Description

MOTIFSIM is a tool for detecting similarity in a single or multiple DNA motif datasets. It accepts nine different input formats from several motif finders and generates the results in multiple HTML, PDF, and Text files. The tool combines all input datasets into one list and performs pair-wise comparisons on the entire list. MOTIFSIM converts all input motifs into position specific probability matrices for comparisons. The tool reports the global significant motifs, the global and local significant motifs, as well as best matches for each motif in the combined list or in a single dataset.

Version 2.2 allows combining similar motifs in the results. It also allows comparing the global significant motifs as well as every motif in the combined list with motifs in a database. In addition, the relationship between motifs can be visualized via motif tree.

Motif Input Format

MOTIFSIM accepts the following motif input formats in text file (.txt).

Input Format Example Restriction
TRANSFAC NA Test1
XX
DE Test1
XX
P0 A C G T
01 4 36 5 5 C
02 39 0 9 2 A
03 10 30 0 10 C
04 2 1 38 9 G
05 4 3 5 38 T
06 9 0 31 10 G
07 4 6 21 10 G
08 1 9 10 30 T
XX

NA Test2
XX
DE Test2
XX
P0 A C G T
01 0 40 10 0 C
02 38 0 10 2 A
03 0 30 10 10 C
04 2 11 28 9 G
05 9 3 10 28 T
XX

One empty line must be present to separate two motifs.
Space or tab can be used to separate matrix's elements.
TRANSFAC-like DE Test1
01 4 31 5 5 C
02 29 0 9 2 A
03 0 30 0 10 C
04 2 1 28 9 G
05 4 3 5 28 T
06 9 0 31 0 G
XX

DE Test2
01 0 40 10 0 C
02 38 0 10 2 A
03 0 30 10 10 C
04 2 11 28 9 G
05 9 3 10 28 T
06 50 0 0 0 A
07 0 50 0 0 C
08 0 0 50 0 G
09 0 0 0 50 T
XX

Columns 2, 3, 4, and 5 in the matrix represent A, C, G, and T values respectively.
One empty line must be present to separate two motifs.
Space or tab can be used to separate matrix's elements.
TRANSFAC-like DE sscCCCGCGcs
1 5 15 9 5
2 4 18 10 2
3 0 23 8 3
4 1 29 4 0
5 0 28 6 0
6 0 27 7 0
7 0 0 34 0
8 0 34 0 0
9 0 2 32 0
10 4 16 8 6
11 0 11 18 5
XX

DE atactttggc
1 1 0 0 0
2 0 0 0 1
3 1 0 0 0
4 0 1 0 0
5 0 0 0 1
6 0 0 0 1
7 0 0 0 1
8 0 0 1 0
9 0 0 1 0
10 0 1 0 0
XX

Columns 2, 3, 4, and 5 in the matrix represent A, C, G, and T values respectively.
One empty line must be present to separate two motifs.
Space or tab can be used to separate matrix's elements.
PSSM >TFW3
73 81 407 61
44 578 0 0
485 65 0 72
0 570 52 0
79 0 0 543
0 0 622 0

>TFW1
0 0 1 39
0 0 0 40
4 1 33 2
6 25 2 7
7 2 25 6
2 33 1 4
40 0 0 0
39 1 0 0

Columns 1, 2, 3, and 4 in the matrix represent A, C, G, and T values respectively.
One empty line must be present to separate two motifs.
Space or tab can be used to separate matrix's elements.
Jaspar >NR4A2
A [ 8 13 0 3 2 0 14 3 ]
C [ 1 0 0 0 2 13 0 8 ]
G [ 3 1 13 11 0 0 0 2 ]
T [ 2 0 1 0 10 1 0 1 ]

>RORA_1
A [15 9 6 11 21 0 0 0 0 25 ]
C [ 1 1 12 2 0 0 0 0 25 0 ]
G [ 2 0 4 5 4 25 25 0 0 0 ]
T [ 7 15 3 7 0 0 0 25 0 0 ]

One empty line must be present to separate two motifs.
Space or tab can be used to separate matrix's elements.
MEME's output --------------------------------------------------------------------------------
Motif 1 position-specific probability matrix
--------------------------------------------------------------------------------
letter-probability matrix: alength= 4 w= 11 nsites= 142 E= 6.0e-015
0.000000 0.598592 0.176056 0.225352
0.000000 0.626761 0.000000 0.373239
0.000000 0.000000 0.000000 1.000000
0.000000 0.408451 0.514085 0.077465
0.091549 0.823944 0.028169 0.056338
0.133803 0.690141 0.000000 0.176056
0.042254 0.281690 0.000000 0.676056
0.007042 0.683099 0.197183 0.112676
0.197183 0.000000 0.000000 0.802817
0.000000 0.084507 0.690141 0.225352
0.091549 0.605634 0.169014 0.133803

--------------------------------------------------------------------------------
Motif 2 position-specific probability matrix
--------------------------------------------------------------------------------
letter-probability matrix: alength= 4 w= 14 nsites= 24 E= 6.3e-010
0.833333 0.000000 0.166667 0.000000
0.000000 1.000000 0.000000 0.000000
0.875000 0.000000 0.000000 0.125000
0.083333 0.875000 0.041667 0.000000
0.958333 0.000000 0.000000 0.041667
0.125000 0.875000 0.000000 0.000000
0.833333 0.166667 0.000000 0.000000
0.000000 0.750000 0.000000 0.250000
0.666667 0.000000 0.208333 0.125000
0.000000 0.833333 0.041667 0.125000
0.791667 0.125000 0.083333 0.000000
0.000000 1.000000 0.000000 0.000000
0.708333 0.000000 0.083333 0.208333
0.000000 0.958333 0.000000 0.041667

One empty line must be present to separate two motifs.
Space or tab can be used to separate matrix's elements.
Consensus sequence >C001
CYCYYSHGGCCASMAGAGGGCRCYAGATCCCCT

>C002
WWWWWWWWWWWWAAAAAAAAAWWAAWWWWW

>C003
VTGYRYRYACACACACAYRCAYRYR

>C004
SNSVCCCSBCCCCCSCCCCCSSY

>C005
SCSCSSSSSCSSCSCCSSSSCCSSSSSSC

>C006
TWWWAAAAAAWWAAAAWWAAAAAAAAAA

>C007
MYVGAGGCCAGAAGAGGGCAYCAGATYCCHT

Motif is in IUPAC format.
One empty line must be present to separate two motifs.
Sequence Alignment >Test1
GATACGTGGCAAAACCCTGGG
GCCACGT-CCGGGAACCTGGG
CGCATGTGCACCAATTACACC
ACGACGTGTTCCCAAATTTTT
CACACGTGCCCCCCAAGTTTG
GGGGGTTACACCCTTTTAAAA
CCAAGTTTAAGGGGTTTTGGA
AAACCGGTTAAAACCTTGCGC

>Test2
CCCAATAGCTTTT-TTTTTTAAACCCCC-CC
GGGTGTGCGCGACCACCAAAATTTTAAAAAA
AAACCCTTTGGGCCCGGGTTAAACCCCGGGG
TTTTTTCCCAAACCCAAAGGGTTTTTCGCCC
CACAAAAACCGGTTTTTTGCCGCGCCCCAAA
CCAAAAAACCCTT-TTTTCCCAAAAGGGGGG
CACAAACACCCCCCCCCAAAATTT-TGGGCG

One empty line must be present to separate two motifs.
Matrix (Horizontal) 7 10 6 13 4 21 0 22
1 4 3 4 10 0 2 1
4 2 6 4 2 2 0 0
11 7 8 2 7 0 21 0

27 0 1 27 27 20
0 0 9 0 0 0
0 0 0 0 0 1
0 27 17 0 0 6

Rows 1, 2, 3, and 4 represent A, C, G, and T values respectively.
One empty line must be present to separate two motifs.
Space or tab can be used to separate matrix's elements.
Matrix (Vertical) 0.450000 0.250000 0.000000 0.300000
0.800000 0.000000 0.000000 0.200000
0.850000 0.000000 0.150000 0.000000
1.000000 0.000000 0.000000 0.000000
0.750000 0.000000 0.250000 0.000000
0.400000 0.300000 0.050000 0.250000
0.850000 0.100000 0.000000 0.050000
0.850000 0.150000 0.000000 0.000000
1.000000 0.000000 0.000000 0.000000
0.500000 0.100000 0.400000 0.000000

0.000000 0.812500 0.125000 0.062500
0.375000 0.000000 0.000000 0.625000
0.062500 0.000000 0.937500 0.000000
0.562500 0.125000 0.187500 0.125000
0.000000 0.000000 1.000000 0.000000
0.062500 0.937500 0.000000 0.000000

Columns 1, 2, 3, and 4 represent A, C, G, and T values respectively.
One empty line must be present to separate two motifs.
Space or tab can be used to separate matrix's elements.

Running MOTIFSIM

Upload/Use existing files/Insert files on browser

Users can upload files, use existing files, or insert files on the browser using specified formats above to run the tool. Registered users can store uploaded files and results for an extended period. Public files including uploaded datasets and results are cleared periodically.

Number of files to read

This version supports a maximum of twenty files.

Input file format

Specifying input file format is not required. However, input format must be one of the formats listed in the table above. Input file can also contain a mixture of nine acceptable formats above.

Number of top significant motifs

This value is currently limited to ≤ 50. This is a cutoff for the number of top global significant motifs as well as the number of top global and local significant motifs generated in the results.

Number of best matches

This value is extended from 20 in the previous version to ≤ 50 in this version. The number of best matches is the number of motifs that are most similar to motif i (i from 1 to m) in a combined motif list M. This value is used for selecting the number of most similar motifs to motif i and report them in the results. These best matched motifs are listed in order of similarity with the most similar one on the top of the list.

Cutoff for similarity

Currently, the cutoff values are ≥ 50 %, ≥ 60 %, ≥ 70 %, ≥ 75 %, ≥ 80 %, ≥ 85 %, and ≥ 90 %. A value ≥ 75 % indicates a match of 75 % or greater between two motifs. We suggest to use a cutoff ≥ 75 % as this value showed a good threshold in our case studies. If a higher cutoff value is used, fewer similar motifs are generated in the results. However, these motifs are much more similar to the motif being compared.

Database Match

Users can select a motif database for matching with the global significant motifs, the global and local significant motifs, as well as every motif in the combined list. Currently, the tool supports Jaspar 2016 [1], Transfac [2] (free version), and UniPROBE [3] databases.

Motif Tree

The motif tree can be generated for the global significant motifs and for the entire combined motif list as well. The tree is built using hclust function in R [4]. This function implements the hierarchical clustering algorithm. The tool generates the distance matrix for building the tree. This matrix contains best similarity scores between motifs.

Combine Similar Motifs

Similar motifs discovered in the results can be combined into new motifs. Two similar motifs can be combined into a new motif if the new motif satisfies the similarity threshold with both of its parents.

Output file type

Users can choose between (1) Global Significant Motifs Only and (2) All. The first option generates only the global significant motifs in the results. The second option generates everything and it requires longer time for processing large datasets.

Output file format

The tool provides four options for output file format: Text, HTML, PDF, and All which returns all formats. HTML, PDF, and All require longer time for processing large datasets.

Use sample data

Users can run tests on sample data. This button selects 5 existing sample datasets and it fills in the required input parameters on the next page. Users then only need to click on the Submit button to run the test. The result page is shown after the submitted job is completed.

Output Visibility

Unregistered users can keep the results private and retrieve them later via the search Job ID page.

Results

The results can be viewed or downloaded in HTML, PDF, Text, and all three formats by using the links in the Results section or from View/Download Results page. The tool generates multiple results described in the table below.

Output file name (without Job ID prefix) Description
1. input_motifs.txt This file contains motifs from all datasets. The motifs are in position specific probability matrices. They are in the order of the datasets are entered by the user.
2. HTML_Results.html The results in HTML format. Motif's logos are included.
3. HTML_Results.pdf The results in PDF format. Motif's logos are included.
4. Results.txt The results in Text format. Motifs are in position specific probability matrices.
5. Results_Without_Motif_Details.txt The results in Text format. Motif's detail is not included.
6. HTML_Results_Database_Matching.html The results match with motif database in HTML format. Motif's logos are included.
7. HTML_Results_Database_Matching.pdf The results match with motif database in PDF format. Motif's logos are included.
8. Results_Database_Matching.txt The results match with motif database in Text format. Motifs are in position specific probability matrices.
9. Results_Database_Matching_Without_Motif_Details.txt The results match with motif database in Text format. Motif's detail is not included.
10. HTML_Global_Matching_Results.html This file contains only the global significant motifs in HTML format.
11. HTML_Global_Matching_Results.pdf Same as in (10) but the file is in PDF format.
12. Results_Global_Matching.txt Same as in (10) but the file is in Text format.
13. HTML_Results_Database_Matching_Global_Matching.html This file contains only the global significant motifs that match with motif database. The results are in HTML format. Motif's logos are included.
14. HTML_Results_Database_Matching_Global_Matching.pdf Same as in (13) but the file is in PDF format.
15. Results_Database_Matching_Global_Matching.txt This file contains only the global significant motifs that match with motif database. The results are in Text format. Motifs are in position specific probability matrices.
16. Results_Combined_Motifs_Global_Matching.txt This file contains combined motifs for the global significant motifs and their best matches. The motifs are combined in a pair-wise fashion. The motifs are in IUPAC format. Pair-wise matching information is included.
17. Results_Combined_Motifs_Global_and_Local_Matching.txt This file contains combined motifs for the global and local significant motifs and their best matches. The motifs are combined in a pair-wise fashion. The motifs are in IUPAC format. Pair-wise matching information is included.
18. Results_Combined_Motifs_Best_Matches.txt This file contains combined motifs for every motif and its best matches. The motifs are combined in a pair-wise fashion. The motifs are in IUPAC format. Pair-wise matching information is included.
19. Motif_Tree.html The motif tree shows the relationship between motifs in the entire combined list. The file is in HTML format.
20. Global_Matching_Motif_Tree.html The motif tree shows the relationship between motifs for the global significant motifs and their best matches. The file is in HTML format.
21. Motif_Tree.png Same as in (19) but the file is in PNG image format.
22. Global_Matching_Motif_Tree.png Same as in (20) but the file is in PNG image format.

Each result file has two sections: Input and Results. The Input section lists input parameters entered by the user.
The result files (numbers 2-5 in the table) have three subsections for: (1) global significant motifs, (2) global and local significant motifs, and (3) best matches for each motif.
The results match with motif database (numbers 6-9 in the table) show best matches in a motif database for each motif in the combined list.
The global matching result files (numbers 10-12 in the table) contain only the global significant motifs and their best matches.
The result files (numbers 13-15 in the table) contain only the global significant motifs and their best matches found in a motif database.
Other output information can be found in the table below.

Output Information Description
Dataset # Dataset is numbered from 1, 2, 3, ..., n in the order they are entered.
Motif ID Each motif in the combined list is assigned with a unique ID, which is an integer from 1, 2, 3, ... n, in the order of the dataset is entered.
Motif Name Motif name in the input file if available.
Matching Format of First Motif Matching format of the first motif in the comparison. The format can be the original motif or its reverse complement.
Matching Format of Second Motif Matching format of the second motif in the comparison. The format can be the original motif or its reverse complement.
Direction Matching can be in forward or backward direction.
Position # Matching position number. Starting at position 1 on the top if it is in forward direction or at the bottom if it is in backward direction.
# of Overlap The number of overlapping columns when matching two motifs.
Similarity Score This score is described in our algorithm.
Alignment Alignment of two motifs in IUPAC format.

Download Test Datasets

Test datasets came from original publication: N.T.L. Tran and C.-H. Huang, A survey of motif finding Web tools for detecting binding site motifs in ChIP-Seq data. Biology Direct, 9(4):1-22, 2014.

Motif Dataset Motif Input Format Number of Motifs
DREME_DM230 MEME's output 1
MEME_DM230 MEME's output 20
PScanChIP_DM230 Jaspar 14
RSAT_peak-motifs_DM230 TRANSFAC-like 10
W-ChIPMotifs_DM230 PSSM 11
MEME_DM05 MEME's output 46
MEME-ChIP_DM05 MEME's output 4
PScanChIP_DM05 Jaspar 16
RSAT_peak-motifs_DM05 TRANSFAC-like 17
W-ChIPMotifs_DM05 PSSM 11
DREME_DM721 MEME's output 16
MEME-ChIP_DM721 MEME's output 11
PScanChIP_DM721 Jaspar 37
RSAT_peak-motifs_DM721 TRANSFAC-like 40
CisFinder_DM721_Cluster PSSM 153
DREME_DM01 MEME's output 51
MEME-CHIP_DM01 MEME's output 9
PScanChIP_DM01 Jaspar 27
RSAT_peak-motifs_DM01 TRANSFAC-like 40
DREME_DM254 MEME's output 45
MEME-CHIP_DM254 MEME's output 24
PScanChIP_DM254 Jaspar 39
RSAT_peak-motifs_DM254 TRANSFAC-like 63

Download Sample Test Results

Datasets for Comparison Results (Version 2.2) Results (Version 2.1) Results (Version 2.0) Results (Version 1.0)
W-ChIPMotifs_DM230.txt
RSAT_peak-motifs_DM230.txt
Input Motifs in Text
Results in HTML
Results in PDF
Results in Text
Results Without Motif's Details in Text
Results for Database Matching in HTML
Results for Database Matching in PDF
Results for Database Matching in Text
Results for Database Matching Without Motif Details in Text
Global Matching Results in HTML
Global Matching Results in PDF
Global Matching Results in Text
Global Matching Results Match with Database in HTML
Global Matching Results Match with Database in PDF
Global Matching Results Match with Database in Text
Combined Motifs for Global Matching in Text
Combined Motifs for Global and Local Matching in Text
Combined Motifs for Best Matches in Text
Motif Tree in HTML
Motif Tree in PDF
Motif Tree for Global Matching in HTML
Motif Tree for Global Matching in PDF
Motif Tree in PNG Image
Motif Tree for Global Matching in PNG Image

Input Motifs in Text
Results in HTML
Results in PDF
Results in Text
Results Without Motif's Details in Text
Results for Database Matching in HTML
Results for Database Matching in PDF
Results for Database Matching in Text
Results for Database Matching Without Motif Details in Text
Global Matching Results in HTML
Global Matching Results in PDF
Global Matching Results in Text
Global Matching Results Match with Database in HTML
Global Matching Results Match with Database in PDF
Global Matching Results Match with Database in Text
Combined Motifs for Global Matching in Text
Combined Motifs for Global and Local Matching in Text
Combined Motifs for Best Matches in Text
Phylogenetic Tree in HTML
Phylogenetic Tree in PDF
Phylogenetic Tree for Global Matching in HTML
Phylogenetic Tree for Global Matching in PDF
Phylogenetic Tree in PNG Image
Phylogenetic Tree for Global Matching in PNG Image

Input Motifs in Text
Results in HTML
Results in PDF
Results in Text
Results Without Motif's Details in Text
Global Matching Results in HTML
Global Matching Results in PDF
Global Matching Results in Text
Results
Results Without Motif's Details
PScanChIP_DM05.txt
RSAT_peak-motifs_DM05.txt
Input Motifs in Text
Results in HTML
Results in PDF
Results in Text
Results Without Motif's Details in Text
Results for Database Matching in HTML
Results for Database Matching in PDF
Results for Database Matching in Text
Results for Database Matching Without Motif Details in Text
Global Matching Results in HTML
Global Matching Results in PDF
Global Matching Results in Text
Global Matching Results Match with Database in HTML
Global Matching Results Match with Database in PDF
Global Matching Results Match with Database in Text
Combined Motifs for Global Matching in Text
Combined Motifs for Global and Local Matching in Text
Combined Motifs for Best Matches in Text
Motif Tree in HTML
Motif Tree in PDF
Motif Tree for Global Matching in HTML
Motif Tree for Global Matching in PDF
Motif Tree in PNG Image
Motif Tree for Global Matching in PNG Image

Input Motifs in Text
Results in HTML
Results in PDF
Results in Text
Results Without Motif's Details in Text
Results for Database Matching in HTML
Results for Database Matching in PDF
Results for Database Matching in Text
Results for Database Matching Without Motif Details in Text
Global Matching Results in HTML
Global Matching Results in PDF
Global Matching Results in Text
Global Matching Results Match with Database in HTML
Global Matching Results Match with Database in PDF
Global Matching Results Match with Database in Text
Combined Motifs for Global Matching in Text
Combined Motifs for Global and Local Matching in Text
Combined Motifs for Best Matches in Text
Phylogenetic Tree in HTML
Phylogenetic Tree in PDF
Phylogenetic Tree for Global Matching in HTML
Phylogenetic Tree for Global Matching in PDF
Phylogenetic Tree in PNG Image
Phylogenetic Tree for Global Matching in PNG Image

Input Motifs in Text
Results in HTML
Results in PDF
Results in Text
Results Without Motif's Details in Text
Global Matching Results in HTML
Global Matching Results in PDF
Global Matching Results in Text
Results
Results Without Motif's Details
MEME-ChIP_DM721.txt
PScanChIP_DM721.txt
Input Motifs in Text
Results in HTML
Results in PDF
Results in Text
Results Without Motif's Details in Text
Results for Database Matching in HTML
Results for Database Matching in PDF
Results for Database Matching in Text
Results for Database Matching Without Motif Details in Text
Global Matching Results in HTML
Global Matching Results in PDF
Global Matching Results in Text
Global Matching Results Match with Database in HTML
Global Matching Results Match with Database in PDF
Global Matching Results Match with Database in Text
Combined Motifs for Global Matching in Text
Combined Motifs for Global and Local Matching in Text
Combined Motifs for Best Matches in Text
Motif Tree in HTML
Motif Tree in PDF
Motif Tree for Global Matching in HTML
Motif Tree for Global Matching in PDF
Motif Tree in PNG Image
Motif Tree for Global Matching in PNG Image

Input Motifs in Text
Results in HTML
Results in PDF
Results in Text
Results Without Motif's Details in Text
Results for Database Matching in HTML
Results for Database Matching in PDF
Results for Database Matching in Text
Results for Database Matching Without Motif Details in Text
Global Matching Results in HTML
Global Matching Results in PDF
Global Matching Results in Text
Global Matching Results Match with Database in HTML
Global Matching Results Match with Database in PDF
Global Matching Results Match with Database in Text
Combined Motifs for Global Matching in Text
Combined Motifs for Global and Local Matching in Text
Combined Motifs for Best Matches in Text
Phylogenetic Tree in HTML
Phylogenetic Tree in PDF
Phylogenetic Tree for Global Matching in HTML
Phylogenetic Tree for Global Matching in PDF
Phylogenetic Tree in PNG Image
Phylogenetic Tree for Global Matching in PNG Image

Input Motifs in Text
Results in HTML
Results in PDF
Results in Text
Results Without Motif's Details in Text
Global Matching Results in HTML
Global Matching Results in PDF
Global Matching Results in Text
Results
Results Without Motif's Details
DREME_DM230.txt
MEME_DM230.txt
PScanChIP_DM230.txt
RSAT_peak-motifs_DM230.txt
W-ChIPMotifs_DM230.txt
Input Motifs in Text
Results in HTML
Results in PDF
Results in Text
Results Without Motif's Details in Text
Results for Database Matching in HTML
Results for Database Matching in PDF
Results for Database Matching in Text
Results for Database Matching Without Motif Details in Text
Global Matching Results in HTML
Global Matching Results in PDF
Global Matching Results in Text
Global Matching Results Match with Database in HTML
Global Matching Results Match with Database in PDF
Global Matching Results Match with Database in Text
Combined Motifs for Global Matching in Text
Combined Motifs for Global and Local Matching in Text
Combined Motifs for Best Matches in Text
Motif Tree in HTML
Motif Tree in PDF
Motif Tree for Global Matching in HTML
Motif Tree for Global Matching in PDF
Motif Tree in PNG Image
Motif Tree for Global Matching in PNG Image

Input Motifs in Text
Results in HTML
Results in PDF
Results in Text
Results Without Motif's Details in Text
Results for Database Matching in HTML
Results for Database Matching in PDF
Results for Database Matching in Text
Results for Database Matching Without Motif Details in Text
Global Matching Results in HTML
Global Matching Results in PDF
Global Matching Results in Text
Global Matching Results Match with Database in HTML
Global Matching Results Match with Database in PDF
Global Matching Results Match with Database in Text
Combined Motifs for Global Matching in Text
Combined Motifs for Global and Local Matching in Text
Combined Motifs for Best Matches in Text
Phylogenetic Tree in HTML
Phylogenetic Tree in PDF
Phylogenetic Tree for Global Matching in HTML
Phylogenetic Tree for Global Matching in PDF
Phylogenetic Tree in PNG Image
Phylogenetic Tree for Global Matching in PNG Image

Input Motifs in Text
Results in HTML
Results in PDF
Results in Text
Results Without Motif's Details in Text
Global Matching Results in HTML
Global Matching Results in PDF
Global Matching Results in Text
Results
Results Without Motif's Details
MEME_DM05.txt
MEME-ChIP_DM05.txt
PScanChIP_DM05.txt
RSAT_peak-motifs_DM05.txt
W-ChIPMotifs_DM05.txt
Input Motifs in Text
Results in HTML
Results in PDF
Results in Text
Results Without Motif's Details in Text
Results for Database Matching in HTML
Results for Database Matching in PDF
Results for Database Matching in Text
Results for Database Matching Without Motif Details in Text
Global Matching Results in HTML
Global Matching Results in PDF
Global Matching Results in Text
Global Matching Results Match with Database in HTML
Global Matching Results Match with Database in PDF
Global Matching Results Match with Database in Text
Combined Motifs for Global Matching in Text
Combined Motifs for Global and Local Matching in Text
Combined Motifs for Best Matches in Text
Motif Tree in HTML
Motif Tree in PDF
Motif Tree for Global Matching in HTML
Motif Tree for Global Matching in PDF
Motif Tree in PNG Image
Motif Tree for Global Matching in PNG Image

Input Motifs in Text
Results in HTML
Results in PDF
Results in Text
Results Without Motif's Details in Text
Results for Database Matching in HTML
Results for Database Matching in PDF
Results for Database Matching in Text
Results for Database Matching Without Motif Details in Text
Global Matching Results in HTML
Global Matching Results in PDF
Global Matching Results in Text
Global Matching Results Match with Database in HTML
Global Matching Results Match with Database in PDF
Global Matching Results Match with Database in Text
Combined Motifs for Global Matching in Text
Combined Motifs for Global and Local Matching in Text
Combined Motifs for Best Matches in Text
Phylogenetic Tree in HTML
Phylogenetic Tree in PDF
Phylogenetic Tree for Global Matching in HTML
Phylogenetic Tree for Global Matching in PDF
Phylogenetic Tree in PNG Image
Phylogenetic Tree for Global Matching in PNG Image

Input Motifs in Text
Results in HTML
Results in PDF
Results in Text
Results Without Motif's Details in Text
Global Matching Results in HTML
Global Matching Results in PDF
Global Matching Results in Text
Results
Results Without Motif's Details
DREME_DM721.txt
MEME_DM721.txt
PScanChIP_DM721.txt
RSAT_peak-motifs_DM721.txt
Input Motifs in Text
Results in HTML
Results in PDF
Results in Text
Results Without Motif's Details in Text
Results for Database Matching in HTML
Results for Database Matching in PDF
Results for Database Matching in Text
Results for Database Matching Without Motif Details in Text
Global Matching Results in HTML
Global Matching Results in PDF
Global Matching Results in Text
Global Matching Results Match with Database in HTML
Global Matching Results Match with Database in PDF
Global Matching Results Match with Database in Text
Combined Motifs for Global Matching in Text
Combined Motifs for Global and Local Matching in Text
Combined Motifs for Best Matches in Text
Motif Tree in HTML
Motif Tree in PDF
Motif Tree for Global Matching in HTML
Motif Tree for Global Matching in PDF
Motif Tree in PNG Image
Motif Tree for Global Matching in PNG Image

Input Motifs in Text
Results in HTML
Results in PDF
Results in Text
Results Without Motif's Details in Text
Results for Database Matching in HTML
Results for Database Matching in PDF
Results for Database Matching in Text
Results for Database Matching Without Motif Details in Text
Global Matching Results in HTML
Global Matching Results in PDF
Global Matching Results in Text
Global Matching Results Match with Database in HTML
Global Matching Results Match with Database in PDF
Global Matching Results Match with Database in Text
Combined Motifs for Global Matching in Text
Combined Motifs for Global and Local Matching in Text
Combined Motifs for Best Matches in Text
Phylogenetic Tree in HTML
Phylogenetic Tree in PDF
Phylogenetic Tree for Global Matching in HTML
Phylogenetic Tree for Global Matching in PDF
Phylogenetic Tree in PNG Image
Phylogenetic Tree for Global Matching in PNG Image

Input Motifs in Text
Results in HTML
Results in PDF
Results in Text
Results Without Motif's Details in Text
Global Matching Results in HTML
Global Matching Results in PDF
Global Matching Results in Text
Results
Results Without Motif's Details
CisFinder_DM721_Cluster.txt Input Motifs in Text
Results in HTML
Results in PDF
Results in Text
Results Without Motif's Details in Text
Results for Database Matching in HTML
Results for Database Matching in PDF
Results for Database Matching in Text
Results for Database Matching Without Motif Details in Text
Global Matching Results in HTML
Global Matching Results in PDF
Global Matching Results in Text
Global Matching Results Match with Database in HTML
Global Matching Results Match with Database in PDF
Global Matching Results Match with Database in Text
Combined Motifs for Global Matching in Text
Combined Motifs for Global and Local Matching in Text
Combined Motifs for Best Matches in Text
Motif Tree in HTML
Motif Tree in PDF
Motif Tree in PNG Image
Input Motifs in Text
Results in HTML
Results in PDF
Results in Text
Results Without Motif's Details in Text
Results for Database Matching in HTML
Results for Database Matching in PDF
Results for Database Matching in Text
Results for Database Matching Without Motif Details in Text
Global Matching Results in HTML
Global Matching Results in PDF
Global Matching Results in Text
Global Matching Results Match with Database in HTML
Global Matching Results Match with Database in PDF
Global Matching Results Match with Database in Text
Combined Motifs for Global Matching in Text
Combined Motifs for Global and Local Matching in Text
Combined Motifs for Best Matches in Text
Phylogenetic Tree in HTML
Phylogenetic Tree in PDF
Phylogenetic Tree in PNG Image
Input Motifs in Text
Results in HTML
Results in PDF
Results in Text
Results Without Motif's Details in Text
Global Matching Results in HTML
Global Matching Results in PDF
Global Matching Results in Text
DREME_DM01.txt
MEME-CHIP_DM01.txt
PScanChIP_DM01.txt
RSAT_peak-motifs_DM01.txt
Input Motifs in Text
Results in HTML
Results in PDF
Results in Text
Results Without Motif's Details in Text
Results for Database Matching in HTML
Results for Database Matching in PDF
Results for Database Matching in Text
Results for Database Matching Without Motif Details in Text
Global Matching Results in HTML
Global Matching Results in PDF
Global Matching Results in Text
Global Matching Results Match with Database in HTML
Global Matching Results Match with Database in PDF
Global Matching Results Match with Database in Text
Combined Motifs for Global Matching in Text
Combined Motifs for Global and Local Matching in Text
Combined Motifs for Best Matches in Text
Motif Tree in HTML
Motif Tree in PDF
Motif Tree for Global Matching in HTML
Motif Tree for Global Matching in PDF
Motif Tree in PNG Image
Motif Tree for Global Matching in PNG Image

Input Motifs in Text
Results in HTML
Results in PDF
Results in Text
Results Without Motif's Details in Text
Results for Database Matching in HTML
Results for Database Matching in PDF
Results for Database Matching in Text
Results for Database Matching Without Motif Details in Text
Global Matching Results in HTML
Global Matching Results in PDF
Global Matching Results in Text
Global Matching Results Match with Database in HTML
Global Matching Results Match with Database in PDF
Global Matching Results Match with Database in Text
Combined Motifs for Global Matching in Text
Combined Motifs for Global and Local Matching in Text
Combined Motifs for Best Matches in Text
Phylogenetic Tree in HTML
Phylogenetic Tree in PDF
Phylogenetic Tree for Global Matching in HTML
Phylogenetic Tree for Global Matching in PDF
Phylogenetic Tree in PNG Image
Phylogenetic Tree for Global Matching in PNG Image

Input Motifs in Text
Results in HTML
Results in PDF
Results in Text
Results Without Motif's Details in Text
Global Matching Results in HTML
Global Matching Results in PDF
Global Matching Results in Text
DREME_DM254.txt
MEME-CHIP_DM254.txt
PScanChIP_DM254.txt
RSAT_peak-motifs_DM254.txt
Input Motifs in Text
Results in HTML
Results in PDF
Results in Text
Results Without Motif's Details in Text
Results for Database Matching in HTML
Results for Database Matching in PDF
Results for Database Matching in Text
Results for Database Matching Without Motif Details in Text
Global Matching Results in HTML
Global Matching Results in PDF
Global Matching Results in Text
Global Matching Results Match with Database in HTML
Global Matching Results Match with Database in PDF
Global Matching Results Match with Database in Text
Combined Motifs for Global Matching in Text
Combined Motifs for Global and Local Matching in Text
Combined Motifs for Best Matches in Text
Motif Tree in HTML
Motif Tree in PDF
Motif Tree for Global Matching in HTML
Motif Tree for Global Matching in PDF
Motif Tree in PNG Image
Motif Tree for Global Matching in PNG Image

Input Motifs in Text
Results in HTML
Results in PDF
Results in Text
Results Without Motif's Details in Text
Results for Database Matching in HTML
Results for Database Matching in PDF
Results for Database Matching in Text
Results for Database Matching Without Motif Details in Text
Global Matching Results in HTML
Global Matching Results in PDF
Global Matching Results in Text
Global Matching Results Match with Database in HTML
Global Matching Results Match with Database in PDF
Global Matching Results Match with Database in Text
Combined Motifs for Global Matching in Text
Combined Motifs for Global and Local Matching in Text
Combined Motifs for Best Matches in Text
Phylogenetic Tree in HTML
Phylogenetic Tree in PDF
Phylogenetic Tree for Global Matching in HTML
Phylogenetic Tree for Global Matching in PDF
Phylogenetic Tree in PNG Image
Phylogenetic Tree for Global Matching in PNG Image

Input Motifs in Text
Results in HTML
Results in PDF
Results in Text
Results Without Motif's Details in Text
Global Matching Results in HTML
Global Matching Results in PDF
Global Matching Results in Text

References

1. Sandelin A, Alkema W, Engstrom P, Wasserman WW, Lenhard B: JASPAR: an open-access database for eukaryotic transcription factor binding profiles. Nucleic Acids Research 2004, 32:D91-D94.
2. Matys V, Fricke E, Geffers R, Gossling E, Haubrock M, Hehl R, Hornischer K, Karas D, Kel AE, Kel-Margoulis OV, Kloos DU, Land S, Lewicki-Potapov B, Michael H, Munch R, Reuter I, Rotert S, Saxel H, Scheer M, Thiele S, Wingender E: TRANSFAC®: transcriptional regulation, from patterns to profiles. Nucleic Acids Research 2003, 31(1):374-8.
3. Newburger N and Bulyk M. UniPROBE: an online database of protein binding microarray data on protein–DNA interactions. Nucleic Acids Research 2009, 37:D77-D82.
4. R Core Team (2016). R: A language and environment for statistical computing. R Foundation for Statistical Computing , Vienna, Austria. URL https://www.R-project.org/.