | 14 |
Similarity score: | 0.0781052 |
Original motif Consensus sequence: AGCCYCTGGYAACCAYYAWT | Reverse complement motif Consensus sequence: AWTKKTGGTTKCCAGKGGCT |
Dataset #: | 1 |
Motif ID: | 306 |
Motif name: | Motif 306 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 14 |
Similarity score: | 0.0803617 |
Original motif Consensus sequence: GACATGAGCTGGCGCTTG | Reverse complement motif Consensus sequence: CAAGCGCCAGCTCATGTC |
Dataset #: 1 | Motif ID: 206 | Motif name: Motif 206 |
Original motif Consensus sequence: GCTCCWGTGYGKCC | Reverse complement motif Consensus sequence: GGRCKCACWGGAGC |
Best Matches for Motif ID 206 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 215 |
Motif name: | Motif 215 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 14 |
Similarity score: | 0.038263 |
Original motif Consensus sequence: HGCTCCTGTGSKCCC | Reverse complement motif Consensus sequence: GGGRSCACAGGAGCD |
Dataset #: | 1 |
Motif ID: | 67 |
Motif name: | Motif 67 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 14 |
Similarity score: | 0.0894523 |
Original motif Consensus sequence: CTGGGCTCCTGAGTCTGGTG | Reverse complement motif Consensus sequence: CACCAGACTCAGGAGCCCAG |
Dataset #: | 1 |
Motif ID: | 176 |
Motif name: | Motif 176 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 14 |
Similarity score: | 0.0920579 |
Original motif Consensus sequence: AGGCCCCAGTGTSTGTTGTT | Reverse complement motif Consensus sequence: AACAACASACACTGGGGCCT |
Dataset #: | 1 |
Motif ID: | 84 |
Motif name: | Motif 84 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 14 |
Similarity score: | 0.0936498 |
Original motif Consensus sequence: CTGGGTCCCCCAGCAGTGCC | Reverse complement motif Consensus sequence: GGCACTGCTGGGGGACCCAG |
Dataset #: | 1 |
Motif ID: | 321 |
Motif name: | Motif 321 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 7 |
Number of overlap: | 14 |
Similarity score: | 0.095951 |
Original motif Consensus sequence: AAGCTCGAACTGGGTGGAGC | Reverse complement motif Consensus sequence: GCTCCACCCAGTTCGAGCTT |
Dataset #: 1 | Motif ID: 207 | Motif name: Motif 207 |
Original motif Consensus sequence: GACCTTGA | Reverse complement motif Consensus sequence: TCAAGGTC |
Best Matches for Motif ID 207 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 11 |
Motif name: | Motif 11 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 8 |
Similarity score: | 0.0145765 |
Original motif Consensus sequence: CTCAAGGTCCA | Reverse complement motif Consensus sequence: TGGACCTTGAG |
Dataset #: | 1 |
Motif ID: | 264 |
Motif name: | Motif 264 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 8 |
Similarity score: | 0.0364604 |
Original motif Consensus sequence: CCAAGGTCACA | Reverse complement motif Consensus sequence: TGTGACCTTGG |
Dataset #: | 1 |
Motif ID: | 362 |
Motif name: | Motif 362 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 8 |
Similarity score: | 0.0423228 |
Original motif Consensus sequence: GCTCTGAAGGTCC | Reverse complement motif Consensus sequence: GGACCTTCAGAGC |
Dataset #: | 1 |
Motif ID: | 302 |
Motif name: | Motif 302 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 8 |
Similarity score: | 0.0468349 |
Original motif Consensus sequence: GACCCTGAGAGC | Reverse complement motif Consensus sequence: GCTCTCAGGGTC |
Dataset #: | 1 |
Motif ID: | 328 |
Motif name: | Motif 328 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 10 |
Number of overlap: | 8 |
Similarity score: | 0.0507846 |
Original motif Consensus sequence: GATACAAAATCAATGTR | Reverse complement motif Consensus sequence: KACATTGATTTTGTATC |
Dataset #: 1 | Motif ID: 208 | Motif name: Motif 208 |
Original motif Consensus sequence: GTGAGGGCGAT | Reverse complement motif Consensus sequence: ATCGCCCTCAC |
Best Matches for Motif ID 208 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 329 |
Motif name: | Motif 329 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 7 |
Number of overlap: | 11 |
Similarity score: | 0.0622115 |
Original motif Consensus sequence: GGGAGGGATATATTAGC | Reverse complement motif Consensus sequence: GCTAATATATCCCTCCC |
Dataset #: | 1 |
Motif ID: | 332 |
Motif name: | Motif 332 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 10 |
Number of overlap: | 11 |
Similarity score: | 0.0654927 |
Original motif Consensus sequence: CTGGCCCTCAATGGTTAAAC | Reverse complement motif Consensus sequence: GTTTAACCATTGAGGGCCAG |
Dataset #: | 1 |
Motif ID: | 53 |
Motif name: | Motif 53 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 6 |
Number of overlap: | 11 |
Similarity score: | 0.0735725 |
Original motif Consensus sequence: GTCCCATCGACCACCCAAG | Reverse complement motif Consensus sequence: CTTGGGTGGTCGATGGGAC |
Dataset #: | 1 |
Motif ID: | 16 |
Motif name: | Motif 16 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 8 |
Number of overlap: | 11 |
Similarity score: | 0.0751839 |
Original motif Consensus sequence: GAAAGGGAACTCCCTGACCC | Reverse complement motif Consensus sequence: GGGTCAGGGAGTTCCCTTTC |
Dataset #: | 1 |
Motif ID: | 96 |
Motif name: | Motif 96 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 7 |
Number of overlap: | 11 |
Similarity score: | 0.0788665 |
Original motif Consensus sequence: AAGCTGAGGGAGCCGGCTCC | Reverse complement motif Consensus sequence: GGAGCCGGCTCCCTCAGCTT |
Dataset #: 1 | Motif ID: 209 | Motif name: Motif 209 |
Original motif Consensus sequence: CTGTCAGCCCAT | Reverse complement motif Consensus sequence: ATGGGCTGACAG |
Best Matches for Motif ID 209 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 284 |
Motif name: | Motif 284 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 12 |
Similarity score: | 0.0568336 |
Original motif Consensus sequence: CATTTGGGAGCCCATTGA | Reverse complement motif Consensus sequence: TCAATGGGCTCCCAAATG |
Dataset #: | 1 |
Motif ID: | 193 |
Motif name: | Motif 193 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 6 |
Number of overlap: | 12 |
Similarity score: | 0.0594073 |
Original motif Consensus sequence: ATACAATGGGGGTACAGRC | Reverse complement motif Consensus sequence: GKCTGTACCCCCATTGTAT |
Dataset #: | 1 |
Motif ID: | 306 |
Motif name: | Motif 306 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 12 |
Similarity score: | 0.0708524 |
Original motif Consensus sequence: GACATGAGCTGGCGCTTG | Reverse complement motif Consensus sequence: CAAGCGCCAGCTCATGTC |
Dataset #: | 1 |
Motif ID: | 4 |
Motif name: | Motif 4 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 12 |
Similarity score: | 0.071408 |
Original motif Consensus sequence: GCTGGGATTACAGG | Reverse complement motif Consensus sequence: CCTGTAATCCCAGC |
Dataset #: | 1 |
Motif ID: | 122 |
Motif name: | Motif 122 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 5 |
Number of overlap: | 12 |
Similarity score: | 0.0804186 |
Original motif Consensus sequence: CCTTGGCCAGCCCAGAAAG | Reverse complement motif Consensus sequence: CTTTCTGGGCTGGCCAAGG |
Dataset #: 1 | Motif ID: 210 | Motif name: Motif 210 |
Original motif Consensus sequence: CTCGGATGGTAA | Reverse complement motif Consensus sequence: TTACCATCCGAG |
Best Matches for Motif ID 210 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 25 |
Motif name: | Motif 25 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 12 |
Similarity score: | 0.0447432 |
Original motif Consensus sequence: CATTTCCAWCTGAGGTAC | Reverse complement motif Consensus sequence: GTACCTCAGWTGGAAATG |
Dataset #: | 1 |
Motif ID: | 82 |
Motif name: | Motif 82 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 12 |
Similarity score: | 0.0679752 |
Original motif Consensus sequence: GCTTAGCACCYGGGCCAGC | Reverse complement motif Consensus sequence: GCTGGCCCKGGTGCTAAGC |
Dataset #: | 1 |
Motif ID: | 53 |
Motif name: | Motif 53 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 8 |
Number of overlap: | 12 |
Similarity score: | 0.078255 |
Original motif Consensus sequence: GTCCCATCGACCACCCAAG | Reverse complement motif Consensus sequence: CTTGGGTGGTCGATGGGAC |
Dataset #: | 1 |
Motif ID: | 214 |
Motif name: | Motif 214 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 12 |
Similarity score: | 0.0812199 |
Original motif Consensus sequence: CTCAGGAATGGAAAACC | Reverse complement motif Consensus sequence: GGTTTTCCATTCCTGAG |
Dataset #: | 1 |
Motif ID: | 305 |
Motif name: | Motif 305 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 12 |
Similarity score: | 0.0825424 |
Original motif Consensus sequence: AATGACCAATTGAGAGC | Reverse complement motif Consensus sequence: GCTCTCAATTGGTCATT |
Dataset #: 1 | Motif ID: 211 | Motif name: Motif 211 |
Original motif Consensus sequence: GACTTCAAGAATGAAGCCG | Reverse complement motif Consensus sequence: CGGCTTCATTCTTGAAGTC |
Best Matches for Motif ID 211 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 144 |
Motif name: | Motif 144 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.0872886 |
Original motif Consensus sequence: CCGCTGCACTGTGGGAGCCC | Reverse complement motif Consensus sequence: GGGCTCCCACAGTGCAGCGG |
Dataset #: | 1 |
Motif ID: | 61 |
Motif name: | Motif 61 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.109235 |
Original motif Consensus sequence: GGATCCACTGGGTGAAGCCA | Reverse complement motif Consensus sequence: TGGCTTCACCCAGTGGATCC |
Dataset #: | 1 |
Motif ID: | 311 |
Motif name: | Motif 311 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.112192 |
Original motif Consensus sequence: GGCATCACGGATCCTACCAA | Reverse complement motif Consensus sequence: TTGGTAGGATCCGTGATGCC |
Dataset #: | 1 |
Motif ID: | 65 |
Motif name: | Motif 65 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.113323 |
Original motif Consensus sequence: AGAAATCGAGCRCAGCGCCG | Reverse complement motif Consensus sequence: CGGCGCTGMGCTCGATTTCT |
Dataset #: | 1 |
Motif ID: | 8 |
Motif name: | Motif 8 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.114911 |
Original motif Consensus sequence: ATCRCTTGAGSYCAGGAGKT | Reverse complement motif Consensus sequence: ARCTCCTGKSCTCAAGKGAT |
Dataset #: 1 | Motif ID: 212 | Motif name: Motif 212 |
Original motif Consensus sequence: TAGGGTAGTCAAR | Reverse complement motif Consensus sequence: MTTGACTACCCTA |
Best Matches for Motif ID 212 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 53 |
Motif name: | Motif 53 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 6 |
Number of overlap: | 13 |
Similarity score: | 0.0571978 |
Original motif Consensus sequence: GTCCCATCGACCACCCAAG | Reverse complement motif Consensus sequence: CTTGGGTGGTCGATGGGAC |
Dataset #: | 1 |
Motif ID: | 194 |
Motif name: | Motif 194 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 13 |
Similarity score: | 0.0722477 |
Original motif Consensus sequence: CAAGGGTATAYGAGTAGCTG | Reverse complement motif Consensus sequence: CAGCTACTCKTATACCCTTG |
Dataset #: | 1 |
Motif ID: | 184 |
Motif name: | Motif 184 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 13 |
Similarity score: | 0.0728242 |
Original motif Consensus sequence: ATATTGATGATCCTGACC | Reverse complement motif Consensus sequence: GGTCAGGATCATCAATAT |
Dataset #: | 1 |
Motif ID: | 308 |
Motif name: | Motif 308 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 13 |
Similarity score: | 0.0736225 |
Original motif Consensus sequence: AAATTAGGCCAATTAATAAC | Reverse complement motif Consensus sequence: GTTATTAATTGGCCTAATTT |
Dataset #: | 1 |
Motif ID: | 327 |
Motif name: | Motif 327 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 13 |
Similarity score: | 0.0737666 |
Original motif Consensus sequence: AGGAGGAAGTCAATTTC | Reverse complement motif Consensus sequence: GAAATTGACTTCCTCCT |
Dataset #: 1 | Motif ID: 213 | Motif name: Motif 213 |
Original motif Consensus sequence: AAYRGACTAATACA | Reverse complement motif Consensus sequence: TGTATTAGTCMMTT |
Best Matches for Motif ID 213 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 262 |
Motif name: | Motif 262 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 14 |
Similarity score: | 0.0676805 |
Original motif Consensus sequence: CTCAGTGTTAATCTCCTGTC | Reverse complement motif Consensus sequence: GACAGGAGATTAACACTGAG |
Dataset #: | 1 |
Motif ID: | 29 |
Motif name: | Motif 29 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 7 |
Number of overlap: | 14 |
Similarity score: | 0.0742206 |
Original motif Consensus sequence: CTGGGCRACAGAGYRAGACY | Reverse complement motif Consensus sequence: MGTCTMKCTCTGTKGCCCAG |
Dataset #: | 1 |
Motif ID: | 224 |
Motif name: | Motif 224 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 14 |
Similarity score: | 0.0749712 |
Original motif Consensus sequence: AATGAGTTAAGACTTTG | Reverse complement motif Consensus sequence: CAAAGTCTTAACTCATT |
Dataset #: | 1 |
Motif ID: | 356 |
Motif name: | Motif 356 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 14 |
Similarity score: | 0.0750949 |
Original motif Consensus sequence: AATTAAAAGACACAGACTG | Reverse complement motif Consensus sequence: CAGTCTGTGTCTTTTAATT |
Dataset #: | 1 |
Motif ID: | 234 |
Motif name: | Motif 234 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 7 |
Number of overlap: | 14 |
Similarity score: | 0.0758743 |
Original motif Consensus sequence: AAGGAACAAACTCCRGACAC | Reverse complement motif Consensus sequence: GTGTCKGGAGTTTGTTCCTT |
Dataset #: 1 | Motif ID: 214 | Motif name: Motif 214 |
Original motif Consensus sequence: CTCAGGAATGGAAAACC | Reverse complement motif Consensus sequence: GGTTTTCCATTCCTGAG |
Best Matches for Motif ID 214 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 7 |
Motif name: | Motif 7 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 17 |
Similarity score: | 0.10823 |
Original motif Consensus sequence: GTCTCWAMAAAAAAWAMAAA | Reverse complement motif Consensus sequence: TTTYTWTTTTTTYTWGAGAC |
Dataset #: | 1 |
Motif ID: | 291 |
Motif name: | Motif 291 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 17 |
Similarity score: | 0.109842 |
Original motif Consensus sequence: CTGAGGACCTGAGGTCRTA | Reverse complement motif Consensus sequence: TAMGACCTCAGGTCCTCAG |
Dataset #: | 1 |
Motif ID: | 262 |
Motif name: | Motif 262 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 17 |
Similarity score: | 0.110599 |
Original motif Consensus sequence: CTCAGTGTTAATCTCCTGTC | Reverse complement motif Consensus sequence: GACAGGAGATTAACACTGAG |
Dataset #: | 1 |
Motif ID: | 19 |
Motif name: | Motif 19 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 17 |
Similarity score: | 0.112077 |
Original motif Consensus sequence: CACCAGGAGATTATATCCCR | Reverse complement motif Consensus sequence: MGGGATATAATCTCCTGGTG |
Dataset #: | 1 |
Motif ID: | 332 |
Motif name: | Motif 332 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 17 |
Similarity score: | 0.112221 |
Original motif Consensus sequence: CTGGCCCTCAATGGTTAAAC | Reverse complement motif Consensus sequence: GTTTAACCATTGAGGGCCAG |
Dataset #: 1 | Motif ID: 215 | Motif name: Motif 215 |
Original motif Consensus sequence: HGCTCCTGTGSKCCC | Reverse complement motif Consensus sequence: GGGRSCACAGGAGCD |
Best Matches for Motif ID 215 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 8 |
Motif name: | Motif 8 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 6 |
Number of overlap: | 15 |
Similarity score: | 0.0619315 |
Original motif Consensus sequence: ATCRCTTGAGSYCAGGAGKT | Reverse complement motif Consensus sequence: ARCTCCTGKSCTCAAGKGAT |
Dataset #: | 1 |
Motif ID: | 84 |
Motif name: | Motif 84 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 15 |
Similarity score: | 0.0736896 |
Original motif Consensus sequence: CTGGGTCCCCCAGCAGTGCC | Reverse complement motif Consensus sequence: GGCACTGCTGGGGGACCCAG |
Dataset #: | 1 |
Motif ID: | 3 |
Motif name: | Motif 3 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 15 |
Similarity score: | 0.0753884 |
Original motif Consensus sequence: GCTGGAGTGCAGTGGCRYGA | Reverse complement motif Consensus sequence: TCKMGCCACTGCACTCCAGC |
Dataset #: | 1 |
Motif ID: | 115 |
Motif name: | Motif 115 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 15 |
Similarity score: | 0.0800012 |
Original motif Consensus sequence: ATGATCCAGCAATYCCACTH | Reverse complement motif Consensus sequence: HAGTGGKATTGCTGGATCAT |
Dataset #: | 1 |
Motif ID: | 179 |
Motif name: | Motif 179 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 15 |
Similarity score: | 0.0803784 |
Original motif Consensus sequence: AGGTCCTTCAGGAGGTATTC | Reverse complement motif Consensus sequence: GAATACCTCCTGAAGGACCT |
Dataset #: 1 | Motif ID: 216 | Motif name: Motif 216 |
Original motif Consensus sequence: CAGAAATCACC | Reverse complement motif Consensus sequence: GGTGATTTCTG |
Best Matches for Motif ID 216 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 35 |
Motif name: | Motif 35 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 7 |
Number of overlap: | 11 |
Similarity score: | 0.0137887 |
Original motif Consensus sequence: CAGAAATCACCCGTCTT | Reverse complement motif Consensus sequence: AAGACGGGTGATTTCTG |
Dataset #: | 1 |
Motif ID: | 261 |
Motif name: | Motif 261 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 11 |
Similarity score: | 0.0239476 |
Original motif Consensus sequence: ATCTCASAAATCACCACTA | Reverse complement motif Consensus sequence: TAGTGGTGATTTSTGAGAT |
Dataset #: | 1 |
Motif ID: | 336 |
Motif name: | Motif 336 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 11 |
Similarity score: | 0.0684419 |
Original motif Consensus sequence: ATGTAACCAAAYACCACCTG | Reverse complement motif Consensus sequence: CAGGTGGTKTTTGGTTACAT |
Dataset #: | 1 |
Motif ID: | 115 |
Motif name: | Motif 115 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 7 |
Number of overlap: | 11 |
Similarity score: | 0.0740976 |
Original motif Consensus sequence: ATGATCCAGCAATYCCACTH | Reverse complement motif Consensus sequence: HAGTGGKATTGCTGGATCAT |
Dataset #: | 1 |
Motif ID: | 279 |
Motif name: | Motif 279 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 11 |
Similarity score: | 0.0743914 |
Original motif Consensus sequence: GGGGGAGACATCACACR | Reverse complement motif Consensus sequence: MGTGTGATGTCTCCCCC |
Dataset #: 1 | Motif ID: 217 | Motif name: Motif 217 |
Original motif Consensus sequence: CCCTACTGTTCTCY | Reverse complement motif Consensus sequence: KGAGAACAGTAGGG |
Best Matches for Motif ID 217 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 63 |
Motif name: | Motif 63 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 14 |
Similarity score: | 0.0624984 |
Original motif Consensus sequence: AGTGAGAACATRYRRTRTTT | Reverse complement motif Consensus sequence: AAAMAMMKMATGTTCTCACT |
Dataset #: | 1 |
Motif ID: | 242 |
Motif name: | Motif 242 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 14 |
Similarity score: | 0.070491 |
Original motif Consensus sequence: AACCCTATTGTGAACTGYG | Reverse complement motif Consensus sequence: CMCAGTTCACAATAGGGTT |
Dataset #: | 1 |
Motif ID: | 85 |
Motif name: | Motif 85 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 14 |
Similarity score: | 0.073742 |
Original motif Consensus sequence: CTAGACATAAAGGTTCTCCA | Reverse complement motif Consensus sequence: TGGAGAACCTTTATGTCTAG |
Dataset #: | 1 |
Motif ID: | 3 |
Motif name: | Motif 3 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 14 |
Similarity score: | 0.0746812 |
Original motif Consensus sequence: GCTGGAGTGCAGTGGCRYGA | Reverse complement motif Consensus sequence: TCKMGCCACTGCACTCCAGC |
Dataset #: | 1 |
Motif ID: | 105 |
Motif name: | Motif 105 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 14 |
Similarity score: | 0.0768892 |
Original motif Consensus sequence: GCCTCTCCCTCCACACCTCC | Reverse complement motif Consensus sequence: GGAGGTGTGGAGGGAGAGGC |
Dataset #: 1 | Motif ID: 218 | Motif name: Motif 218 |
Original motif Consensus sequence: AAGTWACTT | Reverse complement motif Consensus sequence: AAGTWACTT |
Best Matches for Motif ID 218 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 327 |
Motif name: | Motif 327 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 7 |
Number of overlap: | 9 |
Similarity score: | 0.0387296 |
Original motif Consensus sequence: AGGAGGAAGTCAATTTC | Reverse complement motif Consensus sequence: GAAATTGACTTCCTCCT |
Dataset #: | 1 |
Motif ID: | 231 |
Motif name: | Motif 231 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 8 |
Number of overlap: | 9 |
Similarity score: | 0.0394637 |
Original motif Consensus sequence: ACAAGGCAAGTCCCTTCY | Reverse complement motif Consensus sequence: MGAAGGGACTTGCCTTGT |
Dataset #: | 1 |
Motif ID: | 316 |
Motif name: | Motif 316 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 9 |
Similarity score: | 0.0489965 |
Original motif Consensus sequence: CGGAAGTGACGT | Reverse complement motif Consensus sequence: ACGTCACTTCCG |
Dataset #: | 1 |
Motif ID: | 213 |
Motif name: | Motif 213 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 6 |
Number of overlap: | 9 |
Similarity score: | 0.0574127 |
Original motif Consensus sequence: AAYRGACTAATACA | Reverse complement motif Consensus sequence: TGTATTAGTCMMTT |
Dataset #: | 1 |
Motif ID: | 166 |
Motif name: | Motif 166 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 9 |
Similarity score: | 0.0685527 |
Original motif Consensus sequence: AAGGGACATTKGAG | Reverse complement motif Consensus sequence: CTCRAATGTCCCTT |
Dataset #: 1 | Motif ID: 219 | Motif name: Motif 219 |
Original motif Consensus sequence: CTGCAGCCTC | Reverse complement motif Consensus sequence: GAGGCTGCAG |
Best Matches for Motif ID 219 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 68 |
Motif name: | Motif 68 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 10 |
Similarity score: | 0.0362773 |
Original motif Consensus sequence: CATGGCGGGCTGCAGGTC | Reverse complement motif Consensus sequence: GACCTGCAGCCCGCCATG |
Dataset #: | 1 |
Motif ID: | 220 |
Motif name: | Motif 220 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 10 |
Similarity score: | 0.0471481 |
Original motif Consensus sequence: TGCACTGCACCCAC | Reverse complement motif Consensus sequence: GTGGGTGCAGTGCA |
Dataset #: | 1 |
Motif ID: | 320 |
Motif name: | Motif 320 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 10 |
Similarity score: | 0.0475708 |
Original motif Consensus sequence: CATCTGGAGCCCCA | Reverse complement motif Consensus sequence: TGGGGCTCCAGATG |
Dataset #: | 1 |
Motif ID: | 191 |
Motif name: | Motif 191 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 10 |
Similarity score: | 0.049186 |
Original motif Consensus sequence: AAAGTGCCGAGAKTGCAGC | Reverse complement motif Consensus sequence: GCTGCARTCTCGGCACTTT |
Dataset #: | 1 |
Motif ID: | 313 |
Motif name: | Motif 313 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 5 |
Number of overlap: | 10 |
Similarity score: | 0.0535162 |
Original motif Consensus sequence: CTCCTGCCTCAGCY | Reverse complement motif Consensus sequence: MGCTGAGGCAGGAG |
Dataset #: 1 | Motif ID: 220 | Motif name: Motif 220 |
Original motif Consensus sequence: TGCACTGCACCCAC | Reverse complement motif Consensus sequence: GTGGGTGCAGTGCA |
Best Matches for Motif ID 220 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 17 |
Motif name: | Motif 17 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 14 |
Similarity score: | 0.0478061 |
Original motif Consensus sequence: AGACAGTGGGYGCAGGHCA | Reverse complement motif Consensus sequence: TGHCCTGCKCCCACTGTCT |
Dataset #: | 1 |
Motif ID: | 289 |
Motif name: | Motif 289 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 14 |
Similarity score: | 0.0840846 |
Original motif Consensus sequence: TGATGGGTGCACCAAA | Reverse complement motif Consensus sequence: TTTGGTGCACCCATCA |
Dataset #: | 1 |
Motif ID: | 6 |
Motif name: | Motif 6 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 14 |
Similarity score: | 0.0843879 |
Original motif Consensus sequence: GCTCACTGCAASCTC | Reverse complement motif Consensus sequence: GAGSTTGCAGTGAGC |
Dataset #: | 1 |
Motif ID: | 3 |
Motif name: | Motif 3 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 14 |
Similarity score: | 0.0884996 |
Original motif Consensus sequence: GCTGGAGTGCAGTGGCRYGA | Reverse complement motif Consensus sequence: TCKMGCCACTGCACTCCAGC |
Dataset #: | 1 |
Motif ID: | 350 |
Motif name: | Motif 350 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 14 |
Similarity score: | 0.0914277 |
Original motif Consensus sequence: TCTGGAGTGGACCTCCAGCA | Reverse complement motif Consensus sequence: TGCTGGAGGTCCACTCCAGA |
Dataset #: 1 | Motif ID: 221 | Motif name: Motif 221 |
Original motif Consensus sequence: GGGAGGAAGGGGACAC | Reverse complement motif Consensus sequence: GTGTCCCCTTCCTCCC |
Best Matches for Motif ID 221 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 294 |
Motif name: | Motif 294 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 5 |
Number of overlap: | 16 |
Similarity score: | 0.0830942 |
Original motif Consensus sequence: AGCTGTGAGAAGAGGGCCAC | Reverse complement motif Consensus sequence: GTGGCCCTCTTCTCACAGCT |
Dataset #: | 1 |
Motif ID: | 178 |
Motif name: | Motif 178 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 16 |
Similarity score: | 0.0878739 |
Original motif Consensus sequence: ACTGTCTTCCACCTCCACAT | Reverse complement motif Consensus sequence: ATGTGGAGGTGGAAGACAGT |
Dataset #: | 1 |
Motif ID: | 214 |
Motif name: | Motif 214 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 16 |
Similarity score: | 0.0907477 |
Original motif Consensus sequence: CTCAGGAATGGAAAACC | Reverse complement motif Consensus sequence: GGTTTTCCATTCCTGAG |
Dataset #: | 1 |
Motif ID: | 105 |
Motif name: | Motif 105 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 16 |
Similarity score: | 0.090827 |
Original motif Consensus sequence: GCCTCTCCCTCCACACCTCC | Reverse complement motif Consensus sequence: GGAGGTGTGGAGGGAGAGGC |
Dataset #: | 1 |
Motif ID: | 14 |
Motif name: | Motif 14 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 16 |
Similarity score: | 0.0917203 |
Original motif Consensus sequence: ACCTGGAAAATCGGGTCACT | Reverse complement motif Consensus sequence: AGTGACCCGATTTTCCAGGT |
Dataset #: 1 | Motif ID: 222 | Motif name: Motif 222 |
Original motif Consensus sequence: CGAGATCACGCCA | Reverse complement motif Consensus sequence: TGGCGTGATCTCG |
Best Matches for Motif ID 222 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 61 |
Motif name: | Motif 61 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 8 |
Number of overlap: | 13 |
Similarity score: | 0.0800547 |
Original motif Consensus sequence: GGATCCACTGGGTGAAGCCA | Reverse complement motif Consensus sequence: TGGCTTCACCCAGTGGATCC |
Dataset #: | 1 |
Motif ID: | 99 |
Motif name: | Motif 99 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 13 |
Similarity score: | 0.0816199 |
Original motif Consensus sequence: GCAAAKGACATGATYTCATT | Reverse complement motif Consensus sequence: AATGAKATCATGTCYTTTGC |
Dataset #: | 1 |
Motif ID: | 68 |
Motif name: | Motif 68 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 13 |
Similarity score: | 0.0858328 |
Original motif Consensus sequence: CATGGCGGGCTGCAGGTC | Reverse complement motif Consensus sequence: GACCTGCAGCCCGCCATG |
Dataset #: | 1 |
Motif ID: | 3 |
Motif name: | Motif 3 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 6 |
Number of overlap: | 13 |
Similarity score: | 0.0874221 |
Original motif Consensus sequence: GCTGGAGTGCAGTGGCRYGA | Reverse complement motif Consensus sequence: TCKMGCCACTGCACTCCAGC |
Dataset #: | 1 |
Motif ID: | 35 |
Motif name: | Motif 35 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 13 |
Similarity score: | 0.0876684 |
Original motif Consensus sequence: CAGAAATCACCCGTCTT | Reverse complement motif Consensus sequence: AAGACGGGTGATTTCTG |
Dataset #: 1 | Motif ID: 223 | Motif name: Motif 223 |
Original motif Consensus sequence: AGCCTCCYGAGTA | Reverse complement motif Consensus sequence: TACTCMGGAGGCT |
Best Matches for Motif ID 223 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 232 |
Motif name: | Motif 232 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 13 |
Similarity score: | 0.0672113 |
Original motif Consensus sequence: AGTTGTAATTGGGAGACTT | Reverse complement motif Consensus sequence: AAGTCTCCCAATTACAACT |
Dataset #: | 1 |
Motif ID: | 67 |
Motif name: | Motif 67 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 6 |
Number of overlap: | 13 |
Similarity score: | 0.075298 |
Original motif Consensus sequence: CTGGGCTCCTGAGTCTGGTG | Reverse complement motif Consensus sequence: CACCAGACTCAGGAGCCCAG |
Dataset #: | 1 |
Motif ID: | 15 |
Motif name: | Motif 15 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 13 |
Similarity score: | 0.0838744 |
Original motif Consensus sequence: CTTGCGCTTCCCRRGTGA | Reverse complement motif Consensus sequence: TCACKMGGGAAGCGCAAG |
Dataset #: | 1 |
Motif ID: | 239 |
Motif name: | Motif 239 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 13 |
Similarity score: | 0.0898433 |
Original motif Consensus sequence: AGCCTCCAGAACTGT | Reverse complement motif Consensus sequence: ACAGTTCTGGAGGCT |
Dataset #: | 1 |
Motif ID: | 108 |
Motif name: | Motif 108 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 13 |
Similarity score: | 0.0907206 |
Original motif Consensus sequence: CGAGCCTCCCCGAYGAGCGC | Reverse complement motif Consensus sequence: GCGCTCKTCGGGGAGGCTCG |
Dataset #: 1 | Motif ID: 224 | Motif name: Motif 224 |
Original motif Consensus sequence: AATGAGTTAAGACTTTG | Reverse complement motif Consensus sequence: CAAAGTCTTAACTCATT |
Best Matches for Motif ID 224 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 190 |
Motif name: | Motif 190 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 17 |
Similarity score: | 0.10346 |
Original motif Consensus sequence: CAAAGGCATAAGAATGAT | Reverse complement motif Consensus sequence: ATCATTCTTATGCCTTTG |
Dataset #: | 1 |
Motif ID: | 129 |
Motif name: | Motif 129 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 17 |
Similarity score: | 0.103511 |
Original motif Consensus sequence: AAGAGGTTTAATTGRCTCA | Reverse complement motif Consensus sequence: TGAGKCAATTAAACCTCTT |
Dataset #: | 1 |
Motif ID: | 64 |
Motif name: | Motif 64 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 17 |
Similarity score: | 0.105466 |
Original motif Consensus sequence: GAAGGCAGCTAAGGCCCGGY | Reverse complement motif Consensus sequence: KCCGGGCCTTAGCTGCCTTC |
Dataset #: | 1 |
Motif ID: | 63 |
Motif name: | Motif 63 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 17 |
Similarity score: | 0.107183 |
Original motif Consensus sequence: AGTGAGAACATRYRRTRTTT | Reverse complement motif Consensus sequence: AAAMAMMKMATGTTCTCACT |
Dataset #: | 1 |
Motif ID: | 262 |
Motif name: | Motif 262 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 17 |
Similarity score: | 0.107753 |
Original motif Consensus sequence: CTCAGTGTTAATCTCCTGTC | Reverse complement motif Consensus sequence: GACAGGAGATTAACACTGAG |
Dataset #: 1 | Motif ID: 225 | Motif name: Motif 225 |
Original motif Consensus sequence: GCACATGTAYCCYAGAACTT | Reverse complement motif Consensus sequence: AAGTTCTKGGKTACATGTGC |
Best Matches for Motif ID 225 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 83 |
Motif name: | Motif 83 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.113312 |
Original motif Consensus sequence: AAAATGTGGTAYATAYAYAC | Reverse complement motif Consensus sequence: GTKTMTATMTACCACATTTT |
Dataset #: | 1 |
Motif ID: | 179 |
Motif name: | Motif 179 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.118212 |
Original motif Consensus sequence: AGGTCCTTCAGGAGGTATTC | Reverse complement motif Consensus sequence: GAATACCTCCTGAAGGACCT |
Dataset #: | 1 |
Motif ID: | 96 |
Motif name: | Motif 96 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.120502 |
Original motif Consensus sequence: AAGCTGAGGGAGCCGGCTCC | Reverse complement motif Consensus sequence: GGAGCCGGCTCCCTCAGCTT |
Dataset #: | 1 |
Motif ID: | 201 |
Motif name: | Motif 201 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.123085 |
Original motif Consensus sequence: GTAACACTCACCGCGARGGT | Reverse complement motif Consensus sequence: ACCKTCGCGGTGAGTGTTAC |
Dataset #: | 1 |
Motif ID: | 13 |
Motif name: | Motif 13 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.125642 |
Original motif Consensus sequence: AAGCAGGGCGAGGCATTGCC | Reverse complement motif Consensus sequence: GGCAATGCCTCGCCCTGCTT |
Dataset #: 1 | Motif ID: 226 | Motif name: Motif 226 |
Original motif Consensus sequence: AATAAACATGG | Reverse complement motif Consensus sequence: CCATGTTTATT |
Best Matches for Motif ID 226 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 270 |
Motif name: | Motif 270 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 11 |
Similarity score: | 0.0612696 |
Original motif Consensus sequence: CCATGATTGTRAGG | Reverse complement motif Consensus sequence: CCTMACAATCATGG |
Dataset #: | 1 |
Motif ID: | 252 |
Motif name: | Motif 252 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 11 |
Similarity score: | 0.0671681 |
Original motif Consensus sequence: AATTAGCYRGG | Reverse complement motif Consensus sequence: CCMKGCTAATT |
Dataset #: | 1 |
Motif ID: | 257 |
Motif name: | Motif 257 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 11 |
Similarity score: | 0.0686983 |
Original motif Consensus sequence: GAGAACACATGGACA | Reverse complement motif Consensus sequence: TGTCCATGTGTTCTC |
Dataset #: | 1 |
Motif ID: | 303 |
Motif name: | Motif 303 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 11 |
Similarity score: | 0.0776401 |
Original motif Consensus sequence: AGTTCTTAAAGATGGT | Reverse complement motif Consensus sequence: ACCATCTTTAAGAACT |
Dataset #: | 1 |
Motif ID: | 129 |
Motif name: | Motif 129 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 8 |
Number of overlap: | 11 |
Similarity score: | 0.0862085 |
Original motif Consensus sequence: AAGAGGTTTAATTGRCTCA | Reverse complement motif Consensus sequence: TGAGKCAATTAAACCTCTT |
Dataset #: 1 | Motif ID: 227 | Motif name: Motif 227 |
Original motif Consensus sequence: CCCAAATCTCATSTTGAAT | Reverse complement motif Consensus sequence: ATTCAASATGAGATTTGGG |
Best Matches for Motif ID 227 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 170 |
Motif name: | Motif 170 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.103606 |
Original motif Consensus sequence: AATCAACCCTGGYRATCAAT | Reverse complement motif Consensus sequence: ATTGATMKCCAGGGTTGATT |
Dataset #: | 1 |
Motif ID: | 280 |
Motif name: | Motif 280 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.107017 |
Original motif Consensus sequence: CCTAGATTTCAGARGATGT | Reverse complement motif Consensus sequence: ACATCMTCTGAAATCTAGG |
Dataset #: | 1 |
Motif ID: | 242 |
Motif name: | Motif 242 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.108656 |
Original motif Consensus sequence: AACCCTATTGTGAACTGYG | Reverse complement motif Consensus sequence: CMCAGTTCACAATAGGGTT |
Dataset #: | 1 |
Motif ID: | 177 |
Motif name: | Motif 177 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.10976 |
Original motif Consensus sequence: CCCGAAGCTGCRYRCTCGGT | Reverse complement motif Consensus sequence: ACCGAGMKMGCAGCTTCGGG |
Dataset #: | 1 |
Motif ID: | 235 |
Motif name: | Motif 235 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.110263 |
Original motif Consensus sequence: TCCAAATGGGAGAAATTGGC | Reverse complement motif Consensus sequence: GCCAATTTCTCCCATTTGGA |
Dataset #: 1 | Motif ID: 228 | Motif name: Motif 228 |
Original motif Consensus sequence: AGCTACTTG | Reverse complement motif Consensus sequence: CAAGTAGCT |
Best Matches for Motif ID 228 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 194 |
Motif name: | Motif 194 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 11 |
Number of overlap: | 9 |
Similarity score: | 0.0385506 |
Original motif Consensus sequence: CAAGGGTATAYGAGTAGCTG | Reverse complement motif Consensus sequence: CAGCTACTCKTATACCCTTG |
Dataset #: | 1 |
Motif ID: | 231 |
Motif name: | Motif 231 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 9 |
Similarity score: | 0.0563554 |
Original motif Consensus sequence: ACAAGGCAAGTCCCTTCY | Reverse complement motif Consensus sequence: MGAAGGGACTTGCCTTGT |
Dataset #: | 1 |
Motif ID: | 52 |
Motif name: | Motif 52 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 7 |
Number of overlap: | 9 |
Similarity score: | 0.0620324 |
Original motif Consensus sequence: GACTGGCAGGCAGCTCCACC | Reverse complement motif Consensus sequence: GGTGGAGCTGCCTGCCAGTC |
Dataset #: | 1 |
Motif ID: | 269 |
Motif name: | Motif 269 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 9 |
Similarity score: | 0.0633451 |
Original motif Consensus sequence: AGCGACATGTGC | Reverse complement motif Consensus sequence: GCACATGTCGCT |
Dataset #: | 1 |
Motif ID: | 304 |
Motif name: | Motif 304 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 9 |
Number of overlap: | 9 |
Similarity score: | 0.0713836 |
Original motif Consensus sequence: AGTGTTTCCAAMCTGCT | Reverse complement motif Consensus sequence: AGCAGYTTGGAAACACT |
Dataset #: 1 | Motif ID: 229 | Motif name: Motif 229 |
Original motif Consensus sequence: GCCTTGCTGCCGC | Reverse complement motif Consensus sequence: GCGGCAGCAAGGC |
Best Matches for Motif ID 229 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 247 |
Motif name: | Motif 247 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 13 |
Similarity score: | 0.0380597 |
Original motif Consensus sequence: GCCTCACTGCCRC | Reverse complement motif Consensus sequence: GKGGCAGTGAGGC |
Dataset #: | 1 |
Motif ID: | 149 |
Motif name: | Motif 149 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 6 |
Number of overlap: | 13 |
Similarity score: | 0.0728792 |
Original motif Consensus sequence: ACTCAGCCCRCCTGCACCC | Reverse complement motif Consensus sequence: GGGTGCAGGMGGGCTGAGT |
Dataset #: | 1 |
Motif ID: | 17 |
Motif name: | Motif 17 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 6 |
Number of overlap: | 13 |
Similarity score: | 0.0799361 |
Original motif Consensus sequence: AGACAGTGGGYGCAGGHCA | Reverse complement motif Consensus sequence: TGHCCTGCKCCCACTGTCT |
Dataset #: | 1 |
Motif ID: | 164 |
Motif name: | Motif 164 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 5 |
Number of overlap: | 13 |
Similarity score: | 0.0833059 |
Original motif Consensus sequence: AGCCCCGGTTCCCGCYCGC | Reverse complement motif Consensus sequence: GCGMGCGGGAACCGGGGCT |
Dataset #: | 1 |
Motif ID: | 64 |
Motif name: | Motif 64 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 13 |
Similarity score: | 0.0835602 |
Original motif Consensus sequence: GAAGGCAGCTAAGGCCCGGY | Reverse complement motif Consensus sequence: KCCGGGCCTTAGCTGCCTTC |
Dataset #: 1 | Motif ID: 230 | Motif name: Motif 230 |
Original motif Consensus sequence: AGAAAGGCATGTGAAAA | Reverse complement motif Consensus sequence: TTTTCACATGCCTTTCT |
Best Matches for Motif ID 230 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 254 |
Motif name: | Motif 254 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 17 |
Similarity score: | 0.093628 |
Original motif Consensus sequence: AAAATCACAAGCATTCCTAT | Reverse complement motif Consensus sequence: ATAGGAATGCTTGTGATTTT |
Dataset #: | 1 |
Motif ID: | 12 |
Motif name: | Motif 12 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 17 |
Similarity score: | 0.102426 |
Original motif Consensus sequence: AGACCAGCCTGGCCAAC | Reverse complement motif Consensus sequence: GTTGGCCAGGCTGGTCT |
Dataset #: | 1 |
Motif ID: | 290 |
Motif name: | Motif 290 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 17 |
Similarity score: | 0.110581 |
Original motif Consensus sequence: TGATACCCAGGCAAACAG | Reverse complement motif Consensus sequence: CTGTTTGCCTGGGTATCA |
Dataset #: | 1 |
Motif ID: | 308 |
Motif name: | Motif 308 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 17 |
Similarity score: | 0.11099 |
Original motif Consensus sequence: AAATTAGGCCAATTAATAAC | Reverse complement motif Consensus sequence: GTTATTAATTGGCCTAATTT |
Dataset #: | 1 |
Motif ID: | 63 |
Motif name: | Motif 63 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 17 |
Similarity score: | 0.111345 |
Original motif Consensus sequence: AGTGAGAACATRYRRTRTTT | Reverse complement motif Consensus sequence: AAAMAMMKMATGTTCTCACT |
Dataset #: 1 | Motif ID: 231 | Motif name: Motif 231 |
Original motif Consensus sequence: ACAAGGCAAGTCCCTTCY | Reverse complement motif Consensus sequence: MGAAGGGACTTGCCTTGT |
Best Matches for Motif ID 231 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 16 |
Motif name: | Motif 16 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 18 |
Similarity score: | 0.0860131 |
Original motif Consensus sequence: GAAAGGGAACTCCCTGACCC | Reverse complement motif Consensus sequence: GGGTCAGGGAGTTCCCTTTC |
Dataset #: | 1 |
Motif ID: | 310 |
Motif name: | Motif 310 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 18 |
Similarity score: | 0.0932717 |
Original motif Consensus sequence: CCCATGCAAGTCYRAAATCC | Reverse complement motif Consensus sequence: GGATTTMKGACTTGCATGGG |
Dataset #: | 1 |
Motif ID: | 13 |
Motif name: | Motif 13 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 18 |
Similarity score: | 0.0987599 |
Original motif Consensus sequence: AAGCAGGGCGAGGCATTGCC | Reverse complement motif Consensus sequence: GGCAATGCCTCGCCCTGCTT |
Dataset #: | 1 |
Motif ID: | 14 |
Motif name: | Motif 14 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 18 |
Similarity score: | 0.103588 |
Original motif Consensus sequence: ACCTGGAAAATCGGGTCACT | Reverse complement motif Consensus sequence: AGTGACCCGATTTTCCAGGT |
Dataset #: | 1 |
Motif ID: | 63 |
Motif name: | Motif 63 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 18 |
Similarity score: | 0.103835 |
Original motif Consensus sequence: AGTGAGAACATRYRRTRTTT | Reverse complement motif Consensus sequence: AAAMAMMKMATGTTCTCACT |
Dataset #: 1 | Motif ID: 232 | Motif name: Motif 232 |
Original motif Consensus sequence: AGTTGTAATTGGGAGACTT | Reverse complement motif Consensus sequence: AAGTCTCCCAATTACAACT |
Best Matches for Motif ID 232 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 336 |
Motif name: | Motif 336 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.0998938 |
Original motif Consensus sequence: ATGTAACCAAAYACCACCTG | Reverse complement motif Consensus sequence: CAGGTGGTKTTTGGTTACAT |
Dataset #: | 1 |
Motif ID: | 178 |
Motif name: | Motif 178 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.102119 |
Original motif Consensus sequence: ACTGTCTTCCACCTCCACAT | Reverse complement motif Consensus sequence: ATGTGGAGGTGGAAGACAGT |
Dataset #: | 1 |
Motif ID: | 308 |
Motif name: | Motif 308 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.103158 |
Original motif Consensus sequence: AAATTAGGCCAATTAATAAC | Reverse complement motif Consensus sequence: GTTATTAATTGGCCTAATTT |
Dataset #: | 1 |
Motif ID: | 321 |
Motif name: | Motif 321 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.107769 |
Original motif Consensus sequence: AAGCTCGAACTGGGTGGAGC | Reverse complement motif Consensus sequence: GCTCCACCCAGTTCGAGCTT |
Dataset #: | 1 |
Motif ID: | 160 |
Motif name: | Motif 160 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.109016 |
Original motif Consensus sequence: AAATTACCCAGTCTCAGGTA | Reverse complement motif Consensus sequence: TACCTGAGACTGGGTAATTT |
Dataset #: 1 | Motif ID: 233 | Motif name: Motif 233 |
Original motif Consensus sequence: GTTAACTGTAAAACAGCCT | Reverse complement motif Consensus sequence: AGGCTGTTTTACAGTTAAC |
Best Matches for Motif ID 233 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 137 |
Motif name: | Motif 137 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.105595 |
Original motif Consensus sequence: AGGTTTGTTACATAGGTAWA | Reverse complement motif Consensus sequence: TWTACCTATGTAACAAACCT |
Dataset #: | 1 |
Motif ID: | 55 |
Motif name: | Motif 55 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.106073 |
Original motif Consensus sequence: ATGGAATAYTATTCAGCCAT | Reverse complement motif Consensus sequence: ATGGCTGAATAKTATTCCAT |
Dataset #: | 1 |
Motif ID: | 139 |
Motif name: | Motif 139 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.109762 |
Original motif Consensus sequence: AGCCYCTGGYAACCAYYAWT | Reverse complement motif Consensus sequence: AWTKKTGGTTKCCAGKGGCT |
Dataset #: | 1 |
Motif ID: | 179 |
Motif name: | Motif 179 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.115112 |
Original motif Consensus sequence: AGGTCCTTCAGGAGGTATTC | Reverse complement motif Consensus sequence: GAATACCTCCTGAAGGACCT |
Dataset #: | 1 |
Motif ID: | 62 |
Motif name: | Motif 62 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.116079 |
Original motif Consensus sequence: AGGAACAGCTCCRGTCTAC | Reverse complement motif Consensus sequence: GTAGACKGGAGCTGTTCCT |
Dataset #: 1 | Motif ID: 234 | Motif name: Motif 234 |
Original motif Consensus sequence: AAGGAACAAACTCCRGACAC | Reverse complement motif Consensus sequence: GTGTCKGGAGTTTGTTCCTT |
Best Matches for Motif ID 234 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 55 |
Motif name: | Motif 55 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.0933537 |
Original motif Consensus sequence: ATGGAATAYTATTCAGCCAT | Reverse complement motif Consensus sequence: ATGGCTGAATAKTATTCCAT |
Dataset #: | 1 |
Motif ID: | 333 |
Motif name: | Motif 333 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.117565 |
Original motif Consensus sequence: TAGATAATAGCTCCAGCTTT | Reverse complement motif Consensus sequence: AAAGCTGGAGCTATTATCTA |
Dataset #: | 1 |
Motif ID: | 336 |
Motif name: | Motif 336 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.120219 |
Original motif Consensus sequence: ATGTAACCAAAYACCACCTG | Reverse complement motif Consensus sequence: CAGGTGGTKTTTGGTTACAT |
Dataset #: | 1 |
Motif ID: | 309 |
Motif name: | Motif 309 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.120596 |
Original motif Consensus sequence: CATTCTGGGGTCTGGAGGAY | Reverse complement motif Consensus sequence: MTCCTCCAGACCCCAGAATG |
Dataset #: | 1 |
Motif ID: | 16 |
Motif name: | Motif 16 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.126322 |
Original motif Consensus sequence: GAAAGGGAACTCCCTGACCC | Reverse complement motif Consensus sequence: GGGTCAGGGAGTTCCCTTTC |
Dataset #: 1 | Motif ID: 235 | Motif name: Motif 235 |
Original motif Consensus sequence: TCCAAATGGGAGAAATTGGC | Reverse complement motif Consensus sequence: GCCAATTTCTCCCATTTGGA |
Best Matches for Motif ID 235 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 13 |
Motif name: | Motif 13 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.119043 |
Original motif Consensus sequence: AAGCAGGGCGAGGCATTGCC | Reverse complement motif Consensus sequence: GGCAATGCCTCGCCCTGCTT |
Dataset #: | 1 |
Motif ID: | 155 |
Motif name: | Motif 155 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.121347 |
Original motif Consensus sequence: TCCCTCCCGGACGGGGYGGC | Reverse complement motif Consensus sequence: GCCKCCCCGTCCGGGAGGGA |
Dataset #: | 1 |
Motif ID: | 177 |
Motif name: | Motif 177 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.123305 |
Original motif Consensus sequence: CCCGAAGCTGCRYRCTCGGT | Reverse complement motif Consensus sequence: ACCGAGMKMGCAGCTTCGGG |
Dataset #: | 1 |
Motif ID: | 83 |
Motif name: | Motif 83 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.126931 |
Original motif Consensus sequence: AAAATGTGGTAYATAYAYAC | Reverse complement motif Consensus sequence: GTKTMTATMTACCACATTTT |
Dataset #: | 1 |
Motif ID: | 225 |
Motif name: | Motif 225 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.127095 |
Original motif Consensus sequence: GCACATGTAYCCYAGAACTT | Reverse complement motif Consensus sequence: AAGTTCTKGGKTACATGTGC |
Dataset #: 1 | Motif ID: 236 | Motif name: Motif 236 |
Original motif Consensus sequence: ATCTGAGGTACCG | Reverse complement motif Consensus sequence: CGGTACCTCAGAT |
Best Matches for Motif ID 236 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 96 |
Motif name: | Motif 96 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 7 |
Number of overlap: | 13 |
Similarity score: | 0.072129 |
Original motif Consensus sequence: AAGCTGAGGGAGCCGGCTCC | Reverse complement motif Consensus sequence: GGAGCCGGCTCCCTCAGCTT |
Dataset #: | 1 |
Motif ID: | 320 |
Motif name: | Motif 320 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 13 |
Similarity score: | 0.0813404 |
Original motif Consensus sequence: CATCTGGAGCCCCA | Reverse complement motif Consensus sequence: TGGGGCTCCAGATG |
Dataset #: | 1 |
Motif ID: | 291 |
Motif name: | Motif 291 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 13 |
Similarity score: | 0.0882611 |
Original motif Consensus sequence: CTGAGGACCTGAGGTCRTA | Reverse complement motif Consensus sequence: TAMGACCTCAGGTCCTCAG |
Dataset #: | 1 |
Motif ID: | 187 |
Motif name: | Motif 187 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 13 |
Similarity score: | 0.0890438 |
Original motif Consensus sequence: TCTCTGAGCCTCAGTT | Reverse complement motif Consensus sequence: AACTGAGGCTCAGAGA |
Dataset #: | 1 |
Motif ID: | 241 |
Motif name: | Motif 241 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 13 |
Similarity score: | 0.089076 |
Original motif Consensus sequence: GCACTGAGTGAACGA | Reverse complement motif Consensus sequence: TCGTTCACTCAGTGC |
Dataset #: 1 | Motif ID: 237 | Motif name: Motif 237 |
Original motif Consensus sequence: TAGCCAAGGRAA | Reverse complement motif Consensus sequence: TTKCCTTGGCTA |
Best Matches for Motif ID 237 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 274 |
Motif name: | Motif 274 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 12 |
Similarity score: | 0.056906 |
Original motif Consensus sequence: CTGGTCAAGGAAA | Reverse complement motif Consensus sequence: TTTCCTTGACCAG |
Dataset #: | 1 |
Motif ID: | 24 |
Motif name: | Motif 24 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 12 |
Similarity score: | 0.0581846 |
Original motif Consensus sequence: CKAGTCAAAGAAA | Reverse complement motif Consensus sequence: TTTCTTTGACTRG |
Dataset #: | 1 |
Motif ID: | 290 |
Motif name: | Motif 290 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 12 |
Similarity score: | 0.0704633 |
Original motif Consensus sequence: TGATACCCAGGCAAACAG | Reverse complement motif Consensus sequence: CTGTTTGCCTGGGTATCA |
Dataset #: | 1 |
Motif ID: | 196 |
Motif name: | Motif 196 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 12 |
Similarity score: | 0.0840989 |
Original motif Consensus sequence: CCTGCCATTGCYSAGGCTTG | Reverse complement motif Consensus sequence: CAAGCCTSKGCAATGGCAGG |
Dataset #: | 1 |
Motif ID: | 122 |
Motif name: | Motif 122 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 12 |
Similarity score: | 0.0852018 |
Original motif Consensus sequence: CCTTGGCCAGCCCAGAAAG | Reverse complement motif Consensus sequence: CTTTCTGGGCTGGCCAAGG |
Dataset #: 1 | Motif ID: 238 | Motif name: Motif 238 |
Original motif Consensus sequence: ACATGGGCG | Reverse complement motif Consensus sequence: CGCCCATGT |
Best Matches for Motif ID 238 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 353 |
Motif name: | Motif 353 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 9 |
Similarity score: | 0.0421539 |
Original motif Consensus sequence: CACATGGAAGC | Reverse complement motif Consensus sequence: GCTTCCATGTG |
Dataset #: | 1 |
Motif ID: | 324 |
Motif name: | Motif 324 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 9 |
Similarity score: | 0.0421539 |
Original motif Consensus sequence: ACGCACCTGTA | Reverse complement motif Consensus sequence: TACAGGTGCGT |
Dataset #: | 1 |
Motif ID: | 235 |
Motif name: | Motif 235 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 9 |
Number of overlap: | 9 |
Similarity score: | 0.0532025 |
Original motif Consensus sequence: TCCAAATGGGAGAAATTGGC | Reverse complement motif Consensus sequence: GCCAATTTCTCCCATTTGGA |
Dataset #: | 1 |
Motif ID: | 36 |
Motif name: | Motif 36 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 11 |
Number of overlap: | 9 |
Similarity score: | 0.0536448 |
Original motif Consensus sequence: ACATCCCAGACGATGGGCG | Reverse complement motif Consensus sequence: CGCCCATCGTCTGGGATGT |
Dataset #: | 1 |
Motif ID: | 93 |
Motif name: | Motif 93 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 9 |
Similarity score: | 0.0544118 |
Original motif Consensus sequence: CCATGTGCGG | Reverse complement motif Consensus sequence: CCGCACATGG |
Dataset #: 1 | Motif ID: 239 | Motif name: Motif 239 |
Original motif Consensus sequence: AGCCTCCAGAACTGT | Reverse complement motif Consensus sequence: ACAGTTCTGGAGGCT |
Best Matches for Motif ID 239 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 309 |
Motif name: | Motif 309 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 6 |
Number of overlap: | 15 |
Similarity score: | 0.0847179 |
Original motif Consensus sequence: CATTCTGGGGTCTGGAGGAY | Reverse complement motif Consensus sequence: MTCCTCCAGACCCCAGAATG |
Dataset #: | 1 |
Motif ID: | 307 |
Motif name: | Motif 307 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 15 |
Similarity score: | 0.0931523 |
Original motif Consensus sequence: AGATGCCAGCCAGAGCTCT | Reverse complement motif Consensus sequence: AGAGCTCTGGCTGGCATCT |
Dataset #: | 1 |
Motif ID: | 155 |
Motif name: | Motif 155 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 6 |
Number of overlap: | 15 |
Similarity score: | 0.0940799 |
Original motif Consensus sequence: TCCCTCCCGGACGGGGYGGC | Reverse complement motif Consensus sequence: GCCKCCCCGTCCGGGAGGGA |
Dataset #: | 1 |
Motif ID: | 108 |
Motif name: | Motif 108 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 15 |
Similarity score: | 0.0951379 |
Original motif Consensus sequence: CGAGCCTCCCCGAYGAGCGC | Reverse complement motif Consensus sequence: GCGCTCKTCGGGGAGGCTCG |
Dataset #: | 1 |
Motif ID: | 105 |
Motif name: | Motif 105 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 6 |
Number of overlap: | 15 |
Similarity score: | 0.0954906 |
Original motif Consensus sequence: GCCTCTCCCTCCACACCTCC | Reverse complement motif Consensus sequence: GGAGGTGTGGAGGGAGAGGC |
Dataset #: 1 | Motif ID: 240 | Motif name: Motif 240 |
Original motif Consensus sequence: ATGTGCWGTCCC | Reverse complement motif Consensus sequence: GGGACWGCACAT |
Best Matches for Motif ID 240 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 279 |
Motif name: | Motif 279 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 12 |
Similarity score: | 0.0578868 |
Original motif Consensus sequence: GGGGGAGACATCACACR | Reverse complement motif Consensus sequence: MGTGTGATGTCTCCCCC |
Dataset #: | 1 |
Motif ID: | 306 |
Motif name: | Motif 306 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 12 |
Similarity score: | 0.0660844 |
Original motif Consensus sequence: GACATGAGCTGGCGCTTG | Reverse complement motif Consensus sequence: CAAGCGCCAGCTCATGTC |
Dataset #: | 1 |
Motif ID: | 192 |
Motif name: | Motif 192 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 8 |
Number of overlap: | 12 |
Similarity score: | 0.0665252 |
Original motif Consensus sequence: GAATCCTGGGACAGCCTGT | Reverse complement motif Consensus sequence: ACAGGCTGTCCCAGGATTC |
Dataset #: | 1 |
Motif ID: | 320 |
Motif name: | Motif 320 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 12 |
Similarity score: | 0.0676775 |
Original motif Consensus sequence: CATCTGGAGCCCCA | Reverse complement motif Consensus sequence: TGGGGCTCCAGATG |
Dataset #: | 1 |
Motif ID: | 106 |
Motif name: | Motif 106 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 12 |
Similarity score: | 0.069616 |
Original motif Consensus sequence: ATTGGTGTATTTACAATCCC | Reverse complement motif Consensus sequence: GGGATTGTAAATACACCAAT |
Dataset #: 1 | Motif ID: 241 | Motif name: Motif 241 |
Original motif Consensus sequence: GCACTGAGTGAACGA | Reverse complement motif Consensus sequence: TCGTTCACTCAGTGC |
Best Matches for Motif ID 241 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 144 |
Motif name: | Motif 144 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 6 |
Number of overlap: | 15 |
Similarity score: | 0.0442756 |
Original motif Consensus sequence: CCGCTGCACTGTGGGAGCCC | Reverse complement motif Consensus sequence: GGGCTCCCACAGTGCAGCGG |
Dataset #: | 1 |
Motif ID: | 61 |
Motif name: | Motif 61 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 15 |
Similarity score: | 0.0478162 |
Original motif Consensus sequence: GGATCCACTGGGTGAAGCCA | Reverse complement motif Consensus sequence: TGGCTTCACCCAGTGGATCC |
Dataset #: | 1 |
Motif ID: | 48 |
Motif name: | Motif 48 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 15 |
Similarity score: | 0.0574241 |
Original motif Consensus sequence: AGCTCCCAGCGTGAGCGACG | Reverse complement motif Consensus sequence: CGTCGCTCACGCTGGGAGCT |
Dataset #: | 1 |
Motif ID: | 312 |
Motif name: | Motif 312 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 15 |
Similarity score: | 0.0588064 |
Original motif Consensus sequence: AGGACTGAGGGTGCCYRGGG | Reverse complement motif Consensus sequence: CCCMKGGCACCCTCAGTCCT |
Dataset #: | 1 |
Motif ID: | 17 |
Motif name: | Motif 17 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 15 |
Similarity score: | 0.0672559 |
Original motif Consensus sequence: AGACAGTGGGYGCAGGHCA | Reverse complement motif Consensus sequence: TGHCCTGCKCCCACTGTCT |
Dataset #: 1 | Motif ID: 242 | Motif name: Motif 242 |
Original motif Consensus sequence: AACCCTATTGTGAACTGYG | Reverse complement motif Consensus sequence: CMCAGTTCACAATAGGGTT |
Best Matches for Motif ID 242 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 176 |
Motif name: | Motif 176 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.0985886 |
Original motif Consensus sequence: AGGCCCCAGTGTSTGTTGTT | Reverse complement motif Consensus sequence: AACAACASACACTGGGGCCT |
Dataset #: | 1 |
Motif ID: | 202 |
Motif name: | Motif 202 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.11357 |
Original motif Consensus sequence: ACACATCACAAAGCAGTTTC | Reverse complement motif Consensus sequence: GAAACTGCTTTGTGATGTGT |
Dataset #: | 1 |
Motif ID: | 99 |
Motif name: | Motif 99 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.115902 |
Original motif Consensus sequence: GCAAAKGACATGATYTCATT | Reverse complement motif Consensus sequence: AATGAKATCATGTCYTTTGC |
Dataset #: | 1 |
Motif ID: | 48 |
Motif name: | Motif 48 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.116379 |
Original motif Consensus sequence: AGCTCCCAGCGTGAGCGACG | Reverse complement motif Consensus sequence: CGTCGCTCACGCTGGGAGCT |
Dataset #: | 1 |
Motif ID: | 227 |
Motif name: | Motif 227 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.11749 |
Original motif Consensus sequence: CCCAAATCTCATSTTGAAT | Reverse complement motif Consensus sequence: ATTCAASATGAGATTTGGG |
Dataset #: 1 | Motif ID: 243 | Motif name: Motif 243 |
Original motif Consensus sequence: CAGTGGTTCTCAA | Reverse complement motif Consensus sequence: TTGAGAACCACTG |
Best Matches for Motif ID 243 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 350 |
Motif name: | Motif 350 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 5 |
Number of overlap: | 13 |
Similarity score: | 0.0720775 |
Original motif Consensus sequence: TCTGGAGTGGACCTCCAGCA | Reverse complement motif Consensus sequence: TGCTGGAGGTCCACTCCAGA |
Dataset #: | 1 |
Motif ID: | 147 |
Motif name: | Motif 147 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 13 |
Similarity score: | 0.0768151 |
Original motif Consensus sequence: CTGGGCACCATTGA | Reverse complement motif Consensus sequence: TCAATGGTGCCCAG |
Dataset #: | 1 |
Motif ID: | 85 |
Motif name: | Motif 85 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 8 |
Number of overlap: | 13 |
Similarity score: | 0.0785125 |
Original motif Consensus sequence: CTAGACATAAAGGTTCTCCA | Reverse complement motif Consensus sequence: TGGAGAACCTTTATGTCTAG |
Dataset #: | 1 |
Motif ID: | 170 |
Motif name: | Motif 170 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 13 |
Similarity score: | 0.0831649 |
Original motif Consensus sequence: AATCAACCCTGGYRATCAAT | Reverse complement motif Consensus sequence: ATTGATMKCCAGGGTTGATT |
Dataset #: | 1 |
Motif ID: | 43 |
Motif name: | Motif 43 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 13 |
Similarity score: | 0.0849124 |
Original motif Consensus sequence: GCCAGGCAGAGRGKCTCCT | Reverse complement motif Consensus sequence: AGGAGRCMCTCTGCCTGGC |
Dataset #: 1 | Motif ID: 244 | Motif name: Motif 244 |
Original motif Consensus sequence: GTATWTACCCA | Reverse complement motif Consensus sequence: TGGGTAWATAC |
Best Matches for Motif ID 244 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 168 |
Motif name: | Motif 168 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 11 |
Similarity score: | 0.0692202 |
Original motif Consensus sequence: AGGTATTTCTCCCACC | Reverse complement motif Consensus sequence: GGTGGGAGAAATACCT |
Dataset #: | 1 |
Motif ID: | 319 |
Motif name: | Motif 319 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 11 |
Similarity score: | 0.0769317 |
Original motif Consensus sequence: TAGTTTTTAACAA | Reverse complement motif Consensus sequence: TTGTTAAAAACTA |
Dataset #: | 1 |
Motif ID: | 106 |
Motif name: | Motif 106 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 11 |
Similarity score: | 0.077946 |
Original motif Consensus sequence: ATTGGTGTATTTACAATCCC | Reverse complement motif Consensus sequence: GGGATTGTAAATACACCAAT |
Dataset #: | 1 |
Motif ID: | 224 |
Motif name: | Motif 224 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 11 |
Similarity score: | 0.0793596 |
Original motif Consensus sequence: AATGAGTTAAGACTTTG | Reverse complement motif Consensus sequence: CAAAGTCTTAACTCATT |
Dataset #: | 1 |
Motif ID: | 83 |
Motif name: | Motif 83 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 9 |
Number of overlap: | 11 |
Similarity score: | 0.0804324 |
Original motif Consensus sequence: AAAATGTGGTAYATAYAYAC | Reverse complement motif Consensus sequence: GTKTMTATMTACCACATTTT |
Dataset #: 1 | Motif ID: 245 | Motif name: Motif 245 |
Original motif Consensus sequence: CAGACTGCCTCCTCAA | Reverse complement motif Consensus sequence: TTGAGGAGGCAGTCTG |
Best Matches for Motif ID 245 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 178 |
Motif name: | Motif 178 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 16 |
Similarity score: | 0.0807607 |
Original motif Consensus sequence: ACTGTCTTCCACCTCCACAT | Reverse complement motif Consensus sequence: ATGTGGAGGTGGAAGACAGT |
Dataset #: | 1 |
Motif ID: | 96 |
Motif name: | Motif 96 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 16 |
Similarity score: | 0.0972589 |
Original motif Consensus sequence: AAGCTGAGGGAGCCGGCTCC | Reverse complement motif Consensus sequence: GGAGCCGGCTCCCTCAGCTT |
Dataset #: | 1 |
Motif ID: | 356 |
Motif name: | Motif 356 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 16 |
Similarity score: | 0.0988443 |
Original motif Consensus sequence: AATTAAAAGACACAGACTG | Reverse complement motif Consensus sequence: CAGTCTGTGTCTTTTAATT |
Dataset #: | 1 |
Motif ID: | 149 |
Motif name: | Motif 149 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 16 |
Similarity score: | 0.100811 |
Original motif Consensus sequence: ACTCAGCCCRCCTGCACCC | Reverse complement motif Consensus sequence: GGGTGCAGGMGGGCTGAGT |
Dataset #: | 1 |
Motif ID: | 202 |
Motif name: | Motif 202 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 5 |
Number of overlap: | 16 |
Similarity score: | 0.105987 |
Original motif Consensus sequence: ACACATCACAAAGCAGTTTC | Reverse complement motif Consensus sequence: GAAACTGCTTTGTGATGTGT |
Dataset #: 1 | Motif ID: 246 | Motif name: Motif 246 |
Original motif Consensus sequence: GCAGCTTCACTCCTGA | Reverse complement motif Consensus sequence: TCAGGAGTGAAGCTGC |
Best Matches for Motif ID 246 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 350 |
Motif name: | Motif 350 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 16 |
Similarity score: | 0.0626054 |
Original motif Consensus sequence: TCTGGAGTGGACCTCCAGCA | Reverse complement motif Consensus sequence: TGCTGGAGGTCCACTCCAGA |
Dataset #: | 1 |
Motif ID: | 3 |
Motif name: | Motif 3 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 16 |
Similarity score: | 0.0810673 |
Original motif Consensus sequence: GCTGGAGTGCAGTGGCRYGA | Reverse complement motif Consensus sequence: TCKMGCCACTGCACTCCAGC |
Dataset #: | 1 |
Motif ID: | 15 |
Motif name: | Motif 15 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 16 |
Similarity score: | 0.087745 |
Original motif Consensus sequence: CTTGCGCTTCCCRRGTGA | Reverse complement motif Consensus sequence: TCACKMGGGAAGCGCAAG |
Dataset #: | 1 |
Motif ID: | 214 |
Motif name: | Motif 214 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 16 |
Similarity score: | 0.0898189 |
Original motif Consensus sequence: CTCAGGAATGGAAAACC | Reverse complement motif Consensus sequence: GGTTTTCCATTCCTGAG |
Dataset #: | 1 |
Motif ID: | 64 |
Motif name: | Motif 64 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 5 |
Number of overlap: | 16 |
Similarity score: | 0.0986718 |
Original motif Consensus sequence: GAAGGCAGCTAAGGCCCGGY | Reverse complement motif Consensus sequence: KCCGGGCCTTAGCTGCCTTC |
Dataset #: 1 | Motif ID: 247 | Motif name: Motif 247 |
Original motif Consensus sequence: GCCTCACTGCCRC | Reverse complement motif Consensus sequence: GKGGCAGTGAGGC |
Best Matches for Motif ID 247 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 136 |
Motif name: | Motif 136 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 13 |
Similarity score: | 0.0407776 |
Original motif Consensus sequence: CCCTCACTGCCCGGGG | Reverse complement motif Consensus sequence: CCCCGGGCAGTGAGGG |
Dataset #: | 1 |
Motif ID: | 229 |
Motif name: | Motif 229 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 13 |
Similarity score: | 0.0419595 |
Original motif Consensus sequence: GCCTTGCTGCCGC | Reverse complement motif Consensus sequence: GCGGCAGCAAGGC |
Dataset #: | 1 |
Motif ID: | 311 |
Motif name: | Motif 311 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 13 |
Similarity score: | 0.0798714 |
Original motif Consensus sequence: GGCATCACGGATCCTACCAA | Reverse complement motif Consensus sequence: TTGGTAGGATCCGTGATGCC |
Dataset #: | 1 |
Motif ID: | 111 |
Motif name: | Motif 111 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 13 |
Similarity score: | 0.0800588 |
Original motif Consensus sequence: AGGAGCCCCTCHGCCCR | Reverse complement motif Consensus sequence: KGGGCDGAGGGGCTCCT |
Dataset #: | 1 |
Motif ID: | 149 |
Motif name: | Motif 149 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 13 |
Similarity score: | 0.0819712 |
Original motif Consensus sequence: ACTCAGCCCRCCTGCACCC | Reverse complement motif Consensus sequence: GGGTGCAGGMGGGCTGAGT |
Dataset #: 1 | Motif ID: 248 | Motif name: Motif 248 |
Original motif Consensus sequence: TAATGGGTACAAA | Reverse complement motif Consensus sequence: TTTGTACCCATTA |
Best Matches for Motif ID 248 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 289 |
Motif name: | Motif 289 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 13 |
Similarity score: | 0.0609387 |
Original motif Consensus sequence: TGATGGGTGCACCAAA | Reverse complement motif Consensus sequence: TTTGGTGCACCCATCA |
Dataset #: | 1 |
Motif ID: | 356 |
Motif name: | Motif 356 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 13 |
Similarity score: | 0.0698241 |
Original motif Consensus sequence: AATTAAAAGACACAGACTG | Reverse complement motif Consensus sequence: CAGTCTGTGTCTTTTAATT |
Dataset #: | 1 |
Motif ID: | 333 |
Motif name: | Motif 333 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 13 |
Similarity score: | 0.0771988 |
Original motif Consensus sequence: TAGATAATAGCTCCAGCTTT | Reverse complement motif Consensus sequence: AAAGCTGGAGCTATTATCTA |
Dataset #: | 1 |
Motif ID: | 225 |
Motif name: | Motif 225 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 13 |
Similarity score: | 0.0773246 |
Original motif Consensus sequence: GCACATGTAYCCYAGAACTT | Reverse complement motif Consensus sequence: AAGTTCTKGGKTACATGTGC |
Dataset #: | 1 |
Motif ID: | 193 |
Motif name: | Motif 193 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 13 |
Similarity score: | 0.0779989 |
Original motif Consensus sequence: ATACAATGGGGGTACAGRC | Reverse complement motif Consensus sequence: GKCTGTACCCCCATTGTAT |
Dataset #: 1 | Motif ID: 249 | Motif name: Motif 249 |
Original motif Consensus sequence: TGTGAAGAGACCACCAA | Reverse complement motif Consensus sequence: TTGGTGGTCTCTTCACA |
Best Matches for Motif ID 249 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 294 |
Motif name: | Motif 294 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 17 |
Similarity score: | 0.0818261 |
Original motif Consensus sequence: AGCTGTGAGAAGAGGGCCAC | Reverse complement motif Consensus sequence: GTGGCCCTCTTCTCACAGCT |
Dataset #: | 1 |
Motif ID: | 279 |
Motif name: | Motif 279 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 17 |
Similarity score: | 0.106605 |
Original motif Consensus sequence: GGGGGAGACATCACACR | Reverse complement motif Consensus sequence: MGTGTGATGTCTCCCCC |
Dataset #: | 1 |
Motif ID: | 83 |
Motif name: | Motif 83 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 17 |
Similarity score: | 0.110316 |
Original motif Consensus sequence: AAAATGTGGTAYATAYAYAC | Reverse complement motif Consensus sequence: GTKTMTATMTACCACATTTT |
Dataset #: | 1 |
Motif ID: | 52 |
Motif name: | Motif 52 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 17 |
Similarity score: | 0.112629 |
Original motif Consensus sequence: GACTGGCAGGCAGCTCCACC | Reverse complement motif Consensus sequence: GGTGGAGCTGCCTGCCAGTC |
Dataset #: | 1 |
Motif ID: | 350 |
Motif name: | Motif 350 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 17 |
Similarity score: | 0.112706 |
Original motif Consensus sequence: TCTGGAGTGGACCTCCAGCA | Reverse complement motif Consensus sequence: TGCTGGAGGTCCACTCCAGA |
Dataset #: 1 | Motif ID: 250 | Motif name: Motif 250 |
Original motif Consensus sequence: CCACCGCTCC | Reverse complement motif Consensus sequence: GGAGCGGTGG |
Best Matches for Motif ID 250 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 107 |
Motif name: | Motif 107 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 10 |
Similarity score: | 0.03718 |
Original motif Consensus sequence: GAGCCACYGCRCC | Reverse complement motif Consensus sequence: GGMGCKGTGGCTC |
Dataset #: | 1 |
Motif ID: | 56 |
Motif name: | Motif 56 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 7 |
Number of overlap: | 10 |
Similarity score: | 0.0459856 |
Original motif Consensus sequence: CRTGAGCCACYGYRCCYGGC | Reverse complement motif Consensus sequence: GCCKGGMKCMGTGGCTCAKG |
Dataset #: | 1 |
Motif ID: | 105 |
Motif name: | Motif 105 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 10 |
Similarity score: | 0.0478436 |
Original motif Consensus sequence: GCCTCTCCCTCCACACCTCC | Reverse complement motif Consensus sequence: GGAGGTGTGGAGGGAGAGGC |
Dataset #: | 1 |
Motif ID: | 2 |
Motif name: | Motif 2 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 10 |
Similarity score: | 0.0491967 |
Original motif Consensus sequence: ATTAGCYRGGCRTGGTGGC | Reverse complement motif Consensus sequence: GCCACCAMGCCMKGCTAAT |
Dataset #: | 1 |
Motif ID: | 331 |
Motif name: | Motif 331 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 8 |
Number of overlap: | 10 |
Similarity score: | 0.0519556 |
Original motif Consensus sequence: CCACCACAGCTCAAGGAGGC | Reverse complement motif Consensus sequence: GCCTCCTTGAGCTGTGGTGG |
Dataset #: 1 | Motif ID: 251 | Motif name: Motif 251 |
Original motif Consensus sequence: CAGGCTGGTCTCG | Reverse complement motif Consensus sequence: CGAGACCAGCCTG |
Best Matches for Motif ID 251 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 307 |
Motif name: | Motif 307 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 13 |
Similarity score: | 0.0730434 |
Original motif Consensus sequence: AGATGCCAGCCAGAGCTCT | Reverse complement motif Consensus sequence: AGAGCTCTGGCTGGCATCT |
Dataset #: | 1 |
Motif ID: | 192 |
Motif name: | Motif 192 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 6 |
Number of overlap: | 13 |
Similarity score: | 0.0761402 |
Original motif Consensus sequence: GAATCCTGGGACAGCCTGT | Reverse complement motif Consensus sequence: ACAGGCTGTCCCAGGATTC |
Dataset #: | 1 |
Motif ID: | 78 |
Motif name: | Motif 78 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 13 |
Similarity score: | 0.0811019 |
Original motif Consensus sequence: CGAGCCCTGCCCCGCGG | Reverse complement motif Consensus sequence: CCGCGGGGCAGGGCTCG |
Dataset #: | 1 |
Motif ID: | 52 |
Motif name: | Motif 52 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 7 |
Number of overlap: | 13 |
Similarity score: | 0.0865311 |
Original motif Consensus sequence: GACTGGCAGGCAGCTCCACC | Reverse complement motif Consensus sequence: GGTGGAGCTGCCTGCCAGTC |
Dataset #: | 1 |
Motif ID: | 122 |
Motif name: | Motif 122 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 13 |
Similarity score: | 0.0910885 |
Original motif Consensus sequence: CCTTGGCCAGCCCAGAAAG | Reverse complement motif Consensus sequence: CTTTCTGGGCTGGCCAAGG |
Dataset #: 1 | Motif ID: 252 | Motif name: Motif 252 |
Original motif Consensus sequence: AATTAGCYRGG | Reverse complement motif Consensus sequence: CCMKGCTAATT |
Best Matches for Motif ID 252 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 226 |
Motif name: | Motif 226 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 11 |
Similarity score: | 0.0630561 |
Original motif Consensus sequence: AATAAACATGG | Reverse complement motif Consensus sequence: CCATGTTTATT |
Dataset #: | 1 |
Motif ID: | 38 |
Motif name: | Motif 38 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 11 |
Similarity score: | 0.0649059 |
Original motif Consensus sequence: GCAGTGAGCYRAGA | Reverse complement motif Consensus sequence: TCTMKGCTCACTGC |
Dataset #: | 1 |
Motif ID: | 160 |
Motif name: | Motif 160 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 11 |
Similarity score: | 0.0702894 |
Original motif Consensus sequence: AAATTACCCAGTCTCAGGTA | Reverse complement motif Consensus sequence: TACCTGAGACTGGGTAATTT |
Dataset #: | 1 |
Motif ID: | 306 |
Motif name: | Motif 306 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 6 |
Number of overlap: | 11 |
Similarity score: | 0.0819954 |
Original motif Consensus sequence: GACATGAGCTGGCGCTTG | Reverse complement motif Consensus sequence: CAAGCGCCAGCTCATGTC |
Dataset #: | 1 |
Motif ID: | 330 |
Motif name: | Motif 330 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 11 |
Similarity score: | 0.0823491 |
Original motif Consensus sequence: AAAACCAGCAAGTTTTTAT | Reverse complement motif Consensus sequence: ATAAAAACTTGCTGGTTTT |
Dataset #: 1 | Motif ID: 253 | Motif name: Motif 253 |
Original motif Consensus sequence: AGAGTCTCACTCTGT | Reverse complement motif Consensus sequence: ACAGAGTGAGACTCT |
Best Matches for Motif ID 253 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 231 |
Motif name: | Motif 231 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 15 |
Similarity score: | 0.0826494 |
Original motif Consensus sequence: ACAAGGCAAGTCCCTTCY | Reverse complement motif Consensus sequence: MGAAGGGACTTGCCTTGT |
Dataset #: | 1 |
Motif ID: | 43 |
Motif name: | Motif 43 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 15 |
Similarity score: | 0.0874293 |
Original motif Consensus sequence: GCCAGGCAGAGRGKCTCCT | Reverse complement motif Consensus sequence: AGGAGRCMCTCTGCCTGGC |
Dataset #: | 1 |
Motif ID: | 13 |
Motif name: | Motif 13 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 15 |
Similarity score: | 0.0917557 |
Original motif Consensus sequence: AAGCAGGGCGAGGCATTGCC | Reverse complement motif Consensus sequence: GGCAATGCCTCGCCCTGCTT |
Dataset #: | 1 |
Motif ID: | 177 |
Motif name: | Motif 177 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 15 |
Similarity score: | 0.0934943 |
Original motif Consensus sequence: CCCGAAGCTGCRYRCTCGGT | Reverse complement motif Consensus sequence: ACCGAGMKMGCAGCTTCGGG |
Dataset #: | 1 |
Motif ID: | 109 |
Motif name: | Motif 109 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 15 |
Similarity score: | 0.0950453 |
Original motif Consensus sequence: GAGAGAGAGAGAGAGAGAGA | Reverse complement motif Consensus sequence: TCTCTCTCTCTCTCTCTCTC |
Dataset #: 1 | Motif ID: 254 | Motif name: Motif 254 |
Original motif Consensus sequence: AAAATCACAAGCATTCCTAT | Reverse complement motif Consensus sequence: ATAGGAATGCTTGTGATTTT |
Best Matches for Motif ID 254 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 83 |
Motif name: | Motif 83 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.113683 |
Original motif Consensus sequence: AAAATGTGGTAYATAYAYAC | Reverse complement motif Consensus sequence: GTKTMTATMTACCACATTTT |
Dataset #: | 1 |
Motif ID: | 176 |
Motif name: | Motif 176 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.121683 |
Original motif Consensus sequence: AGGCCCCAGTGTSTGTTGTT | Reverse complement motif Consensus sequence: AACAACASACACTGGGGCCT |
Dataset #: | 1 |
Motif ID: | 63 |
Motif name: | Motif 63 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.124533 |
Original motif Consensus sequence: AGTGAGAACATRYRRTRTTT | Reverse complement motif Consensus sequence: AAAMAMMKMATGTTCTCACT |
Dataset #: | 1 |
Motif ID: | 58 |
Motif name: | Motif 58 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.128088 |
Original motif Consensus sequence: ATGGACAYTTRGGTTGHTTC | Reverse complement motif Consensus sequence: GAAHCAACCKAAKTGTCCAT |
Dataset #: | 1 |
Motif ID: | 160 |
Motif name: | Motif 160 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.128511 |
Original motif Consensus sequence: AAATTACCCAGTCTCAGGTA | Reverse complement motif Consensus sequence: TACCTGAGACTGGGTAATTT |
Dataset #: 1 | Motif ID: 255 | Motif name: Motif 255 |
Original motif Consensus sequence: CTGCTATAACAAA | Reverse complement motif Consensus sequence: TTTGTTATAGCAG |
Best Matches for Motif ID 255 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 137 |
Motif name: | Motif 137 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 13 |
Similarity score: | 0.0686391 |
Original motif Consensus sequence: AGGTTTGTTACATAGGTAWA | Reverse complement motif Consensus sequence: TWTACCTATGTAACAAACCT |
Dataset #: | 1 |
Motif ID: | 299 |
Motif name: | Motif 299 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 13 |
Similarity score: | 0.0785239 |
Original motif Consensus sequence: CCCTGCTAGAACCTCCAA | Reverse complement motif Consensus sequence: TTGGAGGTTCTAGCAGGG |
Dataset #: | 1 |
Motif ID: | 117 |
Motif name: | Motif 117 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 13 |
Similarity score: | 0.0860443 |
Original motif Consensus sequence: AACAACAACAACAAMAA | Reverse complement motif Consensus sequence: TTYTTGTTGTTGTTGTT |
Dataset #: | 1 |
Motif ID: | 196 |
Motif name: | Motif 196 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 7 |
Number of overlap: | 13 |
Similarity score: | 0.0860633 |
Original motif Consensus sequence: CCTGCCATTGCYSAGGCTTG | Reverse complement motif Consensus sequence: CAAGCCTSKGCAATGGCAGG |
Dataset #: | 1 |
Motif ID: | 21 |
Motif name: | Motif 21 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 13 |
Similarity score: | 0.0907214 |
Original motif Consensus sequence: GCCGTTTKTTAAGCCCGTY | Reverse complement motif Consensus sequence: KACGGGCTTAARAAACGGC |
Dataset #: 1 | Motif ID: 256 | Motif name: Motif 256 |
Original motif Consensus sequence: RCAGTGTACACTGY | Reverse complement motif Consensus sequence: KCAGTGTACACTGM |
Best Matches for Motif ID 256 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 242 |
Motif name: | Motif 242 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 14 |
Similarity score: | 0.0643389 |
Original motif Consensus sequence: AACCCTATTGTGAACTGYG | Reverse complement motif Consensus sequence: CMCAGTTCACAATAGGGTT |
Dataset #: | 1 |
Motif ID: | 176 |
Motif name: | Motif 176 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 14 |
Similarity score: | 0.0671024 |
Original motif Consensus sequence: AGGCCCCAGTGTSTGTTGTT | Reverse complement motif Consensus sequence: AACAACASACACTGGGGCCT |
Dataset #: | 1 |
Motif ID: | 70 |
Motif name: | Motif 70 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 14 |
Similarity score: | 0.0717951 |
Original motif Consensus sequence: CTATTGTGAATARTGCTGC | Reverse complement motif Consensus sequence: GCAGCAMTATTCACAATAG |
Dataset #: | 1 |
Motif ID: | 112 |
Motif name: | Motif 112 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 14 |
Similarity score: | 0.0738478 |
Original motif Consensus sequence: GCTGTGTGACCTTGGGCAAG | Reverse complement motif Consensus sequence: CTTGCCCAAGGTCACACAGC |
Dataset #: | 1 |
Motif ID: | 357 |
Motif name: | Motif 357 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 14 |
Similarity score: | 0.0744746 |
Original motif Consensus sequence: CAAGTTGACACATAAAATTA | Reverse complement motif Consensus sequence: TAATTTTATGTGTCAACTTG |
Dataset #: 1 | Motif ID: 257 | Motif name: Motif 257 |
Original motif Consensus sequence: GAGAACACATGGACA | Reverse complement motif Consensus sequence: TGTCCATGTGTTCTC |
Best Matches for Motif ID 257 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 63 |
Motif name: | Motif 63 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 15 |
Similarity score: | 0.0985209 |
Original motif Consensus sequence: AGTGAGAACATRYRRTRTTT | Reverse complement motif Consensus sequence: AAAMAMMKMATGTTCTCACT |
Dataset #: | 1 |
Motif ID: | 221 |
Motif name: | Motif 221 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 15 |
Similarity score: | 0.10032 |
Original motif Consensus sequence: GGGAGGAAGGGGACAC | Reverse complement motif Consensus sequence: GTGTCCCCTTCCTCCC |
Dataset #: | 1 |
Motif ID: | 33 |
Motif name: | Motif 33 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 15 |
Similarity score: | 0.100528 |
Original motif Consensus sequence: ACGCCCACGGAGTCTC | Reverse complement motif Consensus sequence: GAGACTCCGTGGGCGT |
Dataset #: | 1 |
Motif ID: | 25 |
Motif name: | Motif 25 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 15 |
Similarity score: | 0.102413 |
Original motif Consensus sequence: CATTTCCAWCTGAGGTAC | Reverse complement motif Consensus sequence: GTACCTCAGWTGGAAATG |
Dataset #: | 1 |
Motif ID: | 294 |
Motif name: | Motif 294 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 15 |
Similarity score: | 0.103591 |
Original motif Consensus sequence: AGCTGTGAGAAGAGGGCCAC | Reverse complement motif Consensus sequence: GTGGCCCTCTTCTCACAGCT |
Dataset #: 1 | Motif ID: 258 | Motif name: Motif 258 |
Original motif Consensus sequence: CCACCAACAGTGTAY | Reverse complement motif Consensus sequence: MTACACTGTTGGTGG |
Best Matches for Motif ID 258 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 144 |
Motif name: | Motif 144 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 15 |
Similarity score: | 0.0771788 |
Original motif Consensus sequence: CCGCTGCACTGTGGGAGCCC | Reverse complement motif Consensus sequence: GGGCTCCCACAGTGCAGCGG |
Dataset #: | 1 |
Motif ID: | 330 |
Motif name: | Motif 330 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 5 |
Number of overlap: | 15 |
Similarity score: | 0.0810042 |
Original motif Consensus sequence: AAAACCAGCAAGTTTTTAT | Reverse complement motif Consensus sequence: ATAAAAACTTGCTGGTTTT |
Dataset #: | 1 |
Motif ID: | 193 |
Motif name: | Motif 193 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 5 |
Number of overlap: | 15 |
Similarity score: | 0.0921216 |
Original motif Consensus sequence: ATACAATGGGGGTACAGRC | Reverse complement motif Consensus sequence: GKCTGTACCCCCATTGTAT |
Dataset #: | 1 |
Motif ID: | 62 |
Motif name: | Motif 62 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 15 |
Similarity score: | 0.0987651 |
Original motif Consensus sequence: AGGAACAGCTCCRGTCTAC | Reverse complement motif Consensus sequence: GTAGACKGGAGCTGTTCCT |
Dataset #: | 1 |
Motif ID: | 33 |
Motif name: | Motif 33 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 15 |
Similarity score: | 0.103803 |
Original motif Consensus sequence: ACGCCCACGGAGTCTC | Reverse complement motif Consensus sequence: GAGACTCCGTGGGCGT |
Dataset #: 1 | Motif ID: 259 | Motif name: Motif 259 |
Original motif Consensus sequence: CCCACACCCTTATTA | Reverse complement motif Consensus sequence: TAATAAGGGTGTGGG |
Best Matches for Motif ID 259 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 169 |
Motif name: | Motif 169 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 15 |
Similarity score: | 0.0922705 |
Original motif Consensus sequence: CCCAAATCCTATAAAA | Reverse complement motif Consensus sequence: TTTTATAGGATTTGGG |
Dataset #: | 1 |
Motif ID: | 312 |
Motif name: | Motif 312 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 15 |
Similarity score: | 0.0982406 |
Original motif Consensus sequence: AGGACTGAGGGTGCCYRGGG | Reverse complement motif Consensus sequence: CCCMKGGCACCCTCAGTCCT |
Dataset #: | 1 |
Motif ID: | 349 |
Motif name: | Motif 349 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 15 |
Similarity score: | 0.106051 |
Original motif Consensus sequence: AGAGCCAAATCATGARTGAA | Reverse complement motif Consensus sequence: TTCAMTCATGATTTGGCTCT |
Dataset #: | 1 |
Motif ID: | 330 |
Motif name: | Motif 330 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 15 |
Similarity score: | 0.106485 |
Original motif Consensus sequence: AAAACCAGCAAGTTTTTAT | Reverse complement motif Consensus sequence: ATAAAAACTTGCTGGTTTT |
Dataset #: | 1 |
Motif ID: | 98 |
Motif name: | Motif 98 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 15 |
Similarity score: | 0.107379 |
Original motif Consensus sequence: AGTTCCGGGTGGGCGTGGG | Reverse complement motif Consensus sequence: CCCACGCCCACCCGGAACT |
Dataset #: 1 | Motif ID: 260 | Motif name: Motif 260 |
Original motif Consensus sequence: GGTGCCCCTCTGGGACRAA | Reverse complement motif Consensus sequence: TTMGTCCCAGAGGGGCACC |
Best Matches for Motif ID 260 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 84 |
Motif name: | Motif 84 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.0961044 |
Original motif Consensus sequence: CTGGGTCCCCCAGCAGTGCC | Reverse complement motif Consensus sequence: GGCACTGCTGGGGGACCCAG |
Dataset #: | 1 |
Motif ID: | 61 |
Motif name: | Motif 61 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.100972 |
Original motif Consensus sequence: GGATCCACTGGGTGAAGCCA | Reverse complement motif Consensus sequence: TGGCTTCACCCAGTGGATCC |
Dataset #: | 1 |
Motif ID: | 155 |
Motif name: | Motif 155 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.10173 |
Original motif Consensus sequence: TCCCTCCCGGACGGGGYGGC | Reverse complement motif Consensus sequence: GCCKCCCCGTCCGGGAGGGA |
Dataset #: | 1 |
Motif ID: | 29 |
Motif name: | Motif 29 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.103455 |
Original motif Consensus sequence: CTGGGCRACAGAGYRAGACY | Reverse complement motif Consensus sequence: MGTCTMKCTCTGTKGCCCAG |
Dataset #: | 1 |
Motif ID: | 85 |
Motif name: | Motif 85 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.103612 |
Original motif Consensus sequence: CTAGACATAAAGGTTCTCCA | Reverse complement motif Consensus sequence: TGGAGAACCTTTATGTCTAG |
Dataset #: 1 | Motif ID: 261 | Motif name: Motif 261 |
Original motif Consensus sequence: ATCTCASAAATCACCACTA | Reverse complement motif Consensus sequence: TAGTGGTGATTTSTGAGAT |
Best Matches for Motif ID 261 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 336 |
Motif name: | Motif 336 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.0782433 |
Original motif Consensus sequence: ATGTAACCAAAYACCACCTG | Reverse complement motif Consensus sequence: CAGGTGGTKTTTGGTTACAT |
Dataset #: | 1 |
Motif ID: | 7 |
Motif name: | Motif 7 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.0942998 |
Original motif Consensus sequence: GTCTCWAMAAAAAAWAMAAA | Reverse complement motif Consensus sequence: TTTYTWTTTTTTYTWGAGAC |
Dataset #: | 1 |
Motif ID: | 119 |
Motif name: | Motif 119 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.113215 |
Original motif Consensus sequence: AAGTCCAAGATCAAGGTGYY | Reverse complement motif Consensus sequence: KKCACCTTGATCTTGGACTT |
Dataset #: | 1 |
Motif ID: | 332 |
Motif name: | Motif 332 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.115495 |
Original motif Consensus sequence: CTGGCCCTCAATGGTTAAAC | Reverse complement motif Consensus sequence: GTTTAACCATTGAGGGCCAG |
Dataset #: | 1 |
Motif ID: | 178 |
Motif name: | Motif 178 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.116588 |
Original motif Consensus sequence: ACTGTCTTCCACCTCCACAT | Reverse complement motif Consensus sequence: ATGTGGAGGTGGAAGACAGT |
Dataset #: 1 | Motif ID: 262 | Motif name: Motif 262 |
Original motif Consensus sequence: CTCAGTGTTAATCTCCTGTC | Reverse complement motif Consensus sequence: GACAGGAGATTAACACTGAG |
Best Matches for Motif ID 262 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 293 |
Motif name: | Motif 293 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.108944 |
Original motif Consensus sequence: CTGACTGGGAGACACCTCCC | Reverse complement motif Consensus sequence: GGGAGGTGTCTCCCAGTCAG |
Dataset #: | 1 |
Motif ID: | 350 |
Motif name: | Motif 350 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.129073 |
Original motif Consensus sequence: TCTGGAGTGGACCTCCAGCA | Reverse complement motif Consensus sequence: TGCTGGAGGTCCACTCCAGA |
Dataset #: | 1 |
Motif ID: | 104 |
Motif name: | Motif 104 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.131966 |
Original motif Consensus sequence: CAACATGGATGRARCTGGAG | Reverse complement motif Consensus sequence: CTCCAGKTMCATCCATGTTG |
Dataset #: | 1 |
Motif ID: | 64 |
Motif name: | Motif 64 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.133887 |
Original motif Consensus sequence: GAAGGCAGCTAAGGCCCGGY | Reverse complement motif Consensus sequence: KCCGGGCCTTAGCTGCCTTC |
Dataset #: | 1 |
Motif ID: | 26 |
Motif name: | Motif 26 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.138871 |
Original motif Consensus sequence: CTCCTGCCTCAGCCTCCCRA | Reverse complement motif Consensus sequence: TMGGGAGGCTGAGGCAGGAG |
Dataset #: 1 | Motif ID: 263 | Motif name: Motif 263 |
Original motif Consensus sequence: CCCAGCTCTGCC | Reverse complement motif Consensus sequence: GGCAGAGCTGGG |
Best Matches for Motif ID 263 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 84 |
Motif name: | Motif 84 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 12 |
Similarity score: | 0.0427579 |
Original motif Consensus sequence: CTGGGTCCCCCAGCAGTGCC | Reverse complement motif Consensus sequence: GGCACTGCTGGGGGACCCAG |
Dataset #: | 1 |
Motif ID: | 183 |
Motif name: | Motif 183 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 12 |
Similarity score: | 0.0507335 |
Original motif Consensus sequence: GCCRGCCCTGCYGGCC | Reverse complement motif Consensus sequence: GGCCMGCAGGGCKGGC |
Dataset #: | 1 |
Motif ID: | 78 |
Motif name: | Motif 78 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 12 |
Similarity score: | 0.0634235 |
Original motif Consensus sequence: CGAGCCCTGCCCCGCGG | Reverse complement motif Consensus sequence: CCGCGGGGCAGGGCTCG |
Dataset #: | 1 |
Motif ID: | 26 |
Motif name: | Motif 26 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 12 |
Similarity score: | 0.0664844 |
Original motif Consensus sequence: CTCCTGCCTCAGCCTCCCRA | Reverse complement motif Consensus sequence: TMGGGAGGCTGAGGCAGGAG |
Dataset #: | 1 |
Motif ID: | 138 |
Motif name: | Motif 138 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 12 |
Similarity score: | 0.0690886 |
Original motif Consensus sequence: CAGCCAGATCRSCC | Reverse complement motif Consensus sequence: GGSKGATCTGGCTG |
Dataset #: 1 | Motif ID: 264 | Motif name: Motif 264 |
Original motif Consensus sequence: CCAAGGTCACA | Reverse complement motif Consensus sequence: TGTGACCTTGG |
Best Matches for Motif ID 264 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 112 |
Motif name: | Motif 112 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 11 |
Similarity score: | 0.0343671 |
Original motif Consensus sequence: GCTGTGTGACCTTGGGCAAG | Reverse complement motif Consensus sequence: CTTGCCCAAGGTCACACAGC |
Dataset #: | 1 |
Motif ID: | 242 |
Motif name: | Motif 242 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 11 |
Similarity score: | 0.0609262 |
Original motif Consensus sequence: AACCCTATTGTGAACTGYG | Reverse complement motif Consensus sequence: CMCAGTTCACAATAGGGTT |
Dataset #: | 1 |
Motif ID: | 119 |
Motif name: | Motif 119 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 11 |
Similarity score: | 0.0681999 |
Original motif Consensus sequence: AAGTCCAAGATCAAGGTGYY | Reverse complement motif Consensus sequence: KKCACCTTGATCTTGGACTT |
Dataset #: | 1 |
Motif ID: | 137 |
Motif name: | Motif 137 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 6 |
Number of overlap: | 11 |
Similarity score: | 0.069002 |
Original motif Consensus sequence: AGGTTTGTTACATAGGTAWA | Reverse complement motif Consensus sequence: TWTACCTATGTAACAAACCT |
Dataset #: | 1 |
Motif ID: | 291 |
Motif name: | Motif 291 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 11 |
Similarity score: | 0.0740266 |
Original motif Consensus sequence: CTGAGGACCTGAGGTCRTA | Reverse complement motif Consensus sequence: TAMGACCTCAGGTCCTCAG |
Dataset #: 1 | Motif ID: 265 | Motif name: Motif 265 |
Original motif Consensus sequence: GCGCATGCGCA | Reverse complement motif Consensus sequence: TGCGCATGCGC |
Best Matches for Motif ID 265 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 180 |
Motif name: | Motif 180 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 11 |
Similarity score: | 0.00596496 |
Original motif Consensus sequence: TGCGCATGCGCA | Reverse complement motif Consensus sequence: TGCGCATGCGCA |
Dataset #: | 1 |
Motif ID: | 100 |
Motif name: | Motif 100 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 11 |
Similarity score: | 0.0616255 |
Original motif Consensus sequence: GCTGGCCCGCAAGCGCCGCG | Reverse complement motif Consensus sequence: CGCGGCGCTTGCGGGCCAGC |
Dataset #: | 1 |
Motif ID: | 306 |
Motif name: | Motif 306 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 5 |
Number of overlap: | 11 |
Similarity score: | 0.0658945 |
Original motif Consensus sequence: GACATGAGCTGGCGCTTG | Reverse complement motif Consensus sequence: CAAGCGCCAGCTCATGTC |
Dataset #: | 1 |
Motif ID: | 215 |
Motif name: | Motif 215 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 11 |
Similarity score: | 0.079487 |
Original motif Consensus sequence: HGCTCCTGTGSKCCC | Reverse complement motif Consensus sequence: GGGRSCACAGGAGCD |
Dataset #: | 1 |
Motif ID: | 51 |
Motif name: | Motif 51 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 11 |
Similarity score: | 0.0805098 |
Original motif Consensus sequence: GTGGGTGCGCGCA | Reverse complement motif Consensus sequence: TGCGCGCACCCAC |
Dataset #: 1 | Motif ID: 266 | Motif name: Motif 266 |
Original motif Consensus sequence: GCAGCAGCAGCA | Reverse complement motif Consensus sequence: TGCTGCTGCTGC |
Best Matches for Motif ID 266 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 101 |
Motif name: | Motif 101 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 12 |
Similarity score: | 0.0655581 |
Original motif Consensus sequence: CGCCGCCGCCGC | Reverse complement motif Consensus sequence: GCGGCGGCGGCG |
Dataset #: | 1 |
Motif ID: | 313 |
Motif name: | Motif 313 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 12 |
Similarity score: | 0.0732114 |
Original motif Consensus sequence: CTCCTGCCTCAGCY | Reverse complement motif Consensus sequence: MGCTGAGGCAGGAG |
Dataset #: | 1 |
Motif ID: | 350 |
Motif name: | Motif 350 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 9 |
Number of overlap: | 12 |
Similarity score: | 0.0784217 |
Original motif Consensus sequence: TCTGGAGTGGACCTCCAGCA | Reverse complement motif Consensus sequence: TGCTGGAGGTCCACTCCAGA |
Dataset #: | 1 |
Motif ID: | 229 |
Motif name: | Motif 229 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 12 |
Similarity score: | 0.0792404 |
Original motif Consensus sequence: GCCTTGCTGCCGC | Reverse complement motif Consensus sequence: GCGGCAGCAAGGC |
Dataset #: | 1 |
Motif ID: | 184 |
Motif name: | Motif 184 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 12 |
Similarity score: | 0.0798146 |
Original motif Consensus sequence: ATATTGATGATCCTGACC | Reverse complement motif Consensus sequence: GGTCAGGATCATCAATAT |
Dataset #: 1 | Motif ID: 267 | Motif name: Motif 267 |
Original motif Consensus sequence: ATGGACTTGAGA | Reverse complement motif Consensus sequence: TCTCAAGTCCAT |
Best Matches for Motif ID 267 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 291 |
Motif name: | Motif 291 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 6 |
Number of overlap: | 12 |
Similarity score: | 0.0822148 |
Original motif Consensus sequence: CTGAGGACCTGAGGTCRTA | Reverse complement motif Consensus sequence: TAMGACCTCAGGTCCTCAG |
Dataset #: | 1 |
Motif ID: | 21 |
Motif name: | Motif 21 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 12 |
Similarity score: | 0.0832965 |
Original motif Consensus sequence: GCCGTTTKTTAAGCCCGTY | Reverse complement motif Consensus sequence: KACGGGCTTAARAAACGGC |
Dataset #: | 1 |
Motif ID: | 62 |
Motif name: | Motif 62 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 8 |
Number of overlap: | 12 |
Similarity score: | 0.0857476 |
Original motif Consensus sequence: AGGAACAGCTCCRGTCTAC | Reverse complement motif Consensus sequence: GTAGACKGGAGCTGTTCCT |
Dataset #: | 1 |
Motif ID: | 232 |
Motif name: | Motif 232 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 6 |
Number of overlap: | 12 |
Similarity score: | 0.0886223 |
Original motif Consensus sequence: AGTTGTAATTGGGAGACTT | Reverse complement motif Consensus sequence: AAGTCTCCCAATTACAACT |
Dataset #: | 1 |
Motif ID: | 166 |
Motif name: | Motif 166 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 12 |
Similarity score: | 0.0887226 |
Original motif Consensus sequence: AAGGGACATTKGAG | Reverse complement motif Consensus sequence: CTCRAATGTCCCTT |
Dataset #: 1 | Motif ID: 268 | Motif name: Motif 268 |
Original motif Consensus sequence: ATAGTGAGACC | Reverse complement motif Consensus sequence: GGTCTCACTAT |
Best Matches for Motif ID 268 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 32 |
Motif name: | Motif 32 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 11 |
Similarity score: | 0.0513709 |
Original motif Consensus sequence: ATGGTGAAACCC | Reverse complement motif Consensus sequence: GGGTTTCACCAT |
Dataset #: | 1 |
Motif ID: | 253 |
Motif name: | Motif 253 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 11 |
Similarity score: | 0.0539738 |
Original motif Consensus sequence: AGAGTCTCACTCTGT | Reverse complement motif Consensus sequence: ACAGAGTGAGACTCT |
Dataset #: | 1 |
Motif ID: | 29 |
Motif name: | Motif 29 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 10 |
Number of overlap: | 11 |
Similarity score: | 0.0624225 |
Original motif Consensus sequence: CTGGGCRACAGAGYRAGACY | Reverse complement motif Consensus sequence: MGTCTMKCTCTGTKGCCCAG |
Dataset #: | 1 |
Motif ID: | 232 |
Motif name: | Motif 232 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 11 |
Similarity score: | 0.0678548 |
Original motif Consensus sequence: AGTTGTAATTGGGAGACTT | Reverse complement motif Consensus sequence: AAGTCTCCCAATTACAACT |
Dataset #: | 1 |
Motif ID: | 204 |
Motif name: | Motif 204 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 11 |
Similarity score: | 0.0686646 |
Original motif Consensus sequence: AGAGYRAGACTCC | Reverse complement motif Consensus sequence: GGAGTCTMKCTCT |
Dataset #: 1 | Motif ID: 269 | Motif name: Motif 269 |
Original motif Consensus sequence: AGCGACATGTGC | Reverse complement motif Consensus sequence: GCACATGTCGCT |
Best Matches for Motif ID 269 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 225 |
Motif name: | Motif 225 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 12 |
Similarity score: | 0.0483903 |
Original motif Consensus sequence: GCACATGTAYCCYAGAACTT | Reverse complement motif Consensus sequence: AAGTTCTKGGKTACATGTGC |
Dataset #: | 1 |
Motif ID: | 166 |
Motif name: | Motif 166 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 12 |
Similarity score: | 0.0581181 |
Original motif Consensus sequence: AAGGGACATTKGAG | Reverse complement motif Consensus sequence: CTCRAATGTCCCTT |
Dataset #: | 1 |
Motif ID: | 157 |
Motif name: | Motif 157 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 12 |
Similarity score: | 0.062288 |
Original motif Consensus sequence: GCGCACGGCGCGG | Reverse complement motif Consensus sequence: CCGCGCCGTGCGC |
Dataset #: | 1 |
Motif ID: | 230 |
Motif name: | Motif 230 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 12 |
Similarity score: | 0.0646389 |
Original motif Consensus sequence: AGAAAGGCATGTGAAAA | Reverse complement motif Consensus sequence: TTTTCACATGCCTTTCT |
Dataset #: | 1 |
Motif ID: | 23 |
Motif name: | Motif 23 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 8 |
Number of overlap: | 12 |
Similarity score: | 0.0679249 |
Original motif Consensus sequence: GGTTCATCTCACTAGGGAGT | Reverse complement motif Consensus sequence: ACTCCCTAGTGAGATGAACC |
Dataset #: 1 | Motif ID: 270 | Motif name: Motif 270 |
Original motif Consensus sequence: CCATGATTGTRAGG | Reverse complement motif Consensus sequence: CCTMACAATCATGG |
Best Matches for Motif ID 270 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 136 |
Motif name: | Motif 136 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 14 |
Similarity score: | 0.0904714 |
Original motif Consensus sequence: CCCTCACTGCCCGGGG | Reverse complement motif Consensus sequence: CCCCGGGCAGTGAGGG |
Dataset #: | 1 |
Motif ID: | 95 |
Motif name: | Motif 95 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 14 |
Similarity score: | 0.091519 |
Original motif Consensus sequence: ACCCYGTCTGGGAGGTG | Reverse complement motif Consensus sequence: CACCTCCCAGACMGGGT |
Dataset #: | 1 |
Motif ID: | 189 |
Motif name: | Motif 189 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 14 |
Similarity score: | 0.0977764 |
Original motif Consensus sequence: ATCCAGTCTATCATTG | Reverse complement motif Consensus sequence: CAATGATAGACTGGAT |
Dataset #: | 1 |
Motif ID: | 254 |
Motif name: | Motif 254 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 14 |
Similarity score: | 0.0983227 |
Original motif Consensus sequence: AAAATCACAAGCATTCCTAT | Reverse complement motif Consensus sequence: ATAGGAATGCTTGTGATTTT |
Dataset #: | 1 |
Motif ID: | 201 |
Motif name: | Motif 201 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 6 |
Number of overlap: | 14 |
Similarity score: | 0.0984147 |
Original motif Consensus sequence: GTAACACTCACCGCGARGGT | Reverse complement motif Consensus sequence: ACCKTCGCGGTGAGTGTTAC |
Dataset #: 1 | Motif ID: 271 | Motif name: Motif 271 |
Original motif Consensus sequence: AGGGATCTAGGTTGCR | Reverse complement motif Consensus sequence: KGCAACCTAGATCCCT |
Best Matches for Motif ID 271 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 307 |
Motif name: | Motif 307 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 16 |
Similarity score: | 0.0814563 |
Original motif Consensus sequence: AGATGCCAGCCAGAGCTCT | Reverse complement motif Consensus sequence: AGAGCTCTGGCTGGCATCT |
Dataset #: | 1 |
Motif ID: | 58 |
Motif name: | Motif 58 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 16 |
Similarity score: | 0.0869615 |
Original motif Consensus sequence: ATGGACAYTTRGGTTGHTTC | Reverse complement motif Consensus sequence: GAAHCAACCKAAKTGTCCAT |
Dataset #: | 1 |
Motif ID: | 64 |
Motif name: | Motif 64 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 16 |
Similarity score: | 0.0921874 |
Original motif Consensus sequence: GAAGGCAGCTAAGGCCCGGY | Reverse complement motif Consensus sequence: KCCGGGCCTTAGCTGCCTTC |
Dataset #: | 1 |
Motif ID: | 19 |
Motif name: | Motif 19 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 5 |
Number of overlap: | 16 |
Similarity score: | 0.096154 |
Original motif Consensus sequence: CACCAGGAGATTATATCCCR | Reverse complement motif Consensus sequence: MGGGATATAATCTCCTGGTG |
Dataset #: | 1 |
Motif ID: | 311 |
Motif name: | Motif 311 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 16 |
Similarity score: | 0.0980366 |
Original motif Consensus sequence: GGCATCACGGATCCTACCAA | Reverse complement motif Consensus sequence: TTGGTAGGATCCGTGATGCC |
Dataset #: 1 | Motif ID: 272 | Motif name: Motif 272 |
Original motif Consensus sequence: CAGCTGTCAC | Reverse complement motif Consensus sequence: GTGACAGCTG |
Best Matches for Motif ID 272 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 334 |
Motif name: | Motif 334 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 10 |
Similarity score: | 0.0227273 |
Original motif Consensus sequence: CATCTGTCAC | Reverse complement motif Consensus sequence: GTGACAGATG |
Dataset #: | 1 |
Motif ID: | 199 |
Motif name: | Motif 199 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 10 |
Similarity score: | 0.037149 |
Original motif Consensus sequence: ACAGCTGGCACC | Reverse complement motif Consensus sequence: GGTGCCAGCTGT |
Dataset #: | 1 |
Motif ID: | 1 |
Motif name: | Motif 1 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 10 |
Similarity score: | 0.0483787 |
Original motif Consensus sequence: GGGGTGACAGABGB | Reverse complement motif Consensus sequence: BCVTCTGTCACCCC |
Dataset #: | 1 |
Motif ID: | 325 |
Motif name: | Motif 325 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 10 |
Similarity score: | 0.0565248 |
Original motif Consensus sequence: AGCAGCTGTAAATA | Reverse complement motif Consensus sequence: TATTTACAGCTGCT |
Dataset #: | 1 |
Motif ID: | 49 |
Motif name: | Motif 49 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 10 |
Similarity score: | 0.0671188 |
Original motif Consensus sequence: ACATCTGYMMCC | Reverse complement motif Consensus sequence: GGRRMCAGATGT |
Dataset #: 1 | Motif ID: 273 | Motif name: Motif 273 |
Original motif Consensus sequence: AGCCTAGGCCTAC | Reverse complement motif Consensus sequence: GTAGGCCTAGGCT |
Best Matches for Motif ID 273 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 365 |
Motif name: | Motif 365 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 13 |
Similarity score: | 0.0731001 |
Original motif Consensus sequence: AGCTCCGGTCTAC | Reverse complement motif Consensus sequence: GTAGACCGGAGCT |
Dataset #: | 1 |
Motif ID: | 13 |
Motif name: | Motif 13 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 13 |
Similarity score: | 0.0735654 |
Original motif Consensus sequence: AAGCAGGGCGAGGCATTGCC | Reverse complement motif Consensus sequence: GGCAATGCCTCGCCCTGCTT |
Dataset #: | 1 |
Motif ID: | 62 |
Motif name: | Motif 62 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 7 |
Number of overlap: | 13 |
Similarity score: | 0.0803293 |
Original motif Consensus sequence: AGGAACAGCTCCRGTCTAC | Reverse complement motif Consensus sequence: GTAGACKGGAGCTGTTCCT |
Dataset #: | 1 |
Motif ID: | 64 |
Motif name: | Motif 64 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 7 |
Number of overlap: | 13 |
Similarity score: | 0.0829415 |
Original motif Consensus sequence: GAAGGCAGCTAAGGCCCGGY | Reverse complement motif Consensus sequence: KCCGGGCCTTAGCTGCCTTC |
Dataset #: | 1 |
Motif ID: | 26 |
Motif name: | Motif 26 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 5 |
Number of overlap: | 13 |
Similarity score: | 0.0838018 |
Original motif Consensus sequence: CTCCTGCCTCAGCCTCCCRA | Reverse complement motif Consensus sequence: TMGGGAGGCTGAGGCAGGAG |
Dataset #: 1 | Motif ID: 274 | Motif name: Motif 274 |
Original motif Consensus sequence: CTGGTCAAGGAAA | Reverse complement motif Consensus sequence: TTTCCTTGACCAG |
Best Matches for Motif ID 274 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 24 |
Motif name: | Motif 24 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 13 |
Similarity score: | 0.0483985 |
Original motif Consensus sequence: CKAGTCAAAGAAA | Reverse complement motif Consensus sequence: TTTCTTTGACTRG |
Dataset #: | 1 |
Motif ID: | 331 |
Motif name: | Motif 331 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 13 |
Similarity score: | 0.0763683 |
Original motif Consensus sequence: CCACCACAGCTCAAGGAGGC | Reverse complement motif Consensus sequence: GCCTCCTTGAGCTGTGGTGG |
Dataset #: | 1 |
Motif ID: | 135 |
Motif name: | Motif 135 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 13 |
Similarity score: | 0.077238 |
Original motif Consensus sequence: CTCTTGTTGCCCAG | Reverse complement motif Consensus sequence: CTGGGCAACAAGAG |
Dataset #: | 1 |
Motif ID: | 179 |
Motif name: | Motif 179 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 13 |
Similarity score: | 0.0876128 |
Original motif Consensus sequence: AGGTCCTTCAGGAGGTATTC | Reverse complement motif Consensus sequence: GAATACCTCCTGAAGGACCT |
Dataset #: | 1 |
Motif ID: | 196 |
Motif name: | Motif 196 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 13 |
Similarity score: | 0.0913407 |
Original motif Consensus sequence: CCTGCCATTGCYSAGGCTTG | Reverse complement motif Consensus sequence: CAAGCCTSKGCAATGGCAGG |
Dataset #: 1 | Motif ID: 275 | Motif name: Motif 275 |
Original motif Consensus sequence: CTCACAGAGTTAAA | Reverse complement motif Consensus sequence: TTTAACTCTGTGAG |
Best Matches for Motif ID 275 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 48 |
Motif name: | Motif 48 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 14 |
Similarity score: | 0.0799887 |
Original motif Consensus sequence: AGCTCCCAGCGTGAGCGACG | Reverse complement motif Consensus sequence: CGTCGCTCACGCTGGGAGCT |
Dataset #: | 1 |
Motif ID: | 137 |
Motif name: | Motif 137 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 7 |
Number of overlap: | 14 |
Similarity score: | 0.0822742 |
Original motif Consensus sequence: AGGTTTGTTACATAGGTAWA | Reverse complement motif Consensus sequence: TWTACCTATGTAACAAACCT |
Dataset #: | 1 |
Motif ID: | 144 |
Motif name: | Motif 144 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 14 |
Similarity score: | 0.0838641 |
Original motif Consensus sequence: CCGCTGCACTGTGGGAGCCC | Reverse complement motif Consensus sequence: GGGCTCCCACAGTGCAGCGG |
Dataset #: | 1 |
Motif ID: | 326 |
Motif name: | Motif 326 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 14 |
Similarity score: | 0.0840845 |
Original motif Consensus sequence: GACATGGAGTCAAAGG | Reverse complement motif Consensus sequence: CCTTTGACTCCATGTC |
Dataset #: | 1 |
Motif ID: | 29 |
Motif name: | Motif 29 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 14 |
Similarity score: | 0.0858362 |
Original motif Consensus sequence: CTGGGCRACAGAGYRAGACY | Reverse complement motif Consensus sequence: MGTCTMKCTCTGTKGCCCAG |
Dataset #: 1 | Motif ID: 276 | Motif name: Motif 276 |
Original motif Consensus sequence: TGGCCTGTTAGGAA | Reverse complement motif Consensus sequence: TTCCTAACAGGCCA |
Best Matches for Motif ID 276 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 45 |
Motif name: | Motif 45 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 14 |
Similarity score: | 0.0718165 |
Original motif Consensus sequence: TGCCCAGTCTGGAAAGTG | Reverse complement motif Consensus sequence: CACTTTCCAGACTGGGCA |
Dataset #: | 1 |
Motif ID: | 308 |
Motif name: | Motif 308 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 6 |
Number of overlap: | 14 |
Similarity score: | 0.0893293 |
Original motif Consensus sequence: AAATTAGGCCAATTAATAAC | Reverse complement motif Consensus sequence: GTTATTAATTGGCCTAATTT |
Dataset #: | 1 |
Motif ID: | 305 |
Motif name: | Motif 305 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 14 |
Similarity score: | 0.099366 |
Original motif Consensus sequence: AATGACCAATTGAGAGC | Reverse complement motif Consensus sequence: GCTCTCAATTGGTCATT |
Dataset #: | 1 |
Motif ID: | 122 |
Motif name: | Motif 122 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 14 |
Similarity score: | 0.100366 |
Original motif Consensus sequence: CCTTGGCCAGCCCAGAAAG | Reverse complement motif Consensus sequence: CTTTCTGGGCTGGCCAAGG |
Dataset #: | 1 |
Motif ID: | 100 |
Motif name: | Motif 100 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 5 |
Number of overlap: | 14 |
Similarity score: | 0.101376 |
Original motif Consensus sequence: GCTGGCCCGCAAGCGCCGCG | Reverse complement motif Consensus sequence: CGCGGCGCTTGCGGGCCAGC |
Dataset #: 1 | Motif ID: 277 | Motif name: Motif 277 |
Original motif Consensus sequence: GCCCTCACCAGAAGC | Reverse complement motif Consensus sequence: GCTTCTGGTGAGGGC |
Best Matches for Motif ID 277 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 96 |
Motif name: | Motif 96 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 15 |
Similarity score: | 0.0937412 |
Original motif Consensus sequence: AAGCTGAGGGAGCCGGCTCC | Reverse complement motif Consensus sequence: GGAGCCGGCTCCCTCAGCTT |
Dataset #: | 1 |
Motif ID: | 84 |
Motif name: | Motif 84 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 15 |
Similarity score: | 0.094292 |
Original motif Consensus sequence: CTGGGTCCCCCAGCAGTGCC | Reverse complement motif Consensus sequence: GGCACTGCTGGGGGACCCAG |
Dataset #: | 1 |
Motif ID: | 48 |
Motif name: | Motif 48 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 5 |
Number of overlap: | 15 |
Similarity score: | 0.0943045 |
Original motif Consensus sequence: AGCTCCCAGCGTGAGCGACG | Reverse complement motif Consensus sequence: CGTCGCTCACGCTGGGAGCT |
Dataset #: | 1 |
Motif ID: | 108 |
Motif name: | Motif 108 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 15 |
Similarity score: | 0.0957474 |
Original motif Consensus sequence: CGAGCCTCCCCGAYGAGCGC | Reverse complement motif Consensus sequence: GCGCTCKTCGGGGAGGCTCG |
Dataset #: | 1 |
Motif ID: | 122 |
Motif name: | Motif 122 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 5 |
Number of overlap: | 15 |
Similarity score: | 0.0961872 |
Original motif Consensus sequence: CCTTGGCCAGCCCAGAAAG | Reverse complement motif Consensus sequence: CTTTCTGGGCTGGCCAAGG |
Dataset #: 1 | Motif ID: 278 | Motif name: Motif 278 |
Original motif Consensus sequence: ACTTTCAGGCATAACA | Reverse complement motif Consensus sequence: TGTTATGCCTGAAAGT |
Best Matches for Motif ID 278 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 52 |
Motif name: | Motif 52 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 16 |
Similarity score: | 0.0883057 |
Original motif Consensus sequence: GACTGGCAGGCAGCTCCACC | Reverse complement motif Consensus sequence: GGTGGAGCTGCCTGCCAGTC |
Dataset #: | 1 |
Motif ID: | 357 |
Motif name: | Motif 357 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 16 |
Similarity score: | 0.101075 |
Original motif Consensus sequence: CAAGTTGACACATAAAATTA | Reverse complement motif Consensus sequence: TAATTTTATGTGTCAACTTG |
Dataset #: | 1 |
Motif ID: | 292 |
Motif name: | Motif 292 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 16 |
Similarity score: | 0.102784 |
Original motif Consensus sequence: AAGACCTTCCAGTGGGACAA | Reverse complement motif Consensus sequence: TTGTCCCACTGGAAGGTCTT |
Dataset #: | 1 |
Motif ID: | 102 |
Motif name: | Motif 102 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 16 |
Similarity score: | 0.110723 |
Original motif Consensus sequence: CTCATTTAATCCTCACAAC | Reverse complement motif Consensus sequence: GTTGTGAGGATTAAATGAG |
Dataset #: | 1 |
Motif ID: | 254 |
Motif name: | Motif 254 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 16 |
Similarity score: | 0.114892 |
Original motif Consensus sequence: AAAATCACAAGCATTCCTAT | Reverse complement motif Consensus sequence: ATAGGAATGCTTGTGATTTT |
Dataset #: 1 | Motif ID: 279 | Motif name: Motif 279 |
Original motif Consensus sequence: GGGGGAGACATCACACR | Reverse complement motif Consensus sequence: MGTGTGATGTCTCCCCC |
Best Matches for Motif ID 279 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 249 |
Motif name: | Motif 249 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 17 |
Similarity score: | 0.10127 |
Original motif Consensus sequence: TGTGAAGAGACCACCAA | Reverse complement motif Consensus sequence: TTGGTGGTCTCTTCACA |
Dataset #: | 1 |
Motif ID: | 92 |
Motif name: | Motif 92 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 17 |
Similarity score: | 0.103877 |
Original motif Consensus sequence: GGGGGCTGACCCCCCCACC | Reverse complement motif Consensus sequence: GGTGGGGGGGTCAGCCCCC |
Dataset #: | 1 |
Motif ID: | 115 |
Motif name: | Motif 115 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 17 |
Similarity score: | 0.104422 |
Original motif Consensus sequence: ATGATCCAGCAATYCCACTH | Reverse complement motif Consensus sequence: HAGTGGKATTGCTGGATCAT |
Dataset #: | 1 |
Motif ID: | 350 |
Motif name: | Motif 350 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 17 |
Similarity score: | 0.106892 |
Original motif Consensus sequence: TCTGGAGTGGACCTCCAGCA | Reverse complement motif Consensus sequence: TGCTGGAGGTCCACTCCAGA |
Dataset #: | 1 |
Motif ID: | 294 |
Motif name: | Motif 294 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 17 |
Similarity score: | 0.107484 |
Original motif Consensus sequence: AGCTGTGAGAAGAGGGCCAC | Reverse complement motif Consensus sequence: GTGGCCCTCTTCTCACAGCT |
Dataset #: 1 | Motif ID: 280 | Motif name: Motif 280 |
Original motif Consensus sequence: CCTAGATTTCAGARGATGT | Reverse complement motif Consensus sequence: ACATCMTCTGAAATCTAGG |
Best Matches for Motif ID 280 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 3 |
Motif name: | Motif 3 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.098089 |
Original motif Consensus sequence: GCTGGAGTGCAGTGGCRYGA | Reverse complement motif Consensus sequence: TCKMGCCACTGCACTCCAGC |
Dataset #: | 1 |
Motif ID: | 196 |
Motif name: | Motif 196 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.110835 |
Original motif Consensus sequence: CCTGCCATTGCYSAGGCTTG | Reverse complement motif Consensus sequence: CAAGCCTSKGCAATGGCAGG |
Dataset #: | 1 |
Motif ID: | 195 |
Motif name: | Motif 195 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.112769 |
Original motif Consensus sequence: TAAAAGACTACAWATTGGGT | Reverse complement motif Consensus sequence: ACCCAATWTGTAGTCTTTTA |
Dataset #: | 1 |
Motif ID: | 262 |
Motif name: | Motif 262 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.114054 |
Original motif Consensus sequence: CTCAGTGTTAATCTCCTGTC | Reverse complement motif Consensus sequence: GACAGGAGATTAACACTGAG |
Dataset #: | 1 |
Motif ID: | 192 |
Motif name: | Motif 192 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.114945 |
Original motif Consensus sequence: GAATCCTGGGACAGCCTGT | Reverse complement motif Consensus sequence: ACAGGCTGTCCCAGGATTC |
Dataset #: 1 | Motif ID: 281 | Motif name: Motif 281 |
Original motif Consensus sequence: AAATGGAATCAT | Reverse complement motif Consensus sequence: ATGATTCCATTT |
Best Matches for Motif ID 281 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 326 |
Motif name: | Motif 326 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 12 |
Similarity score: | 0.0598156 |
Original motif Consensus sequence: GACATGGAGTCAAAGG | Reverse complement motif Consensus sequence: CCTTTGACTCCATGTC |
Dataset #: | 1 |
Motif ID: | 308 |
Motif name: | Motif 308 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 7 |
Number of overlap: | 12 |
Similarity score: | 0.0709771 |
Original motif Consensus sequence: AAATTAGGCCAATTAATAAC | Reverse complement motif Consensus sequence: GTTATTAATTGGCCTAATTT |
Dataset #: | 1 |
Motif ID: | 148 |
Motif name: | Motif 148 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 12 |
Similarity score: | 0.0717431 |
Original motif Consensus sequence: AAAGAGAGTCAGCGAAG | Reverse complement motif Consensus sequence: CTTCGCTGACTCTCTTT |
Dataset #: | 1 |
Motif ID: | 14 |
Motif name: | Motif 14 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 8 |
Number of overlap: | 12 |
Similarity score: | 0.0745254 |
Original motif Consensus sequence: ACCTGGAAAATCGGGTCACT | Reverse complement motif Consensus sequence: AGTGACCCGATTTTCCAGGT |
Dataset #: | 1 |
Motif ID: | 99 |
Motif name: | Motif 99 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 8 |
Number of overlap: | 12 |
Similarity score: | 0.0765832 |
Original motif Consensus sequence: GCAAAKGACATGATYTCATT | Reverse complement motif Consensus sequence: AATGAKATCATGTCYTTTGC |
Dataset #: 1 | Motif ID: 282 | Motif name: Motif 282 |
Original motif Consensus sequence: GTCTCTACTAAAA | Reverse complement motif Consensus sequence: TTTTAGTAGAGAC |
Best Matches for Motif ID 282 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 7 |
Motif name: | Motif 7 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 13 |
Similarity score: | 0.033043 |
Original motif Consensus sequence: GTCTCWAMAAAAAAWAMAAA | Reverse complement motif Consensus sequence: TTTYTWTTTTTTYTWGAGAC |
Dataset #: | 1 |
Motif ID: | 294 |
Motif name: | Motif 294 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 5 |
Number of overlap: | 13 |
Similarity score: | 0.0894973 |
Original motif Consensus sequence: AGCTGTGAGAAGAGGGCCAC | Reverse complement motif Consensus sequence: GTGGCCCTCTTCTCACAGCT |
Dataset #: | 1 |
Motif ID: | 227 |
Motif name: | Motif 227 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 13 |
Similarity score: | 0.0954988 |
Original motif Consensus sequence: CCCAAATCTCATSTTGAAT | Reverse complement motif Consensus sequence: ATTCAASATGAGATTTGGG |
Dataset #: | 1 |
Motif ID: | 232 |
Motif name: | Motif 232 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 13 |
Similarity score: | 0.0959906 |
Original motif Consensus sequence: AGTTGTAATTGGGAGACTT | Reverse complement motif Consensus sequence: AAGTCTCCCAATTACAACT |
Dataset #: | 1 |
Motif ID: | 224 |
Motif name: | Motif 224 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 13 |
Similarity score: | 0.0973832 |
Original motif Consensus sequence: AATGAGTTAAGACTTTG | Reverse complement motif Consensus sequence: CAAAGTCTTAACTCATT |
Dataset #: 1 | Motif ID: 283 | Motif name: Motif 283 |
Original motif Consensus sequence: GCCCTCACCATCC | Reverse complement motif Consensus sequence: GGATGGTGAGGGC |
Best Matches for Motif ID 283 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 277 |
Motif name: | Motif 277 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 13 |
Similarity score: | 0.0577529 |
Original motif Consensus sequence: GCCCTCACCAGAAGC | Reverse complement motif Consensus sequence: GCTTCTGGTGAGGGC |
Dataset #: | 1 |
Motif ID: | 26 |
Motif name: | Motif 26 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 5 |
Number of overlap: | 13 |
Similarity score: | 0.0747837 |
Original motif Consensus sequence: CTCCTGCCTCAGCCTCCCRA | Reverse complement motif Consensus sequence: TMGGGAGGCTGAGGCAGGAG |
Dataset #: | 1 |
Motif ID: | 89 |
Motif name: | Motif 89 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 13 |
Similarity score: | 0.0759531 |
Original motif Consensus sequence: GGCTGCGGAGGGTGTA | Reverse complement motif Consensus sequence: TACACCCTCCGCAGCC |
Dataset #: | 1 |
Motif ID: | 72 |
Motif name: | Motif 72 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 13 |
Similarity score: | 0.0811013 |
Original motif Consensus sequence: CGCACTCCTCAGCC | Reverse complement motif Consensus sequence: GGCTGAGGAGTGCG |
Dataset #: | 1 |
Motif ID: | 100 |
Motif name: | Motif 100 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 13 |
Similarity score: | 0.0835643 |
Original motif Consensus sequence: GCTGGCCCGCAAGCGCCGCG | Reverse complement motif Consensus sequence: CGCGGCGCTTGCGGGCCAGC |
Dataset #: 1 | Motif ID: 284 | Motif name: Motif 284 |
Original motif Consensus sequence: CATTTGGGAGCCCATTGA | Reverse complement motif Consensus sequence: TCAATGGGCTCCCAAATG |
Best Matches for Motif ID 284 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 122 |
Motif name: | Motif 122 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 18 |
Similarity score: | 0.0934546 |
Original motif Consensus sequence: CCTTGGCCAGCCCAGAAAG | Reverse complement motif Consensus sequence: CTTTCTGGGCTGGCCAAGG |
Dataset #: | 1 |
Motif ID: | 235 |
Motif name: | Motif 235 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 18 |
Similarity score: | 0.105262 |
Original motif Consensus sequence: TCCAAATGGGAGAAATTGGC | Reverse complement motif Consensus sequence: GCCAATTTCTCCCATTTGGA |
Dataset #: | 1 |
Motif ID: | 311 |
Motif name: | Motif 311 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 18 |
Similarity score: | 0.106572 |
Original motif Consensus sequence: GGCATCACGGATCCTACCAA | Reverse complement motif Consensus sequence: TTGGTAGGATCCGTGATGCC |
Dataset #: | 1 |
Motif ID: | 104 |
Motif name: | Motif 104 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 18 |
Similarity score: | 0.107655 |
Original motif Consensus sequence: CAACATGGATGRARCTGGAG | Reverse complement motif Consensus sequence: CTCCAGKTMCATCCATGTTG |
Dataset #: | 1 |
Motif ID: | 306 |
Motif name: | Motif 306 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 18 |
Similarity score: | 0.111838 |
Original motif Consensus sequence: GACATGAGCTGGCGCTTG | Reverse complement motif Consensus sequence: CAAGCGCCAGCTCATGTC |
Dataset #: 1 | Motif ID: 285 | Motif name: Motif 285 |
Original motif Consensus sequence: CACTGCACTCCAGC | Reverse complement motif Consensus sequence: GCTGGAGTGCAGTG |
Best Matches for Motif ID 285 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 3 |
Motif name: | Motif 3 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 14 |
Similarity score: | 0.00211425 |
Original motif Consensus sequence: GCTGGAGTGCAGTGGCRYGA | Reverse complement motif Consensus sequence: TCKMGCCACTGCACTCCAGC |
Dataset #: | 1 |
Motif ID: | 149 |
Motif name: | Motif 149 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 14 |
Similarity score: | 0.0792554 |
Original motif Consensus sequence: ACTCAGCCCRCCTGCACCC | Reverse complement motif Consensus sequence: GGGTGCAGGMGGGCTGAGT |
Dataset #: | 1 |
Motif ID: | 350 |
Motif name: | Motif 350 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 14 |
Similarity score: | 0.0809977 |
Original motif Consensus sequence: TCTGGAGTGGACCTCCAGCA | Reverse complement motif Consensus sequence: TGCTGGAGGTCCACTCCAGA |
Dataset #: | 1 |
Motif ID: | 105 |
Motif name: | Motif 105 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 14 |
Similarity score: | 0.0818524 |
Original motif Consensus sequence: GCCTCTCCCTCCACACCTCC | Reverse complement motif Consensus sequence: GGAGGTGTGGAGGGAGAGGC |
Dataset #: | 1 |
Motif ID: | 246 |
Motif name: | Motif 246 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 14 |
Similarity score: | 0.0819031 |
Original motif Consensus sequence: GCAGCTTCACTCCTGA | Reverse complement motif Consensus sequence: TCAGGAGTGAAGCTGC |
Dataset #: 1 | Motif ID: 286 | Motif name: Motif 286 |
Original motif Consensus sequence: CAGGCGGCTGGGAG | Reverse complement motif Consensus sequence: CTCCCAGCCGCCTG |
Best Matches for Motif ID 286 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 165 |
Motif name: | Motif 165 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 7 |
Number of overlap: | 14 |
Similarity score: | 0.0824568 |
Original motif Consensus sequence: ATCTGACAGGAGGYRGAGCT | Reverse complement motif Consensus sequence: AGCTCMKCCTCCTGTCAGAT |
Dataset #: | 1 |
Motif ID: | 36 |
Motif name: | Motif 36 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 14 |
Similarity score: | 0.0825275 |
Original motif Consensus sequence: ACATCCCAGACGATGGGCG | Reverse complement motif Consensus sequence: CGCCCATCGTCTGGGATGT |
Dataset #: | 1 |
Motif ID: | 309 |
Motif name: | Motif 309 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 14 |
Similarity score: | 0.0841785 |
Original motif Consensus sequence: CATTCTGGGGTCTGGAGGAY | Reverse complement motif Consensus sequence: MTCCTCCAGACCCCAGAATG |
Dataset #: | 1 |
Motif ID: | 125 |
Motif name: | Motif 125 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 14 |
Similarity score: | 0.0849087 |
Original motif Consensus sequence: CGCCCGGCCAGCCGC | Reverse complement motif Consensus sequence: GCGGCTGGCCGGGCG |
Dataset #: | 1 |
Motif ID: | 60 |
Motif name: | Motif 60 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 14 |
Similarity score: | 0.0884768 |
Original motif Consensus sequence: GATCACGAGGTCAGGAG | Reverse complement motif Consensus sequence: CTCCTGACCTCGTGATC |
Dataset #: 1 | Motif ID: 287 | Motif name: Motif 287 |
Original motif Consensus sequence: CATTATGCTAARTG | Reverse complement motif Consensus sequence: CAMTTAGCATAATG |
Best Matches for Motif ID 287 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 308 |
Motif name: | Motif 308 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 14 |
Similarity score: | 0.0753566 |
Original motif Consensus sequence: AAATTAGGCCAATTAATAAC | Reverse complement motif Consensus sequence: GTTATTAATTGGCCTAATTT |
Dataset #: | 1 |
Motif ID: | 70 |
Motif name: | Motif 70 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 14 |
Similarity score: | 0.0796028 |
Original motif Consensus sequence: CTATTGTGAATARTGCTGC | Reverse complement motif Consensus sequence: GCAGCAMTATTCACAATAG |
Dataset #: | 1 |
Motif ID: | 58 |
Motif name: | Motif 58 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 14 |
Similarity score: | 0.0797498 |
Original motif Consensus sequence: ATGGACAYTTRGGTTGHTTC | Reverse complement motif Consensus sequence: GAAHCAACCKAAKTGTCCAT |
Dataset #: | 1 |
Motif ID: | 45 |
Motif name: | Motif 45 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 5 |
Number of overlap: | 14 |
Similarity score: | 0.0807351 |
Original motif Consensus sequence: TGCCCAGTCTGGAAAGTG | Reverse complement motif Consensus sequence: CACTTTCCAGACTGGGCA |
Dataset #: | 1 |
Motif ID: | 280 |
Motif name: | Motif 280 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 5 |
Number of overlap: | 14 |
Similarity score: | 0.090033 |
Original motif Consensus sequence: CCTAGATTTCAGARGATGT | Reverse complement motif Consensus sequence: ACATCMTCTGAAATCTAGG |
Dataset #: 1 | Motif ID: 288 | Motif name: Motif 288 |
Original motif Consensus sequence: CCCAAGTCCC | Reverse complement motif Consensus sequence: GGGACTTGGG |
Best Matches for Motif ID 288 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 169 |
Motif name: | Motif 169 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 7 |
Number of overlap: | 10 |
Similarity score: | 0.0450065 |
Original motif Consensus sequence: CCCAAATCCTATAAAA | Reverse complement motif Consensus sequence: TTTTATAGGATTTGGG |
Dataset #: | 1 |
Motif ID: | 227 |
Motif name: | Motif 227 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 10 |
Number of overlap: | 10 |
Similarity score: | 0.0494747 |
Original motif Consensus sequence: CCCAAATCTCATSTTGAAT | Reverse complement motif Consensus sequence: ATTCAASATGAGATTTGGG |
Dataset #: | 1 |
Motif ID: | 231 |
Motif name: | Motif 231 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 10 |
Similarity score: | 0.0498601 |
Original motif Consensus sequence: ACAAGGCAAGTCCCTTCY | Reverse complement motif Consensus sequence: MGAAGGGACTTGCCTTGT |
Dataset #: | 1 |
Motif ID: | 267 |
Motif name: | Motif 267 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 10 |
Similarity score: | 0.0528606 |
Original motif Consensus sequence: ATGGACTTGAGA | Reverse complement motif Consensus sequence: TCTCAAGTCCAT |
Dataset #: | 1 |
Motif ID: | 164 |
Motif name: | Motif 164 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 8 |
Number of overlap: | 10 |
Similarity score: | 0.0606246 |
Original motif Consensus sequence: AGCCCCGGTTCCCGCYCGC | Reverse complement motif Consensus sequence: GCGMGCGGGAACCGGGGCT |
Dataset #: 1 | Motif ID: 289 | Motif name: Motif 289 |
Original motif Consensus sequence: TGATGGGTGCACCAAA | Reverse complement motif Consensus sequence: TTTGGTGCACCCATCA |
Best Matches for Motif ID 289 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 17 |
Motif name: | Motif 17 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 16 |
Similarity score: | 0.100149 |
Original motif Consensus sequence: AGACAGTGGGYGCAGGHCA | Reverse complement motif Consensus sequence: TGHCCTGCKCCCACTGTCT |
Dataset #: | 1 |
Motif ID: | 106 |
Motif name: | Motif 106 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 16 |
Similarity score: | 0.103791 |
Original motif Consensus sequence: ATTGGTGTATTTACAATCCC | Reverse complement motif Consensus sequence: GGGATTGTAAATACACCAAT |
Dataset #: | 1 |
Motif ID: | 249 |
Motif name: | Motif 249 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 16 |
Similarity score: | 0.105577 |
Original motif Consensus sequence: TGTGAAGAGACCACCAA | Reverse complement motif Consensus sequence: TTGGTGGTCTCTTCACA |
Dataset #: | 1 |
Motif ID: | 341 |
Motif name: | Motif 341 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 16 |
Similarity score: | 0.107792 |
Original motif Consensus sequence: ATCCATCCATCCATCCA | Reverse complement motif Consensus sequence: TGGATGGATGGATGGAT |
Dataset #: | 1 |
Motif ID: | 311 |
Motif name: | Motif 311 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 16 |
Similarity score: | 0.109184 |
Original motif Consensus sequence: GGCATCACGGATCCTACCAA | Reverse complement motif Consensus sequence: TTGGTAGGATCCGTGATGCC |
Dataset #: 1 | Motif ID: 290 | Motif name: Motif 290 |
Original motif Consensus sequence: TGATACCCAGGCAAACAG | Reverse complement motif Consensus sequence: CTGTTTGCCTGGGTATCA |
Best Matches for Motif ID 290 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 170 |
Motif name: | Motif 170 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 18 |
Similarity score: | 0.0975901 |
Original motif Consensus sequence: AATCAACCCTGGYRATCAAT | Reverse complement motif Consensus sequence: ATTGATMKCCAGGGTTGATT |
Dataset #: | 1 |
Motif ID: | 67 |
Motif name: | Motif 67 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 18 |
Similarity score: | 0.0999158 |
Original motif Consensus sequence: CTGGGCTCCTGAGTCTGGTG | Reverse complement motif Consensus sequence: CACCAGACTCAGGAGCCCAG |
Dataset #: | 1 |
Motif ID: | 112 |
Motif name: | Motif 112 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 18 |
Similarity score: | 0.107254 |
Original motif Consensus sequence: GCTGTGTGACCTTGGGCAAG | Reverse complement motif Consensus sequence: CTTGCCCAAGGTCACACAGC |
Dataset #: | 1 |
Motif ID: | 66 |
Motif name: | Motif 66 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 18 |
Similarity score: | 0.10792 |
Original motif Consensus sequence: ACACACAYACACACACACA | Reverse complement motif Consensus sequence: TGTGTGTGTGTKTGTGTGT |
Dataset #: | 1 |
Motif ID: | 160 |
Motif name: | Motif 160 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 18 |
Similarity score: | 0.112251 |
Original motif Consensus sequence: AAATTACCCAGTCTCAGGTA | Reverse complement motif Consensus sequence: TACCTGAGACTGGGTAATTT |
Dataset #: 1 | Motif ID: 291 | Motif name: Motif 291 |
Original motif Consensus sequence: CTGAGGACCTGAGGTCRTA | Reverse complement motif Consensus sequence: TAMGACCTCAGGTCCTCAG |
Best Matches for Motif ID 291 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 63 |
Motif name: | Motif 63 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.0928513 |
Original motif Consensus sequence: AGTGAGAACATRYRRTRTTT | Reverse complement motif Consensus sequence: AAAMAMMKMATGTTCTCACT |
Dataset #: | 1 |
Motif ID: | 99 |
Motif name: | Motif 99 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.0929924 |
Original motif Consensus sequence: GCAAAKGACATGATYTCATT | Reverse complement motif Consensus sequence: AATGAKATCATGTCYTTTGC |
Dataset #: | 1 |
Motif ID: | 67 |
Motif name: | Motif 67 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.105301 |
Original motif Consensus sequence: CTGGGCTCCTGAGTCTGGTG | Reverse complement motif Consensus sequence: CACCAGACTCAGGAGCCCAG |
Dataset #: | 1 |
Motif ID: | 26 |
Motif name: | Motif 26 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.114654 |
Original motif Consensus sequence: CTCCTGCCTCAGCCTCCCRA | Reverse complement motif Consensus sequence: TMGGGAGGCTGAGGCAGGAG |
Dataset #: | 1 |
Motif ID: | 56 |
Motif name: | Motif 56 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.117941 |
Original motif Consensus sequence: CRTGAGCCACYGYRCCYGGC | Reverse complement motif Consensus sequence: GCCKGGMKCMGTGGCTCAKG |
Dataset #: 1 | Motif ID: 292 | Motif name: Motif 292 |
Original motif Consensus sequence: AAGACCTTCCAGTGGGACAA | Reverse complement motif Consensus sequence: TTGTCCCACTGGAAGGTCTT |
Best Matches for Motif ID 292 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 179 |
Motif name: | Motif 179 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.094932 |
Original motif Consensus sequence: AGGTCCTTCAGGAGGTATTC | Reverse complement motif Consensus sequence: GAATACCTCCTGAAGGACCT |
Dataset #: | 1 |
Motif ID: | 119 |
Motif name: | Motif 119 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.106872 |
Original motif Consensus sequence: AAGTCCAAGATCAAGGTGYY | Reverse complement motif Consensus sequence: KKCACCTTGATCTTGGACTT |
Dataset #: | 1 |
Motif ID: | 176 |
Motif name: | Motif 176 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.109322 |
Original motif Consensus sequence: AGGCCCCAGTGTSTGTTGTT | Reverse complement motif Consensus sequence: AACAACASACACTGGGGCCT |
Dataset #: | 1 |
Motif ID: | 178 |
Motif name: | Motif 178 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.112394 |
Original motif Consensus sequence: ACTGTCTTCCACCTCCACAT | Reverse complement motif Consensus sequence: ATGTGGAGGTGGAAGACAGT |
Dataset #: | 1 |
Motif ID: | 115 |
Motif name: | Motif 115 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.11745 |
Original motif Consensus sequence: ATGATCCAGCAATYCCACTH | Reverse complement motif Consensus sequence: HAGTGGKATTGCTGGATCAT |
Dataset #: 1 | Motif ID: 293 | Motif name: Motif 293 |
Original motif Consensus sequence: CTGACTGGGAGACACCTCCC | Reverse complement motif Consensus sequence: GGGAGGTGTCTCCCAGTCAG |
Best Matches for Motif ID 293 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 262 |
Motif name: | Motif 262 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.106264 |
Original motif Consensus sequence: CTCAGTGTTAATCTCCTGTC | Reverse complement motif Consensus sequence: GACAGGAGATTAACACTGAG |
Dataset #: | 1 |
Motif ID: | 16 |
Motif name: | Motif 16 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.115344 |
Original motif Consensus sequence: GAAAGGGAACTCCCTGACCC | Reverse complement motif Consensus sequence: GGGTCAGGGAGTTCCCTTTC |
Dataset #: | 1 |
Motif ID: | 312 |
Motif name: | Motif 312 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.123537 |
Original motif Consensus sequence: AGGACTGAGGGTGCCYRGGG | Reverse complement motif Consensus sequence: CCCMKGGCACCCTCAGTCCT |
Dataset #: | 1 |
Motif ID: | 112 |
Motif name: | Motif 112 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.126725 |
Original motif Consensus sequence: GCTGTGTGACCTTGGGCAAG | Reverse complement motif Consensus sequence: CTTGCCCAAGGTCACACAGC |
Dataset #: | 1 |
Motif ID: | 65 |
Motif name: | Motif 65 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.133644 |
Original motif Consensus sequence: AGAAATCGAGCRCAGCGCCG | Reverse complement motif Consensus sequence: CGGCGCTGMGCTCGATTTCT |
Dataset #: 1 | Motif ID: 294 | Motif name: Motif 294 |
Original motif Consensus sequence: AGCTGTGAGAAGAGGGCCAC | Reverse complement motif Consensus sequence: GTGGCCCTCTTCTCACAGCT |
Best Matches for Motif ID 294 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 201 |
Motif name: | Motif 201 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.113168 |
Original motif Consensus sequence: GTAACACTCACCGCGARGGT | Reverse complement motif Consensus sequence: ACCKTCGCGGTGAGTGTTAC |
Dataset #: | 1 |
Motif ID: | 145 |
Motif name: | Motif 145 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.119835 |
Original motif Consensus sequence: GCCAGTCACAAAARGACAMA | Reverse complement motif Consensus sequence: TYTGTCMTTTTGTGACTGGC |
Dataset #: | 1 |
Motif ID: | 165 |
Motif name: | Motif 165 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.122097 |
Original motif Consensus sequence: ATCTGACAGGAGGYRGAGCT | Reverse complement motif Consensus sequence: AGCTCMKCCTCCTGTCAGAT |
Dataset #: | 1 |
Motif ID: | 105 |
Motif name: | Motif 105 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.122268 |
Original motif Consensus sequence: GCCTCTCCCTCCACACCTCC | Reverse complement motif Consensus sequence: GGAGGTGTGGAGGGAGAGGC |
Dataset #: | 1 |
Motif ID: | 179 |
Motif name: | Motif 179 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.127957 |
Original motif Consensus sequence: AGGTCCTTCAGGAGGTATTC | Reverse complement motif Consensus sequence: GAATACCTCCTGAAGGACCT |
Dataset #: 1 | Motif ID: 295 | Motif name: Motif 295 |
Original motif Consensus sequence: CCCCGCCCC | Reverse complement motif Consensus sequence: GGGGCGGGG |
Best Matches for Motif ID 295 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 78 |
Motif name: | Motif 78 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 5 |
Number of overlap: | 9 |
Similarity score: | 0.02574 |
Original motif Consensus sequence: CGAGCCCTGCCCCGCGG | Reverse complement motif Consensus sequence: CCGCGGGGCAGGGCTCG |
Dataset #: | 1 |
Motif ID: | 250 |
Motif name: | Motif 250 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 9 |
Similarity score: | 0.0380756 |
Original motif Consensus sequence: CCACCGCTCC | Reverse complement motif Consensus sequence: GGAGCGGTGG |
Dataset #: | 1 |
Motif ID: | 46 |
Motif name: | Motif 46 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 9 |
Similarity score: | 0.0387901 |
Original motif Consensus sequence: CCCCWCCCCCA | Reverse complement motif Consensus sequence: TGGGGGWGGGG |
Dataset #: | 1 |
Motif ID: | 92 |
Motif name: | Motif 92 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 9 |
Similarity score: | 0.047748 |
Original motif Consensus sequence: GGGGGCTGACCCCCCCACC | Reverse complement motif Consensus sequence: GGTGGGGGGGTCAGCCCCC |
Dataset #: | 1 |
Motif ID: | 16 |
Motif name: | Motif 16 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 9 |
Similarity score: | 0.0495574 |
Original motif Consensus sequence: GAAAGGGAACTCCCTGACCC | Reverse complement motif Consensus sequence: GGGTCAGGGAGTTCCCTTTC |
Dataset #: 1 | Motif ID: 296 | Motif name: Motif 296 |
Original motif Consensus sequence: CCACGTGG | Reverse complement motif Consensus sequence: CCACGTGG |
Best Matches for Motif ID 296 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 120 |
Motif name: | Motif 120 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 5 |
Number of overlap: | 8 |
Similarity score: | 0.0506234 |
Original motif Consensus sequence: CCATGTGSTCCC | Reverse complement motif Consensus sequence: GGGASCACATGG |
Dataset #: | 1 |
Motif ID: | 61 |
Motif name: | Motif 61 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 5 |
Number of overlap: | 8 |
Similarity score: | 0.0551535 |
Original motif Consensus sequence: GGATCCACTGGGTGAAGCCA | Reverse complement motif Consensus sequence: TGGCTTCACCCAGTGGATCC |
Dataset #: | 1 |
Motif ID: | 98 |
Motif name: | Motif 98 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 8 |
Number of overlap: | 8 |
Similarity score: | 0.0566616 |
Original motif Consensus sequence: AGTTCCGGGTGGGCGTGGG | Reverse complement motif Consensus sequence: CCCACGCCCACCCGGAACT |
Dataset #: | 1 |
Motif ID: | 104 |
Motif name: | Motif 104 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 13 |
Number of overlap: | 8 |
Similarity score: | 0.0583814 |
Original motif Consensus sequence: CAACATGGATGRARCTGGAG | Reverse complement motif Consensus sequence: CTCCAGKTMCATCCATGTTG |
Dataset #: | 1 |
Motif ID: | 163 |
Motif name: | Motif 163 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 6 |
Number of overlap: | 8 |
Similarity score: | 0.0613138 |
Original motif Consensus sequence: CCTCCGTGGGCTCC | Reverse complement motif Consensus sequence: GGAGCCCACGGAGG |
Dataset #: 1 | Motif ID: 297 | Motif name: Motif 297 |
Original motif Consensus sequence: ACCAATCAGCA | Reverse complement motif Consensus sequence: TGCTGATTGGT |
Best Matches for Motif ID 297 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 261 |
Motif name: | Motif 261 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 11 |
Similarity score: | 0.0606967 |
Original motif Consensus sequence: ATCTCASAAATCACCACTA | Reverse complement motif Consensus sequence: TAGTGGTGATTTSTGAGAT |
Dataset #: | 1 |
Motif ID: | 336 |
Motif name: | Motif 336 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 11 |
Similarity score: | 0.0632904 |
Original motif Consensus sequence: ATGTAACCAAAYACCACCTG | Reverse complement motif Consensus sequence: CAGGTGGTKTTTGGTTACAT |
Dataset #: | 1 |
Motif ID: | 347 |
Motif name: | Motif 347 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 11 |
Similarity score: | 0.0719846 |
Original motif Consensus sequence: ACACCTATTCGCACAC | Reverse complement motif Consensus sequence: GTGTGCGAATAGGTGT |
Dataset #: | 1 |
Motif ID: | 363 |
Motif name: | Motif 363 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 11 |
Similarity score: | 0.0728365 |
Original motif Consensus sequence: CAAGGTCTGATTGTW | Reverse complement motif Consensus sequence: WACAATCAGACCTTG |
Dataset #: | 1 |
Motif ID: | 35 |
Motif name: | Motif 35 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 11 |
Similarity score: | 0.0840444 |
Original motif Consensus sequence: CAGAAATCACCCGTCTT | Reverse complement motif Consensus sequence: AAGACGGGTGATTTCTG |
Dataset #: 1 | Motif ID: 298 | Motif name: Motif 298 |
Original motif Consensus sequence: ATAGAGGAGGACC | Reverse complement motif Consensus sequence: GGTCCTCCTCTAT |
Best Matches for Motif ID 298 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 260 |
Motif name: | Motif 260 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 13 |
Similarity score: | 0.0631665 |
Original motif Consensus sequence: GGTGCCCCTCTGGGACRAA | Reverse complement motif Consensus sequence: TTMGTCCCAGAGGGGCACC |
Dataset #: | 1 |
Motif ID: | 294 |
Motif name: | Motif 294 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 6 |
Number of overlap: | 13 |
Similarity score: | 0.0642679 |
Original motif Consensus sequence: AGCTGTGAGAAGAGGGCCAC | Reverse complement motif Consensus sequence: GTGGCCCTCTTCTCACAGCT |
Dataset #: | 1 |
Motif ID: | 29 |
Motif name: | Motif 29 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 8 |
Number of overlap: | 13 |
Similarity score: | 0.0658365 |
Original motif Consensus sequence: CTGGGCRACAGAGYRAGACY | Reverse complement motif Consensus sequence: MGTCTMKCTCTGTKGCCCAG |
Dataset #: | 1 |
Motif ID: | 253 |
Motif name: | Motif 253 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 13 |
Similarity score: | 0.0707264 |
Original motif Consensus sequence: AGAGTCTCACTCTGT | Reverse complement motif Consensus sequence: ACAGAGTGAGACTCT |
Dataset #: | 1 |
Motif ID: | 108 |
Motif name: | Motif 108 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 13 |
Similarity score: | 0.0811499 |
Original motif Consensus sequence: CGAGCCTCCCCGAYGAGCGC | Reverse complement motif Consensus sequence: GCGCTCKTCGGGGAGGCTCG |
Dataset #: 1 | Motif ID: 299 | Motif name: Motif 299 |
Original motif Consensus sequence: CCCTGCTAGAACCTCCAA | Reverse complement motif Consensus sequence: TTGGAGGTTCTAGCAGGG |
Best Matches for Motif ID 299 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 26 |
Motif name: | Motif 26 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 18 |
Similarity score: | 0.0856135 |
Original motif Consensus sequence: CTCCTGCCTCAGCCTCCCRA | Reverse complement motif Consensus sequence: TMGGGAGGCTGAGGCAGGAG |
Dataset #: | 1 |
Motif ID: | 178 |
Motif name: | Motif 178 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 18 |
Similarity score: | 0.097377 |
Original motif Consensus sequence: ACTGTCTTCCACCTCCACAT | Reverse complement motif Consensus sequence: ATGTGGAGGTGGAAGACAGT |
Dataset #: | 1 |
Motif ID: | 84 |
Motif name: | Motif 84 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 18 |
Similarity score: | 0.100452 |
Original motif Consensus sequence: CTGGGTCCCCCAGCAGTGCC | Reverse complement motif Consensus sequence: GGCACTGCTGGGGGACCCAG |
Dataset #: | 1 |
Motif ID: | 350 |
Motif name: | Motif 350 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 18 |
Similarity score: | 0.100799 |
Original motif Consensus sequence: TCTGGAGTGGACCTCCAGCA | Reverse complement motif Consensus sequence: TGCTGGAGGTCCACTCCAGA |
Dataset #: | 1 |
Motif ID: | 52 |
Motif name: | Motif 52 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 18 |
Similarity score: | 0.102664 |
Original motif Consensus sequence: GACTGGCAGGCAGCTCCACC | Reverse complement motif Consensus sequence: GGTGGAGCTGCCTGCCAGTC |
Dataset #: 1 | Motif ID: 300 | Motif name: Motif 300 |
Original motif Consensus sequence: CATTTTACAGA | Reverse complement motif Consensus sequence: TCTGTAAAATG |
Best Matches for Motif ID 300 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 45 |
Motif name: | Motif 45 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 11 |
Similarity score: | 0.0501861 |
Original motif Consensus sequence: TGCCCAGTCTGGAAAGTG | Reverse complement motif Consensus sequence: CACTTTCCAGACTGGGCA |
Dataset #: | 1 |
Motif ID: | 233 |
Motif name: | Motif 233 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 11 |
Similarity score: | 0.071946 |
Original motif Consensus sequence: GTTAACTGTAAAACAGCCT | Reverse complement motif Consensus sequence: AGGCTGTTTTACAGTTAAC |
Dataset #: | 1 |
Motif ID: | 14 |
Motif name: | Motif 14 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 9 |
Number of overlap: | 11 |
Similarity score: | 0.0723755 |
Original motif Consensus sequence: ACCTGGAAAATCGGGTCACT | Reverse complement motif Consensus sequence: AGTGACCCGATTTTCCAGGT |
Dataset #: | 1 |
Motif ID: | 27 |
Motif name: | Motif 27 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 11 |
Similarity score: | 0.0735422 |
Original motif Consensus sequence: CACTTCCCAGACGGGGCG | Reverse complement motif Consensus sequence: CGCCCCGTCTGGGAAGTG |
Dataset #: | 1 |
Motif ID: | 156 |
Motif name: | Motif 156 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 11 |
Similarity score: | 0.0773708 |
Original motif Consensus sequence: CACTTCCCAGAC | Reverse complement motif Consensus sequence: GTCTGGGAAGTG |
Dataset #: 1 | Motif ID: 301 | Motif name: Motif 301 |
Original motif Consensus sequence: CCAAGACYCCAGAC | Reverse complement motif Consensus sequence: GTCTGGMGTCTTGG |
Best Matches for Motif ID 301 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 309 |
Motif name: | Motif 309 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 14 |
Similarity score: | 0.0547706 |
Original motif Consensus sequence: CATTCTGGGGTCTGGAGGAY | Reverse complement motif Consensus sequence: MTCCTCCAGACCCCAGAATG |
Dataset #: | 1 |
Motif ID: | 280 |
Motif name: | Motif 280 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 14 |
Similarity score: | 0.0659934 |
Original motif Consensus sequence: CCTAGATTTCAGARGATGT | Reverse complement motif Consensus sequence: ACATCMTCTGAAATCTAGG |
Dataset #: | 1 |
Motif ID: | 234 |
Motif name: | Motif 234 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 14 |
Similarity score: | 0.0768046 |
Original motif Consensus sequence: AAGGAACAAACTCCRGACAC | Reverse complement motif Consensus sequence: GTGTCKGGAGTTTGTTCCTT |
Dataset #: | 1 |
Motif ID: | 195 |
Motif name: | Motif 195 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 6 |
Number of overlap: | 14 |
Similarity score: | 0.0814768 |
Original motif Consensus sequence: TAAAAGACTACAWATTGGGT | Reverse complement motif Consensus sequence: ACCCAATWTGTAGTCTTTTA |
Dataset #: | 1 |
Motif ID: | 56 |
Motif name: | Motif 56 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 7 |
Number of overlap: | 14 |
Similarity score: | 0.0823107 |
Original motif Consensus sequence: CRTGAGCCACYGYRCCYGGC | Reverse complement motif Consensus sequence: GCCKGGMKCMGTGGCTCAKG |
Dataset #: 1 | Motif ID: 302 | Motif name: Motif 302 |
Original motif Consensus sequence: GACCCTGAGAGC | Reverse complement motif Consensus sequence: GCTCTCAGGGTC |
Best Matches for Motif ID 302 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 340 |
Motif name: | Motif 340 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 12 |
Similarity score: | 0.0268873 |
Original motif Consensus sequence: GACCCAGAGAGC | Reverse complement motif Consensus sequence: GCTCTCTGGGTC |
Dataset #: | 1 |
Motif ID: | 362 |
Motif name: | Motif 362 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 12 |
Similarity score: | 0.0423209 |
Original motif Consensus sequence: GCTCTGAAGGTCC | Reverse complement motif Consensus sequence: GGACCTTCAGAGC |
Dataset #: | 1 |
Motif ID: | 323 |
Motif name: | Motif 323 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 12 |
Similarity score: | 0.0548786 |
Original motif Consensus sequence: GCTCTCAGGTCCA | Reverse complement motif Consensus sequence: TGGACCTGAGAGC |
Dataset #: | 1 |
Motif ID: | 10 |
Motif name: | Motif 10 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 12 |
Similarity score: | 0.0701639 |
Original motif Consensus sequence: AGGASCSTCYSWGCCMGGY | Reverse complement motif Consensus sequence: MCCYGGCWSMGASGSTCCT |
Dataset #: | 1 |
Motif ID: | 17 |
Motif name: | Motif 17 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 12 |
Similarity score: | 0.0731393 |
Original motif Consensus sequence: AGACAGTGGGYGCAGGHCA | Reverse complement motif Consensus sequence: TGHCCTGCKCCCACTGTCT |
Dataset #: 1 | Motif ID: 303 | Motif name: Motif 303 |
Original motif Consensus sequence: AGTTCTTAAAGATGGT | Reverse complement motif Consensus sequence: ACCATCTTTAAGAACT |
Best Matches for Motif ID 303 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 179 |
Motif name: | Motif 179 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 16 |
Similarity score: | 0.0731282 |
Original motif Consensus sequence: AGGTCCTTCAGGAGGTATTC | Reverse complement motif Consensus sequence: GAATACCTCCTGAAGGACCT |
Dataset #: | 1 |
Motif ID: | 190 |
Motif name: | Motif 190 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 16 |
Similarity score: | 0.0867922 |
Original motif Consensus sequence: CAAAGGCATAAGAATGAT | Reverse complement motif Consensus sequence: ATCATTCTTATGCCTTTG |
Dataset #: | 1 |
Motif ID: | 202 |
Motif name: | Motif 202 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 16 |
Similarity score: | 0.0876942 |
Original motif Consensus sequence: ACACATCACAAAGCAGTTTC | Reverse complement motif Consensus sequence: GAAACTGCTTTGTGATGTGT |
Dataset #: | 1 |
Motif ID: | 21 |
Motif name: | Motif 21 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 16 |
Similarity score: | 0.0880938 |
Original motif Consensus sequence: GCCGTTTKTTAAGCCCGTY | Reverse complement motif Consensus sequence: KACGGGCTTAARAAACGGC |
Dataset #: | 1 |
Motif ID: | 242 |
Motif name: | Motif 242 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 16 |
Similarity score: | 0.088173 |
Original motif Consensus sequence: AACCCTATTGTGAACTGYG | Reverse complement motif Consensus sequence: CMCAGTTCACAATAGGGTT |
Dataset #: 1 | Motif ID: 304 | Motif name: Motif 304 |
Original motif Consensus sequence: AGTGTTTCCAAMCTGCT | Reverse complement motif Consensus sequence: AGCAGYTTGGAAACACT |
Best Matches for Motif ID 304 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 139 |
Motif name: | Motif 139 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 17 |
Similarity score: | 0.0916595 |
Original motif Consensus sequence: AGCCYCTGGYAACCAYYAWT | Reverse complement motif Consensus sequence: AWTKKTGGTTKCCAGKGGCT |
Dataset #: | 1 |
Motif ID: | 178 |
Motif name: | Motif 178 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 17 |
Similarity score: | 0.0916702 |
Original motif Consensus sequence: ACTGTCTTCCACCTCCACAT | Reverse complement motif Consensus sequence: ATGTGGAGGTGGAAGACAGT |
Dataset #: | 1 |
Motif ID: | 194 |
Motif name: | Motif 194 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 17 |
Similarity score: | 0.095632 |
Original motif Consensus sequence: CAAGGGTATAYGAGTAGCTG | Reverse complement motif Consensus sequence: CAGCTACTCKTATACCCTTG |
Dataset #: | 1 |
Motif ID: | 262 |
Motif name: | Motif 262 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 17 |
Similarity score: | 0.102026 |
Original motif Consensus sequence: CTCAGTGTTAATCTCCTGTC | Reverse complement motif Consensus sequence: GACAGGAGATTAACACTGAG |
Dataset #: | 1 |
Motif ID: | 235 |
Motif name: | Motif 235 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 17 |
Similarity score: | 0.107468 |
Original motif Consensus sequence: TCCAAATGGGAGAAATTGGC | Reverse complement motif Consensus sequence: GCCAATTTCTCCCATTTGGA |
Dataset #: 1 | Motif ID: 305 | Motif name: Motif 305 |
Original motif Consensus sequence: AATGACCAATTGAGAGC | Reverse complement motif Consensus sequence: GCTCTCAATTGGTCATT |
Best Matches for Motif ID 305 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 332 |
Motif name: | Motif 332 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 17 |
Similarity score: | 0.0848872 |
Original motif Consensus sequence: CTGGCCCTCAATGGTTAAAC | Reverse complement motif Consensus sequence: GTTTAACCATTGAGGGCCAG |
Dataset #: | 1 |
Motif ID: | 170 |
Motif name: | Motif 170 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 17 |
Similarity score: | 0.0979755 |
Original motif Consensus sequence: AATCAACCCTGGYRATCAAT | Reverse complement motif Consensus sequence: ATTGATMKCCAGGGTTGATT |
Dataset #: | 1 |
Motif ID: | 308 |
Motif name: | Motif 308 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 17 |
Similarity score: | 0.101217 |
Original motif Consensus sequence: AAATTAGGCCAATTAATAAC | Reverse complement motif Consensus sequence: GTTATTAATTGGCCTAATTT |
Dataset #: | 1 |
Motif ID: | 261 |
Motif name: | Motif 261 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 17 |
Similarity score: | 0.103313 |
Original motif Consensus sequence: ATCTCASAAATCACCACTA | Reverse complement motif Consensus sequence: TAGTGGTGATTTSTGAGAT |
Dataset #: | 1 |
Motif ID: | 160 |
Motif name: | Motif 160 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 17 |
Similarity score: | 0.106625 |
Original motif Consensus sequence: AAATTACCCAGTCTCAGGTA | Reverse complement motif Consensus sequence: TACCTGAGACTGGGTAATTT |
Dataset #: 1 | Motif ID: 306 | Motif name: Motif 306 |
Original motif Consensus sequence: GACATGAGCTGGCGCTTG | Reverse complement motif Consensus sequence: CAAGCGCCAGCTCATGTC |
Best Matches for Motif ID 306 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 333 |
Motif name: | Motif 333 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 18 |
Similarity score: | 0.102628 |
Original motif Consensus sequence: TAGATAATAGCTCCAGCTTT | Reverse complement motif Consensus sequence: AAAGCTGGAGCTATTATCTA |
Dataset #: | 1 |
Motif ID: | 262 |
Motif name: | Motif 262 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 18 |
Similarity score: | 0.107908 |
Original motif Consensus sequence: CTCAGTGTTAATCTCCTGTC | Reverse complement motif Consensus sequence: GACAGGAGATTAACACTGAG |
Dataset #: | 1 |
Motif ID: | 234 |
Motif name: | Motif 234 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 18 |
Similarity score: | 0.118321 |
Original motif Consensus sequence: AAGGAACAAACTCCRGACAC | Reverse complement motif Consensus sequence: GTGTCKGGAGTTTGTTCCTT |
Dataset #: | 1 |
Motif ID: | 202 |
Motif name: | Motif 202 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 18 |
Similarity score: | 0.118931 |
Original motif Consensus sequence: ACACATCACAAAGCAGTTTC | Reverse complement motif Consensus sequence: GAAACTGCTTTGTGATGTGT |
Dataset #: | 1 |
Motif ID: | 284 |
Motif name: | Motif 284 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 18 |
Similarity score: | 0.119654 |
Original motif Consensus sequence: CATTTGGGAGCCCATTGA | Reverse complement motif Consensus sequence: TCAATGGGCTCCCAAATG |
Dataset #: 1 | Motif ID: 307 | Motif name: Motif 307 |
Original motif Consensus sequence: AGATGCCAGCCAGAGCTCT | Reverse complement motif Consensus sequence: AGAGCTCTGGCTGGCATCT |
Best Matches for Motif ID 307 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 48 |
Motif name: | Motif 48 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.0871974 |
Original motif Consensus sequence: AGCTCCCAGCGTGAGCGACG | Reverse complement motif Consensus sequence: CGTCGCTCACGCTGGGAGCT |
Dataset #: | 1 |
Motif ID: | 333 |
Motif name: | Motif 333 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.0921664 |
Original motif Consensus sequence: TAGATAATAGCTCCAGCTTT | Reverse complement motif Consensus sequence: AAAGCTGGAGCTATTATCTA |
Dataset #: | 1 |
Motif ID: | 310 |
Motif name: | Motif 310 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.0945368 |
Original motif Consensus sequence: CCCATGCAAGTCYRAAATCC | Reverse complement motif Consensus sequence: GGATTTMKGACTTGCATGGG |
Dataset #: | 1 |
Motif ID: | 115 |
Motif name: | Motif 115 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.107882 |
Original motif Consensus sequence: ATGATCCAGCAATYCCACTH | Reverse complement motif Consensus sequence: HAGTGGKATTGCTGGATCAT |
Dataset #: | 1 |
Motif ID: | 36 |
Motif name: | Motif 36 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.112048 |
Original motif Consensus sequence: ACATCCCAGACGATGGGCG | Reverse complement motif Consensus sequence: CGCCCATCGTCTGGGATGT |
Dataset #: 1 | Motif ID: 308 | Motif name: Motif 308 |
Original motif Consensus sequence: AAATTAGGCCAATTAATAAC | Reverse complement motif Consensus sequence: GTTATTAATTGGCCTAATTT |
Best Matches for Motif ID 308 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 83 |
Motif name: | Motif 83 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.109629 |
Original motif Consensus sequence: AAAATGTGGTAYATAYAYAC | Reverse complement motif Consensus sequence: GTKTMTATMTACCACATTTT |
Dataset #: | 1 |
Motif ID: | 58 |
Motif name: | Motif 58 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.116375 |
Original motif Consensus sequence: ATGGACAYTTRGGTTGHTTC | Reverse complement motif Consensus sequence: GAAHCAACCKAAKTGTCCAT |
Dataset #: | 1 |
Motif ID: | 160 |
Motif name: | Motif 160 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.118957 |
Original motif Consensus sequence: AAATTACCCAGTCTCAGGTA | Reverse complement motif Consensus sequence: TACCTGAGACTGGGTAATTT |
Dataset #: | 1 |
Motif ID: | 357 |
Motif name: | Motif 357 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.121938 |
Original motif Consensus sequence: CAAGTTGACACATAAAATTA | Reverse complement motif Consensus sequence: TAATTTTATGTGTCAACTTG |
Dataset #: | 1 |
Motif ID: | 137 |
Motif name: | Motif 137 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.124013 |
Original motif Consensus sequence: AGGTTTGTTACATAGGTAWA | Reverse complement motif Consensus sequence: TWTACCTATGTAACAAACCT |
Dataset #: 1 | Motif ID: 309 | Motif name: Motif 309 |
Original motif Consensus sequence: CATTCTGGGGTCTGGAGGAY | Reverse complement motif Consensus sequence: MTCCTCCAGACCCCAGAATG |
Best Matches for Motif ID 309 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 139 |
Motif name: | Motif 139 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.116685 |
Original motif Consensus sequence: AGCCYCTGGYAACCAYYAWT | Reverse complement motif Consensus sequence: AWTKKTGGTTKCCAGKGGCT |
Dataset #: | 1 |
Motif ID: | 115 |
Motif name: | Motif 115 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.118752 |
Original motif Consensus sequence: ATGATCCAGCAATYCCACTH | Reverse complement motif Consensus sequence: HAGTGGKATTGCTGGATCAT |
Dataset #: | 1 |
Motif ID: | 234 |
Motif name: | Motif 234 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.122145 |
Original motif Consensus sequence: AAGGAACAAACTCCRGACAC | Reverse complement motif Consensus sequence: GTGTCKGGAGTTTGTTCCTT |
Dataset #: | 1 |
Motif ID: | 119 |
Motif name: | Motif 119 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.126441 |
Original motif Consensus sequence: AAGTCCAAGATCAAGGTGYY | Reverse complement motif Consensus sequence: KKCACCTTGATCTTGGACTT |
Dataset #: | 1 |
Motif ID: | 202 |
Motif name: | Motif 202 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.127396 |
Original motif Consensus sequence: ACACATCACAAAGCAGTTTC | Reverse complement motif Consensus sequence: GAAACTGCTTTGTGATGTGT |
Dataset #: 1 | Motif ID: 310 | Motif name: Motif 310 |
Original motif Consensus sequence: CCCATGCAAGTCYRAAATCC | Reverse complement motif Consensus sequence: GGATTTMKGACTTGCATGGG |
Best Matches for Motif ID 310 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 144 |
Motif name: | Motif 144 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.119136 |
Original motif Consensus sequence: CCGCTGCACTGTGGGAGCCC | Reverse complement motif Consensus sequence: GGGCTCCCACAGTGCAGCGG |
Dataset #: | 1 |
Motif ID: | 16 |
Motif name: | Motif 16 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.119991 |
Original motif Consensus sequence: GAAAGGGAACTCCCTGACCC | Reverse complement motif Consensus sequence: GGGTCAGGGAGTTCCCTTTC |
Dataset #: | 1 |
Motif ID: | 312 |
Motif name: | Motif 312 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.121495 |
Original motif Consensus sequence: AGGACTGAGGGTGCCYRGGG | Reverse complement motif Consensus sequence: CCCMKGGCACCCTCAGTCCT |
Dataset #: | 1 |
Motif ID: | 137 |
Motif name: | Motif 137 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.128302 |
Original motif Consensus sequence: AGGTTTGTTACATAGGTAWA | Reverse complement motif Consensus sequence: TWTACCTATGTAACAAACCT |
Dataset #: | 1 |
Motif ID: | 56 |
Motif name: | Motif 56 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.128336 |
Original motif Consensus sequence: CRTGAGCCACYGYRCCYGGC | Reverse complement motif Consensus sequence: GCCKGGMKCMGTGGCTCAKG |
Dataset #: 1 | Motif ID: 311 | Motif name: Motif 311 |
Original motif Consensus sequence: GGCATCACGGATCCTACCAA | Reverse complement motif Consensus sequence: TTGGTAGGATCCGTGATGCC |
Best Matches for Motif ID 311 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 26 |
Motif name: | Motif 26 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.129928 |
Original motif Consensus sequence: CTCCTGCCTCAGCCTCCCRA | Reverse complement motif Consensus sequence: TMGGGAGGCTGAGGCAGGAG |
Dataset #: | 1 |
Motif ID: | 61 |
Motif name: | Motif 61 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.134094 |
Original motif Consensus sequence: GGATCCACTGGGTGAAGCCA | Reverse complement motif Consensus sequence: TGGCTTCACCCAGTGGATCC |
Dataset #: | 1 |
Motif ID: | 76 |
Motif name: | Motif 76 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.134531 |
Original motif Consensus sequence: GTGCCAGGCACTGTKCTARG | Reverse complement motif Consensus sequence: CMTAGYACAGTGCCTGGCAC |
Dataset #: | 1 |
Motif ID: | 106 |
Motif name: | Motif 106 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.136164 |
Original motif Consensus sequence: ATTGGTGTATTTACAATCCC | Reverse complement motif Consensus sequence: GGGATTGTAAATACACCAAT |
Dataset #: | 1 |
Motif ID: | 84 |
Motif name: | Motif 84 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.137635 |
Original motif Consensus sequence: CTGGGTCCCCCAGCAGTGCC | Reverse complement motif Consensus sequence: GGCACTGCTGGGGGACCCAG |
Dataset #: 1 | Motif ID: 312 | Motif name: Motif 312 |
Original motif Consensus sequence: AGGACTGAGGGTGCCYRGGG | Reverse complement motif Consensus sequence: CCCMKGGCACCCTCAGTCCT |
Best Matches for Motif ID 312 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 48 |
Motif name: | Motif 48 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.104551 |
Original motif Consensus sequence: AGCTCCCAGCGTGAGCGACG | Reverse complement motif Consensus sequence: CGTCGCTCACGCTGGGAGCT |
Dataset #: | 1 |
Motif ID: | 176 |
Motif name: | Motif 176 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.105418 |
Original motif Consensus sequence: AGGCCCCAGTGTSTGTTGTT | Reverse complement motif Consensus sequence: AACAACASACACTGGGGCCT |
Dataset #: | 1 |
Motif ID: | 84 |
Motif name: | Motif 84 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.107814 |
Original motif Consensus sequence: CTGGGTCCCCCAGCAGTGCC | Reverse complement motif Consensus sequence: GGCACTGCTGGGGGACCCAG |
Dataset #: | 1 |
Motif ID: | 310 |
Motif name: | Motif 310 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.11163 |
Original motif Consensus sequence: CCCATGCAAGTCYRAAATCC | Reverse complement motif Consensus sequence: GGATTTMKGACTTGCATGGG |
Dataset #: | 1 |
Motif ID: | 16 |
Motif name: | Motif 16 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.112186 |
Original motif Consensus sequence: GAAAGGGAACTCCCTGACCC | Reverse complement motif Consensus sequence: GGGTCAGGGAGTTCCCTTTC |
Dataset #: 1 | Motif ID: 313 | Motif name: Motif 313 |
Original motif Consensus sequence: CTCCTGCCTCAGCY | Reverse complement motif Consensus sequence: MGCTGAGGCAGGAG |
Best Matches for Motif ID 313 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 26 |
Motif name: | Motif 26 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 14 |
Similarity score: | 0.0298178 |
Original motif Consensus sequence: CTCCTGCCTCAGCCTCCCRA | Reverse complement motif Consensus sequence: TMGGGAGGCTGAGGCAGGAG |
Dataset #: | 1 |
Motif ID: | 96 |
Motif name: | Motif 96 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 14 |
Similarity score: | 0.0599095 |
Original motif Consensus sequence: AAGCTGAGGGAGCCGGCTCC | Reverse complement motif Consensus sequence: GGAGCCGGCTCCCTCAGCTT |
Dataset #: | 1 |
Motif ID: | 105 |
Motif name: | Motif 105 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 5 |
Number of overlap: | 14 |
Similarity score: | 0.0742075 |
Original motif Consensus sequence: GCCTCTCCCTCCACACCTCC | Reverse complement motif Consensus sequence: GGAGGTGTGGAGGGAGAGGC |
Dataset #: | 1 |
Motif ID: | 67 |
Motif name: | Motif 67 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 6 |
Number of overlap: | 14 |
Similarity score: | 0.0752599 |
Original motif Consensus sequence: CTGGGCTCCTGAGTCTGGTG | Reverse complement motif Consensus sequence: CACCAGACTCAGGAGCCCAG |
Dataset #: | 1 |
Motif ID: | 72 |
Motif name: | Motif 72 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 14 |
Similarity score: | 0.0799645 |
Original motif Consensus sequence: CGCACTCCTCAGCC | Reverse complement motif Consensus sequence: GGCTGAGGAGTGCG |
Dataset #: 1 | Motif ID: 314 | Motif name: Motif 314 |
Original motif Consensus sequence: GGAACGCACAT | Reverse complement motif Consensus sequence: ATGTGCGTTCC |
Best Matches for Motif ID 314 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 240 |
Motif name: | Motif 240 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 11 |
Similarity score: | 0.0430601 |
Original motif Consensus sequence: ATGTGCWGTCCC | Reverse complement motif Consensus sequence: GGGACWGCACAT |
Dataset #: | 1 |
Motif ID: | 312 |
Motif name: | Motif 312 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 6 |
Number of overlap: | 11 |
Similarity score: | 0.0705974 |
Original motif Consensus sequence: AGGACTGAGGGTGCCYRGGG | Reverse complement motif Consensus sequence: CCCMKGGCACCCTCAGTCCT |
Dataset #: | 1 |
Motif ID: | 144 |
Motif name: | Motif 144 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 11 |
Similarity score: | 0.0731257 |
Original motif Consensus sequence: CCGCTGCACTGTGGGAGCCC | Reverse complement motif Consensus sequence: GGGCTCCCACAGTGCAGCGG |
Dataset #: | 1 |
Motif ID: | 15 |
Motif name: | Motif 15 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 11 |
Similarity score: | 0.0769547 |
Original motif Consensus sequence: CTTGCGCTTCCCRRGTGA | Reverse complement motif Consensus sequence: TCACKMGGGAAGCGCAAG |
Dataset #: | 1 |
Motif ID: | 18 |
Motif name: | Motif 18 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 11 |
Similarity score: | 0.0796102 |
Original motif Consensus sequence: GAAAAGCGCAGTATTMGGG | Reverse complement motif Consensus sequence: CCCYAATACTGCGCTTTTC |
Dataset #: 1 | Motif ID: 315 | Motif name: Motif 315 |
Original motif Consensus sequence: CCAAACCATATCA | Reverse complement motif Consensus sequence: TGATATGGTTTGG |
Best Matches for Motif ID 315 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 169 |
Motif name: | Motif 169 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 13 |
Similarity score: | 0.0520963 |
Original motif Consensus sequence: CCCAAATCCTATAAAA | Reverse complement motif Consensus sequence: TTTTATAGGATTTGGG |
Dataset #: | 1 |
Motif ID: | 227 |
Motif name: | Motif 227 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 13 |
Similarity score: | 0.0822582 |
Original motif Consensus sequence: CCCAAATCTCATSTTGAAT | Reverse complement motif Consensus sequence: ATTCAASATGAGATTTGGG |
Dataset #: | 1 |
Motif ID: | 331 |
Motif name: | Motif 331 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 13 |
Similarity score: | 0.0861727 |
Original motif Consensus sequence: CCACCACAGCTCAAGGAGGC | Reverse complement motif Consensus sequence: GCCTCCTTGAGCTGTGGTGG |
Dataset #: | 1 |
Motif ID: | 190 |
Motif name: | Motif 190 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 6 |
Number of overlap: | 13 |
Similarity score: | 0.090194 |
Original motif Consensus sequence: CAAAGGCATAAGAATGAT | Reverse complement motif Consensus sequence: ATCATTCTTATGCCTTTG |
Dataset #: | 1 |
Motif ID: | 259 |
Motif name: | Motif 259 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 13 |
Similarity score: | 0.0922621 |
Original motif Consensus sequence: CCCACACCCTTATTA | Reverse complement motif Consensus sequence: TAATAAGGGTGTGGG |
Dataset #: 1 | Motif ID: 316 | Motif name: Motif 316 |
Original motif Consensus sequence: CGGAAGTGACGT | Reverse complement motif Consensus sequence: ACGTCACTTCCG |
Best Matches for Motif ID 316 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 136 |
Motif name: | Motif 136 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 12 |
Similarity score: | 0.0580654 |
Original motif Consensus sequence: CCCTCACTGCCCGGGG | Reverse complement motif Consensus sequence: CCCCGGGCAGTGAGGG |
Dataset #: | 1 |
Motif ID: | 247 |
Motif name: | Motif 247 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 12 |
Similarity score: | 0.0581297 |
Original motif Consensus sequence: GCCTCACTGCCRC | Reverse complement motif Consensus sequence: GKGGCAGTGAGGC |
Dataset #: | 1 |
Motif ID: | 246 |
Motif name: | Motif 246 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 12 |
Similarity score: | 0.0638384 |
Original motif Consensus sequence: GCAGCTTCACTCCTGA | Reverse complement motif Consensus sequence: TCAGGAGTGAAGCTGC |
Dataset #: | 1 |
Motif ID: | 30 |
Motif name: | Motif 30 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 12 |
Similarity score: | 0.0713677 |
Original motif Consensus sequence: AGGAGCGCCTCTKCCCGGC | Reverse complement motif Consensus sequence: GCCGGGRAGAGGCGCTCCT |
Dataset #: | 1 |
Motif ID: | 327 |
Motif name: | Motif 327 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 12 |
Similarity score: | 0.0721835 |
Original motif Consensus sequence: AGGAGGAAGTCAATTTC | Reverse complement motif Consensus sequence: GAAATTGACTTCCTCCT |
Dataset #: 1 | Motif ID: 317 | Motif name: Motif 317 |
Original motif Consensus sequence: ACATGCTACAACAT | Reverse complement motif Consensus sequence: ATGTTGTAGCATGT |
Best Matches for Motif ID 317 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 299 |
Motif name: | Motif 299 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 14 |
Similarity score: | 0.0691153 |
Original motif Consensus sequence: CCCTGCTAGAACCTCCAA | Reverse complement motif Consensus sequence: TTGGAGGTTCTAGCAGGG |
Dataset #: | 1 |
Motif ID: | 36 |
Motif name: | Motif 36 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 14 |
Similarity score: | 0.0828209 |
Original motif Consensus sequence: ACATCCCAGACGATGGGCG | Reverse complement motif Consensus sequence: CGCCCATCGTCTGGGATGT |
Dataset #: | 1 |
Motif ID: | 280 |
Motif name: | Motif 280 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 6 |
Number of overlap: | 14 |
Similarity score: | 0.0862934 |
Original motif Consensus sequence: CCTAGATTTCAGARGATGT | Reverse complement motif Consensus sequence: ACATCMTCTGAAATCTAGG |
Dataset #: | 1 |
Motif ID: | 195 |
Motif name: | Motif 195 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 14 |
Similarity score: | 0.0870528 |
Original motif Consensus sequence: TAAAAGACTACAWATTGGGT | Reverse complement motif Consensus sequence: ACCCAATWTGTAGTCTTTTA |
Dataset #: | 1 |
Motif ID: | 284 |
Motif name: | Motif 284 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 14 |
Similarity score: | 0.0936287 |
Original motif Consensus sequence: CATTTGGGAGCCCATTGA | Reverse complement motif Consensus sequence: TCAATGGGCTCCCAAATG |
Dataset #: 1 | Motif ID: 318 | Motif name: Motif 318 |
Original motif Consensus sequence: CAGCCCCG | Reverse complement motif Consensus sequence: CGGGGCTG |
Best Matches for Motif ID 318 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 88 |
Motif name: | Motif 88 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 8 |
Similarity score: | 0.00509921 |
Original motif Consensus sequence: ACCGGGGCTGCA | Reverse complement motif Consensus sequence: TGCAGCCCCGGT |
Dataset #: | 1 |
Motif ID: | 183 |
Motif name: | Motif 183 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 8 |
Similarity score: | 0.0248687 |
Original motif Consensus sequence: GCCRGCCCTGCYGGCC | Reverse complement motif Consensus sequence: GGCCMGCAGGGCKGGC |
Dataset #: | 1 |
Motif ID: | 78 |
Motif name: | Motif 78 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 8 |
Similarity score: | 0.026456 |
Original motif Consensus sequence: CGAGCCCTGCCCCGCGG | Reverse complement motif Consensus sequence: CCGCGGGGCAGGGCTCG |
Dataset #: | 1 |
Motif ID: | 92 |
Motif name: | Motif 92 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 12 |
Number of overlap: | 8 |
Similarity score: | 0.0266885 |
Original motif Consensus sequence: GGGGGCTGACCCCCCCACC | Reverse complement motif Consensus sequence: GGTGGGGGGGTCAGCCCCC |
Dataset #: | 1 |
Motif ID: | 122 |
Motif name: | Motif 122 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 8 |
Number of overlap: | 8 |
Similarity score: | 0.0291045 |
Original motif Consensus sequence: CCTTGGCCAGCCCAGAAAG | Reverse complement motif Consensus sequence: CTTTCTGGGCTGGCCAAGG |
Dataset #: 1 | Motif ID: 319 | Motif name: Motif 319 |
Original motif Consensus sequence: TAGTTTTTAACAA | Reverse complement motif Consensus sequence: TTGTTAAAAACTA |
Best Matches for Motif ID 319 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 154 |
Motif name: | Motif 154 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 13 |
Similarity score: | 0.0753436 |
Original motif Consensus sequence: CATTAGATTCTCATAGGA | Reverse complement motif Consensus sequence: TCCTATGAGAATCTAATG |
Dataset #: | 1 |
Motif ID: | 243 |
Motif name: | Motif 243 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 13 |
Similarity score: | 0.0843202 |
Original motif Consensus sequence: CAGTGGTTCTCAA | Reverse complement motif Consensus sequence: TTGAGAACCACTG |
Dataset #: | 1 |
Motif ID: | 299 |
Motif name: | Motif 299 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 13 |
Similarity score: | 0.084899 |
Original motif Consensus sequence: CCCTGCTAGAACCTCCAA | Reverse complement motif Consensus sequence: TTGGAGGTTCTAGCAGGG |
Dataset #: | 1 |
Motif ID: | 137 |
Motif name: | Motif 137 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 13 |
Similarity score: | 0.0861013 |
Original motif Consensus sequence: AGGTTTGTTACATAGGTAWA | Reverse complement motif Consensus sequence: TWTACCTATGTAACAAACCT |
Dataset #: | 1 |
Motif ID: | 333 |
Motif name: | Motif 333 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 8 |
Number of overlap: | 13 |
Similarity score: | 0.08657 |
Original motif Consensus sequence: TAGATAATAGCTCCAGCTTT | Reverse complement motif Consensus sequence: AAAGCTGGAGCTATTATCTA |
Dataset #: 1 | Motif ID: 320 | Motif name: Motif 320 |
Original motif Consensus sequence: CATCTGGAGCCCCA | Reverse complement motif Consensus sequence: TGGGGCTCCAGATG |
Best Matches for Motif ID 320 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 205 |
Motif name: | Motif 205 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 14 |
Similarity score: | 0.057175 |
Original motif Consensus sequence: CATCTGGCAGCCCA | Reverse complement motif Consensus sequence: TGGGCTGCCAGATG |
Dataset #: | 1 |
Motif ID: | 284 |
Motif name: | Motif 284 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 14 |
Similarity score: | 0.071304 |
Original motif Consensus sequence: CATTTGGGAGCCCATTGA | Reverse complement motif Consensus sequence: TCAATGGGCTCCCAAATG |
Dataset #: | 1 |
Motif ID: | 67 |
Motif name: | Motif 67 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 14 |
Similarity score: | 0.0870604 |
Original motif Consensus sequence: CTGGGCTCCTGAGTCTGGTG | Reverse complement motif Consensus sequence: CACCAGACTCAGGAGCCCAG |
Dataset #: | 1 |
Motif ID: | 68 |
Motif name: | Motif 68 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 5 |
Number of overlap: | 14 |
Similarity score: | 0.087898 |
Original motif Consensus sequence: CATGGCGGGCTGCAGGTC | Reverse complement motif Consensus sequence: GACCTGCAGCCCGCCATG |
Dataset #: | 1 |
Motif ID: | 84 |
Motif name: | Motif 84 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 5 |
Number of overlap: | 14 |
Similarity score: | 0.0974135 |
Original motif Consensus sequence: CTGGGTCCCCCAGCAGTGCC | Reverse complement motif Consensus sequence: GGCACTGCTGGGGGACCCAG |
Dataset #: 1 | Motif ID: 321 | Motif name: Motif 321 |
Original motif Consensus sequence: AAGCTCGAACTGGGTGGAGC | Reverse complement motif Consensus sequence: GCTCCACCCAGTTCGAGCTT |
Best Matches for Motif ID 321 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 201 |
Motif name: | Motif 201 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.114862 |
Original motif Consensus sequence: GTAACACTCACCGCGARGGT | Reverse complement motif Consensus sequence: ACCKTCGCGGTGAGTGTTAC |
Dataset #: | 1 |
Motif ID: | 160 |
Motif name: | Motif 160 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.117485 |
Original motif Consensus sequence: AAATTACCCAGTCTCAGGTA | Reverse complement motif Consensus sequence: TACCTGAGACTGGGTAATTT |
Dataset #: | 1 |
Motif ID: | 144 |
Motif name: | Motif 144 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.118909 |
Original motif Consensus sequence: CCGCTGCACTGTGGGAGCCC | Reverse complement motif Consensus sequence: GGGCTCCCACAGTGCAGCGG |
Dataset #: | 1 |
Motif ID: | 23 |
Motif name: | Motif 23 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.12743 |
Original motif Consensus sequence: GGTTCATCTCACTAGGGAGT | Reverse complement motif Consensus sequence: ACTCCCTAGTGAGATGAACC |
Dataset #: | 1 |
Motif ID: | 119 |
Motif name: | Motif 119 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.130736 |
Original motif Consensus sequence: AAGTCCAAGATCAAGGTGYY | Reverse complement motif Consensus sequence: KKCACCTTGATCTTGGACTT |
Dataset #: 1 | Motif ID: 322 | Motif name: Motif 322 |
Original motif Consensus sequence: AGGGCCTTTGCASWTGC | Reverse complement motif Consensus sequence: GCAWSTGCAAAGGCCCT |
Best Matches for Motif ID 322 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 196 |
Motif name: | Motif 196 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 17 |
Similarity score: | 0.0779611 |
Original motif Consensus sequence: CCTGCCATTGCYSAGGCTTG | Reverse complement motif Consensus sequence: CAAGCCTSKGCAATGGCAGG |
Dataset #: | 1 |
Motif ID: | 171 |
Motif name: | Motif 171 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 17 |
Similarity score: | 0.0904024 |
Original motif Consensus sequence: AAAAGTCCACAGTCCAAAGT | Reverse complement motif Consensus sequence: ACTTTGGACTGTGGACTTTT |
Dataset #: | 1 |
Motif ID: | 137 |
Motif name: | Motif 137 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 17 |
Similarity score: | 0.0909504 |
Original motif Consensus sequence: AGGTTTGTTACATAGGTAWA | Reverse complement motif Consensus sequence: TWTACCTATGTAACAAACCT |
Dataset #: | 1 |
Motif ID: | 64 |
Motif name: | Motif 64 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 17 |
Similarity score: | 0.0915142 |
Original motif Consensus sequence: GAAGGCAGCTAAGGCCCGGY | Reverse complement motif Consensus sequence: KCCGGGCCTTAGCTGCCTTC |
Dataset #: | 1 |
Motif ID: | 86 |
Motif name: | Motif 86 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 17 |
Similarity score: | 0.0922727 |
Original motif Consensus sequence: AGTAGGTGCTCARTAAATRB | Reverse complement motif Consensus sequence: VMATTTAKTGAGCACCTACT |
Dataset #: 1 | Motif ID: 323 | Motif name: Motif 323 |
Original motif Consensus sequence: GCTCTCAGGTCCA | Reverse complement motif Consensus sequence: TGGACCTGAGAGC |
Best Matches for Motif ID 323 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 291 |
Motif name: | Motif 291 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 13 |
Similarity score: | 0.0533584 |
Original motif Consensus sequence: CTGAGGACCTGAGGTCRTA | Reverse complement motif Consensus sequence: TAMGACCTCAGGTCCTCAG |
Dataset #: | 1 |
Motif ID: | 52 |
Motif name: | Motif 52 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 6 |
Number of overlap: | 13 |
Similarity score: | 0.0809407 |
Original motif Consensus sequence: GACTGGCAGGCAGCTCCACC | Reverse complement motif Consensus sequence: GGTGGAGCTGCCTGCCAGTC |
Dataset #: | 1 |
Motif ID: | 29 |
Motif name: | Motif 29 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 13 |
Similarity score: | 0.0818999 |
Original motif Consensus sequence: CTGGGCRACAGAGYRAGACY | Reverse complement motif Consensus sequence: MGTCTMKCTCTGTKGCCCAG |
Dataset #: | 1 |
Motif ID: | 225 |
Motif name: | Motif 225 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 13 |
Similarity score: | 0.0879728 |
Original motif Consensus sequence: GCACATGTAYCCYAGAACTT | Reverse complement motif Consensus sequence: AAGTTCTKGGKTACATGTGC |
Dataset #: | 1 |
Motif ID: | 362 |
Motif name: | Motif 362 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 13 |
Similarity score: | 0.0895644 |
Original motif Consensus sequence: GCTCTGAAGGTCC | Reverse complement motif Consensus sequence: GGACCTTCAGAGC |
Dataset #: 1 | Motif ID: 324 | Motif name: Motif 324 |
Original motif Consensus sequence: ACGCACCTGTA | Reverse complement motif Consensus sequence: TACAGGTGCGT |
Best Matches for Motif ID 324 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 355 |
Motif name: | Motif 355 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 11 |
Similarity score: | 0.0752538 |
Original motif Consensus sequence: TATGAGCCTGTAA | Reverse complement motif Consensus sequence: TTACAGGCTCATA |
Dataset #: | 1 |
Motif ID: | 167 |
Motif name: | Motif 167 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 11 |
Similarity score: | 0.0802613 |
Original motif Consensus sequence: CCGCTCCTGTGC | Reverse complement motif Consensus sequence: GCACAGGAGCGG |
Dataset #: | 1 |
Motif ID: | 104 |
Motif name: | Motif 104 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 9 |
Number of overlap: | 11 |
Similarity score: | 0.0876733 |
Original motif Consensus sequence: CAACATGGATGRARCTGGAG | Reverse complement motif Consensus sequence: CTCCAGKTMCATCCATGTTG |
Dataset #: | 1 |
Motif ID: | 149 |
Motif name: | Motif 149 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 11 |
Similarity score: | 0.088024 |
Original motif Consensus sequence: ACTCAGCCCRCCTGCACCC | Reverse complement motif Consensus sequence: GGGTGCAGGMGGGCTGAGT |
Dataset #: | 1 |
Motif ID: | 98 |
Motif name: | Motif 98 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 6 |
Number of overlap: | 11 |
Similarity score: | 0.0887977 |
Original motif Consensus sequence: AGTTCCGGGTGGGCGTGGG | Reverse complement motif Consensus sequence: CCCACGCCCACCCGGAACT |
Dataset #: 1 | Motif ID: 325 | Motif name: Motif 325 |
Original motif Consensus sequence: AGCAGCTGTAAATA | Reverse complement motif Consensus sequence: TATTTACAGCTGCT |
Best Matches for Motif ID 325 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 25 |
Motif name: | Motif 25 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 5 |
Number of overlap: | 14 |
Similarity score: | 0.087674 |
Original motif Consensus sequence: CATTTCCAWCTGAGGTAC | Reverse complement motif Consensus sequence: GTACCTCAGWTGGAAATG |
Dataset #: | 1 |
Motif ID: | 303 |
Motif name: | Motif 303 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 14 |
Similarity score: | 0.0891021 |
Original motif Consensus sequence: AGTTCTTAAAGATGGT | Reverse complement motif Consensus sequence: ACCATCTTTAAGAACT |
Dataset #: | 1 |
Motif ID: | 139 |
Motif name: | Motif 139 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 7 |
Number of overlap: | 14 |
Similarity score: | 0.0976016 |
Original motif Consensus sequence: AGCCYCTGGYAACCAYYAWT | Reverse complement motif Consensus sequence: AWTKKTGGTTKCCAGKGGCT |
Dataset #: | 1 |
Motif ID: | 304 |
Motif name: | Motif 304 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 14 |
Similarity score: | 0.100233 |
Original motif Consensus sequence: AGTGTTTCCAAMCTGCT | Reverse complement motif Consensus sequence: AGCAGYTTGGAAACACT |
Dataset #: | 1 |
Motif ID: | 242 |
Motif name: | Motif 242 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 14 |
Similarity score: | 0.104976 |
Original motif Consensus sequence: AACCCTATTGTGAACTGYG | Reverse complement motif Consensus sequence: CMCAGTTCACAATAGGGTT |
Dataset #: 1 | Motif ID: 326 | Motif name: Motif 326 |
Original motif Consensus sequence: GACATGGAGTCAAAGG | Reverse complement motif Consensus sequence: CCTTTGACTCCATGTC |
Best Matches for Motif ID 326 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 105 |
Motif name: | Motif 105 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 16 |
Similarity score: | 0.0861073 |
Original motif Consensus sequence: GCCTCTCCCTCCACACCTCC | Reverse complement motif Consensus sequence: GGAGGTGTGGAGGGAGAGGC |
Dataset #: | 1 |
Motif ID: | 290 |
Motif name: | Motif 290 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 16 |
Similarity score: | 0.0886417 |
Original motif Consensus sequence: TGATACCCAGGCAAACAG | Reverse complement motif Consensus sequence: CTGTTTGCCTGGGTATCA |
Dataset #: | 1 |
Motif ID: | 104 |
Motif name: | Motif 104 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 16 |
Similarity score: | 0.0935769 |
Original motif Consensus sequence: CAACATGGATGRARCTGGAG | Reverse complement motif Consensus sequence: CTCCAGKTMCATCCATGTTG |
Dataset #: | 1 |
Motif ID: | 293 |
Motif name: | Motif 293 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 16 |
Similarity score: | 0.0948138 |
Original motif Consensus sequence: CTGACTGGGAGACACCTCCC | Reverse complement motif Consensus sequence: GGGAGGTGTCTCCCAGTCAG |
Dataset #: | 1 |
Motif ID: | 109 |
Motif name: | Motif 109 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 16 |
Similarity score: | 0.0957162 |
Original motif Consensus sequence: GAGAGAGAGAGAGAGAGAGA | Reverse complement motif Consensus sequence: TCTCTCTCTCTCTCTCTCTC |
Dataset #: 1 | Motif ID: 327 | Motif name: Motif 327 |
Original motif Consensus sequence: AGGAGGAAGTCAATTTC | Reverse complement motif Consensus sequence: GAAATTGACTTCCTCCT |
Best Matches for Motif ID 327 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 85 |
Motif name: | Motif 85 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 17 |
Similarity score: | 0.087633 |
Original motif Consensus sequence: CTAGACATAAAGGTTCTCCA | Reverse complement motif Consensus sequence: TGGAGAACCTTTATGTCTAG |
Dataset #: | 1 |
Motif ID: | 328 |
Motif name: | Motif 328 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 17 |
Similarity score: | 0.0921863 |
Original motif Consensus sequence: GATACAAAATCAATGTR | Reverse complement motif Consensus sequence: KACATTGATTTTGTATC |
Dataset #: | 1 |
Motif ID: | 350 |
Motif name: | Motif 350 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 17 |
Similarity score: | 0.0926364 |
Original motif Consensus sequence: TCTGGAGTGGACCTCCAGCA | Reverse complement motif Consensus sequence: TGCTGGAGGTCCACTCCAGA |
Dataset #: | 1 |
Motif ID: | 86 |
Motif name: | Motif 86 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 17 |
Similarity score: | 0.094205 |
Original motif Consensus sequence: AGTAGGTGCTCARTAAATRB | Reverse complement motif Consensus sequence: VMATTTAKTGAGCACCTACT |
Dataset #: | 1 |
Motif ID: | 333 |
Motif name: | Motif 333 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 17 |
Similarity score: | 0.100031 |
Original motif Consensus sequence: TAGATAATAGCTCCAGCTTT | Reverse complement motif Consensus sequence: AAAGCTGGAGCTATTATCTA |
Dataset #: 1 | Motif ID: 328 | Motif name: Motif 328 |
Original motif Consensus sequence: GATACAAAATCAATGTR | Reverse complement motif Consensus sequence: KACATTGATTTTGTATC |
Best Matches for Motif ID 328 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 119 |
Motif name: | Motif 119 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 17 |
Similarity score: | 0.0460385 |
Original motif Consensus sequence: AAGTCCAAGATCAAGGTGYY | Reverse complement motif Consensus sequence: KKCACCTTGATCTTGGACTT |
Dataset #: | 1 |
Motif ID: | 19 |
Motif name: | Motif 19 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 17 |
Similarity score: | 0.0587823 |
Original motif Consensus sequence: CACCAGGAGATTATATCCCR | Reverse complement motif Consensus sequence: MGGGATATAATCTCCTGGTG |
Dataset #: | 1 |
Motif ID: | 202 |
Motif name: | Motif 202 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 17 |
Similarity score: | 0.0635566 |
Original motif Consensus sequence: ACACATCACAAAGCAGTTTC | Reverse complement motif Consensus sequence: GAAACTGCTTTGTGATGTGT |
Dataset #: | 1 |
Motif ID: | 58 |
Motif name: | Motif 58 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 17 |
Similarity score: | 0.0636486 |
Original motif Consensus sequence: ATGGACAYTTRGGTTGHTTC | Reverse complement motif Consensus sequence: GAAHCAACCKAAKTGTCCAT |
Dataset #: | 1 |
Motif ID: | 327 |
Motif name: | Motif 327 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 17 |
Similarity score: | 0.0643479 |
Original motif Consensus sequence: AGGAGGAAGTCAATTTC | Reverse complement motif Consensus sequence: GAAATTGACTTCCTCCT |
Dataset #: 1 | Motif ID: 329 | Motif name: Motif 329 |
Original motif Consensus sequence: GGGAGGGATATATTAGC | Reverse complement motif Consensus sequence: GCTAATATATCCCTCCC |
Best Matches for Motif ID 329 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 333 |
Motif name: | Motif 333 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 17 |
Similarity score: | 0.0923491 |
Original motif Consensus sequence: TAGATAATAGCTCCAGCTTT | Reverse complement motif Consensus sequence: AAAGCTGGAGCTATTATCTA |
Dataset #: | 1 |
Motif ID: | 235 |
Motif name: | Motif 235 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 17 |
Similarity score: | 0.102804 |
Original motif Consensus sequence: TCCAAATGGGAGAAATTGGC | Reverse complement motif Consensus sequence: GCCAATTTCTCCCATTTGGA |
Dataset #: | 1 |
Motif ID: | 293 |
Motif name: | Motif 293 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 17 |
Similarity score: | 0.109545 |
Original motif Consensus sequence: CTGACTGGGAGACACCTCCC | Reverse complement motif Consensus sequence: GGGAGGTGTCTCCCAGTCAG |
Dataset #: | 1 |
Motif ID: | 83 |
Motif name: | Motif 83 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 17 |
Similarity score: | 0.114728 |
Original motif Consensus sequence: AAAATGTGGTAYATAYAYAC | Reverse complement motif Consensus sequence: GTKTMTATMTACCACATTTT |
Dataset #: | 1 |
Motif ID: | 279 |
Motif name: | Motif 279 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 17 |
Similarity score: | 0.115902 |
Original motif Consensus sequence: GGGGGAGACATCACACR | Reverse complement motif Consensus sequence: MGTGTGATGTCTCCCCC |
Dataset #: 1 | Motif ID: 330 | Motif name: Motif 330 |
Original motif Consensus sequence: AAAACCAGCAAGTTTTTAT | Reverse complement motif Consensus sequence: ATAAAAACTTGCTGGTTTT |
Best Matches for Motif ID 330 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 63 |
Motif name: | Motif 63 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.0925249 |
Original motif Consensus sequence: AGTGAGAACATRYRRTRTTT | Reverse complement motif Consensus sequence: AAAMAMMKMATGTTCTCACT |
Dataset #: | 1 |
Motif ID: | 308 |
Motif name: | Motif 308 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.112206 |
Original motif Consensus sequence: AAATTAGGCCAATTAATAAC | Reverse complement motif Consensus sequence: GTTATTAATTGGCCTAATTT |
Dataset #: | 1 |
Motif ID: | 254 |
Motif name: | Motif 254 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.114461 |
Original motif Consensus sequence: AAAATCACAAGCATTCCTAT | Reverse complement motif Consensus sequence: ATAGGAATGCTTGTGATTTT |
Dataset #: | 1 |
Motif ID: | 99 |
Motif name: | Motif 99 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.121081 |
Original motif Consensus sequence: GCAAAKGACATGATYTCATT | Reverse complement motif Consensus sequence: AATGAKATCATGTCYTTTGC |
Dataset #: | 1 |
Motif ID: | 202 |
Motif name: | Motif 202 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.121875 |
Original motif Consensus sequence: ACACATCACAAAGCAGTTTC | Reverse complement motif Consensus sequence: GAAACTGCTTTGTGATGTGT |
Dataset #: 1 | Motif ID: 331 | Motif name: Motif 331 |
Original motif Consensus sequence: CCACCACAGCTCAAGGAGGC | Reverse complement motif Consensus sequence: GCCTCCTTGAGCTGTGGTGG |
Best Matches for Motif ID 331 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 119 |
Motif name: | Motif 119 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.112645 |
Original motif Consensus sequence: AAGTCCAAGATCAAGGTGYY | Reverse complement motif Consensus sequence: KKCACCTTGATCTTGGACTT |
Dataset #: | 1 |
Motif ID: | 155 |
Motif name: | Motif 155 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.115101 |
Original motif Consensus sequence: TCCCTCCCGGACGGGGYGGC | Reverse complement motif Consensus sequence: GCCKCCCCGTCCGGGAGGGA |
Dataset #: | 1 |
Motif ID: | 23 |
Motif name: | Motif 23 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.126303 |
Original motif Consensus sequence: GGTTCATCTCACTAGGGAGT | Reverse complement motif Consensus sequence: ACTCCCTAGTGAGATGAACC |
Dataset #: | 1 |
Motif ID: | 179 |
Motif name: | Motif 179 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.127958 |
Original motif Consensus sequence: AGGTCCTTCAGGAGGTATTC | Reverse complement motif Consensus sequence: GAATACCTCCTGAAGGACCT |
Dataset #: | 1 |
Motif ID: | 310 |
Motif name: | Motif 310 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.132863 |
Original motif Consensus sequence: CCCATGCAAGTCYRAAATCC | Reverse complement motif Consensus sequence: GGATTTMKGACTTGCATGGG |
Dataset #: 1 | Motif ID: 332 | Motif name: Motif 332 |
Original motif Consensus sequence: CTGGCCCTCAATGGTTAAAC | Reverse complement motif Consensus sequence: GTTTAACCATTGAGGGCCAG |
Best Matches for Motif ID 332 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 336 |
Motif name: | Motif 336 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.102201 |
Original motif Consensus sequence: ATGTAACCAAAYACCACCTG | Reverse complement motif Consensus sequence: CAGGTGGTKTTTGGTTACAT |
Dataset #: | 1 |
Motif ID: | 179 |
Motif name: | Motif 179 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.106854 |
Original motif Consensus sequence: AGGTCCTTCAGGAGGTATTC | Reverse complement motif Consensus sequence: GAATACCTCCTGAAGGACCT |
Dataset #: | 1 |
Motif ID: | 170 |
Motif name: | Motif 170 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.115252 |
Original motif Consensus sequence: AATCAACCCTGGYRATCAAT | Reverse complement motif Consensus sequence: ATTGATMKCCAGGGTTGATT |
Dataset #: | 1 |
Motif ID: | 292 |
Motif name: | Motif 292 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.115516 |
Original motif Consensus sequence: AAGACCTTCCAGTGGGACAA | Reverse complement motif Consensus sequence: TTGTCCCACTGGAAGGTCTT |
Dataset #: | 1 |
Motif ID: | 29 |
Motif name: | Motif 29 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.117502 |
Original motif Consensus sequence: CTGGGCRACAGAGYRAGACY | Reverse complement motif Consensus sequence: MGTCTMKCTCTGTKGCCCAG |
Dataset #: 1 | Motif ID: 333 | Motif name: Motif 333 |
Original motif Consensus sequence: TAGATAATAGCTCCAGCTTT | Reverse complement motif Consensus sequence: AAAGCTGGAGCTATTATCTA |
Best Matches for Motif ID 333 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 106 |
Motif name: | Motif 106 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.0856788 |
Original motif Consensus sequence: ATTGGTGTATTTACAATCCC | Reverse complement motif Consensus sequence: GGGATTGTAAATACACCAAT |
Dataset #: | 1 |
Motif ID: | 96 |
Motif name: | Motif 96 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.0904379 |
Original motif Consensus sequence: AAGCTGAGGGAGCCGGCTCC | Reverse complement motif Consensus sequence: GGAGCCGGCTCCCTCAGCTT |
Dataset #: | 1 |
Motif ID: | 234 |
Motif name: | Motif 234 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.0912488 |
Original motif Consensus sequence: AAGGAACAAACTCCRGACAC | Reverse complement motif Consensus sequence: GTGTCKGGAGTTTGTTCCTT |
Dataset #: | 1 |
Motif ID: | 196 |
Motif name: | Motif 196 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.102365 |
Original motif Consensus sequence: CCTGCCATTGCYSAGGCTTG | Reverse complement motif Consensus sequence: CAAGCCTSKGCAATGGCAGG |
Dataset #: | 1 |
Motif ID: | 194 |
Motif name: | Motif 194 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.103421 |
Original motif Consensus sequence: CAAGGGTATAYGAGTAGCTG | Reverse complement motif Consensus sequence: CAGCTACTCKTATACCCTTG |
Dataset #: 1 | Motif ID: 334 | Motif name: Motif 334 |
Original motif Consensus sequence: CATCTGTCAC | Reverse complement motif Consensus sequence: GTGACAGATG |
Best Matches for Motif ID 334 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 272 |
Motif name: | Motif 272 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 10 |
Similarity score: | 0.0227273 |
Original motif Consensus sequence: CAGCTGTCAC | Reverse complement motif Consensus sequence: GTGACAGCTG |
Dataset #: | 1 |
Motif ID: | 1 |
Motif name: | Motif 1 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 10 |
Similarity score: | 0.0317788 |
Original motif Consensus sequence: GGGGTGACAGABGB | Reverse complement motif Consensus sequence: BCVTCTGTCACCCC |
Dataset #: | 1 |
Motif ID: | 49 |
Motif name: | Motif 49 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 10 |
Similarity score: | 0.0451613 |
Original motif Consensus sequence: ACATCTGYMMCC | Reverse complement motif Consensus sequence: GGRRMCAGATGT |
Dataset #: | 1 |
Motif ID: | 205 |
Motif name: | Motif 205 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 10 |
Similarity score: | 0.0558301 |
Original motif Consensus sequence: CATCTGGCAGCCCA | Reverse complement motif Consensus sequence: TGGGCTGCCAGATG |
Dataset #: | 1 |
Motif ID: | 199 |
Motif name: | Motif 199 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 10 |
Similarity score: | 0.0598762 |
Original motif Consensus sequence: ACAGCTGGCACC | Reverse complement motif Consensus sequence: GGTGCCAGCTGT |
Dataset #: 1 | Motif ID: 335 | Motif name: Motif 335 |
Original motif Consensus sequence: GTTAATGCTGA | Reverse complement motif Consensus sequence: TCAGCATTAAC |
Best Matches for Motif ID 335 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 184 |
Motif name: | Motif 184 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 6 |
Number of overlap: | 11 |
Similarity score: | 0.054088 |
Original motif Consensus sequence: ATATTGATGATCCTGACC | Reverse complement motif Consensus sequence: GGTCAGGATCATCAATAT |
Dataset #: | 1 |
Motif ID: | 262 |
Motif name: | Motif 262 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 9 |
Number of overlap: | 11 |
Similarity score: | 0.0564195 |
Original motif Consensus sequence: CTCAGTGTTAATCTCCTGTC | Reverse complement motif Consensus sequence: GACAGGAGATTAACACTGAG |
Dataset #: | 1 |
Motif ID: | 278 |
Motif name: | Motif 278 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 11 |
Similarity score: | 0.0591879 |
Original motif Consensus sequence: ACTTTCAGGCATAACA | Reverse complement motif Consensus sequence: TGTTATGCCTGAAAGT |
Dataset #: | 1 |
Motif ID: | 261 |
Motif name: | Motif 261 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 6 |
Number of overlap: | 11 |
Similarity score: | 0.0655056 |
Original motif Consensus sequence: ATCTCASAAATCACCACTA | Reverse complement motif Consensus sequence: TAGTGGTGATTTSTGAGAT |
Dataset #: | 1 |
Motif ID: | 102 |
Motif name: | Motif 102 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 11 |
Similarity score: | 0.0670851 |
Original motif Consensus sequence: CTCATTTAATCCTCACAAC | Reverse complement motif Consensus sequence: GTTGTGAGGATTAAATGAG |
Dataset #: 1 | Motif ID: 336 | Motif name: Motif 336 |
Original motif Consensus sequence: ATGTAACCAAAYACCACCTG | Reverse complement motif Consensus sequence: CAGGTGGTKTTTGGTTACAT |
Best Matches for Motif ID 336 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 332 |
Motif name: | Motif 332 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.108577 |
Original motif Consensus sequence: CTGGCCCTCAATGGTTAAAC | Reverse complement motif Consensus sequence: GTTTAACCATTGAGGGCCAG |
Dataset #: | 1 |
Motif ID: | 55 |
Motif name: | Motif 55 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.115891 |
Original motif Consensus sequence: ATGGAATAYTATTCAGCCAT | Reverse complement motif Consensus sequence: ATGGCTGAATAKTATTCCAT |
Dataset #: | 1 |
Motif ID: | 115 |
Motif name: | Motif 115 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.123315 |
Original motif Consensus sequence: ATGATCCAGCAATYCCACTH | Reverse complement motif Consensus sequence: HAGTGGKATTGCTGGATCAT |
Dataset #: | 1 |
Motif ID: | 234 |
Motif name: | Motif 234 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.123723 |
Original motif Consensus sequence: AAGGAACAAACTCCRGACAC | Reverse complement motif Consensus sequence: GTGTCKGGAGTTTGTTCCTT |
Dataset #: | 1 |
Motif ID: | 160 |
Motif name: | Motif 160 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.127587 |
Original motif Consensus sequence: AAATTACCCAGTCTCAGGTA | Reverse complement motif Consensus sequence: TACCTGAGACTGGGTAATTT |
Dataset #: 1 | Motif ID: 337 | Motif name: Motif 337 |
Original motif Consensus sequence: AAACTAGAAA | Reverse complement motif Consensus sequence: TTTCTAGTTT |
Best Matches for Motif ID 337 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 195 |
Motif name: | Motif 195 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 7 |
Number of overlap: | 10 |
Similarity score: | 0.0563059 |
Original motif Consensus sequence: TAAAAGACTACAWATTGGGT | Reverse complement motif Consensus sequence: ACCCAATWTGTAGTCTTTTA |
Dataset #: | 1 |
Motif ID: | 330 |
Motif name: | Motif 330 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 10 |
Similarity score: | 0.0573722 |
Original motif Consensus sequence: AAAACCAGCAAGTTTTTAT | Reverse complement motif Consensus sequence: ATAAAAACTTGCTGGTTTT |
Dataset #: | 1 |
Motif ID: | 7 |
Motif name: | Motif 7 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 10 |
Similarity score: | 0.0579018 |
Original motif Consensus sequence: GTCTCWAMAAAAAAWAMAAA | Reverse complement motif Consensus sequence: TTTYTWTTTTTTYTWGAGAC |
Dataset #: | 1 |
Motif ID: | 233 |
Motif name: | Motif 233 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 10 |
Similarity score: | 0.0651653 |
Original motif Consensus sequence: GTTAACTGTAAAACAGCCT | Reverse complement motif Consensus sequence: AGGCTGTTTTACAGTTAAC |
Dataset #: | 1 |
Motif ID: | 73 |
Motif name: | Motif 73 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 10 |
Similarity score: | 0.0679233 |
Original motif Consensus sequence: CAAACTGCAAG | Reverse complement motif Consensus sequence: CTTGCAGTTTG |
Dataset #: 1 | Motif ID: 338 | Motif name: Motif 338 |
Original motif Consensus sequence: CTGCAGCC | Reverse complement motif Consensus sequence: GGCTGCAG |
Best Matches for Motif ID 338 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 68 |
Motif name: | Motif 68 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 8 |
Similarity score: | 0.0130204 |
Original motif Consensus sequence: CATGGCGGGCTGCAGGTC | Reverse complement motif Consensus sequence: GACCTGCAGCCCGCCATG |
Dataset #: | 1 |
Motif ID: | 219 |
Motif name: | Motif 219 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 8 |
Similarity score: | 0.0154581 |
Original motif Consensus sequence: CTGCAGCCTC | Reverse complement motif Consensus sequence: GAGGCTGCAG |
Dataset #: | 1 |
Motif ID: | 149 |
Motif name: | Motif 149 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 12 |
Number of overlap: | 8 |
Similarity score: | 0.0406936 |
Original motif Consensus sequence: ACTCAGCCCRCCTGCACCC | Reverse complement motif Consensus sequence: GGGTGCAGGMGGGCTGAGT |
Dataset #: | 1 |
Motif ID: | 89 |
Motif name: | Motif 89 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 9 |
Number of overlap: | 8 |
Similarity score: | 0.0413146 |
Original motif Consensus sequence: GGCTGCGGAGGGTGTA | Reverse complement motif Consensus sequence: TACACCCTCCGCAGCC |
Dataset #: | 1 |
Motif ID: | 220 |
Motif name: | Motif 220 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 8 |
Similarity score: | 0.0415555 |
Original motif Consensus sequence: TGCACTGCACCCAC | Reverse complement motif Consensus sequence: GTGGGTGCAGTGCA |
Dataset #: 1 | Motif ID: 339 | Motif name: Motif 339 |
Original motif Consensus sequence: CTCACCTCCTGC | Reverse complement motif Consensus sequence: GCAGGAGGTGAG |
Best Matches for Motif ID 339 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 60 |
Motif name: | Motif 60 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 12 |
Similarity score: | 0.0722162 |
Original motif Consensus sequence: GATCACGAGGTCAGGAG | Reverse complement motif Consensus sequence: CTCCTGACCTCGTGATC |
Dataset #: | 1 |
Motif ID: | 179 |
Motif name: | Motif 179 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 12 |
Similarity score: | 0.0795057 |
Original motif Consensus sequence: AGGTCCTTCAGGAGGTATTC | Reverse complement motif Consensus sequence: GAATACCTCCTGAAGGACCT |
Dataset #: | 1 |
Motif ID: | 149 |
Motif name: | Motif 149 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 12 |
Similarity score: | 0.0820882 |
Original motif Consensus sequence: ACTCAGCCCRCCTGCACCC | Reverse complement motif Consensus sequence: GGGTGCAGGMGGGCTGAGT |
Dataset #: | 1 |
Motif ID: | 262 |
Motif name: | Motif 262 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 12 |
Similarity score: | 0.0822961 |
Original motif Consensus sequence: CTCAGTGTTAATCTCCTGTC | Reverse complement motif Consensus sequence: GACAGGAGATTAACACTGAG |
Dataset #: | 1 |
Motif ID: | 165 |
Motif name: | Motif 165 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 12 |
Similarity score: | 0.082371 |
Original motif Consensus sequence: ATCTGACAGGAGGYRGAGCT | Reverse complement motif Consensus sequence: AGCTCMKCCTCCTGTCAGAT |
Dataset #: 1 | Motif ID: 340 | Motif name: Motif 340 |
Original motif Consensus sequence: GACCCAGAGAGC | Reverse complement motif Consensus sequence: GCTCTCTGGGTC |
Best Matches for Motif ID 340 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 302 |
Motif name: | Motif 302 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 12 |
Similarity score: | 0.0285197 |
Original motif Consensus sequence: GACCCTGAGAGC | Reverse complement motif Consensus sequence: GCTCTCAGGGTC |
Dataset #: | 1 |
Motif ID: | 362 |
Motif name: | Motif 362 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 12 |
Similarity score: | 0.0566001 |
Original motif Consensus sequence: GCTCTGAAGGTCC | Reverse complement motif Consensus sequence: GGACCTTCAGAGC |
Dataset #: | 1 |
Motif ID: | 175 |
Motif name: | Motif 175 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 12 |
Similarity score: | 0.0723494 |
Original motif Consensus sequence: AGCTAGAYACAGAGTGC | Reverse complement motif Consensus sequence: GCACTCTGTMTCTAGCT |
Dataset #: | 1 |
Motif ID: | 323 |
Motif name: | Motif 323 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 12 |
Similarity score: | 0.0776328 |
Original motif Consensus sequence: GCTCTCAGGTCCA | Reverse complement motif Consensus sequence: TGGACCTGAGAGC |
Dataset #: | 1 |
Motif ID: | 60 |
Motif name: | Motif 60 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 12 |
Similarity score: | 0.0825042 |
Original motif Consensus sequence: GATCACGAGGTCAGGAG | Reverse complement motif Consensus sequence: CTCCTGACCTCGTGATC |
Dataset #: 1 | Motif ID: 341 | Motif name: Motif 341 |
Original motif Consensus sequence: ATCCATCCATCCATCCA | Reverse complement motif Consensus sequence: TGGATGGATGGATGGAT |
Best Matches for Motif ID 341 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 115 |
Motif name: | Motif 115 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 17 |
Similarity score: | 0.0809092 |
Original motif Consensus sequence: ATGATCCAGCAATYCCACTH | Reverse complement motif Consensus sequence: HAGTGGKATTGCTGGATCAT |
Dataset #: | 1 |
Motif ID: | 58 |
Motif name: | Motif 58 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 17 |
Similarity score: | 0.0940608 |
Original motif Consensus sequence: ATGGACAYTTRGGTTGHTTC | Reverse complement motif Consensus sequence: GAAHCAACCKAAKTGTCCAT |
Dataset #: | 1 |
Motif ID: | 53 |
Motif name: | Motif 53 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 17 |
Similarity score: | 0.0958074 |
Original motif Consensus sequence: GTCCCATCGACCACCCAAG | Reverse complement motif Consensus sequence: CTTGGGTGGTCGATGGGAC |
Dataset #: | 1 |
Motif ID: | 66 |
Motif name: | Motif 66 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 17 |
Similarity score: | 0.100906 |
Original motif Consensus sequence: ACACACAYACACACACACA | Reverse complement motif Consensus sequence: TGTGTGTGTGTKTGTGTGT |
Dataset #: | 1 |
Motif ID: | 105 |
Motif name: | Motif 105 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 17 |
Similarity score: | 0.101118 |
Original motif Consensus sequence: GCCTCTCCCTCCACACCTCC | Reverse complement motif Consensus sequence: GGAGGTGTGGAGGGAGAGGC |
Dataset #: 1 | Motif ID: 342 | Motif name: Motif 342 |
Original motif Consensus sequence: GCCTATTAAAC | Reverse complement motif Consensus sequence: GTTTAATAGGC |
Best Matches for Motif ID 342 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 129 |
Motif name: | Motif 129 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 11 |
Similarity score: | 0.032945 |
Original motif Consensus sequence: AAGAGGTTTAATTGRCTCA | Reverse complement motif Consensus sequence: TGAGKCAATTAAACCTCTT |
Dataset #: | 1 |
Motif ID: | 137 |
Motif name: | Motif 137 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 7 |
Number of overlap: | 11 |
Similarity score: | 0.0624203 |
Original motif Consensus sequence: AGGTTTGTTACATAGGTAWA | Reverse complement motif Consensus sequence: TWTACCTATGTAACAAACCT |
Dataset #: | 1 |
Motif ID: | 308 |
Motif name: | Motif 308 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 11 |
Similarity score: | 0.0647175 |
Original motif Consensus sequence: AAATTAGGCCAATTAATAAC | Reverse complement motif Consensus sequence: GTTATTAATTGGCCTAATTT |
Dataset #: | 1 |
Motif ID: | 21 |
Motif name: | Motif 21 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 11 |
Similarity score: | 0.0690668 |
Original motif Consensus sequence: GCCGTTTKTTAAGCCCGTY | Reverse complement motif Consensus sequence: KACGGGCTTAARAAACGGC |
Dataset #: | 1 |
Motif ID: | 348 |
Motif name: | Motif 348 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 11 |
Similarity score: | 0.0723689 |
Original motif Consensus sequence: ATGGCCTATGACYGSTTTG | Reverse complement motif Consensus sequence: CAAASCKGTCATAGGCCAT |
Dataset #: 1 | Motif ID: 343 | Motif name: Motif 343 |
Original motif Consensus sequence: CTGGGATTACA | Reverse complement motif Consensus sequence: TGTAATCCCAG |
Best Matches for Motif ID 343 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 4 |
Motif name: | Motif 4 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 11 |
Similarity score: | 0.022272 |
Original motif Consensus sequence: GCTGGGATTACAGG | Reverse complement motif Consensus sequence: CCTGTAATCCCAGC |
Dataset #: | 1 |
Motif ID: | 69 |
Motif name: | Motif 69 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 11 |
Similarity score: | 0.0277108 |
Original motif Consensus sequence: GTAGCTGGGAYTACA | Reverse complement motif Consensus sequence: TGTAKTCCCAGCTAC |
Dataset #: | 1 |
Motif ID: | 345 |
Motif name: | Motif 345 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 11 |
Similarity score: | 0.0604855 |
Original motif Consensus sequence: CTGGGAATCCAAC | Reverse complement motif Consensus sequence: GTTGGATTCCCAG |
Dataset #: | 1 |
Motif ID: | 278 |
Motif name: | Motif 278 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 11 |
Similarity score: | 0.0725854 |
Original motif Consensus sequence: ACTTTCAGGCATAACA | Reverse complement motif Consensus sequence: TGTTATGCCTGAAAGT |
Dataset #: | 1 |
Motif ID: | 255 |
Motif name: | Motif 255 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 11 |
Similarity score: | 0.0732372 |
Original motif Consensus sequence: CTGCTATAACAAA | Reverse complement motif Consensus sequence: TTTGTTATAGCAG |
Dataset #: 1 | Motif ID: 344 | Motif name: Motif 344 |
Original motif Consensus sequence: CATAGGAGATGAC | Reverse complement motif Consensus sequence: GTCATCTCCTATG |
Best Matches for Motif ID 344 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 99 |
Motif name: | Motif 99 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 7 |
Number of overlap: | 13 |
Similarity score: | 0.0765815 |
Original motif Consensus sequence: GCAAAKGACATGATYTCATT | Reverse complement motif Consensus sequence: AATGAKATCATGTCYTTTGC |
Dataset #: | 1 |
Motif ID: | 262 |
Motif name: | Motif 262 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 8 |
Number of overlap: | 13 |
Similarity score: | 0.0805293 |
Original motif Consensus sequence: CTCAGTGTTAATCTCCTGTC | Reverse complement motif Consensus sequence: GACAGGAGATTAACACTGAG |
Dataset #: | 1 |
Motif ID: | 23 |
Motif name: | Motif 23 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 6 |
Number of overlap: | 13 |
Similarity score: | 0.0919284 |
Original motif Consensus sequence: GGTTCATCTCACTAGGGAGT | Reverse complement motif Consensus sequence: ACTCCCTAGTGAGATGAACC |
Dataset #: | 1 |
Motif ID: | 311 |
Motif name: | Motif 311 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 13 |
Similarity score: | 0.0937575 |
Original motif Consensus sequence: GGCATCACGGATCCTACCAA | Reverse complement motif Consensus sequence: TTGGTAGGATCCGTGATGCC |
Dataset #: | 1 |
Motif ID: | 36 |
Motif name: | Motif 36 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 6 |
Number of overlap: | 13 |
Similarity score: | 0.0944053 |
Original motif Consensus sequence: ACATCCCAGACGATGGGCG | Reverse complement motif Consensus sequence: CGCCCATCGTCTGGGATGT |
Dataset #: 1 | Motif ID: 345 | Motif name: Motif 345 |
Original motif Consensus sequence: CTGGGAATCCAAC | Reverse complement motif Consensus sequence: GTTGGATTCCCAG |
Best Matches for Motif ID 345 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 4 |
Motif name: | Motif 4 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 13 |
Similarity score: | 0.0624846 |
Original motif Consensus sequence: GCTGGGATTACAGG | Reverse complement motif Consensus sequence: CCTGTAATCCCAGC |
Dataset #: | 1 |
Motif ID: | 154 |
Motif name: | Motif 154 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 5 |
Number of overlap: | 13 |
Similarity score: | 0.0631163 |
Original motif Consensus sequence: CATTAGATTCTCATAGGA | Reverse complement motif Consensus sequence: TCCTATGAGAATCTAATG |
Dataset #: | 1 |
Motif ID: | 115 |
Motif name: | Motif 115 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 6 |
Number of overlap: | 13 |
Similarity score: | 0.070058 |
Original motif Consensus sequence: ATGATCCAGCAATYCCACTH | Reverse complement motif Consensus sequence: HAGTGGKATTGCTGGATCAT |
Dataset #: | 1 |
Motif ID: | 326 |
Motif name: | Motif 326 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 13 |
Similarity score: | 0.0766159 |
Original motif Consensus sequence: GACATGGAGTCAAAGG | Reverse complement motif Consensus sequence: CCTTTGACTCCATGTC |
Dataset #: | 1 |
Motif ID: | 191 |
Motif name: | Motif 191 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 7 |
Number of overlap: | 13 |
Similarity score: | 0.0805023 |
Original motif Consensus sequence: AAAGTGCCGAGAKTGCAGC | Reverse complement motif Consensus sequence: GCTGCARTCTCGGCACTTT |
Dataset #: 1 | Motif ID: 346 | Motif name: Motif 346 |
Original motif Consensus sequence: AAATCTTAAAGCTC | Reverse complement motif Consensus sequence: GAGCTTTAAGATTT |
Best Matches for Motif ID 346 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 303 |
Motif name: | Motif 303 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 14 |
Similarity score: | 0.0682748 |
Original motif Consensus sequence: AGTTCTTAAAGATGGT | Reverse complement motif Consensus sequence: ACCATCTTTAAGAACT |
Dataset #: | 1 |
Motif ID: | 202 |
Motif name: | Motif 202 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 14 |
Similarity score: | 0.0876662 |
Original motif Consensus sequence: ACACATCACAAAGCAGTTTC | Reverse complement motif Consensus sequence: GAAACTGCTTTGTGATGTGT |
Dataset #: | 1 |
Motif ID: | 224 |
Motif name: | Motif 224 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 14 |
Similarity score: | 0.0880907 |
Original motif Consensus sequence: AATGAGTTAAGACTTTG | Reverse complement motif Consensus sequence: CAAAGTCTTAACTCATT |
Dataset #: | 1 |
Motif ID: | 280 |
Motif name: | Motif 280 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 14 |
Similarity score: | 0.0973462 |
Original motif Consensus sequence: CCTAGATTTCAGARGATGT | Reverse complement motif Consensus sequence: ACATCMTCTGAAATCTAGG |
Dataset #: | 1 |
Motif ID: | 85 |
Motif name: | Motif 85 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 5 |
Number of overlap: | 14 |
Similarity score: | 0.100914 |
Original motif Consensus sequence: CTAGACATAAAGGTTCTCCA | Reverse complement motif Consensus sequence: TGGAGAACCTTTATGTCTAG |
Dataset #: 1 | Motif ID: 347 | Motif name: Motif 347 |
Original motif Consensus sequence: ACACCTATTCGCACAC | Reverse complement motif Consensus sequence: GTGTGCGAATAGGTGT |
Best Matches for Motif ID 347 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 66 |
Motif name: | Motif 66 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 16 |
Similarity score: | 0.0719682 |
Original motif Consensus sequence: ACACACAYACACACACACA | Reverse complement motif Consensus sequence: TGTGTGTGTGTKTGTGTGT |
Dataset #: | 1 |
Motif ID: | 294 |
Motif name: | Motif 294 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 16 |
Similarity score: | 0.0824744 |
Original motif Consensus sequence: AGCTGTGAGAAGAGGGCCAC | Reverse complement motif Consensus sequence: GTGGCCCTCTTCTCACAGCT |
Dataset #: | 1 |
Motif ID: | 290 |
Motif name: | Motif 290 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 16 |
Similarity score: | 0.0947322 |
Original motif Consensus sequence: TGATACCCAGGCAAACAG | Reverse complement motif Consensus sequence: CTGTTTGCCTGGGTATCA |
Dataset #: | 1 |
Motif ID: | 225 |
Motif name: | Motif 225 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 16 |
Similarity score: | 0.0975498 |
Original motif Consensus sequence: GCACATGTAYCCYAGAACTT | Reverse complement motif Consensus sequence: AAGTTCTKGGKTACATGTGC |
Dataset #: | 1 |
Motif ID: | 70 |
Motif name: | Motif 70 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 16 |
Similarity score: | 0.102565 |
Original motif Consensus sequence: CTATTGTGAATARTGCTGC | Reverse complement motif Consensus sequence: GCAGCAMTATTCACAATAG |
Dataset #: 1 | Motif ID: 348 | Motif name: Motif 348 |
Original motif Consensus sequence: ATGGCCTATGACYGSTTTG | Reverse complement motif Consensus sequence: CAAASCKGTCATAGGCCAT |
Best Matches for Motif ID 348 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 192 |
Motif name: | Motif 192 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.115392 |
Original motif Consensus sequence: GAATCCTGGGACAGCCTGT | Reverse complement motif Consensus sequence: ACAGGCTGTCCCAGGATTC |
Dataset #: | 1 |
Motif ID: | 280 |
Motif name: | Motif 280 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.117513 |
Original motif Consensus sequence: CCTAGATTTCAGARGATGT | Reverse complement motif Consensus sequence: ACATCMTCTGAAATCTAGG |
Dataset #: | 1 |
Motif ID: | 196 |
Motif name: | Motif 196 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.118 |
Original motif Consensus sequence: CCTGCCATTGCYSAGGCTTG | Reverse complement motif Consensus sequence: CAAGCCTSKGCAATGGCAGG |
Dataset #: | 1 |
Motif ID: | 179 |
Motif name: | Motif 179 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.120128 |
Original motif Consensus sequence: AGGTCCTTCAGGAGGTATTC | Reverse complement motif Consensus sequence: GAATACCTCCTGAAGGACCT |
Dataset #: | 1 |
Motif ID: | 100 |
Motif name: | Motif 100 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.120655 |
Original motif Consensus sequence: GCTGGCCCGCAAGCGCCGCG | Reverse complement motif Consensus sequence: CGCGGCGCTTGCGGGCCAGC |
Dataset #: 1 | Motif ID: 349 | Motif name: Motif 349 |
Original motif Consensus sequence: AGAGCCAAATCATGARTGAA | Reverse complement motif Consensus sequence: TTCAMTCATGATTTGGCTCT |
Best Matches for Motif ID 349 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 165 |
Motif name: | Motif 165 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.121011 |
Original motif Consensus sequence: ATCTGACAGGAGGYRGAGCT | Reverse complement motif Consensus sequence: AGCTCMKCCTCCTGTCAGAT |
Dataset #: | 1 |
Motif ID: | 61 |
Motif name: | Motif 61 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.121473 |
Original motif Consensus sequence: GGATCCACTGGGTGAAGCCA | Reverse complement motif Consensus sequence: TGGCTTCACCCAGTGGATCC |
Dataset #: | 1 |
Motif ID: | 64 |
Motif name: | Motif 64 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.124741 |
Original motif Consensus sequence: GAAGGCAGCTAAGGCCCGGY | Reverse complement motif Consensus sequence: KCCGGGCCTTAGCTGCCTTC |
Dataset #: | 1 |
Motif ID: | 155 |
Motif name: | Motif 155 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.13108 |
Original motif Consensus sequence: TCCCTCCCGGACGGGGYGGC | Reverse complement motif Consensus sequence: GCCKCCCCGTCCGGGAGGGA |
Dataset #: | 1 |
Motif ID: | 176 |
Motif name: | Motif 176 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.131454 |
Original motif Consensus sequence: AGGCCCCAGTGTSTGTTGTT | Reverse complement motif Consensus sequence: AACAACASACACTGGGGCCT |
Dataset #: 1 | Motif ID: 350 | Motif name: Motif 350 |
Original motif Consensus sequence: TCTGGAGTGGACCTCCAGCA | Reverse complement motif Consensus sequence: TGCTGGAGGTCCACTCCAGA |
Best Matches for Motif ID 350 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 3 |
Motif name: | Motif 3 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.100512 |
Original motif Consensus sequence: GCTGGAGTGCAGTGGCRYGA | Reverse complement motif Consensus sequence: TCKMGCCACTGCACTCCAGC |
Dataset #: | 1 |
Motif ID: | 178 |
Motif name: | Motif 178 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.103785 |
Original motif Consensus sequence: ACTGTCTTCCACCTCCACAT | Reverse complement motif Consensus sequence: ATGTGGAGGTGGAAGACAGT |
Dataset #: | 1 |
Motif ID: | 52 |
Motif name: | Motif 52 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.104962 |
Original motif Consensus sequence: GACTGGCAGGCAGCTCCACC | Reverse complement motif Consensus sequence: GGTGGAGCTGCCTGCCAGTC |
Dataset #: | 1 |
Motif ID: | 100 |
Motif name: | Motif 100 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.125531 |
Original motif Consensus sequence: GCTGGCCCGCAAGCGCCGCG | Reverse complement motif Consensus sequence: CGCGGCGCTTGCGGGCCAGC |
Dataset #: | 1 |
Motif ID: | 262 |
Motif name: | Motif 262 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.12666 |
Original motif Consensus sequence: CTCAGTGTTAATCTCCTGTC | Reverse complement motif Consensus sequence: GACAGGAGATTAACACTGAG |
Dataset #: 1 | Motif ID: 351 | Motif name: Motif 351 |
Original motif Consensus sequence: ATTMGGGTGGG | Reverse complement motif Consensus sequence: CCCACCCYAAT |
Best Matches for Motif ID 351 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 259 |
Motif name: | Motif 259 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 11 |
Similarity score: | 0.0511125 |
Original motif Consensus sequence: CCCACACCCTTATTA | Reverse complement motif Consensus sequence: TAATAAGGGTGTGGG |
Dataset #: | 1 |
Motif ID: | 98 |
Motif name: | Motif 98 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 7 |
Number of overlap: | 11 |
Similarity score: | 0.0610932 |
Original motif Consensus sequence: AGTTCCGGGTGGGCGTGGG | Reverse complement motif Consensus sequence: CCCACGCCCACCCGGAACT |
Dataset #: | 1 |
Motif ID: | 286 |
Motif name: | Motif 286 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 11 |
Similarity score: | 0.0771299 |
Original motif Consensus sequence: CAGGCGGCTGGGAG | Reverse complement motif Consensus sequence: CTCCCAGCCGCCTG |
Dataset #: | 1 |
Motif ID: | 153 |
Motif name: | Motif 153 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 11 |
Similarity score: | 0.0778643 |
Original motif Consensus sequence: CACTAGGGAGTGCC | Reverse complement motif Consensus sequence: GGCACTCCCTAGTG |
Dataset #: | 1 |
Motif ID: | 277 |
Motif name: | Motif 277 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 11 |
Similarity score: | 0.0845161 |
Original motif Consensus sequence: GCCCTCACCAGAAGC | Reverse complement motif Consensus sequence: GCTTCTGGTGAGGGC |
Dataset #: 1 | Motif ID: 352 | Motif name: Motif 352 |
Original motif Consensus sequence: CATCTTCA | Reverse complement motif Consensus sequence: TGAAGATG |
Best Matches for Motif ID 352 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 246 |
Motif name: | Motif 246 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 8 |
Number of overlap: | 8 |
Similarity score: | 0.0276887 |
Original motif Consensus sequence: GCAGCTTCACTCCTGA | Reverse complement motif Consensus sequence: TCAGGAGTGAAGCTGC |
Dataset #: | 1 |
Motif ID: | 303 |
Motif name: | Motif 303 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 8 |
Similarity score: | 0.0334876 |
Original motif Consensus sequence: AGTTCTTAAAGATGGT | Reverse complement motif Consensus sequence: ACCATCTTTAAGAACT |
Dataset #: | 1 |
Motif ID: | 227 |
Motif name: | Motif 227 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 8 |
Similarity score: | 0.0397493 |
Original motif Consensus sequence: CCCAAATCTCATSTTGAAT | Reverse complement motif Consensus sequence: ATTCAASATGAGATTTGGG |
Dataset #: | 1 |
Motif ID: | 280 |
Motif name: | Motif 280 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 8 |
Similarity score: | 0.0443445 |
Original motif Consensus sequence: CCTAGATTTCAGARGATGT | Reverse complement motif Consensus sequence: ACATCMTCTGAAATCTAGG |
Dataset #: | 1 |
Motif ID: | 245 |
Motif name: | Motif 245 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 8 |
Number of overlap: | 8 |
Similarity score: | 0.0449237 |
Original motif Consensus sequence: CAGACTGCCTCCTCAA | Reverse complement motif Consensus sequence: TTGAGGAGGCAGTCTG |
Dataset #: 1 | Motif ID: 353 | Motif name: Motif 353 |
Original motif Consensus sequence: CACATGGAAGC | Reverse complement motif Consensus sequence: GCTTCCATGTG |
Best Matches for Motif ID 353 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 225 |
Motif name: | Motif 225 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 11 |
Similarity score: | 0.0523615 |
Original motif Consensus sequence: GCACATGTAYCCYAGAACTT | Reverse complement motif Consensus sequence: AAGTTCTKGGKTACATGTGC |
Dataset #: | 1 |
Motif ID: | 104 |
Motif name: | Motif 104 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 11 |
Similarity score: | 0.0616894 |
Original motif Consensus sequence: CAACATGGATGRARCTGGAG | Reverse complement motif Consensus sequence: CTCCAGKTMCATCCATGTTG |
Dataset #: | 1 |
Motif ID: | 235 |
Motif name: | Motif 235 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 8 |
Number of overlap: | 11 |
Similarity score: | 0.0617739 |
Original motif Consensus sequence: TCCAAATGGGAGAAATTGGC | Reverse complement motif Consensus sequence: GCCAATTTCTCCCATTTGGA |
Dataset #: | 1 |
Motif ID: | 310 |
Motif name: | Motif 310 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 11 |
Similarity score: | 0.0618096 |
Original motif Consensus sequence: CCCATGCAAGTCYRAAATCC | Reverse complement motif Consensus sequence: GGATTTMKGACTTGCATGGG |
Dataset #: | 1 |
Motif ID: | 326 |
Motif name: | Motif 326 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 11 |
Similarity score: | 0.0627655 |
Original motif Consensus sequence: GACATGGAGTCAAAGG | Reverse complement motif Consensus sequence: CCTTTGACTCCATGTC |
Dataset #: 1 | Motif ID: 354 | Motif name: Motif 354 |
Original motif Consensus sequence: GCTGATAAAGAC | Reverse complement motif Consensus sequence: GTCTTTATCAGC |
Best Matches for Motif ID 354 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 329 |
Motif name: | Motif 329 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 6 |
Number of overlap: | 12 |
Similarity score: | 0.0760989 |
Original motif Consensus sequence: GGGAGGGATATATTAGC | Reverse complement motif Consensus sequence: GCTAATATATCCCTCCC |
Dataset #: | 1 |
Motif ID: | 106 |
Motif name: | Motif 106 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 7 |
Number of overlap: | 12 |
Similarity score: | 0.0776121 |
Original motif Consensus sequence: ATTGGTGTATTTACAATCCC | Reverse complement motif Consensus sequence: GGGATTGTAAATACACCAAT |
Dataset #: | 1 |
Motif ID: | 303 |
Motif name: | Motif 303 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 12 |
Similarity score: | 0.0781258 |
Original motif Consensus sequence: AGTTCTTAAAGATGGT | Reverse complement motif Consensus sequence: ACCATCTTTAAGAACT |
Dataset #: | 1 |
Motif ID: | 184 |
Motif name: | Motif 184 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 12 |
Similarity score: | 0.0799308 |
Original motif Consensus sequence: ATATTGATGATCCTGACC | Reverse complement motif Consensus sequence: GGTCAGGATCATCAATAT |
Dataset #: | 1 |
Motif ID: | 262 |
Motif name: | Motif 262 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 5 |
Number of overlap: | 12 |
Similarity score: | 0.0859716 |
Original motif Consensus sequence: CTCAGTGTTAATCTCCTGTC | Reverse complement motif Consensus sequence: GACAGGAGATTAACACTGAG |
Dataset #: 1 | Motif ID: 355 | Motif name: Motif 355 |
Original motif Consensus sequence: TATGAGCCTGTAA | Reverse complement motif Consensus sequence: TTACAGGCTCATA |
Best Matches for Motif ID 355 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 154 |
Motif name: | Motif 154 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 13 |
Similarity score: | 0.059588 |
Original motif Consensus sequence: CATTAGATTCTCATAGGA | Reverse complement motif Consensus sequence: TCCTATGAGAATCTAATG |
Dataset #: | 1 |
Motif ID: | 275 |
Motif name: | Motif 275 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 13 |
Similarity score: | 0.0903624 |
Original motif Consensus sequence: CTCACAGAGTTAAA | Reverse complement motif Consensus sequence: TTTAACTCTGTGAG |
Dataset #: | 1 |
Motif ID: | 184 |
Motif name: | Motif 184 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 6 |
Number of overlap: | 13 |
Similarity score: | 0.0930991 |
Original motif Consensus sequence: ATATTGATGATCCTGACC | Reverse complement motif Consensus sequence: GGTCAGGATCATCAATAT |
Dataset #: | 1 |
Motif ID: | 278 |
Motif name: | Motif 278 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 13 |
Similarity score: | 0.0931692 |
Original motif Consensus sequence: ACTTTCAGGCATAACA | Reverse complement motif Consensus sequence: TGTTATGCCTGAAAGT |
Dataset #: | 1 |
Motif ID: | 356 |
Motif name: | Motif 356 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 13 |
Similarity score: | 0.0940052 |
Original motif Consensus sequence: AATTAAAAGACACAGACTG | Reverse complement motif Consensus sequence: CAGTCTGTGTCTTTTAATT |
Dataset #: 1 | Motif ID: 356 | Motif name: Motif 356 |
Original motif Consensus sequence: AATTAAAAGACACAGACTG | Reverse complement motif Consensus sequence: CAGTCTGTGTCTTTTAATT |
Best Matches for Motif ID 356 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 333 |
Motif name: | Motif 333 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.10357 |
Original motif Consensus sequence: TAGATAATAGCTCCAGCTTT | Reverse complement motif Consensus sequence: AAAGCTGGAGCTATTATCTA |
Dataset #: | 1 |
Motif ID: | 357 |
Motif name: | Motif 357 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.10942 |
Original motif Consensus sequence: CAAGTTGACACATAAAATTA | Reverse complement motif Consensus sequence: TAATTTTATGTGTCAACTTG |
Dataset #: | 1 |
Motif ID: | 232 |
Motif name: | Motif 232 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 19 |
Similarity score: | 0.110112 |
Original motif Consensus sequence: AGTTGTAATTGGGAGACTT | Reverse complement motif Consensus sequence: AAGTCTCCCAATTACAACT |
Dataset #: | 1 |
Motif ID: | 109 |
Motif name: | Motif 109 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.113248 |
Original motif Consensus sequence: GAGAGAGAGAGAGAGAGAGA | Reverse complement motif Consensus sequence: TCTCTCTCTCTCTCTCTCTC |
Dataset #: | 1 |
Motif ID: | 336 |
Motif name: | Motif 336 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 19 |
Similarity score: | 0.115507 |
Original motif Consensus sequence: ATGTAACCAAAYACCACCTG | Reverse complement motif Consensus sequence: CAGGTGGTKTTTGGTTACAT |
Dataset #: 1 | Motif ID: 357 | Motif name: Motif 357 |
Original motif Consensus sequence: CAAGTTGACACATAAAATTA | Reverse complement motif Consensus sequence: TAATTTTATGTGTCAACTTG |
Best Matches for Motif ID 357 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 202 |
Motif name: | Motif 202 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.114196 |
Original motif Consensus sequence: ACACATCACAAAGCAGTTTC | Reverse complement motif Consensus sequence: GAAACTGCTTTGTGATGTGT |
Dataset #: | 1 |
Motif ID: | 137 |
Motif name: | Motif 137 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.114845 |
Original motif Consensus sequence: AGGTTTGTTACATAGGTAWA | Reverse complement motif Consensus sequence: TWTACCTATGTAACAAACCT |
Dataset #: | 1 |
Motif ID: | 194 |
Motif name: | Motif 194 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.119939 |
Original motif Consensus sequence: CAAGGGTATAYGAGTAGCTG | Reverse complement motif Consensus sequence: CAGCTACTCKTATACCCTTG |
Dataset #: | 1 |
Motif ID: | 308 |
Motif name: | Motif 308 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.120519 |
Original motif Consensus sequence: AAATTAGGCCAATTAATAAC | Reverse complement motif Consensus sequence: GTTATTAATTGGCCTAATTT |
Dataset #: | 1 |
Motif ID: | 63 |
Motif name: | Motif 63 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 20 |
Similarity score: | 0.122947 |
Original motif Consensus sequence: AGTGAGAACATRYRRTRTTT | Reverse complement motif Consensus sequence: AAAMAMMKMATGTTCTCACT |
Dataset #: 1 | Motif ID: 358 | Motif name: Motif 358 |
Original motif Consensus sequence: CGTCCATCACCCC | Reverse complement motif Consensus sequence: GGGGTGATGGACG |
Best Matches for Motif ID 358 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 1 |
Motif name: | Motif 1 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 13 |
Similarity score: | 0.0685601 |
Original motif Consensus sequence: GGGGTGACAGABGB | Reverse complement motif Consensus sequence: BCVTCTGTCACCCC |
Dataset #: | 1 |
Motif ID: | 53 |
Motif name: | Motif 53 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 13 |
Similarity score: | 0.0721847 |
Original motif Consensus sequence: GTCCCATCGACCACCCAAG | Reverse complement motif Consensus sequence: CTTGGGTGGTCGATGGGAC |
Dataset #: | 1 |
Motif ID: | 341 |
Motif name: | Motif 341 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 13 |
Similarity score: | 0.0757831 |
Original motif Consensus sequence: ATCCATCCATCCATCCA | Reverse complement motif Consensus sequence: TGGATGGATGGATGGAT |
Dataset #: | 1 |
Motif ID: | 178 |
Motif name: | Motif 178 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 6 |
Number of overlap: | 13 |
Similarity score: | 0.0810183 |
Original motif Consensus sequence: ACTGTCTTCCACCTCCACAT | Reverse complement motif Consensus sequence: ATGTGGAGGTGGAAGACAGT |
Dataset #: | 1 |
Motif ID: | 111 |
Motif name: | Motif 111 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 13 |
Similarity score: | 0.083582 |
Original motif Consensus sequence: AGGAGCCCCTCHGCCCR | Reverse complement motif Consensus sequence: KGGGCDGAGGGGCTCCT |
Dataset #: 1 | Motif ID: 359 | Motif name: Motif 359 |
Original motif Consensus sequence: TGACGTCACS | Reverse complement motif Consensus sequence: SGTGACGTCA |
Best Matches for Motif ID 359 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 61 |
Motif name: | Motif 61 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 10 |
Similarity score: | 0.0622858 |
Original motif Consensus sequence: GGATCCACTGGGTGAAGCCA | Reverse complement motif Consensus sequence: TGGCTTCACCCAGTGGATCC |
Dataset #: | 1 |
Motif ID: | 279 |
Motif name: | Motif 279 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 10 |
Similarity score: | 0.0624843 |
Original motif Consensus sequence: GGGGGAGACATCACACR | Reverse complement motif Consensus sequence: MGTGTGATGTCTCCCCC |
Dataset #: | 1 |
Motif ID: | 291 |
Motif name: | Motif 291 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 10 |
Similarity score: | 0.0832463 |
Original motif Consensus sequence: CTGAGGACCTGAGGTCRTA | Reverse complement motif Consensus sequence: TAMGACCTCAGGTCCTCAG |
Dataset #: | 1 |
Motif ID: | 316 |
Motif name: | Motif 316 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 10 |
Similarity score: | 0.0833695 |
Original motif Consensus sequence: CGGAAGTGACGT | Reverse complement motif Consensus sequence: ACGTCACTTCCG |
Dataset #: | 1 |
Motif ID: | 60 |
Motif name: | Motif 60 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 10 |
Similarity score: | 0.0854535 |
Original motif Consensus sequence: GATCACGAGGTCAGGAG | Reverse complement motif Consensus sequence: CTCCTGACCTCGTGATC |
Dataset #: 1 | Motif ID: 360 | Motif name: Motif 360 |
Original motif Consensus sequence: CAATGGGGTG | Reverse complement motif Consensus sequence: CACCCCATTG |
Best Matches for Motif ID 360 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 193 |
Motif name: | Motif 193 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 10 |
Similarity score: | 0.0498627 |
Original motif Consensus sequence: ATACAATGGGGGTACAGRC | Reverse complement motif Consensus sequence: GKCTGTACCCCCATTGTAT |
Dataset #: | 1 |
Motif ID: | 284 |
Motif name: | Motif 284 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 10 |
Similarity score: | 0.0546882 |
Original motif Consensus sequence: CATTTGGGAGCCCATTGA | Reverse complement motif Consensus sequence: TCAATGGGCTCCCAAATG |
Dataset #: | 1 |
Motif ID: | 242 |
Motif name: | Motif 242 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 10 |
Number of overlap: | 10 |
Similarity score: | 0.0575203 |
Original motif Consensus sequence: AACCCTATTGTGAACTGYG | Reverse complement motif Consensus sequence: CMCAGTTCACAATAGGGTT |
Dataset #: | 1 |
Motif ID: | 23 |
Motif name: | Motif 23 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 10 |
Similarity score: | 0.0718758 |
Original motif Consensus sequence: GGTTCATCTCACTAGGGAGT | Reverse complement motif Consensus sequence: ACTCCCTAGTGAGATGAACC |
Dataset #: | 1 |
Motif ID: | 321 |
Motif name: | Motif 321 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 7 |
Number of overlap: | 10 |
Similarity score: | 0.0732908 |
Original motif Consensus sequence: AAGCTCGAACTGGGTGGAGC | Reverse complement motif Consensus sequence: GCTCCACCCAGTTCGAGCTT |
Dataset #: 1 | Motif ID: 361 | Motif name: Motif 361 |
Original motif Consensus sequence: AGGTCAGGAGTTC | Reverse complement motif Consensus sequence: GAACTCCTGACCT |
Best Matches for Motif ID 361 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 291 |
Motif name: | Motif 291 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 13 |
Similarity score: | 0.0663108 |
Original motif Consensus sequence: CTGAGGACCTGAGGTCRTA | Reverse complement motif Consensus sequence: TAMGACCTCAGGTCCTCAG |
Dataset #: | 1 |
Motif ID: | 234 |
Motif name: | Motif 234 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 8 |
Number of overlap: | 13 |
Similarity score: | 0.0705628 |
Original motif Consensus sequence: AAGGAACAAACTCCRGACAC | Reverse complement motif Consensus sequence: GTGTCKGGAGTTTGTTCCTT |
Dataset #: | 1 |
Motif ID: | 99 |
Motif name: | Motif 99 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 13 |
Similarity score: | 0.0735746 |
Original motif Consensus sequence: GCAAAKGACATGATYTCATT | Reverse complement motif Consensus sequence: AATGAKATCATGTCYTTTGC |
Dataset #: | 1 |
Motif ID: | 72 |
Motif name: | Motif 72 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 13 |
Similarity score: | 0.0755173 |
Original motif Consensus sequence: CGCACTCCTCAGCC | Reverse complement motif Consensus sequence: GGCTGAGGAGTGCG |
Dataset #: | 1 |
Motif ID: | 16 |
Motif name: | Motif 16 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 13 |
Similarity score: | 0.0777779 |
Original motif Consensus sequence: GAAAGGGAACTCCCTGACCC | Reverse complement motif Consensus sequence: GGGTCAGGGAGTTCCCTTTC |
Dataset #: 1 | Motif ID: 362 | Motif name: Motif 362 |
Original motif Consensus sequence: GCTCTGAAGGTCC | Reverse complement motif Consensus sequence: GGACCTTCAGAGC |
Best Matches for Motif ID 362 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 10 |
Motif name: | Motif 10 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 13 |
Similarity score: | 0.0695238 |
Original motif Consensus sequence: AGGASCSTCYSWGCCMGGY | Reverse complement motif Consensus sequence: MCCYGGCWSMGASGSTCCT |
Dataset #: | 1 |
Motif ID: | 179 |
Motif name: | Motif 179 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 13 |
Similarity score: | 0.0873004 |
Original motif Consensus sequence: AGGTCCTTCAGGAGGTATTC | Reverse complement motif Consensus sequence: GAATACCTCCTGAAGGACCT |
Dataset #: | 1 |
Motif ID: | 312 |
Motif name: | Motif 312 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 7 |
Number of overlap: | 13 |
Similarity score: | 0.088213 |
Original motif Consensus sequence: AGGACTGAGGGTGCCYRGGG | Reverse complement motif Consensus sequence: CCCMKGGCACCCTCAGTCCT |
Dataset #: | 1 |
Motif ID: | 60 |
Motif name: | Motif 60 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 13 |
Similarity score: | 0.0888302 |
Original motif Consensus sequence: GATCACGAGGTCAGGAG | Reverse complement motif Consensus sequence: CTCCTGACCTCGTGATC |
Dataset #: | 1 |
Motif ID: | 215 |
Motif name: | Motif 215 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 2 |
Number of overlap: | 13 |
Similarity score: | 0.0929872 |
Original motif Consensus sequence: HGCTCCTGTGSKCCC | Reverse complement motif Consensus sequence: GGGRSCACAGGAGCD |
Dataset #: 1 | Motif ID: 363 | Motif name: Motif 363 |
Original motif Consensus sequence: CAAGGTCTGATTGTW | Reverse complement motif Consensus sequence: WACAATCAGACCTTG |
Best Matches for Motif ID 363 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 227 |
Motif name: | Motif 227 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 15 |
Similarity score: | 0.0937179 |
Original motif Consensus sequence: CCCAAATCTCATSTTGAAT | Reverse complement motif Consensus sequence: ATTCAASATGAGATTTGGG |
Dataset #: | 1 |
Motif ID: | 119 |
Motif name: | Motif 119 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 6 |
Number of overlap: | 15 |
Similarity score: | 0.0941068 |
Original motif Consensus sequence: AAGTCCAAGATCAAGGTGYY | Reverse complement motif Consensus sequence: KKCACCTTGATCTTGGACTT |
Dataset #: | 1 |
Motif ID: | 224 |
Motif name: | Motif 224 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 15 |
Similarity score: | 0.0959593 |
Original motif Consensus sequence: AATGAGTTAAGACTTTG | Reverse complement motif Consensus sequence: CAAAGTCTTAACTCATT |
Dataset #: | 1 |
Motif ID: | 349 |
Motif name: | Motif 349 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 15 |
Similarity score: | 0.0961526 |
Original motif Consensus sequence: AGAGCCAAATCATGARTGAA | Reverse complement motif Consensus sequence: TTCAMTCATGATTTGGCTCT |
Dataset #: | 1 |
Motif ID: | 129 |
Motif name: | Motif 129 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 2 |
Number of overlap: | 15 |
Similarity score: | 0.0975054 |
Original motif Consensus sequence: AAGAGGTTTAATTGRCTCA | Reverse complement motif Consensus sequence: TGAGKCAATTAAACCTCTT |
Dataset #: 1 | Motif ID: 364 | Motif name: Motif 364 |
Original motif Consensus sequence: GGATTTGAACY | Reverse complement motif Consensus sequence: MGTTCAAATCC |
Best Matches for Motif ID 364 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 350 |
Motif name: | Motif 350 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Backward |
Position number: | 4 |
Number of overlap: | 11 |
Similarity score: | 0.0565307 |
Original motif Consensus sequence: TCTGGAGTGGACCTCCAGCA | Reverse complement motif Consensus sequence: TGCTGGAGGTCCACTCCAGA |
Dataset #: | 1 |
Motif ID: | 214 |
Motif name: | Motif 214 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 11 |
Similarity score: | 0.0725975 |
Original motif Consensus sequence: CTCAGGAATGGAAAACC | Reverse complement motif Consensus sequence: GGTTTTCCATTCCTGAG |
Dataset #: | 1 |
Motif ID: | 322 |
Motif name: | Motif 322 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 4 |
Number of overlap: | 11 |
Similarity score: | 0.0730291 |
Original motif Consensus sequence: AGGGCCTTTGCASWTGC | Reverse complement motif Consensus sequence: GCAWSTGCAAAGGCCCT |
Dataset #: | 1 |
Motif ID: | 106 |
Motif name: | Motif 106 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 9 |
Number of overlap: | 11 |
Similarity score: | 0.0730743 |
Original motif Consensus sequence: ATTGGTGTATTTACAATCCC | Reverse complement motif Consensus sequence: GGGATTGTAAATACACCAAT |
Dataset #: | 1 |
Motif ID: | 23 |
Motif name: | Motif 23 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 10 |
Number of overlap: | 11 |
Similarity score: | 0.0767707 |
Original motif Consensus sequence: GGTTCATCTCACTAGGGAGT | Reverse complement motif Consensus sequence: ACTCCCTAGTGAGATGAACC |
Dataset #: 1 | Motif ID: 365 | Motif name: Motif 365 |
Original motif Consensus sequence: AGCTCCGGTCTAC | Reverse complement motif Consensus sequence: GTAGACCGGAGCT |
Best Matches for Motif ID 365 (Highest to Lowest)
Dataset #: | 1 |
Motif ID: | 62 |
Motif name: | Motif 62 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 7 |
Number of overlap: | 13 |
Similarity score: | 0.00780309 |
Original motif Consensus sequence: AGGAACAGCTCCRGTCTAC | Reverse complement motif Consensus sequence: GTAGACKGGAGCTGTTCCT |
Dataset #: | 1 |
Motif ID: | 291 |
Motif name: | Motif 291 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Original Motif |
Direction: | Backward |
Position number: | 3 |
Number of overlap: | 13 |
Similarity score: | 0.0802174 |
Original motif Consensus sequence: CTGAGGACCTGAGGTCRTA | Reverse complement motif Consensus sequence: TAMGACCTCAGGTCCTCAG |
Dataset #: | 1 |
Motif ID: | 273 |
Motif name: | Motif 273 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Original Motif |
Direction: | Forward |
Position number: | 1 |
Number of overlap: | 13 |
Similarity score: | 0.0814755 |
Original motif Consensus sequence: AGCCTAGGCCTAC | Reverse complement motif Consensus sequence: GTAGGCCTAGGCT |
Dataset #: | 1 |
Motif ID: | 225 |
Motif name: | Motif 225 |
Matching format of first motif: | Original Motif |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 7 |
Number of overlap: | 13 |
Similarity score: | 0.0853406 |
Original motif Consensus sequence: GCACATGTAYCCYAGAACTT | Reverse complement motif Consensus sequence: AAGTTCTKGGKTACATGTGC |
Dataset #: | 1 |
Motif ID: | 177 |
Motif name: | Motif 177 |
Matching format of first motif: | Reverse Complement |
Matching format of second motif: | Reverse Complement |
Direction: | Forward |
Position number: | 3 |
Number of overlap: | 13 |
Similarity score: | 0.0899013 |
Original motif Consensus sequence: CCCGAAGCTGCRYRCTCGGT | Reverse complement motif Consensus sequence: ACCGAGMKMGCAGCTTCGGG |
Results created by MOTIFSIM on 03-28-2023 08:14:22
Runtime: 573.345 seconds
MOTIFSIM is written by Ngoc Tam L. Tran
Motif logo generated by weblogo